#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
KIAA2013	90231	broad.mit.edu	37	1	11983200	11983200	+	Silent	SNP	C	C	T			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr1:11983200C>T	ENST00000376572.3	-	2	1565	c.1380G>A	c.(1378-1380)ggG>ggA	p.G460G	KIAA2013_ENST00000376576.3_Silent_p.G460G	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	460						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G460G(1)		endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGAACTGCAGCCCCCCAAAGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											25.0	29.0	28.0					1																	11983200		2188	4286	6474	11905787	SO:0001819	synonymous_variant	90231			AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.1380G>A	1.37:g.11983200C>T		Unknown		x	x	x	11905787	Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Silent	SNP	ENST00000376572.3	37	CCDS141.1	SNP	26	Broad																																																																																				0.607	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006858.1	NM_138346		Silent
SORCS3	22986	broad.mit.edu	37	10	106602582	106602582	+	Silent	SNP	C	C	T			TCGA-24-0970-01	TCGA-24-0970-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr10:106602582C>T	ENST00000369701.3	+	2	887	c.660C>T	c.(658-660)ttC>ttT	p.F220F		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	220					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.F220F(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TGTATGACTTCAACCTGGGCA	0.483																																					NSCLC(116;1497 1690 7108 13108 14106)											1	Substitution - coding silent(1)	ovary(1)	10											103.0	94.0	97.0					10																	106602582		2203	4300	6503	106592572	SO:0001819	synonymous_variant	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.660C>T	10.37:g.106602582C>T		Somatic		x	x	x	106592572	Q5VXF9|Q9NQJ2	Silent	SNP	ENST00000369701.3	37	CCDS7558.1	SNP	29	Broad																																																																																				0.483	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		Silent
MUC5B	727897	broad.mit.edu	37	11	1265831	1265831	+	Missense_Mutation	SNP	T	T	C	rs200031789	byFrequency	TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr11:1265831T>C	ENST00000529681.1	+	31	7779	c.7721T>C	c.(7720-7722)gTc>gCc	p.V2574A	MUC5B_ENST00000447027.1_Missense_Mutation_p.V2577A|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2574	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.|V -> A (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.V2577A(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAGAGACTGTCCACACCTCC	0.652													T|||	62	0.0123802	0.0076	0.0115	5008	,	,		19571	0.001		0.0348	False		,,,				2504	0.0082															1	Substitution - Missense(1)	ovary(1)	11											115.0	137.0	130.0					11																	1265831		2072	4188	6260	1222407	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7721T>C	11.37:g.1265831T>C	ENSP00000436812:p.Val2574Ala	Unknown		x	x	x	1222407	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	SNP	58	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.871|3.871	-0.027898|-0.027898	0.07589|0.07589	.|.	.|.	ENSG00000117983|ENSG00000117983	ENST00000537836|ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	.|T;T	.|0.20881	.|2.04;2.23	2.44|2.44	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.09905|0.09905	0.0243|0.0243	N|N	0.13098|0.13098	0.295|0.295	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.31052|0.31052	-0.9957|-0.9957	6|9	0.66056|0.87932	D|D	0.02|0	.|.	2.2601|2.2601	0.04065|0.04065	0.2406:0.4351:0.0:0.3243|0.2406:0.4351:0.0:0.3243	.|.	.|3212;2577	.|A7Y9J9;E9PBJ0	.|.;.	P|A	118|2574;2577;2546;2589	.|ENSP00000436812:V2574A;ENSP00000415793:V2577A	ENSP00000440615:S118P|ENSP00000343037:V2546A	S|V	+|+	1|2	0|0	MUC5B|MUC5B	1222407|1222407	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	-2.187000|-2.187000	0.01250|0.01250	-0.039000|-0.039000	0.13602|0.13602	-1.232000|-1.232000	0.01568|0.01568	TCC|GTC		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		Missense_Mutation
KRT72	140807	broad.mit.edu	37	12	52992858	52992858	+	Silent	SNP	G	G	T			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr12:52992858G>T	ENST00000537672.2	-	2	475	c.465C>A	c.(463-465)acC>acA	p.T155T	RP11-641A6.2_ENST00000551089.1_RNA|KRT72_ENST00000354310.4_Silent_p.T155T|KRT72_ENST00000398066.3_5'UTR|KRT72_ENST00000293745.2_Silent_p.T155T	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	155	Coil 1A.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.T155T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		GGTTCCACTTGGTCTCTAGCA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	12											108.0	99.0	102.0					12																	52992858		2203	4300	6503	51279125	SO:0001819	synonymous_variant	140807			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.465C>A	12.37:g.52992858G>T		Unknown		x	x	x	51279125	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Silent	SNP	ENST00000537672.2	37	CCDS8833.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	9.446	1.089333	0.20390	.	.	ENSG00000170486	ENST00000549979	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	T	0.70622	0.3245	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67979	-0.5530	4	.	.	.	.	14.5673	0.68185	0.0:0.0:0.8536:0.1464	.	.	.	.	K	152	.	.	Q	-	1	0	KRT72	51279125	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.120000	0.50430	2.838000	0.97847	0.561000	0.74099	CAA		0.547	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747		Silent
NTN4	59277	broad.mit.edu	37	12	96104258	96104258	+	Missense_Mutation	SNP	C	C	T	rs377286047		TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr12:96104258C>T	ENST00000343702.4	-	5	1589	c.1141G>A	c.(1141-1143)Gac>Aac	p.D381N	NTN4_ENST00000553059.1_Missense_Mutation_p.D381N|NTN4_ENST00000344911.4_Missense_Mutation_p.D344N|NTN4_ENST00000552603.1_5'Flank|NTN4_ENST00000538383.1_Missense_Mutation_p.D344N	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	381	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)		p.D381N(1)		NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						CTCCGCAGGTCACGATAGAAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	12						C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	196.0	140.0	159.0		1141	5.4	1.0	12		159	0,8600		0,0,4300	no	missense	NTN4	NM_021229.3	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	381/629	96104258	1,13005	2203	4300	6503	94628389	SO:0001583	missense	59277			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1141G>A	12.37:g.96104258C>T	ENSP00000340998:p.Asp381Asn	Unknown		x	x	x	94628389	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Missense_Mutation	SNP	ENST00000343702.4	37	CCDS9054.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929171	0.52759	2.27E-4	0.0	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.39	5.39	0.77823	EGF-like, laminin (4);	0.044080	0.85682	D	0.000000	T	0.58538	0.2129	L	0.43757	1.38	0.58432	D	0.999997	B;B	0.30406	0.278;0.179	B;B	0.38378	0.125;0.272	T	0.55685	-0.8102	10	0.40728	T	0.16	.	19.5354	0.95251	0.0:1.0:0.0:0.0	.	381;381	Q9HB63-2;Q9HB63	.;NET4_HUMAN	N	381;344;344;381	ENSP00000340998:D381N;ENSP00000339436:D344N;ENSP00000444432:D344N;ENSP00000447292:D381N	ENSP00000340998:D381N	D	-	1	0	NTN4	94628389	1.000000	0.71417	0.970000	0.41538	0.400000	0.30750	4.487000	0.60293	2.709000	0.92574	0.655000	0.94253	GAC		0.488	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229		Missense_Mutation
UTP14C	9724	broad.mit.edu	37	13	52603442	52603442	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr13:52603442G>A	ENST00000521776.2	+	2	1235	c.502G>A	c.(502-504)Gct>Act	p.A168T	ALG11_ENST00000521508.1_3'UTR|ALG11_ENST00000523764.1_3'UTR	NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	168					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.A168T(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		GCCAGCCATTGCTCCCATTGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	13											60.0	61.0	61.0					13																	52603442		2203	4300	6503	51501443	SO:0001583	missense	9724			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.502G>A	13.37:g.52603442G>A	ENSP00000428619:p.Ala168Thr	Unknown		x	x	x	51501443	Q5FWG3|Q92555	Missense_Mutation	SNP	ENST00000521776.2	37	CCDS31978.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	5.192	0.220932	0.09863	.	.	ENSG00000253797	ENST00000521776	T	0.17854	2.25	2.46	0.419	0.16438	.	0.321302	0.36444	N	0.002593	T	0.10723	0.0262	L	0.39633	1.23	0.09310	N	1	B	0.22800	0.075	B	0.23574	0.047	T	0.30090	-0.9990	10	0.20519	T	0.43	-0.2829	4.656	0.12618	0.1432:0.4548:0.402:0.0	.	168	Q5TAP6	UT14C_HUMAN	T	168	ENSP00000428619:A168T	ENSP00000428619:A168T	A	+	1	0	UTP14C	51501443	0.001000	0.12720	0.006000	0.13384	0.975000	0.68041	0.435000	0.21510	-0.056000	0.13221	0.448000	0.29417	GCT		0.527	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045049.2	NM_021645		Missense_Mutation
CGNL1	84952	broad.mit.edu	37	15	57731032	57731032	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr15:57731032C>T	ENST00000281282.5	+	2	913	c.835C>T	c.(835-837)Cgg>Tgg	p.R279W		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	279	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.R279W(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		TCTTCCCTTCCGGCGACAGGA	0.607																																																1	Substitution - Missense(1)	ovary(1)	15											51.0	56.0	54.0					15																	57731032		2192	4292	6484	55518324	SO:0001583	missense	84952			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.835C>T	15.37:g.57731032C>T	ENSP00000281282:p.Arg279Trp	Unknown		x	x	x	55518324	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920762	0.52653	.	.	ENSG00000128849	ENST00000281282	T	0.53640	0.61	5.79	3.91	0.45181	.	0.145230	0.32015	N	0.006720	T	0.40196	0.1107	M	0.62723	1.935	0.42985	D	0.994477	B	0.33135	0.399	B	0.23275	0.045	T	0.37220	-0.9715	10	0.87932	D	0	-29.5113	8.783	0.34802	0.268:0.6639:0.0:0.0682	.	279	Q0VF96	CGNL1_HUMAN	W	279	ENSP00000281282:R279W	ENSP00000281282:R279W	R	+	1	2	CGNL1	55518324	0.994000	0.37717	1.000000	0.80357	0.836000	0.47400	1.701000	0.37825	0.770000	0.33336	0.655000	0.94253	CGG		0.607	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	T			TCGA-24-0970-01	TCGA-24-0970-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr17:7578290C>T	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	17	GRCh37	CD043957|CS011574|CS083991	TP53	D|S							82.0	74.0	76.0					17																	7578290		2203	4300	6503	7519015	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>A	17.37:g.7578290C>T		Somatic		x	x	x	7519015	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007143	0.19199	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
POLDIP2	26073	broad.mit.edu	37	17	26680733	26680733	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr17:26680733G>C	ENST00000540200.1	-	5	422	c.423C>G	c.(421-423)gaC>gaG	p.D141E	POLDIP2_ENST00000003607.4_5'UTR	NM_015584.3	NP_056399.1	Q9Y2S7	PDIP2_HUMAN	polymerase (DNA-directed), delta interacting protein 2	142					mitochondrion morphogenesis (GO:0070584)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)					all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TATGTGGGCAGTCACGAGCAT	0.532																																																0			17											199.0	191.0	194.0					17																	26680733		1998	4169	6167	23704860	SO:0001583	missense	26073			AF077203	CCDS74018.1	17q11.2	2008-02-05			ENSG00000004142	ENSG00000004142			23781	protein-coding gene	gene with protein product		611519				12522211	Standard	NM_015584		Approved	PDIP38, DKFZP586F1524	uc002haz.3	Q9Y2S7	OTTHUMG00000132065	ENST00000540200.1:c.423C>G	17.37:g.26680733G>C	ENSP00000475924:p.Asp141Glu	Unknown		x	x	x	23704860	B2R846|Q96JE4	Missense_Mutation	SNP	ENST00000540200.1	37		SNP	36	Broad																																																																																				0.532	POLDIP2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015584		Missense_Mutation
FEM1A	55527	broad.mit.edu	37	19	4793804	4793804	+	Silent	SNP	C	C	G			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr19:4793804C>G	ENST00000269856.3	+	1	2077	c.1938C>G	c.(1936-1938)gcC>gcG	p.A646A	AC005523.2_ENST00000601192.1_RNA|AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000596170.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	646					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)	p.A646A(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CGGCCCGGGCCCTGGATAAGA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	19											27.0	25.0	26.0					19																	4793804		2203	4300	6503	4744804	SO:0001819	synonymous_variant	55527			BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1938C>G	19.37:g.4793804C>G		Unknown		x	x	x	4744804	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	37	CCDS12135.1	SNP	22	Broad																																																																																				0.597	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1			Silent
CCDC151	115948	broad.mit.edu	37	19	11537566	11537566	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr19:11537566C>A	ENST00000356392.4	-	5	738	c.651G>T	c.(649-651)caG>caT	p.Q217H	CCDC151_ENST00000591179.1_Intron|CCDC151_ENST00000586836.1_Missense_Mutation_p.Q26H|CCDC151_ENST00000545100.1_Missense_Mutation_p.Q163H	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	217								p.Q217H(1)		endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						GCGCCTTCATCTGGGCCTTCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											55.0	59.0	58.0					19																	11537566		2045	4192	6237	11398566	SO:0001583	missense	115948				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.651G>T	19.37:g.11537566C>A	ENSP00000348757:p.Gln217His	Unknown		x	x	x	11398566	B4DXT0|Q96CG5	Missense_Mutation	SNP	ENST00000356392.4	37	CCDS42501.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478890	0.44044	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	D;D	0.84516	-1.86;-1.86	4.65	2.45	0.29901	.	0.157260	0.44483	D	0.000444	T	0.70413	0.3221	N	0.24115	0.695	0.18873	N	0.999988	B;B	0.16396	0.007;0.017	B;B	0.09377	0.004;0.004	T	0.51988	-0.8635	10	0.16420	T	0.52	-11.7556	7.4404	0.27179	0.0:0.7336:0.1705:0.0959	.	217;197	A5D8V7;B4DG09	CC151_HUMAN;.	H	163;217;196	ENSP00000442987:Q163H;ENSP00000348757:Q217H	ENSP00000348757:Q217H	Q	-	3	2	CCDC151	11398566	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	1.686000	0.37669	0.371000	0.24564	0.561000	0.74099	CAG		0.612	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458800.1	NM_145045		Missense_Mutation
CYP4F12	66002	broad.mit.edu	37	19	15794522	15794522	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr19:15794522C>G	ENST00000550308.1	+	7	1247	c.867C>G	c.(865-867)gaC>gaG	p.D289E	CYP4F12_ENST00000324632.10_Missense_Mutation_p.D289E	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	289					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.D289E(1)		NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	TTTTCAAAGACAAAGCCAAGT	0.493																																																1	Substitution - Missense(1)	ovary(1)	19											130.0	127.0	128.0					19																	15794522		2200	4299	6499	15655522	SO:0001583	missense	66002			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.867C>G	19.37:g.15794522C>G	ENSP00000448998:p.Asp289Glu	Unknown		x	x	x	15655522	E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	ENST00000550308.1	37	CCDS42517.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.259890	0.00262	.	.	ENSG00000186204	ENST00000550308;ENST00000324632	T;T	0.69435	-0.4;-0.4	2.47	1.39	0.22231	.	2.426560	0.02742	U	0.116377	T	0.45175	0.1329	N	0.12611	0.24	0.09310	N	1	B	0.06786	0.001	B	0.15870	0.014	T	0.30387	-0.9980	10	0.12103	T	0.63	.	3.7605	0.08602	0.0:0.5895:0.2614:0.1491	.	289	Q9HCS2	CP4FC_HUMAN	E	289	ENSP00000448998:D289E;ENSP00000321821:D289E	ENSP00000321821:D289E	D	+	3	2	CYP4F12	15655522	0.979000	0.34478	0.017000	0.16124	0.003000	0.03518	1.133000	0.31430	0.578000	0.29487	0.491000	0.48974	GAC		0.493	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9			Missense_Mutation
IL36B	27177	broad.mit.edu	37	2	113786566	113786566	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr2:113786566G>C	ENST00000259213.4	-	4	318	c.211C>G	c.(211-213)Ctc>Gtc	p.L71V	IL36B_ENST00000327407.2_Missense_Mutation_p.L71V	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	71					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)	p.L71V(1)		kidney(1)|ovary(1)|pancreas(1)	3						AAGAGACAGAGATCTTTTCCC	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											188.0	165.0	173.0					2																	113786566		2203	4300	6503	113503037	SO:0001583	missense	27177			AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.211C>G	2.37:g.113786566G>C	ENSP00000259213:p.Leu71Val	Unknown		x	x	x	113503037	Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Missense_Mutation	SNP	ENST00000259213.4	37	CCDS2109.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	10.69	1.421911	0.25639	.	.	ENSG00000136696	ENST00000259213;ENST00000327407	T;T	0.27720	1.96;1.65	4.38	2.52	0.30459	.	0.333042	0.21766	N	0.069422	T	0.41834	0.1176	M	0.63843	1.955	0.09310	N	1	P;D	0.61697	0.866;0.99	P;P	0.59115	0.461;0.852	T	0.18023	-1.0350	10	0.52906	T	0.07	.	6.3024	0.21119	0.1041:0.1863:0.7096:0.0	.	71;71	Q9NZH7-2;Q9NZH7	.;IL36B_HUMAN	V	71	ENSP00000259213:L71V;ENSP00000328420:L71V	ENSP00000259213:L71V	L	-	1	0	IL36B	113503037	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.299000	0.19138	0.384000	0.24942	-0.261000	0.10672	CTC		0.418	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1	NM_014438		Missense_Mutation
GGTLC1	92086	broad.mit.edu	37	20	23966531	23966531	+	Missense_Mutation	SNP	C	C	T	rs139692095	byFrequency	TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr20:23966531C>T	ENST00000335694.4	-	4	589	c.385G>A	c.(385-387)Ggg>Agg	p.G129R	GGTLC1_ENST00000278765.4_Missense_Mutation_p.G129R|GGTLC1_ENST00000286890.4_Missense_Mutation_p.G129R	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	129	Glutamate binding. {ECO:0000250}.				glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)	p.G129R(2)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						TGCGTGCCCCCGGCAGCTCCC	0.647													.|||	7	0.00139776	0.0	0.0	5008	,	,		13677	0.0		0.0	False		,,,				2504	0.0072															2	Substitution - Missense(2)	ovary(2)	20						C	ARG/GLY,ARG/GLY	1,3021		0,1,1510	108.0	118.0	115.0		385,385	0.8	0.1	20	dbSNP_134	115	4,5414		0,4,2705	no	missense,missense	GGTLC1	NM_178311.2,NM_178312.2	125,125	0,5,4215	TT,TC,CC		0.0738,0.0331,0.0592	probably-damaging,probably-damaging	129/226,129/226	23966531	5,8435	1511	2709	4220	23914531	SO:0001583	missense	92086			AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.385G>A	20.37:g.23966531C>T	ENSP00000337587:p.Gly129Arg	Unknown		x	x	x	23914531	D3DW43|Q08246	Missense_Mutation	SNP	ENST00000335694.4	37	CCDS13163.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	15.95	2.985052	0.53934	3.31E-4	7.38E-4	ENSG00000149435	ENST00000286890;ENST00000278765;ENST00000335694	T;T;T	0.72394	-0.65;-0.65;-0.65	0.844	0.844	0.18943	.	0.000000	0.85682	D	0.000000	D	0.89406	0.6706	H	0.99800	4.79	0.45662	D	0.998588	D	0.89917	1.0	D	0.79108	0.992	D	0.86593	0.1861	10	0.87932	D	0	-43.9924	7.477	0.27382	0.0:0.9999:0.0:1.0E-4	.	129	Q9BX51	GGTL1_HUMAN	R	129	ENSP00000286890:G129R;ENSP00000278765:G129R;ENSP00000337587:G129R	ENSP00000278765:G129R	G	-	1	0	GGTLC1	23914531	1.000000	0.71417	0.115000	0.21578	0.121000	0.20230	5.038000	0.64177	0.088000	0.17205	0.089000	0.15464	GGG		0.647	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078366.2	NM_178311.2		Missense_Mutation
EFCAB6	64800	broad.mit.edu	37	22	43995977	43995977	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr22:43995977G>A	ENST00000262726.7	-	23	3101	c.2848C>T	c.(2848-2850)Cag>Tag	p.Q950*	EFCAB6_ENST00000396231.2_Nonsense_Mutation_p.Q798*	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	950					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.Q950*(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TCTGTGCTCTGCTGCAGCTCC	0.517																																																1	Substitution - Nonsense(1)	ovary(1)	22											174.0	164.0	168.0					22																	43995977		2203	4300	6503	42327310	SO:0001587	stop_gained	64800			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2848C>T	22.37:g.43995977G>A	ENSP00000262726:p.Gln950*	Unknown		x	x	x	42327310	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Nonsense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	43	10.039492	0.99323	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	.	.	.	5.2	5.2	0.72013	.	0.376195	0.25058	N	0.033472	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-22.9705	15.5878	0.76499	0.0:0.0:1.0:0.0	.	.	.	.	X	798;950	.	ENSP00000262726:Q950X	Q	-	1	0	EFCAB6	42327310	0.960000	0.32886	0.989000	0.46669	0.864000	0.49448	2.171000	0.42453	2.695000	0.91970	0.650000	0.86243	CAG		0.517	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		Nonsense_Mutation
MYRIP	25924	broad.mit.edu	37	3	40286041	40286041	+	Silent	SNP	G	G	A	rs201745391		TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr3:40286041G>A	ENST00000302541.6	+	13	2547	c.2205G>A	c.(2203-2205)gcG>gcA	p.A735A	MYRIP_ENST00000396217.3_Silent_p.A646A|MYRIP_ENST00000444716.1_Silent_p.A735A|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000539167.1_Silent_p.A548A|MYRIP_ENST00000425621.1_Silent_p.A670A	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	735	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)	p.A735A(2)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CCCATCTGGCGGATCTGGAGG	0.607																																																2	Substitution - coding silent(2)	ovary(1)|skin(1)	3						G		0,4406		0,0,2203	60.0	56.0	57.0		2205	-11.1	0.3	3		57	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MYRIP	NM_015460.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		735/860	40286041	1,13005	2203	4300	6503	40261045	SO:0001819	synonymous_variant	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.2205G>A	3.37:g.40286041G>A		Unknown		x	x	x	40261045	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Silent	SNP	ENST00000302541.6	37	CCDS2689.1	SNP	39	Broad																																																																																				0.607	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460		Silent
CEP97	79598	broad.mit.edu	37	3	101476585	101476585	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr3:101476585C>T	ENST00000341893.3	+	9	1887	c.1135C>T	c.(1135-1137)Cga>Tga	p.R379*	CEP97_ENST00000494050.1_Intron|CEP97_ENST00000327230.4_Nonsense_Mutation_p.R379*			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	379	CCP110-binding.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)		p.R379*(1)		cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						GAGATATTCTCGAAATGATCT	0.398																																																1	Substitution - Nonsense(1)	ovary(1)	3											107.0	95.0	99.0					3																	101476585		2203	4300	6503	102959275	SO:0001587	stop_gained	79598			AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1135C>T	3.37:g.101476585C>T	ENSP00000342510:p.Arg379*	Unknown		x	x	x	102959275	B5MDY8|Q8NA71|Q9H5T9	Nonsense_Mutation	SNP	ENST00000341893.3	37	CCDS2944.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487765	0.84854	.	.	ENSG00000182504	ENST00000341893;ENST00000327230	.	.	.	5.04	5.04	0.67666	.	0.572979	0.18145	N	0.150264	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-9.095	8.7281	0.34483	0.0:0.7837:0.0:0.2163	.	.	.	.	X	379	.	ENSP00000325881:R379X	R	+	1	2	CEP97	102959275	0.997000	0.39634	1.000000	0.80357	0.888000	0.51559	0.862000	0.27899	2.328000	0.79073	0.313000	0.20887	CGA		0.398	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548		Nonsense_Mutation
SI	6476	broad.mit.edu	37	3	164735380	164735380	+	Missense_Mutation	SNP	C	C	A	rs41273567		TCGA-24-0970-01	TCGA-24-0970-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr3:164735380C>A	ENST00000264382.3	-	31	3777	c.3715G>T	c.(3715-3717)Gtt>Ttt	p.V1239F		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1239	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.V1239F(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AATTCCCGAACCTCTGAAGTA	0.348										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											65.0	62.0	63.0					3																	164735380		2203	4299	6502	166218074	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3715G>T	3.37:g.164735380C>A	ENSP00000264382:p.Val1239Phe	Somatic		x	x	x	166218074	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577387	0.45902	.	.	ENSG00000090402	ENST00000264382	D	0.94092	-3.35	5.31	-4.39	0.03611	Glycoside hydrolase, superfamily (1);	0.541730	0.19953	N	0.102376	D	0.94175	0.8131	M	0.85197	2.74	0.09310	N	1	P	0.40909	0.732	P	0.47603	0.551	D	0.90856	0.4735	10	0.72032	D	0.01	.	15.4418	0.75190	0.0:0.4038:0.0:0.5962	.	1239	P14410	SUIS_HUMAN	F	1239	ENSP00000264382:V1239F	ENSP00000264382:V1239F	V	-	1	0	SI	166218074	0.006000	0.16342	0.000000	0.03702	0.004000	0.04260	-0.822000	0.04448	-1.123000	0.02940	-1.936000	0.00505	GTT		0.348	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
CCDC39	339829	broad.mit.edu	37	3	180349289	180349289	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr3:180349289C>G	ENST00000442201.2	-	14	2085	c.1966G>C	c.(1966-1968)Gag>Cag	p.E656Q	CCDC39_ENST00000273654.4_Missense_Mutation_p.E740Q	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	656					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.E740Q(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GTTTTCTCCTCTTCTCCTTCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	3											100.0	101.0	101.0					3																	180349289		1849	4096	5945	181831983	SO:0001583	missense	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1966G>C	3.37:g.180349289C>G	ENSP00000405708:p.Glu656Gln	Unknown		x	x	x	181831983	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585641	0.86748	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	.	.	.	5.4	5.4	0.78164	.	0.118143	0.56097	D	0.000031	T	0.80486	0.4632	M	0.82923	2.615	0.44395	D	0.997305	D	0.76494	0.999	D	0.65443	0.935	T	0.82581	-0.0386	9	0.62326	D	0.03	-14.2715	18.2955	0.90145	0.0:1.0:0.0:0.0	.	656	Q9UFE4	CCD39_HUMAN	Q	740;656	.	ENSP00000273654:E740Q	E	-	1	0	CCDC39	181831983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.326000	0.72905	2.678000	0.91216	0.655000	0.94253	GAG		0.348	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		Missense_Mutation
PCDHAC1	56135	broad.mit.edu	37	5	140308286	140308286	+	Silent	SNP	G	G	A			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr5:140308286G>A	ENST00000253807.2	+	1	1809	c.1809G>A	c.(1807-1809)gcG>gcA	p.A603A	PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHAC1_ENST00000409700.3_Silent_p.A603A|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	603	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A603A(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCCCGGGCGTCTGACTCTA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	5											79.0	83.0	81.0					5																	140308286		2203	4300	6503	140288470	SO:0001819	synonymous_variant	56135			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1809G>A	5.37:g.140308286G>A		Unknown		x	x	x	140288470	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	CCDS4241.1	SNP	40	Broad																																																																																				0.522	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898		Silent
EPHA7	2045	broad.mit.edu	37	6	93974358	93974358	+	Missense_Mutation	SNP	T	T	C	rs77295523		TCGA-24-0970-01	TCGA-24-0970-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr6:93974358T>C	ENST00000369303.4	-	8	1880	c.1696A>G	c.(1696-1698)Acc>Gcc	p.T566A		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	566					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.T566A(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		AAAATGATGGTCCCAGCTACA	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											78.0	72.0	74.0					6																	93974358		2203	4299	6502	94031079	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1696A>G	6.37:g.93974358T>C	ENSP00000358309:p.Thr566Ala	Somatic		x	x	x	94031079	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255924	0.59321	.	.	ENSG00000135333	ENST00000369303	T	0.09723	2.95	5.49	5.49	0.81192	.	0.057469	0.64402	D	0.000002	T	0.11922	0.0290	N	0.17723	0.515	0.80722	D	1	D;P;P	0.56035	0.974;0.672;0.543	D;B;B	0.67725	0.953;0.174;0.037	T	0.12293	-1.0553	10	0.59425	D	0.04	.	15.5873	0.76495	0.0:0.0:0.0:1.0	.	566;561;566	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	A	566	ENSP00000358309:T566A	ENSP00000358309:T566A	T	-	1	0	EPHA7	94031079	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.040000	0.89188	2.089000	0.63090	0.533000	0.62120	ACC		0.383	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			Missense_Mutation
RSPH10B2	728194	broad.mit.edu	37	7	6797490	6797490	+	Missense_Mutation	SNP	G	G	A	rs373324068		TCGA-24-0970-01	TCGA-24-0970-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr7:6797490G>A	ENST00000403107.1	+	2	569	c.182G>A	c.(181-183)cGc>cAc	p.R61H	RSPH10B2_ENST00000404077.1_Missense_Mutation_p.R61H|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.R61H|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.R61H|RSPH10B2_ENST00000359718.3_5'UTR			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	61								p.R61H(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						AAAAAAGACCGCCAAAACGTT	0.483																																																2	Substitution - Missense(2)	ovary(2)	7											113.0	127.0	122.0					7																	6797490		2158	4264	6422	6764015	SO:0001583	missense	222967				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.182G>A	7.37:g.6797490G>A	ENSP00000384766:p.Arg61His	Somatic		x	x	x	6764015	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	CCDS43552.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	8.412	0.844331	0.16963	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	2.09	0.206	0.15208	.	32.676400	0.00166	U	0.000004	T	0.24314	0.0589	N	0.08118	0	0.09310	N	0.999999	B	0.30937	0.301	B	0.08055	0.003	T	0.10941	-1.0608	10	0.45353	T	0.12	.	2.831	0.05499	0.0:0.4322:0.2467:0.3211	.	61	B2RC85	R10B2_HUMAN	H	61	ENSP00000384766:R61H;ENSP00000386102:R61H;ENSP00000297186:R61H;ENSP00000416710:R61H	ENSP00000297186:R61H	R	+	2	0	RSPH10B2	6764015	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.459000	0.06728	-0.247000	0.09597	-0.901000	0.02856	CGC		0.483	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697		Missense_Mutation
KIAA1324L	222223	broad.mit.edu	37	7	86556219	86556219	+	Missense_Mutation	SNP	T	T	C	rs370803630		TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr7:86556219T>C	ENST00000450689.2	-	9	1288	c.1103A>G	c.(1102-1104)tAc>tGc	p.Y368C	KIAA1324L_ENST00000297222.6_Missense_Mutation_p.Y128C|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.Y368C|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.Y201C	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	368						integral component of membrane (GO:0016021)		p.Y128C(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					TATCCACTTGTACATTATCTG	0.388																																																1	Substitution - Missense(1)	ovary(1)	7											73.0	73.0	73.0					7																	86556219		2203	4300	6503	86394155	SO:0001583	missense	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1103A>G	7.37:g.86556219T>C	ENSP00000413445:p.Tyr368Cys	Unknown		x	x	x	86394155	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029603	0.54790	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.36878	2.4;1.23;2.4;2.4	5.23	5.23	0.72850	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.80764	0.994;0.944;0.912	T	0.68716	-0.5335	10	0.66056	D	0.02	.	14.5924	0.68378	0.0:0.0:0.0:1.0	.	368;128;201	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	C	368;128;368;201	ENSP00000413445:Y368C;ENSP00000297222:Y128C;ENSP00000397377:Y368C;ENSP00000402390:Y201C	ENSP00000297222:Y128C	Y	-	2	0	KIAA1324L	86394155	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	4.989000	0.63870	2.098000	0.63641	0.460000	0.39030	TAC		0.388	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748		Missense_Mutation
ADAM22	53616	broad.mit.edu	37	7	87762239	87762239	+	Silent	SNP	G	G	A			TCGA-24-0970-01	TCGA-24-0970-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr7:87762239G>A	ENST00000265727.7	+	12	1129	c.1050G>A	c.(1048-1050)tcG>tcA	p.S350S	ADAM22_ENST00000398204.4_Silent_p.S350S|ADAM22_ENST00000398209.3_Silent_p.S350S|ADAM22_ENST00000398201.4_Silent_p.S350S|ADAM22_ENST00000315984.7_Silent_p.S350S			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	350	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S350S(2)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GGATTTGCTCGTTGCTGAAAG	0.408																																																2	Substitution - coding silent(2)	ovary(2)	7											193.0	203.0	199.0					7																	87762239		2087	4234	6321	87600175	SO:0001819	synonymous_variant	53616			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1050G>A	7.37:g.87762239G>A		Somatic		x	x	x	87600175	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	37	CCDS47637.1	SNP	40	Broad																																																																																				0.408	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723		Silent
SMURF1	57154	broad.mit.edu	37	7	98636021	98636021	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr7:98636021C>A	ENST00000361125.1	-	15	2075	c.1756G>T	c.(1756-1758)Gaa>Taa	p.E586*	AC004893.11_ENST00000468960.2_RNA|SMURF1_ENST00000361368.2_Nonsense_Mutation_p.E560*|AC004893.11_ENST00000360902.1_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	586	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)	p.E586*(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CGGACGTATTCTTTCTTATTC	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	7											99.0	82.0	88.0					7																	98636021		2203	4300	6503	98473957	SO:0001587	stop_gained	57154			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.1756G>T	7.37:g.98636021C>A	ENSP00000354621:p.Glu586*	Unknown		x	x	x	98473957	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Nonsense_Mutation	SNP	ENST00000361125.1	37	CCDS34690.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.208232	0.98706	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	.	.	.	5.5	5.5	0.81552	.	0.047074	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.7727	0.96373	0.0:1.0:0.0:0.0	.	.	.	.	X	560;586	.	ENSP00000354621:E586X	E	-	1	0	SMURF1	98473957	1.000000	0.71417	1.000000	0.80357	0.390000	0.30446	7.445000	0.80570	2.758000	0.94735	0.563000	0.77884	GAA		0.577	SMURF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335001.2	NM_020429		Nonsense_Mutation
MUC17	140453	broad.mit.edu	37	7	100685235	100685235	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr7:100685235G>T	ENST00000306151.4	+	3	10602	c.10538G>T	c.(10537-10539)gGt>gTt	p.G3513V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3513	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.G3513V(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAACTGCTGGTGAAGGAAGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	7											232.0	245.0	241.0					7																	100685235		2203	4300	6503	100471955	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10538G>T	7.37:g.100685235G>T	ENSP00000302716:p.Gly3513Val	Unknown		x	x	x	100471955	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	4.322	0.059186	0.08339	.	.	ENSG00000169876	ENST00000306151	T	0.04706	3.57	1.37	-0.395	0.12431	.	.	.	.	.	T	0.06508	0.0167	N	0.14661	0.345	0.09310	N	1	D	0.57899	0.981	D	0.63381	0.914	T	0.43163	-0.9408	9	0.26408	T	0.33	.	7.4543	0.27257	0.0:0.6681:0.3319:0.0	.	3513	Q685J3	MUC17_HUMAN	V	3513	ENSP00000302716:G3513V	ENSP00000302716:G3513V	G	+	2	0	MUC17	100471955	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.822000	0.04448	-0.224000	0.09928	0.186000	0.17326	GGT		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Missense_Mutation
PXDNL	137902	broad.mit.edu	37	8	52322088	52322088	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr8:52322088G>C	ENST00000356297.4	-	17	2196	c.2096C>G	c.(2095-2097)tCc>tGc	p.S699C	PXDNL_ENST00000543296.1_Missense_Mutation_p.S699C	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	699					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S699C(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAGGCTGAGGGAGCGCGGGGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	8											31.0	36.0	34.0					8																	52322088		2110	4234	6344	52484641	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2096C>G	8.37:g.52322088G>C	ENSP00000348645:p.Ser699Cys	Unknown		x	x	x	52484641	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	5.535	0.283615	0.10458	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.66638	-0.19;-0.22	3.19	0.66	0.17868	.	.	.	.	.	T	0.33556	0.0867	N	0.08118	0	0.21933	N	0.999464	P	0.46952	0.887	B	0.31869	0.137	T	0.18840	-1.0324	8	.	.	.	.	4.447	0.11602	0.173:0.0:0.2347:0.5923	.	699	A1KZ92	PXDNL_HUMAN	C	699	ENSP00000348645:S699C;ENSP00000444865:S699C	.	S	-	2	0	PXDNL	52484641	1.000000	0.71417	0.011000	0.14972	0.031000	0.12232	3.359000	0.52292	-0.093000	0.12396	0.561000	0.74099	TCC		0.622	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		Missense_Mutation
MUC5B	727897	broad.mit.edu	37	11	1270397	1270402	+	In_Frame_Del	DEL	CCACGG	CCACGG	-	rs201512746|rs535589552	byFrequency	TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr11:1270397_1270402delCCACGG	ENST00000529681.1	+	31	12345_12350	c.12287_12292delCCACGG	c.(12286-12294)accacggcc>acc	p.TA4099del	MUC5B_ENST00000447027.1_In_Frame_Del_p.TA4102del|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4099	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.A4055_T4056delAT(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCTCCAGGACCACGGCCACGGCCAC	0.704																																																1	Deletion - In frame(1)	ovary(1)	11								54,3442		1,52,1695						1.4	0.0			95	239,7093		2,235,3429	no	coding	MUC5B	NM_002458.2		3,287,5124	A1A1,A1R,RR		3.2597,1.5446,2.7059				293,10535				1226978	SO:0001651	inframe_deletion	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12287_12292delCCACGG	11.37:g.1270403_1270408delCCACGG	ENSP00000436812:p.Thr4099_Ala4100del	Unknown		Capture	Illumina GAIIx	Phase_I	1226973	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	In_Frame_Del	DEL	ENST00000529681.1	37	CCDS44515.2	DEL	18	Broad																																																																																				0.704	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		In_Frame_Del
LMTK3	114783	broad.mit.edu	37	19	48994757	48994758	+	Frame_Shift_Ins	INS	-	-	G			TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr19:48994757_48994758insG	ENST00000600059.1	-	13	4358_4359	c.4131_4132insC	c.(4129-4134)cccgagfs	p.E1378fs	LMTK3_ENST00000270238.3_Frame_Shift_Ins_p.E1407fs			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1378	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GTGTCCCCCTCGGGGGGGGCCT	0.658																																																0			19																																								53686570	SO:0001589	frameshift_variant	114783			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.4132dupC	19.37:g.48994765_48994765dupG	ENSP00000472020:p.Glu1378fs	Unknown		Capture	Illumina GAIIx	Phase_I	53686569	Q4G0U1	Frame_Shift_Ins	INS	ENST00000600059.1	37		INS	31	Broad																																																																																				0.658	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895		Frame_Shift_Ins
SSPO	23145	broad.mit.edu	37	7	149503917	149503920	+	RNA	DEL	GATA	GATA	-	rs72359812|rs66470151	byFrequency	TCGA-24-0970-01	TCGA-24-0970-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-0970-01	TCGA-24-0970-10	g.chr7:149503917_149503920delGATA	ENST00000378016.2	+	0	8745							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGGCCCCGGGATAGATAGAGTGT	0.652														1379	0.275359	0.4803	0.2334	5008	,	,		17754	0.1895		0.1581	False		,,,				2504	0.2372															0			7								1437,2153		344,749,702						3.3	0.9		dbSNP_130	28	1265,6541		120,1025,2758	no	frameshift	SSPO	NM_198455.2		464,1774,3460	A1A1,A1R,RR		16.2055,40.0279,23.7101				2702,8694				149134853			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149503921_149503924delGATA		Unknown		Capture	Illumina GAIIx	Phase_I	149134850	Q76B61	Frame_Shift_Del	DEL	ENST00000378016.2	37		DEL	41	Broad																																																																																				0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				Frame_Shift_Del
