#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZNF426	79088	genome.wustl.edu	37	19	9641741	9641741	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr19:9641741A>G	ENST00000535489.1	-	5	664	c.328T>C	c.(328-330)Tgg>Cgg	p.W110R	ZNF426_ENST00000593003.1_Missense_Mutation_p.W72R|ZNF426_ENST00000589289.1_Intron|ZNF426_ENST00000253115.2_Missense_Mutation_p.W110R			Q9BUY5	ZN426_HUMAN	zinc finger protein 426	110	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W110R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20						CGCATTTCCCATCCTGAAATA	0.443																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	90.0	92.0					19																	9641741		2203	4300	6503	9502741	SO:0001583	missense	79088			AK095759	CCDS12215.1, CCDS74279.1	19p13.2	2013-01-08				ENSG00000130818		"""Zinc fingers, C2H2-type"", ""-"""	20725	protein-coding gene	gene with protein product							Standard	NM_024106		Approved	MGC2663	uc002mlq.3	Q9BUY5		ENST00000535489.1:c.328T>C	19.37:g.9641741A>G	ENSP00000439017:p.Trp110Arg	Somatic		Capture	Illumina GAIIx	4	9502741	B3KTL2	Missense_Mutation	SNP	ENST00000535489.1	37	CCDS12215.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	9.959	1.222209	0.22457	.	.	ENSG00000130818	ENST00000545189;ENST00000253115;ENST00000535489	T;T	0.07021	3.23;3.23	1.53	1.53	0.23141	Krueppel-associated box (1);	.	.	.	.	T	0.07683	0.0193	N	0.08118	0	0.18873	N	0.999986	D;D	0.55605	0.972;0.972	P;P	0.59643	0.861;0.861	T	0.37407	-0.9707	9	0.21540	T	0.41	.	5.172	0.15114	1.0:0.0:0.0:0.0	.	97;110	Q59EH4;Q9BUY5	.;ZN426_HUMAN	R	97;110;110	ENSP00000253115:W110R;ENSP00000439017:W110R	ENSP00000253115:W110R	W	-	1	0	ZNF426	9502741	0.019000	0.18553	0.024000	0.17045	0.459000	0.32528	2.240000	0.43088	0.945000	0.37605	0.377000	0.23210	TGG		0.443	ZNF426-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449905.1	NM_024106		Missense_Mutation
ZNF812	729648	genome.wustl.edu	37	19	9804486	9804486	+	Missense_Mutation	SNP	G	G	A	rs536402597		TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr19:9804486G>A	ENST00000457674.2	-	4	643	c.125C>T	c.(124-126)aCg>aTg	p.T42M	ZNF812_ENST00000536819.1_Intron	NM_001199814.1	NP_001186743.1	P0C7V5	ZN812_HUMAN	zinc finger protein 812	42	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T42M(1)		ovary(1)	1						ATCATCAAACGTCACTGAATC	0.463													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15787	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19																																								9665486	SO:0001583	missense	729648				CCDS54215.1	19p13.2	2014-04-02			ENSG00000224689	ENSG00000224689		"""Zinc fingers, C2H2-type"", ""-"""	33242	protein-coding gene	gene with protein product							Standard	NM_001199814		Approved		uc021uop.1	P0C7V5	OTTHUMG00000167867	ENST00000457674.2:c.125C>T	19.37:g.9804486G>A	ENSP00000395629:p.Thr42Met	Somatic		Capture	Illumina GAIIx	4	9665486		Missense_Mutation	SNP	ENST00000457674.2	37	CCDS54215.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	g	11.20	1.567797	0.28003	.	.	ENSG00000224689	ENST00000457674	T	0.03065	4.06	1.58	-3.16	0.05217	.	.	.	.	.	T	0.06416	0.0165	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.18713	-1.0328	7	0.62326	D	0.03	.	4.1519	0.10242	0.4177:0.352:0.2303:0.0	.	.	.	.	M	42	ENSP00000395629:T42M	ENSP00000395629:T42M	T	-	2	0	ZNF812	9665486	0.003000	0.15002	0.000000	0.03702	0.336000	0.28762	-0.972000	0.03802	-1.254000	0.02485	-1.026000	0.02426	ACG		0.463	ZNF812-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396726.1			Missense_Mutation
HDAC11	79885	genome.wustl.edu	37	3	13545660	13545660	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr3:13545660A>T	ENST00000295757.3	+	9	899	c.716A>T	c.(715-717)gAg>gTg	p.E239V	HDAC11_ENST00000433119.1_Nonsense_Mutation_p.R197*|HDAC11_ENST00000402271.1_Missense_Mutation_p.E160V|HDAC11_ENST00000405025.1_Nonsense_Mutation_p.R79*|HDAC11_ENST00000404548.1_Nonsense_Mutation_p.R107*|HDAC11_ENST00000522202.1_Missense_Mutation_p.E188V|HDAC11_ENST00000404040.1_Missense_Mutation_p.E139V|HDAC11_ENST00000402259.1_Missense_Mutation_p.E73V|HDAC11_ENST00000446613.2_Missense_Mutation_p.E47V|HDAC11_ENST00000437379.2_Missense_Mutation_p.E211V	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	239	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)	p.E239V(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						GATAAGGTGGAGAGGAACATC	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											98.0	90.0	93.0					3																	13545660		2203	4300	6503	13520660	SO:0001583	missense	79885			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.716A>T	3.37:g.13545660A>T	ENSP00000295757:p.Glu239Val	Somatic		Capture	Illumina GAIIx	4	13520660	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Nonsense_Mutation	SNP	ENST00000295757.3	37	CCDS2615.1	SNP	11	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.52|12.52	1.961646|1.961646	0.34659|0.34659	.|.	.|.	ENSG00000163517|ENSG00000163517	ENST00000295757;ENST00000402259;ENST00000402271;ENST00000446613;ENST00000404040;ENST00000522202;ENST00000437379|ENST00000433119;ENST00000404548;ENST00000405025	T;T;T;T;T;T;T|.	0.71579|.	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58|.	5.65|5.65	0.258|0.258	0.15578|0.15578	Histone deacetylase domain (2);|.	0.281721|.	0.39146|.	N|.	0.001459|.	T|.	0.43722|.	0.1260|.	L|L	0.35487|0.35487	1.065|1.065	0.35006|0.35006	D|D	0.756478|0.756478	B;B|.	0.19200|.	0.002;0.034|.	B;B|.	0.23018|.	0.02;0.043|.	T|.	0.52689|.	-0.8542|.	10|.	0.87932|0.87932	D|D	0|0	-1.8835|-1.8835	4.9396|4.9396	0.13958|0.13958	0.6133:0.1455:0.2412:0.0|0.6133:0.1455:0.2412:0.0	.|.	188;239|.	B4DDK1;Q96DB2|.	.;HDA11_HUMAN|.	V|X	239;73;160;47;139;188;211|197;107;79	ENSP00000295757:E239V;ENSP00000384706:E73V;ENSP00000384123:E160V;ENSP00000401487:E47V;ENSP00000385475:E139V;ENSP00000429794:E188V;ENSP00000395188:E211V|.	ENSP00000295757:E239V|ENSP00000385528:R107X	E|R	+|+	2|1	0|2	HDAC11|HDAC11	13520660|13520660	0.899000|0.899000	0.30636|0.30636	0.983000|0.983000	0.44433|0.44433	0.003000|0.003000	0.03518|0.03518	1.950000|1.950000	0.40323|0.40323	0.096000|0.096000	0.17463|0.17463	-0.378000|-0.378000	0.06908|0.06908	GAG|AGA		0.582	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827		Nonsense_Mutation
FGD5	152273	genome.wustl.edu	37	3	14861824	14861824	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr3:14861824G>A	ENST00000285046.5	+	1	1356	c.1246G>A	c.(1246-1248)Gtg>Atg	p.V416M	FGD5_ENST00000543601.1_Missense_Mutation_p.V175M	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	416					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.V175M(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TGTGGTGGTCGTGCTGGAGGA	0.682																																																1	Substitution - Missense(1)	ovary(1)	3											25.0	29.0	28.0					3																	14861824		2059	4177	6236	14836828	SO:0001583	missense	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1246G>A	3.37:g.14861824G>A	ENSP00000285046:p.Val416Met	Somatic		Capture	Illumina GAIIx	4	14836828	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	8.491	0.862099	0.17178	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.78924	-1.22;-1.02	5.03	-10.1	0.00402	.	0.850128	0.10241	N	0.698480	T	0.44244	0.1284	N	0.11201	0.11	0.09310	N	1	B;B	0.31351	0.32;0.181	B;B	0.18561	0.022;0.006	T	0.37709	-0.9694	10	0.30854	T	0.27	-1.9286	2.8404	0.05527	0.2113:0.4016:0.2074:0.1796	.	175;416	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	M	416;175	ENSP00000285046:V416M;ENSP00000445949:V175M	ENSP00000285046:V416M	V	+	1	0	FGD5	14836828	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.928000	0.03980	-4.386000	0.00052	-1.031000	0.02408	GTG		0.682	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		Missense_Mutation
CCT8L2	150160	genome.wustl.edu	37	22	17072821	17072821	+	Missense_Mutation	SNP	G	G	A	rs376606608		TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr22:17072821G>A	ENST00000359963.3	-	1	879	c.620C>T	c.(619-621)gCg>gTg	p.A207V		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	207					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.A207G(1)|p.A207V(1)|p.A207E(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CCCGGGCAGCGCGCACACCCC	0.617																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	22						G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	64.0	63.0	63.0		620	1.8	0.0	22		63	0,8600		0,0,4300	no	missense	CCT8L2	NM_014406.4	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	207/558	17072821	1,13005	2203	4300	6503	15452821	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.620C>T	22.37:g.17072821G>A	ENSP00000353048:p.Ala207Val	Somatic		Capture	Illumina GAIIx	4	15452821	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	g	9.225	1.034437	0.19590	2.27E-4	0.0	ENSG00000198445	ENST00000359963	T	0.78816	-1.21	1.78	1.78	0.24846	.	1.965940	0.03364	N	0.197938	T	0.61949	0.2388	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.18561	0.022	T	0.55328	-0.8158	10	0.66056	D	0.02	-1.6843	7.0003	0.24805	0.0:0.0:1.0:0.0	.	207	Q96SF2	TCPQM_HUMAN	V	207	ENSP00000353048:A207V	ENSP00000353048:A207V	A	-	2	0	CCT8L2	15452821	0.385000	0.25172	0.019000	0.16419	0.030000	0.12068	0.334000	0.19787	0.995000	0.38917	0.379000	0.24179	GCG		0.617	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			Missense_Mutation
CD19	930	genome.wustl.edu	37	16	28943743	28943743	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr16:28943743G>T	ENST00000324662.3	+	2	209	c.165G>T	c.(163-165)gaG>gaT	p.E55D	CD19_ENST00000538922.1_Missense_Mutation_p.E55D|CD19_ENST00000567541.1_Missense_Mutation_p.E55D			P15391	CD19_HUMAN	CD19 molecule	55	Ig-like C2-type 1.				B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)	p.E55D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						GGTCTCGGGAGTCCCCGCTTA	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											36.0	42.0	40.0					16																	28943743		2196	4300	6496	28851244	SO:0001583	missense	930				CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.165G>T	16.37:g.28943743G>T	ENSP00000313419:p.Glu55Asp	Somatic		Capture	Illumina GAIIx	4	28851244	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	ENST00000324662.3	37	CCDS10644.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	8.353	0.831433	0.16820	.	.	ENSG00000177455	ENST00000538922;ENST00000380673;ENST00000324662	T;T	0.38560	1.13;1.13	5.29	-5.14	0.02875	Immunoglobulin subtype (1);Immunoglobulin-like (1);	1.015420	0.07882	N	0.969762	T	0.18002	0.0432	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.26052	-1.0114	10	0.13470	T	0.59	-1.2667	5.3881	0.16229	0.1455:0.3939:0.3642:0.0963	.	55;55	F5H635;P15391	.;CD19_HUMAN	D	55;40;55	ENSP00000437940:E55D;ENSP00000313419:E55D	ENSP00000313419:E55D	E	+	3	2	CD19	28851244	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.468000	0.06656	-1.149000	0.02843	-1.255000	0.01485	GAG		0.587	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214152.2			Missense_Mutation
CHMP4B	128866	genome.wustl.edu	37	20	32436293	32436293	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr20:32436293C>A	ENST00000217402.2	+	2	376	c.211C>A	c.(211-213)Cgt>Agt	p.R71S		NM_176812.4	NP_789782.1	Q9H444	CHM4B_HUMAN	charged multivesicular body protein 4B	71					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|positive regulation of viral release from host cell (GO:1902188)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.R71S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13						GGCACTGAAGCGTAAGAAGAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											65.0	54.0	58.0					20																	32436293		2203	4300	6503	31899954	SO:0001583	missense	128866			AL050349	CCDS13228.1	20q11.22	2011-09-21	2011-09-21	2005-04-04	ENSG00000101421	ENSG00000101421		"""Charged multivesicular body proteins"""	16171	protein-coding gene	gene with protein product		610897	"""chromosome 20 open reading frame 178"", ""chromatin modifying protein 4B"""	C20orf178		14678797	Standard	NM_176812		Approved	dJ553F4.4, Shax1, SNF7-2, VPS32B	uc002xaa.3	Q9H444	OTTHUMG00000032272	ENST00000217402.2:c.211C>A	20.37:g.32436293C>A	ENSP00000217402:p.Arg71Ser	Somatic		Capture	Illumina GAIIx	4	31899954	E1P5N4|Q53ZD6	Missense_Mutation	SNP	ENST00000217402.2	37	CCDS13228.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	32	5.114329	0.94339	.	.	ENSG00000101421	ENST00000217402	T	0.73047	-0.71	5.78	5.78	0.91487	.	0.047704	0.85682	D	0.000000	D	0.86091	0.5850	M	0.90595	3.13	0.80722	D	1	D	0.56746	0.977	P	0.58331	0.837	D	0.88313	0.2957	10	0.87932	D	0	-6.6585	19.996	0.97383	0.0:1.0:0.0:0.0	.	71	Q9H444	CHM4B_HUMAN	S	71	ENSP00000217402:R71S	ENSP00000217402:R71S	R	+	1	0	CHMP4B	31899954	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.047000	0.57383	2.731000	0.93534	0.591000	0.81541	CGT		0.562	CHMP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078738.2			Missense_Mutation
SNX18P7	100418980	genome.wustl.edu	37	9	33576858	33576858	+	IGR	SNP	G	G	A	rs149662767	byFrequency	TCGA-24-0980-01	TCGA-24-0980-10	G	G	A	A	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr9:33576858G>A								ANKRD18B (3859 upstream) : RP11-255A11.21 (3834 downstream)																							AGGTGCAGAGGCTGATGATGT	0.483													.|||	28	0.00559105	0.0008	0.0115	5008	,	,		25009	0.0		0.0179	False		,,,				2504	0.001															0			9																																								33566858	SO:0001628	intergenic_variant	441459																															9.37:g.33576858G>A		Germline		Capture	Illumina GAIIx	4	33566858		Silent	SNP		37		SNP	42	WashU																																																																																			0	0.483									Silent
PRRG1	5638	genome.wustl.edu	37	X	37285167	37285167	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chrX:37285167A>G	ENST00000542554.1	+	4	357	c.85A>G	c.(85-87)Aga>Gga	p.R29G	PRRG1_ENST00000463135.1_Missense_Mutation_p.R29G|TM4SF2_ENST00000465127.1_Missense_Mutation_p.R29G|PRRG1_ENST00000449135.2_Missense_Mutation_p.R29G|PRRG1_ENST00000543642.1_Missense_Mutation_p.R29G|PRRG1_ENST00000378628.4_Missense_Mutation_p.R29G|PRRG1_ENST00000491253.1_Intron	NM_001173489.1	NP_001166960.1	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	29	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R29G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	15						TGAAGAAATAAGACAGGGCAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	X											56.0	54.0	54.0					X																	37285167		2202	4299	6501	37170088	SO:0001583	missense	5638			AF009242	CCDS14239.1, CCDS55397.1	Xp21.1	2010-08-13	2004-05-27		ENSG00000130962	ENSG00000130962			9469	protein-coding gene	gene with protein product		604428	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 1"""			9256434	Standard	NM_000950		Approved	PRGP1	uc004ddo.3	O14668	OTTHUMG00000021360	ENST00000542554.1:c.85A>G	X.37:g.37285167A>G	ENSP00000444278:p.Arg29Gly	Somatic		Capture	Illumina GAIIx	4	37170088	B2R7A3|C9JXL7|D3DWA9|Q5JT66	Missense_Mutation	SNP	ENST00000542554.1	37	CCDS14239.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851868	0.51270	.	.	ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000250349	ENST00000378628;ENST00000466533;ENST00000542554;ENST00000543642;ENST00000484460;ENST00000449135;ENST00000463135;ENST00000465127	D;D;D;D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51	5.18	5.18	0.71444	Gamma-carboxyglutamic acid-rich (GLA) domain (5);Coagulation factor, subgroup, Gla domain (1);	0.317193	0.36409	N	0.002611	D	0.98261	0.9424	M	0.72118	2.19	0.28709	N	0.903655	B	0.32862	0.387	B	0.40256	0.324	D	0.97641	1.0148	10	0.72032	D	0.01	-13.8288	11.9146	0.52757	1.0:0.0:0.0:0.0	.	29	O14668	TMG1_HUMAN	G	29	ENSP00000367894:R29G;ENSP00000418384:R29G;ENSP00000444278:R29G;ENSP00000443271:R29G;ENSP00000420353:R29G;ENSP00000390332:R29G;ENSP00000419999:R29G;ENSP00000417050:R29G	ENSP00000367894:R29G	R	+	1	2	RP5-972B16.2;PRRG1	37170088	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.678000	0.61641	1.716000	0.51395	0.486000	0.48141	AGA		0.333	PRRG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056228.2	NM_000950		Missense_Mutation
CAP1	10487	genome.wustl.edu	37	1	40530176	40530176	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr1:40530176A>G	ENST00000372797.3	+	6	1030	c.469A>G	c.(469-471)Atg>Gtg	p.M157V	CAP1_ENST00000372792.2_Missense_Mutation_p.M157V|CAP1_ENST00000372805.3_Missense_Mutation_p.M157V|CAP1_ENST00000340450.3_Missense_Mutation_p.M156V|CAP1_ENST00000372802.1_Missense_Mutation_p.M156V|CAP1_ENST00000372798.1_Missense_Mutation_p.M156V	NM_001105530.1|NM_006367.3	NP_001099000|NP_006358	Q13114	TRAF3_HUMAN	CAP, adenylate cyclase-associated protein 1 (yeast)	308					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M157V(1)		endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12	Lung NSC(20;5.03e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;4.63e-18)|Epithelial(16;1.27e-16)|all cancers(16;2.3e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTGAAAGAAATGAATGATGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	106.0	108.0					1																	40530176		1864	4101	5965	40302763	SO:0001583	missense	10487			L12168	CCDS41309.1	1p34.3	2010-07-13			ENSG00000131236	ENSG00000131236			20040	protein-coding gene	gene with protein product						1406678, 8761950	Standard	NM_006367		Approved	CAP	uc001cey.4	Q01518	OTTHUMG00000004493	ENST00000372797.3:c.469A>G	1.37:g.40530176A>G	ENSP00000361883:p.Met157Val	Somatic		Capture	Illumina GAIIx	4	40302763	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	ENST00000372797.3	37	CCDS41309.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972690	0.74246	.	.	ENSG00000131236	ENST00000372797;ENST00000372802;ENST00000449311;ENST00000421589;ENST00000414281;ENST00000420216;ENST00000372792;ENST00000538246;ENST00000372798;ENST00000340450;ENST00000372805;ENST00000435719;ENST00000427843;ENST00000424977;ENST00000417287	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.15	4.0	0.46444	Adenylate cyclase-associated CAP, N-terminal (2);	0.035871	0.85682	D	0.000000	T	0.37571	0.1008	M	0.83223	2.63	0.80722	D	1	D;D	0.76494	0.999;0.994	D;D	0.72075	0.976;0.966	T	0.19257	-1.0311	10	0.87932	D	0	-13.4392	10.5559	0.45117	0.8553:0.0:0.0:0.1447	.	104;157	E7ENY9;Q01518	.;CAP1_HUMAN	V	157;156;157;157;157;157;157;134;156;156;157;156;157;157;157	ENSP00000361883:M157V;ENSP00000361888:M156V;ENSP00000398475:M157V;ENSP00000403198:M157V;ENSP00000408561:M157V;ENSP00000410586:M157V;ENSP00000361878:M157V;ENSP00000361884:M156V;ENSP00000344832:M156V;ENSP00000361891:M157V;ENSP00000412859:M156V;ENSP00000413656:M157V;ENSP00000413383:M157V;ENSP00000400943:M157V	ENSP00000344832:M156V	M	+	1	0	CAP1	40302763	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.312000	0.59154	0.786000	0.33708	-0.341000	0.08007	ATG		0.418	CAP1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000013109.1	NM_006367		Missense_Mutation
LRFN1	57622	genome.wustl.edu	37	19	39804613	39804613	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr19:39804613T>C	ENST00000248668.4	-	1	1363	c.1364A>G	c.(1363-1365)cAg>cGg	p.Q455R	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	455	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.Q407R(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GTACTGAACCTGGTACATGCG	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	70.0	68.0					19																	39804613		2073	4234	6307	44496453	SO:0001583	missense	57622			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1364A>G	19.37:g.39804613T>C	ENSP00000248668:p.Gln455Arg	Somatic		Capture	Illumina GAIIx	4	44496453	Q8TBS9	Missense_Mutation	SNP	ENST00000248668.4	37	CCDS46071.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	19.46	3.832330	0.71258	.	.	ENSG00000128011	ENST00000248668	T	0.55588	0.51	4.53	4.53	0.55603	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42420	D	0.000705	T	0.68924	0.3054	M	0.83223	2.63	0.58432	D	0.999998	P	0.42649	0.786	P	0.55222	0.771	T	0.73500	-0.3963	10	0.66056	D	0.02	.	11.8469	0.52389	0.0:0.0:0.0:1.0	.	455	Q9P244	LRFN1_HUMAN	R	455	ENSP00000248668:Q455R	ENSP00000248668:Q455R	Q	-	2	0	LRFN1	44496453	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.826000	0.86716	1.905000	0.55150	0.533000	0.62120	CAG		0.652	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862		Missense_Mutation
MAP4	4134	genome.wustl.edu	37	3	48019417	48019417	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr3:48019417G>A	ENST00000360240.6	-	3	748	c.230C>T	c.(229-231)cCa>cTa	p.P77L	MAP4_ENST00000426837.2_Missense_Mutation_p.P94L|MAP4_ENST00000434267.1_Missense_Mutation_p.P77L|MAP4_ENST00000395734.3_Missense_Mutation_p.P77L|MAP4_ENST00000439356.1_Missense_Mutation_p.P77L|MAP4_ENST00000383737.4_Missense_Mutation_p.P77L	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	77					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.P77L(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TTTAGAAGATGGAGTATCTGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											202.0	181.0	188.0					3																	48019417		2203	4300	6503	47994421	SO:0001583	missense	4134				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.230C>T	3.37:g.48019417G>A	ENSP00000353375:p.Pro77Leu	Somatic		Capture	Illumina GAIIx	4	47994421	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	CCDS33750.1	SNP	47	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.61|17.61	3.431167|3.431167	0.62844|0.62844	.|.	.|.	ENSG00000047849|ENSG00000047849	ENST00000423088|ENST00000383737;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000434267;ENST00000439356	.|T;T;T;T;T;T	.|0.45276	.|0.97;0.97;0.9;0.97;1.38;1.38	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|.	.|.	.|.	.|.	T|T	0.57446|0.57446	0.2054|0.2054	M|M	0.62723|0.62723	1.935|1.935	0.33518|0.33518	D|D	0.59196|0.59196	.|P;D;D	.|0.63046	.|0.675;0.992;0.961	.|B;P;P	.|0.59948	.|0.295;0.866;0.617	T|T	0.69079|0.69079	-0.5240|-0.5240	5|9	.|0.87932	.|D	.|0	-0.0368|-0.0368	13.5529|13.5529	0.61743|0.61743	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|77;77;77	.|Q86V26;P27816-6;P27816	.|.;.;MAP4_HUMAN	Y|L	84|77;77;94;77;77;77	.|ENSP00000373243:P77L;ENSP00000379083:P77L;ENSP00000407602:P94L;ENSP00000353375:P77L;ENSP00000402767:P77L;ENSP00000397414:P77L	.|ENSP00000353375:P77L	H|P	-|-	1|2	0|0	MAP4|MAP4	47994421|47994421	0.947000|0.947000	0.32204|0.32204	0.977000|0.977000	0.42913|0.42913	0.888000|0.888000	0.51559|0.51559	3.770000|3.770000	0.55310|0.55310	2.651000|2.651000	0.90000|0.90000	0.557000|0.557000	0.71058|0.71058	CAT|CCA		0.403	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		Missense_Mutation
KRT73	319101	genome.wustl.edu	37	12	53007473	53007473	+	Splice_Site	SNP	T	T	G			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr12:53007473T>G	ENST00000305748.3	-	5	1017	c.983A>C	c.(982-984)aAg>aCg	p.K328T	RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000551089.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	328	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.K328T(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CGGCCTCACCTTGGTCTGGTA	0.602																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	75.0	78.0					12																	53007473		2203	4300	6503	51293740	SO:0001630	splice_region_variant	319101			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.984+1A>C	12.37:g.53007473T>G		Somatic		Capture	Illumina GAIIx	4	51293740	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	22.6	4.317281	0.81469	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	D;T	0.91740	-2.9;-1.39	4.91	4.91	0.64330	Filament (1);	0.000000	0.52532	D	0.000071	D	0.97399	0.9149	H	0.99299	4.505	0.44627	D	0.997601	D	0.71674	0.998	D	0.72075	0.976	D	0.97103	0.9799	10	0.87932	D	0	.	7.7853	0.29089	0.0:0.1288:0.0:0.8712	.	328	Q86Y46	K2C73_HUMAN	T	328;73	ENSP00000307014:K328T;ENSP00000449081:K73T	ENSP00000307014:K328T	K	-	2	0	KRT73	51293740	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.458000	0.53014	1.986000	0.57962	0.533000	0.62120	AAG		0.602	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	Missense_Mutation	Missense_Mutation
USP34	9736	genome.wustl.edu	37	2	61475758	61475758	+	Silent	SNP	A	A	G			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr2:61475758A>G	ENST00000398571.2	-	49	6358	c.6282T>C	c.(6280-6282)aaT>aaC	p.N2094N		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2094	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.N2094N(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCGTGACCATATTAAATGTGT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	2											106.0	103.0	104.0					2																	61475758		1850	4097	5947	61329262	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6282T>C	2.37:g.61475758A>G		Somatic		Capture	Illumina GAIIx	4	61329262	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1	SNP	16	WashU																																																																																				0.333	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			Silent
AURKC	6795	genome.wustl.edu	37	19	57744900	57744900	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr19:57744900G>C	ENST00000302804.7	+	5	694	c.508G>C	c.(508-510)Gag>Cag	p.E170Q	AURKC_ENST00000598785.1_Missense_Mutation_p.E136Q|AURKC_ENST00000415300.2_Missense_Mutation_p.E151Q|AURKC_ENST00000448930.1_Missense_Mutation_p.E136Q|AURKC_ENST00000599062.1_Missense_Mutation_p.E167Q	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.E136Q(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		TATTAAGCCAGAGAACCTGCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											120.0	113.0	115.0					19																	57744900		2203	4300	6503	62436712	SO:0001583	missense	6795				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.508G>C	19.37:g.57744900G>C	ENSP00000302898:p.Glu170Gln	Somatic		Capture	Illumina GAIIx	4	62436712	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	CCDS33128.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160809	0.78226	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.10099	2.91;2.91;2.91	3.95	3.95	0.45737	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.30386	0.0763	M	0.68728	2.09	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.985;0.999	T	0.02829	-1.1105	10	0.87932	D	0	-28.9392	14.3221	0.66493	0.0:0.0:1.0:0.0	.	167;170;151	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	Q	151;136;170	ENSP00000407162:E151Q;ENSP00000406798:E136Q;ENSP00000302898:E170Q	ENSP00000302898:E170Q	E	+	1	0	AURKC	62436712	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	8.110000	0.89562	2.501000	0.84356	0.561000	0.74099	GAG		0.527	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160		Missense_Mutation
CCDC88B	283234	genome.wustl.edu	37	11	64120233	64120233	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr11:64120233C>T	ENST00000356786.5	+	20	3418	c.3374C>T	c.(3373-3375)gCc>gTc	p.A1125V	CCDC88B_ENST00000359902.2_Missense_Mutation_p.A277V|CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1125						membrane (GO:0016020)		p.A1125V(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAGCTGCAGGCCCAGCGGGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	11											27.0	31.0	30.0					11																	64120233		2199	4287	6486	63876809	SO:0001583	missense	283234			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.3374C>T	11.37:g.64120233C>T	ENSP00000349238:p.Ala1125Val	Somatic		Capture	Illumina GAIIx	4	63876809	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	c	17.58	3.425410	0.62733	.	.	ENSG00000168071	ENST00000356786;ENST00000359902	T;T	0.48201	1.82;0.82	3.95	3.95	0.45737	.	.	.	.	.	T	0.57695	0.2071	L	0.51422	1.61	0.80722	D	1	D;D;D	0.67145	0.996;0.991;0.996	D;P;D	0.63381	0.914;0.86;0.914	T	0.59380	-0.7465	9	0.56958	D	0.05	.	11.6616	0.51349	0.0:1.0:0.0:0.0	.	1125;261;1125	B2RTU8;A6NC98-5;A6NC98	.;.;CC88B_HUMAN	V	1125;277	ENSP00000349238:A1125V;ENSP00000352974:A277V	ENSP00000349238:A1125V	A	+	2	0	CCDC88B	63876809	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	2.909000	0.48758	2.196000	0.70406	0.462000	0.41574	GCC		0.672	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251		Missense_Mutation
CLEC4F	165530	genome.wustl.edu	37	2	71043821	71043821	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr2:71043821G>C	ENST00000272367.2	-	4	768	c.692C>G	c.(691-693)gCc>gGc	p.A231G	CLEC4F_ENST00000426626.1_Missense_Mutation_p.A231G	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	231					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A231G(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						TTCCAAACTGGCATTCAACAT	0.408																																					Colon(107;10 2157 6841 26035)											1	Substitution - Missense(1)	ovary(1)	2											79.0	77.0	78.0					2																	71043821		2203	4300	6503	70897329	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.692C>G	2.37:g.71043821G>C	ENSP00000272367:p.Ala231Gly	Somatic		Capture	Illumina GAIIx	4	70897329	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	3.764	-0.049016	0.07407	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.42900	0.96;0.96	3.51	0.409	0.16382	.	0.492559	0.15114	N	0.279793	T	0.41282	0.1152	L	0.41236	1.265	0.09310	N	1	D;D	0.67145	0.996;0.996	P;D	0.65443	0.906;0.935	T	0.28332	-1.0047	10	0.17369	T	0.5	.	1.7502	0.02970	0.1232:0.1969:0.4589:0.221	.	231;231	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	G	231	ENSP00000272367:A231G;ENSP00000390581:A231G	ENSP00000272367:A231G	A	-	2	0	CLEC4F	70897329	0.000000	0.05858	0.041000	0.18516	0.054000	0.15201	-0.384000	0.07389	0.069000	0.16605	0.313000	0.20887	GCC		0.408	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535		Missense_Mutation
PGS1	9489	genome.wustl.edu	37	17	76423180	76423180	+	IGR	SNP	C	C	T	rs201985449	byFrequency	TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr17:76423180C>T	ENST00000262764.6	+	0	2201				DNAH17_ENST00000389840.5_Missense_Mutation_p.V4223M|DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000585328.1_Missense_Mutation_p.V4195M	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)	p.V4195M(1)		cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TCGTCCAGCACGGCCTTCACC	0.592													c|||	2	0.000399361	0.0	0.0	5008	,	,		17448	0.0		0.0	False		,,,				2504	0.002				Esophageal Squamous(45;182 1126 10685 43198)											1	Substitution - Missense(1)	ovary(1)	17											31.0	25.0	27.0					17																	76423180		2199	4286	6485	73934775	SO:0001628	intergenic_variant	8632				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			17.37:g.76423180C>T		Somatic		Capture	Illumina GAIIx	4	73934775	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	ENST00000262764.6	37	CCDS42391.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	c	9.963	1.223398	0.22457	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.10099	2.91	4.99	4.03	0.46877	.	0.130940	0.34200	N	0.004162	T	0.08935	0.0221	L	0.28776	0.89	0.41139	D	0.985948	B	0.25007	0.116	B	0.28991	0.097	T	0.21793	-1.0235	10	0.33141	T	0.24	.	9.8872	0.41268	0.0:0.8435:0.0:0.1565	.	4195	E7EUM8	.	M	4195;4223	ENSP00000374490:V4223M	ENSP00000300671:V4195M	V	-	1	0	DNAH17	73934775	0.728000	0.28080	0.980000	0.43619	0.444000	0.32077	1.637000	0.37155	1.118000	0.41863	-0.119000	0.15052	GTG		0.592	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419		Missense_Mutation
RPS6KL1	83694	genome.wustl.edu	37	14	75373786	75373786	+	Silent	SNP	T	T	C			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr14:75373786T>C	ENST00000555647.1	-	12	1868	c.1581A>G	c.(1579-1581)gaA>gaG	p.E527E	RPS6KL1_ENST00000354625.2_Silent_p.E496E|RPS6KL1_ENST00000358328.4_Silent_p.E527E|RPS6KL1_ENST00000557413.1_Silent_p.E527E			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	527	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E527E(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		TGACACCACCTTCTCCCATGC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	14											180.0	175.0	177.0					14																	75373786		2203	4300	6503	74443539	SO:0001819	synonymous_variant	83694			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.1581A>G	14.37:g.75373786T>C		Somatic		Capture	Illumina GAIIx	4	74443539	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Silent	SNP	ENST00000555647.1	37	CCDS9834.2	SNP	56	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.813|8.813	0.935615|0.935615	0.18206|0.18206	.|.	.|.	ENSG00000198208|ENSG00000198208	ENST00000555910|ENST00000553971	.|.	.|.	.|.	4.58|4.58	-5.99|-5.99	0.02213|0.02213	.|.	.|.	.|.	.|.	.|.	T|T	0.36248|0.36248	0.0960|0.0960	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38607|0.38607	-0.9653|-0.9653	4|4	.|.	.|.	.|.	0.4027|0.4027	2.3699|2.3699	0.04328|0.04328	0.1277:0.1629:0.423:0.2864|0.1277:0.1629:0.423:0.2864	.|.	.|.	.|.	.|.	R|G	22|82	.|.	.|.	K|R	-|-	2|1	0|2	RPS6KL1|RPS6KL1	74443539|74443539	0.358000|0.358000	0.24947|0.24947	0.009000|0.009000	0.14445|0.14445	0.934000|0.934000	0.57294|0.57294	-0.377000|-0.377000	0.07456|0.07456	-0.972000|-0.972000	0.03559|0.03559	0.260000|0.260000	0.18958|0.18958	AAG|AGG		0.617	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413732.1			Silent
RNF213	57674	genome.wustl.edu	37	17	78363858	78363858	+	Missense_Mutation	SNP	C	C	T	rs191077627		TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr17:78363858C>T	ENST00000582970.1	+	67	15475	c.15332C>T	c.(15331-15333)cCg>cTg	p.P5111L	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.P5160L|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.P3184L|RNF213_ENST00000427003.3_3'UTR	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	5111					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P3184L(1)|p.P5160Q(1)|p.P3184Q(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GATCTGAGCCCGGAAAATGCT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		20599	0.001		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	lung(2)|ovary(1)	17											99.0	103.0	102.0					17																	78363858		2203	4300	6503	75978453	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.15332C>T	17.37:g.78363858C>T	ENSP00000464087:p.Pro5111Leu	Somatic		Capture	Illumina GAIIx	4	75978453	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	SNP	23	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.48	1.949476	0.34377	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T	0.22336	1.96	5.67	5.67	0.87782	.	0.409242	0.24957	N	0.034250	T	0.23926	0.0579	M	0.70595	2.14	0.32342	N	0.559596	P;P	0.51351	0.944;0.936	B;B	0.36504	0.191;0.226	T	0.47959	-0.9076	10	0.56958	D	0.05	.	14.5968	0.68413	0.1459:0.8541:0.0:0.0	.	5111;3184	D6RI12;Q63HN8	.;RN213_HUMAN	L	5111;5160;3184;461	ENSP00000338218:P3184L	ENSP00000338218:P3184L	P	+	2	0	RNF213	75978453	0.001000	0.12720	0.916000	0.36221	0.061000	0.15899	1.417000	0.34770	2.668000	0.90789	0.655000	0.94253	CCG		0.483	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		Missense_Mutation
EFTUD1	79631	genome.wustl.edu	37	15	82551460	82551460	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr15:82551460T>C	ENST00000268206.7	-	3	296	c.128A>G	c.(127-129)aAt>aGt	p.N43S	EFTUD1_ENST00000359445.3_Intron	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	43	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)	p.N43S(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GATGATTCCATTGCTAGATAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	15											131.0	127.0	128.0					15																	82551460		1826	4081	5907	80338515	SO:0001583	missense	79631			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.128A>G	15.37:g.82551460T>C	ENSP00000268206:p.Asn43Ser	Somatic		Capture	Illumina GAIIx	4	80338515	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	ENST00000268206.7	37	CCDS42071.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490244	0.64074	.	.	ENSG00000140598	ENST00000268206	T	0.75821	-0.97	3.62	3.62	0.41486	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.48286	U	0.000196	T	0.82042	0.4951	L	0.58302	1.8	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.83123	-0.0117	10	0.59425	D	0.04	-0.0361	12.0648	0.53581	0.0:0.0:0.0:1.0	.	43	Q7Z2Z2	ETUD1_HUMAN	S	43	ENSP00000268206:N43S	ENSP00000268206:N43S	N	-	2	0	EFTUD1	80338515	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.074000	0.76791	1.531000	0.49152	0.358000	0.22013	AAT		0.338	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	NM_024580		Missense_Mutation
GBP7	388646	genome.wustl.edu	37	1	89637595	89637595	+	Silent	SNP	T	T	A			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr1:89637595T>A	ENST00000294671.2	-	2	162	c.24A>T	c.(22-24)ccA>ccT	p.P8P		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	8	GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P8P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		ACACTGGGCCTGGCATGTGGA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	1											124.0	122.0	122.0					1																	89637595		2203	4300	6503	89410183	SO:0001819	synonymous_variant	388646			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.24A>T	1.37:g.89637595T>A		Somatic		Capture	Illumina GAIIx	4	89410183		Silent	SNP	ENST00000294671.2	37	CCDS720.1	SNP	55	WashU																																																																																				0.478	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398		Silent
PCDH19	57526	genome.wustl.edu	37	X	99551803	99551803	+	Silent	SNP	G	G	A			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chrX:99551803G>A	ENST00000373034.4	-	6	4594	c.2919C>T	c.(2917-2919)ccC>ccT	p.P973P	PCDH19_ENST00000255531.7_Silent_p.P926P|PCDH19_ENST00000420881.2_Silent_p.P925P|PCDH19_ENST00000464981.1_5'Flank	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	973					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P973P(1)|p.P426P(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TGGGGTTCCGGGGCATCCAGC	0.493																																																2	Substitution - coding silent(2)	ovary(2)	X											62.0	60.0	61.0					X																	99551803		2062	4192	6254	99438459	SO:0001819	synonymous_variant	57526			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2919C>T	X.37:g.99551803G>A		Somatic		Capture	Illumina GAIIx	4	99438459	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	CCDS55462.1	SNP	43	WashU																																																																																				0.493	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766		Silent
BCAP29	55973	genome.wustl.edu	37	7	107221265	107221265	+	Silent	SNP	A	A	T			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr7:107221265A>T	ENST00000005259.4	+	2	387	c.48A>T	c.(46-48)atA>atT	p.I16I	BCAP29_ENST00000379119.2_Silent_p.I16I|RP4-593H12.1_ENST00000610269.1_RNA|BCAP29_ENST00000465919.1_Intron|BCAP29_ENST00000494086.1_Intron|BCAP29_ENST00000445771.2_Silent_p.I16I|BCAP29_ENST00000379117.2_Silent_p.I16I	NM_018844.3	NP_061332.2	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein 29	16					apoptotic process (GO:0006915)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|osteoblast differentiation (GO:0001649)|protein localization to endoplasmic reticulum exit site (GO:0070973)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.I16I(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	14						ATGCCGAAATAGGACTCATTT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	7											103.0	92.0	96.0					7																	107221265		2203	4300	6503	107008501	SO:0001819	synonymous_variant	55973				CCDS34730.1, CCDS34731.1	7q22.3	2012-09-20			ENSG00000075790	ENSG00000075790			24131	protein-coding gene	gene with protein product						12477932	Standard	NM_018844		Approved	BAP29, DKFZp686M2086	uc011kma.1	Q9UHQ4	OTTHUMG00000154770	ENST00000005259.4:c.48A>T	7.37:g.107221265A>T		Somatic		Capture	Illumina GAIIx	4	107008501	G5E9L4|O95003	Silent	SNP	ENST00000005259.4	37	CCDS34731.1	SNP	15	WashU																																																																																				0.358	BCAP29-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337011.2	NM_018844		Silent
COL4A6	1288	genome.wustl.edu	37	X	107462959	107462959	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0980-01	TCGA-24-0980-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chrX:107462959A>T	ENST00000372216.4	-	5	396	c.296T>A	c.(295-297)gTt>gAt	p.V99D	COL4A6_ENST00000334504.7_Missense_Mutation_p.V98D|COL4A6_ENST00000394872.2_Intron|COL4A6_ENST00000538570.1_Missense_Mutation_p.V98D|COL4A6_ENST00000545689.1_Missense_Mutation_p.V98D	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	99	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.V98D(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AAAGCCAGGAACTCCCATGGG	0.428									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - Missense(1)	ovary(1)	X											180.0	157.0	165.0					X																	107462959		2203	4300	6503	107349615	SO:0001583	missense	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.296T>A	X.37:g.107462959A>T	ENSP00000361290:p.Val99Asp	Somatic		Capture	Illumina GAIIx	4	107349615	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	11.64	1.699454	0.30142	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	4.93	3.76	0.43208	.	.	.	.	.	D	0.93044	0.7786	L	0.41415	1.275	0.52099	D	0.999942	D;D;D;D	0.61697	0.971;0.99;0.977;0.971	P;P;P;P	0.62298	0.839;0.839;0.9;0.839	D	0.91378	0.5125	9	0.54805	T	0.06	.	7.8336	0.29358	0.8989:0.0:0.1011:0.0	.	98;98;99;98	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	D	99;98;98;98;98	ENSP00000361290:V99D;ENSP00000334733:V98D;ENSP00000443707:V98D;ENSP00000445236:V98D	ENSP00000334733:V98D	V	-	2	0	COL4A6	107349615	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.546000	0.60705	0.772000	0.33382	0.417000	0.27973	GTT		0.428	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			Missense_Mutation
ATM	472	genome.wustl.edu	37	11	108202174	108202174	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr11:108202174G>A	ENST00000452508.2	+	52	7708	c.7519G>A	c.(7519-7521)Gac>Aac	p.D2507N	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.D2507N			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2507	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATGGTAGAGAGACGGAATGAA	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Unknown(1)	ovary(1)	11	GRCh37	CD004352	ATM	D							58.0	57.0	57.0					11																	108202174		2201	4298	6499	107707384	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7519G>A	11.37:g.108202174G>A	ENSP00000388058:p.Asp2507Asn	Somatic		Capture	Illumina GAIIx	4	107707384	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	9.201	1.028408	0.19512	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.81499	-1.5;-1.5	5.43	0.194	0.15143	PIK-related kinase (1);Armadillo-type fold (1);	0.649988	0.17397	N	0.175692	T	0.54255	0.1847	N	0.17474	0.49	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.40117	-0.9580	10	0.02654	T	1	.	2.4914	0.04611	0.2822:0.13:0.4697:0.1181	.	2507	Q13315	ATM_HUMAN	N	2507	ENSP00000278616:D2507N;ENSP00000388058:D2507N	ENSP00000278616:D2507N	D	+	1	0	ATM	107707384	0.885000	0.30320	0.336000	0.25522	0.966000	0.64601	2.410000	0.44592	-0.005000	0.14395	0.467000	0.42956	GAC		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		Missense_Mutation
COL4A5	1287	genome.wustl.edu	37	X	107930810	107930810	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chrX:107930810C>T	ENST00000361603.2	+	47	4640	c.4396C>T	c.(4396-4398)Cgc>Tgc	p.R1466C	COL4A5_ENST00000328300.6_Missense_Mutation_p.R1472C	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1466	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.R1466C(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TCTTATTACACGCCACAGCCA	0.522									Alport syndrome with Diffuse Leiomyomatosis																																							2	Substitution - Missense(2)	ovary(1)|endometrium(1)	X											141.0	126.0	131.0					X																	107930810		2203	4300	6503	107817466	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4396C>T	X.37:g.107930810C>T	ENSP00000354505:p.Arg1466Cys	Somatic		Capture	Illumina GAIIx	4	107817466	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596920	0.87055	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94650	-3.48;-3.48	5.58	5.58	0.84498	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.98216	0.9410	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.99441	1.0938	10	0.87932	D	0	.	18.6316	0.91361	0.0:1.0:0.0:0.0	.	1469;1466	E7EVY4;P29400	.;CO4A5_HUMAN	C	1472;1466;1472	ENSP00000331902:R1472C;ENSP00000354505:R1466C	ENSP00000331902:R1472C	R	+	1	0	COL4A5	107817466	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.805000	0.62561	2.343000	0.79666	0.600000	0.82982	CGC		0.522	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			Missense_Mutation
PHLDB2	90102	genome.wustl.edu	37	3	111672808	111672808	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr3:111672808G>A	ENST00000431670.2	+	12	3215	c.2804G>A	c.(2803-2805)tGt>tAt	p.C935Y	PHLDB2_ENST00000481953.1_Missense_Mutation_p.C892Y|PHLDB2_ENST00000495180.1_Missense_Mutation_p.C426Y|PHLDB2_ENST00000393925.3_Missense_Mutation_p.C935Y|PHLDB2_ENST00000412622.1_Missense_Mutation_p.C892Y|PHLDB2_ENST00000393923.3_Missense_Mutation_p.C919Y	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	935						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.C892Y(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						AGTAACAGCTGTGGAAGTGTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											92.0	77.0	82.0					3																	111672808		2203	4300	6503	113155498	SO:0001583	missense	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2804G>A	3.37:g.111672808G>A	ENSP00000405405:p.Cys935Tyr	Somatic		Capture	Illumina GAIIx	4	113155498	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529950	0.85706	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.41065	1.37;1.22;1.38;1.35;1.22;1.38;1.01	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.63640	0.2528	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	0.982;0.999;1.0;1.0	P;D;D;D	0.87578	0.682;0.99;0.998;0.997	T	0.63892	-0.6534	10	0.56958	D	0.05	.	16.5746	0.84633	0.0:0.0:1.0:0.0	.	426;935;892;919	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	Y	919;935;892;892;935;892;426	ENSP00000377500:C919Y;ENSP00000405405:C935Y;ENSP00000405292:C892Y;ENSP00000418296:C892Y;ENSP00000377502:C935Y;ENSP00000418319:C892Y;ENSP00000420303:C426Y	ENSP00000377500:C919Y	C	+	2	0	PHLDB2	113155498	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.796000	0.85898	2.721000	0.93114	0.655000	0.94253	TGT		0.542	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753		Missense_Mutation
OR8G3P	387815	genome.wustl.edu	37	11	124086295	124086295	+	IGR	SNP	T	T	G			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr11:124086295T>G								OR10D3 (29343 upstream) : OR8G1 (34127 downstream)																							CTGTGTTTTATACTACTATTG	0.448																																																0			11																																								123591505	SO:0001628	intergenic_variant																																11.37:g.124086295T>G		Somatic		Capture	Illumina GAIIx	4	123591505		Nonsense_Mutation	SNP		37		SNP	49	WashU																																																																																			0	0.448									Nonsense_Mutation
POTEJ	653781	genome.wustl.edu	37	2	131414332	131414332	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0980-01	TCGA-24-0980-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr2:131414332G>T	ENST00000409602.1	+	15	2051	c.1999G>T	c.(1999-2001)Gat>Tat	p.D667Y		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	667	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						CATGGATGATGATACCGCTGT	0.473																																																0			2																																								131130802	SO:0001583	missense	653781				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.1999G>T	2.37:g.131414332G>T	ENSP00000387176:p.Asp667Tyr	Somatic		Capture	Illumina GAIIx	4	131130802		Missense_Mutation	SNP	ENST00000409602.1	37	CCDS59432.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	.	13.98	2.397587	0.42512	.	.	ENSG00000222038	ENST00000409602	D	0.97642	-4.47	0.736	0.736	0.18307	.	.	.	.	.	D	0.95778	0.8626	L	0.56396	1.775	0.27759	N	0.94389	.	.	.	.	.	.	D	0.91589	0.5285	7	0.87932	D	0	.	6.9195	0.24380	1.0E-4:0.0:0.9999:0.0	.	.	.	.	Y	667	ENSP00000387176:D667Y	ENSP00000387176:D667Y	D	+	1	0	POTEJ	131130802	1.000000	0.71417	0.129000	0.21949	0.102000	0.19082	6.506000	0.73712	0.132000	0.18615	0.134000	0.15878	GAT		0.473	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333665.1	XM_929706		Missense_Mutation
PCDHA11	56138	genome.wustl.edu	37	5	140249861	140249861	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr5:140249861C>G	ENST00000398640.2	+	1	1173	c.1173C>G	c.(1171-1173)caC>caG	p.H391Q	PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	391	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACGCCCCACGTTCCCTTCA	0.592																																																0			5											124.0	112.0	116.0					5																	140249861		2203	4300	6503	140230045	SO:0001583	missense	56138			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1173C>G	5.37:g.140249861C>G	ENSP00000381636:p.His391Gln	Somatic		Capture	Illumina GAIIx	4	140230045	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	0.050	-1.253219	0.01457	.	.	ENSG00000249158	ENST00000398640	T	0.50001	0.76	5.7	-9.79	0.00494	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.24509	0.0594	L	0.28504	0.86	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.20384	0.029;0.006	T	0.23119	-1.0197	9	0.41790	T	0.15	.	0.6599	0.00841	0.2322:0.26:0.1528:0.3549	.	391;391	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	Q	391	ENSP00000381636:H391Q	ENSP00000381636:H391Q	H	+	3	2	PCDHA11	140230045	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-7.260000	0.00040	-1.647000	0.01511	-0.257000	0.10917	CAC		0.592	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		Missense_Mutation
OR2A5	393046	genome.wustl.edu	37	7	143747797	143747797	+	Silent	SNP	C	C	A			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr7:143747797C>A	ENST00000408906.2	+	1	337	c.303C>A	c.(301-303)acC>acA	p.T101T		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T101T(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					CAATGCAGACCTTTTTATACA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	7											151.0	149.0	150.0					7																	143747797		2106	4252	6358	143378730	SO:0001819	synonymous_variant	393046			U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.303C>A	7.37:g.143747797C>A		Somatic		Capture	Illumina GAIIx	4	143378730	B9EGX2|O43885|O43888	Silent	SNP	ENST00000408906.2	37	CCDS43668.1	SNP	24	WashU																																																																																				0.428	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1			Silent
ANKRD35	148741	genome.wustl.edu	37	1	145561130	145561130	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr1:145561130C>G	ENST00000355594.4	+	10	905	c.818C>G	c.(817-819)cCt>cGt	p.P273R	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	273								p.P273R(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGTTCTCCTCCTAAGAGCTCA	0.547																																					Melanoma(9;127 754 22988 51047)											1	Substitution - Missense(1)	ovary(1)	1											38.0	45.0	42.0					1																	145561130		2203	4300	6503	144272487	SO:0001583	missense	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.818C>G	1.37:g.145561130C>G	ENSP00000347802:p.Pro273Arg	Somatic		Capture	Illumina GAIIx	4	144272487	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	0.410	-0.913983	0.02415	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.68479	-0.33	5.77	4.86	0.63082	.	0.119641	0.38381	N	0.001719	T	0.46737	0.1408	L	0.29908	0.895	0.39258	D	0.964157	P	0.41366	0.747	B	0.43508	0.422	T	0.55373	-0.8151	10	0.52906	T	0.07	-6.0623	13.2862	0.60245	0.0:0.8414:0.1586:0.0	.	273	Q8N283	ANR35_HUMAN	R	182;273	ENSP00000347802:P273R	ENSP00000347802:P273R	P	+	2	0	ANKRD35	144272487	0.079000	0.21365	0.186000	0.23195	0.084000	0.17831	0.432000	0.21461	1.575000	0.49775	-0.150000	0.13652	CCT		0.547	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698		Missense_Mutation
NSD1	64324	genome.wustl.edu	37	5	176687050	176687050	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr5:176687050C>A	ENST00000439151.2	+	14	5072	c.5027C>A	c.(5026-5028)gCt>gAt	p.A1676D	NSD1_ENST00000354179.4_Missense_Mutation_p.A1407D|NSD1_ENST00000361032.4_Missense_Mutation_p.A1573D|NSD1_ENST00000347982.4_Missense_Mutation_p.A1407D	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1676					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A1676D(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTTTGCCTGGCTGCTGGGTCA	0.483			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	1	Substitution - Missense(1)	ovary(1)	5											125.0	115.0	118.0					5																	176687050		2203	4300	6503	176619656	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5027C>A	5.37:g.176687050C>A	ENSP00000395929:p.Ala1676Asp	Somatic		Capture	Illumina GAIIx	4	176619656	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	34	5.316698	0.95682	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93	5.51	5.51	0.81932	Zinc finger, PHD-type (1);	0.000000	0.64402	D	0.000005	D	0.97651	0.9230	M	0.75085	2.285	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.996;0.986	D	0.97938	1.0324	10	0.72032	D	0.01	.	19.783	0.96424	0.0:1.0:0.0:0.0	.	1407;1573;1676	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	D	1407;1676;1407;1573	ENSP00000346111:A1407D;ENSP00000395929:A1676D;ENSP00000343209:A1407D;ENSP00000354310:A1573D	ENSP00000343209:A1407D	A	+	2	0	NSD1	176619656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.752000	0.94435	0.467000	0.42956	GCT		0.483	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		Missense_Mutation
ZNF454	285676	genome.wustl.edu	37	5	178391968	178391968	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0980-01	TCGA-24-0980-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr5:178391968C>G	ENST00000320129.3	+	5	866	c.563C>G	c.(562-564)tCt>tGt	p.S188C	ZNF454_ENST00000519564.1_Missense_Mutation_p.S188C	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S188C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		AAAGTCTTCTCTAAGAGTTCA	0.343																																																1	Substitution - Missense(1)	ovary(1)	5											49.0	51.0	50.0					5																	178391968		2203	4300	6503	178324574	SO:0001583	missense	285676			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.563C>G	5.37:g.178391968C>G	ENSP00000326249:p.Ser188Cys	Somatic		Capture	Illumina GAIIx	4	178324574	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	CCDS4441.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	8.941	0.965922	0.18659	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.36878	1.23;1.23	4.61	2.69	0.31865	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.736837	0.11296	N	0.578702	T	0.25121	0.0610	L	0.41124	1.26	0.20873	N	0.999839	P	0.35456	0.502	B	0.32762	0.152	T	0.27806	-1.0063	10	0.72032	D	0.01	-8.6688	2.9809	0.05953	0.1805:0.5452:0.1749:0.0993	.	188	Q8N9F8	ZN454_HUMAN	C	188	ENSP00000326249:S188C;ENSP00000430354:S188C	ENSP00000326249:S188C	S	+	2	0	ZNF454	178324574	0.000000	0.05858	0.992000	0.48379	0.902000	0.53008	0.687000	0.25407	1.300000	0.44818	0.555000	0.69702	TCT		0.343	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179395464	179395464	+	Missense_Mutation	SNP	T	T	A			TCGA-24-0980-01	TCGA-24-0980-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr2:179395464T>A	ENST00000591111.1	-	308	101179	c.100955A>T	c.(100954-100956)aAa>aTa	p.K33652I	TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K26420I|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K32725I|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K35293I|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K26353I|TTN_ENST00000460472.2_Missense_Mutation_p.K26228I|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000604571.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33652	Ig-like 148.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K32723I(1)|p.K26228I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTTCTGCTTTCAGGAACTG	0.463																																																2	Substitution - Missense(2)	ovary(2)	2											106.0	101.0	102.0					2																	179395464		1890	4108	5998	179103710	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100955A>T	2.37:g.179395464T>A	ENSP00000465570:p.Lys33652Ile	Somatic		Capture	Illumina GAIIx	4	179103710	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	15.61	2.885000	0.51908	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	4.99	4.99	0.66335	Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49949	0.1587	L	0.60455	1.87	0.36266	D	0.854834	D;D;D;D	0.61080	0.989;0.989;0.989;0.985	P;P;P;D	0.65323	0.892;0.892;0.892;0.934	T	0.62637	-0.6812	9	0.87932	D	0	.	14.7021	0.69162	0.0:0.0:0.0:1.0	.	26228;26353;26420;33652	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	32725;26228;26420;26353;26225	ENSP00000343764:K32725I;ENSP00000434586:K26228I;ENSP00000340554:K26420I;ENSP00000352154:K26353I	ENSP00000340554:K26420I	K	-	2	0	TTN	179103710	1.000000	0.71417	0.991000	0.47740	0.758000	0.43043	2.476000	0.45171	1.882000	0.54519	0.374000	0.22700	AAA		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Nonsense_Mutation
SLC45A3	85414	genome.wustl.edu	37	1	205631993	205631993	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr1:205631993G>A	ENST00000367145.3	-	3	1221	c.926C>T	c.(925-927)cCg>cTg	p.P309L	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	309					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.P309L(1)	SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			CTCGGTGCCCGGCTCAGCTCT	0.637			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																		Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	1	Substitution - Missense(1)	ovary(1)	1											39.0	42.0	41.0					1																	205631993		2203	4300	6503	203898616	SO:0001583	missense	85414			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.926C>T	1.37:g.205631993G>A	ENSP00000356113:p.Pro309Leu	Somatic		Capture	Illumina GAIIx	4	203898616	A8K2U9	Missense_Mutation	SNP	ENST00000367145.3	37	CCDS1458.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109833	0.37242	.	.	ENSG00000158715	ENST00000367145	D	0.89939	-2.59	5.13	4.21	0.49690	Major facilitator superfamily domain, general substrate transporter (1);	0.050463	0.85682	N	0.000000	D	0.91707	0.7378	L	0.61218	1.895	0.54753	D	0.999987	D;D	0.71674	0.998;0.998	P;P	0.57204	0.815;0.815	D	0.89958	0.4084	10	0.38643	T	0.18	-4.63	16.3775	0.83410	0.0716:0.0:0.9284:0.0	.	309;309	A8K2U9;Q96JT2	.;S45A3_HUMAN	L	309	ENSP00000356113:P309L	ENSP00000356113:P309L	P	-	2	0	SLC45A3	203898616	1.000000	0.71417	0.996000	0.52242	0.128000	0.20619	5.398000	0.66308	0.572000	0.29383	-0.797000	0.03246	CCG		0.637	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090619.1	NM_033102		Missense_Mutation
Unknown	0	genome.wustl.edu	37	17	0	0	+	IGR	DEL	---	---	TT			TCGA-24-0980-01	TCGA-24-0980-10	-	-	-	T	-	-	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr17:0del---								None (None upstream) : AC108004.5 (4960 downstream)																							AAGCTTCTCA	0.52																																																0			17																																								7519158	SO:0001628	intergenic_variant	7157																															17.37:g.0del---		Somatic		Capture	Illumina GAIIx	4	7519156		Indel	Indel		37		Indel	48	WashU																																																																																			0	0.520									Indel
FAIM2	23017	genome.wustl.edu	37	12	50272394	50272394	+	Intron	SNP	T	T	C	rs370826453		TCGA-24-0980-01	TCGA-24-0980-10	T	T	C	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr12:50272394T>C	ENST00000320634.3	-	12	896				FAIM2_ENST00000550890.1_Intron	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2						apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						tgtgcatgtgtatgtgtgcat	0.388																																																0			12																																								48558661	SO:0001627	intron_variant				AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.802-7958A>G	12.37:g.50272394T>C		Somatic		Capture	Illumina GAIIx	Phase_III	48558661	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Missense_Mutation	SNP	ENST00000320634.3	37	CCDS8791.1	SNP	57	WashU																																																																																				0.388	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1	NM_012306		Missense_Mutation
GPX6	257202	genome.wustl.edu	37	6	28472134	28472134	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0980-01	TCGA-24-0980-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr6:28472134G>C	ENST00000361902.1	-	5	650	c.601C>G	c.(601-603)Cag>Gag	p.Q201E	GPX6_ENST00000474923.1_Silent_p.T167T|GPX6_ENST00000483058.1_5'Flank	NM_182701.1	NP_874360.1	P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	201					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.Q201E(1)		NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	ACTGGAGCCTGGTGGAACCAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											142.0	134.0	136.0					6																	28472134		2022	4216	6238	28580113	SO:0001583	missense	257202				CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000361902.1:c.601C>G	6.37:g.28472134G>C	ENSP00000354581:p.Gln201Glu	Somatic		Capture	Illumina GAIIx	PhaseIII	28580113	Q4PJ17	Missense_Mutation	SNP	ENST00000361902.1	37	CCDS43432.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255435	0.22965	.	.	ENSG00000198704	ENST00000361902	T	0.03663	3.85	4.4	-4.43	0.03568	Thioredoxin-like fold (2);	1.096880	0.06846	N	0.796470	T	0.00967	0.0032	L	0.28608	0.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43523	-0.9386	10	0.25751	T	0.34	.	12.1185	0.53878	0.0:0.1012:0.237:0.6618	.	201	P59796	GPX6_HUMAN	E	201	ENSP00000354581:Q201E	ENSP00000354581:Q201E	Q	-	1	0	GPX6	28580113	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.784000	0.04633	-0.953000	0.03645	-0.169000	0.13324	CAG		0.512	GPX6-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000104340.1			Missense_Mutation
Unknown	0	genome.wustl.edu	37	2	162138424	162138425	+	IGR	INS	-	-	G	rs370453272|rs77778779		TCGA-24-0980-01	TCGA-24-0980-10	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-0980-01	TCGA-24-0980-10	g.chr2:162138424_162138425insG								AC009299.2 (27245 upstream) : PSMD14 (26123 downstream)																							cacccccagctctcggggagtc	0.545																																																0			2																																								161846671	SO:0001628	intergenic_variant	728220																															2.37:g.162138424_162138425insG		Somatic		Capture	Illumina GAIIx	PhaseIII	161846670		Frame_Shift_Ins	INS		37		INS	54	WashU																																																																																			0	0.545									Frame_Shift_Ins
