#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
TRPM5	29850	genome.wustl.edu	37	11	2432892	2432892	+	Silent	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr11:2432892G>C	ENST00000155858.6	-	17	2588	c.2580C>G	c.(2578-2580)ggC>ggG	p.G860G	TRPM5_ENST00000533060.1_Silent_p.G860G|TRPM5_ENST00000528453.1_Silent_p.G860G|TRPM5_ENST00000452833.1_Silent_p.G862G	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5									p.G860G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		TGATCTTGGGGCCCAGCTGCT	0.662																																					NSCLC(1;49 61 17205 18850 43201)											1	Substitution - coding silent(1)	ovary(1)	11											73.0	74.0	74.0					11																	2432892		2202	4298	6500	2389468	SO:0001819	synonymous_variant	29850			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2580C>G	11.37:g.2432892G>C		Somatic		Capture	Illumina GAIIx	4	2389468		Silent	SNP	ENST00000155858.6	37	CCDS31340.1	SNP	42	WashU																																																																																				0.662	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555		Silent
TMC2	117532	genome.wustl.edu	37	20	2592923	2592923	+	Silent	SNP	C	C	A	rs560610752		TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr20:2592923C>A	ENST00000358864.1	+	13	1695	c.1680C>A	c.(1678-1680)ccC>ccA	p.P560P	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	560					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)	p.P560P(1)		NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						AGAGTGTCCCCCGACCACCCC	0.488																																																1	Substitution - coding silent(1)	ovary(1)	20											112.0	104.0	106.0					20																	2592923		2203	4300	6503	2540923	SO:0001819	synonymous_variant	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1680C>A	20.37:g.2592923C>A		Somatic		Capture	Illumina GAIIx	4	2540923	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	ENST00000358864.1	37	CCDS13029.2	SNP	22	WashU																																																																																				0.488	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2			Silent
PRMT8	56341	genome.wustl.edu	37	12	3686064	3686064	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr12:3686064T>G	ENST00000382622.3	+	7	1130	c.740T>G	c.(739-741)aTg>aGg	p.M247R	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Missense_Mutation_p.M238R	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	247	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.M247R(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			GGCTTTGACATGACCTGCATC	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											283.0	255.0	264.0					12																	3686064		2203	4300	6503	3556325	SO:0001583	missense	56341			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.740T>G	12.37:g.3686064T>G	ENSP00000372067:p.Met247Arg	Somatic		Capture	Illumina GAIIx	4	3556325	B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	CCDS8521.2	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	13.77	2.335704	0.41398	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.79554	-1.28;-1.28	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.86768	0.6012	H	0.96861	3.895	0.80722	D	1	B;B	0.25272	0.122;0.017	B;B	0.22386	0.039;0.008	D	0.87133	0.2198	10	0.87932	D	0	.	13.0795	0.59104	0.0:0.0:0.0:1.0	.	238;247	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	R	238;247	ENSP00000414507:M238R;ENSP00000372067:M247R	ENSP00000372067:M247R	M	+	2	0	PRMT8	3556325	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	8.005000	0.88553	1.978000	0.57642	0.533000	0.62120	ATG		0.562	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854		Missense_Mutation
RBAK	57786	genome.wustl.edu	37	7	5103786	5103786	+	Silent	SNP	T	T	C			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr7:5103786T>C	ENST00000353796.3	+	6	1023	c.699T>C	c.(697-699)taT>taC	p.Y233Y	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Silent_p.Y233Y	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	233	Required for interaction with RB1.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.Y233Y(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		AGAAGCCCTATGAGTGGAATG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	7											46.0	48.0	48.0					7																	5103786		2203	4300	6503	5070312	SO:0001819	synonymous_variant	57786			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.699T>C	7.37:g.5103786T>C		Somatic		Capture	Illumina GAIIx	4	5070312	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Silent	SNP	ENST00000353796.3	37	CCDS5337.1	SNP	51	WashU																																																																																				0.383	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163		Silent
TARDBPP1	643503	genome.wustl.edu	37	20	6181907	6181907	+	IGR	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr20:6181907G>C								FERMT1 (77716 upstream) : AL109618.1 (27533 downstream)																							AGCCATCATGGCTGGATTAAT	0.512																																																0			20																																								6129907	SO:0001628	intergenic_variant	643503																															20.37:g.6181907G>C		Somatic		Capture	Illumina GAIIx	4	6129907		Missense_Mutation	SNP		37		SNP	42	WashU																																																																																			0	0.512									Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577018	7577018	+	Splice_Site	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr17:7577018C>T	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(28)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTGCTTACCTCGCTTAGT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(28)|Whole gene deletion(8)|Deletion - Frameshift(2)	lung(7)|breast(7)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|large_intestine(2)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|ovary(2)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|oesophagus(1)|prostate(1)	17	GRCh37	CD920913	TP53	D							127.0	112.0	117.0					17																	7577018		2203	4300	6503	7517743	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1G>A	17.37:g.7577018C>T		Somatic		Capture	Illumina GAIIx	4	7517743	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	9.710	1.156918	0.21454	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.81	3.84	0.44239	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.038	0.36300	0.0:0.9:0.0:0.1	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517743	1.000000	0.71417	0.939000	0.37840	0.223000	0.24884	4.456000	0.60081	1.259000	0.44117	0.561000	0.74099	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
FOXJ2	55810	genome.wustl.edu	37	12	8200495	8200495	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr12:8200495G>A	ENST00000162391.3	+	7	1980	c.835G>A	c.(835-837)Ggg>Agg	p.G279R	FOXJ2_ENST00000428177.2_Missense_Mutation_p.G279R	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	279					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.G279R(1)		autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		TTCTCTCCTGGGGGACATCCC	0.552																																																1	Substitution - Missense(1)	ovary(1)	12											51.0	58.0	55.0					12																	8200495		2203	4300	6503	8091762	SO:0001583	missense	55810			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.835G>A	12.37:g.8200495G>A	ENSP00000162391:p.Gly279Arg	Somatic		Capture	Illumina GAIIx	4	8091762	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	ENST00000162391.3	37	CCDS8587.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962854	0.74016	.	.	ENSG00000065970	ENST00000162391;ENST00000428177	D;D	0.95137	-3.37;-3.62	5.42	5.42	0.78866	.	2.072210	0.02298	N	0.070893	D	0.96790	0.8952	L	0.51422	1.61	0.50467	D	0.999876	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.88020	0.2768	10	0.25106	T	0.35	.	15.0867	0.72158	0.0:0.0:1.0:0.0	.	279;279	Q9P0K8;Q9P0K8-2	FOXJ2_HUMAN;.	R	279	ENSP00000162391:G279R;ENSP00000403411:G279R	ENSP00000162391:G279R	G	+	1	0	FOXJ2	8091762	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.915000	0.69973	2.702000	0.92279	0.462000	0.41574	GGG		0.552	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	NM_018416		Missense_Mutation
RP11-1396O13.13	0	genome.wustl.edu	37	4	9388937	9388937	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr4:9388937G>T	ENST00000508324.1	-	2	76	c.77C>A	c.(76-78)aCa>aAa	p.T26K															p.T26K(1)		breast(2)|lung(7)	9						TCTCTTGGATGTGTCCATCAT	0.428																																																1	Substitution - Missense(1)	ovary(1)	4																																								8998035	SO:0001583	missense																															ENST00000508324.1:c.77C>A	4.37:g.9388937G>T	ENSP00000421652:p.Thr26Lys	Somatic		Capture	Illumina GAIIx	4	8998035		Missense_Mutation	SNP	ENST00000508324.1	37		SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	.	1.142	-0.649149	0.03506	.	.	ENSG00000219492	ENST00000508324	T	0.01647	4.71	0.892	-0.0438	0.13858	.	.	.	.	.	T	0.01800	0.0057	.	.	.	0.18873	N	0.999985	.	.	.	.	.	.	T	0.46925	-0.9156	6	0.45353	T	0.12	.	2.5399	0.04723	0.24:0.3162:0.4437:0.0	.	.	.	.	K	26	ENSP00000421652:T26K	ENSP00000421652:T26K	T	-	2	0	RP11-1396O13.13	8998035	0.000000	0.05858	0.735000	0.30896	0.198000	0.23893	-0.002000	0.12924	-0.015000	0.14150	0.089000	0.15464	ACA		0.428	RP11-1396O13.13-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000359605.2			Missense_Mutation
ZNF491	126069	genome.wustl.edu	37	19	11917171	11917171	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr19:11917171T>A	ENST00000323169.5	+	3	734	c.403T>A	c.(403-405)Ttt>Att	p.F135I	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F135I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						TAAATGTAAGTTTTGTGGGAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	19											98.0	98.0	98.0					19																	11917171		2203	4300	6503	11778171	SO:0001583	missense	126069			AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.403T>A	19.37:g.11917171T>A	ENSP00000313443:p.Phe135Ile	Somatic		Capture	Illumina GAIIx	4	11778171	Q3MJ35|Q8NAT8	Missense_Mutation	SNP	ENST00000323169.5	37	CCDS12267.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	t	4.272	0.049688	0.08243	.	.	ENSG00000177599	ENST00000323169;ENST00000455048;ENST00000450087	T;T	0.18657	2.52;2.2	0.914	-1.83	0.07833	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07548	0.0190	N	0.03029	-0.43	0.09310	N	1	B	0.22851	0.076	B	0.26614	0.071	T	0.29181	-1.0020	9	0.72032	D	0.01	.	1.8011	0.03071	0.1621:0.1694:0.4593:0.2092	.	135	Q8N8L2	ZN491_HUMAN	I	135	ENSP00000313443:F135I;ENSP00000392176:F135I	ENSP00000313443:F135I	F	+	1	0	ZNF491	11778171	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.308000	0.01131	-1.711000	0.01395	-0.473000	0.04963	TTT		0.378	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1	NM_152356		Missense_Mutation
EPHA2	1969	genome.wustl.edu	37	1	16456018	16456018	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1103-01	TCGA-24-1103-10	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:16456018C>G	ENST00000358432.5	-	16	2890	c.2736G>C	c.(2734-2736)tgG>tgC	p.W912C		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	912	Negatively regulates interaction with ARHGEF16.|SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W912C(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	TGGACTCCAGCCACTCGGACA	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	63.0	66.0					1																	16456018		2203	4300	6503	16328605	SO:0001583	missense	1969			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2736G>C	1.37:g.16456018C>G	ENSP00000351209:p.Trp912Cys	Somatic		Capture	Illumina GAIIx	4	16328605	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663402	0.88251	.	.	ENSG00000142627	ENST00000358432	T	0.72282	-0.64	5.78	5.78	0.91487	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.51477	D	0.000083	D	0.89406	0.6706	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91945	0.5566	10	0.87932	D	0	.	18.5625	0.91105	0.0:1.0:0.0:0.0	.	912	P29317	EPHA2_HUMAN	C	912	ENSP00000351209:W912C	ENSP00000351209:W912C	W	-	3	0	EPHA2	16328605	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.733000	0.84916	2.738000	0.93877	0.591000	0.81541	TGG		0.622	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431		Missense_Mutation
ZNF682	91120	genome.wustl.edu	37	19	20117349	20117349	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr19:20117349G>A	ENST00000397165.2	-	4	1122	c.962C>T	c.(961-963)gCc>gTc	p.A321V	ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000597972.1_Missense_Mutation_p.A327V|ZNF682_ENST00000358523.5_Missense_Mutation_p.A289V|ZNF682_ENST00000397162.1_Missense_Mutation_p.A289V|ZNF682_ENST00000595736.1_Missense_Mutation_p.A245V	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A321V(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						GTGGTTAAAGGCTTTCCCACA	0.413																																																1	Substitution - Missense(1)	ovary(1)	19											85.0	89.0	88.0					19																	20117349		2161	4259	6420	19978349	SO:0001583	missense	91120			AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.962C>T	19.37:g.20117349G>A	ENSP00000380351:p.Ala321Val	Somatic		Capture	Illumina GAIIx	4	19978349	B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	ENST00000397165.2	37	CCDS42533.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	5.075	0.199425	0.09652	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000358523	T;T;T	0.37411	2.56;1.2;1.2	1.09	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32763	0.0840	L	0.39898	1.24	0.09310	N	1	P	0.50066	0.931	P	0.49085	0.6	T	0.12604	-1.0541	9	0.48119	T	0.1	.	5.0165	0.14339	0.0:0.3858:0.6142:0.0	.	321	O95780	ZN682_HUMAN	V	321;289;289	ENSP00000380351:A321V;ENSP00000380348:A289V;ENSP00000351324:A289V	ENSP00000351324:A289V	A	-	2	0	ZNF682	19978349	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.659000	0.24994	0.488000	0.27723	0.491000	0.48974	GCC		0.413	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196		Missense_Mutation
HNRNPA2B1	3181	genome.wustl.edu	37	7	26233226	26233226	+	Silent	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr7:26233226G>C	ENST00000354667.4	-	9	1014	c.846C>G	c.(844-846)ggC>ggG	p.G282G	HNRNPA2B1_ENST00000356674.7_Silent_p.G270G|HNRNPA2B1_ENST00000476233.1_5'Flank	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	282	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)	p.G270G(1)	HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						CACCTCCGTAGCCCCCACCCT	0.448			T	ETV1	prostate																																		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	1	Substitution - coding silent(1)	ovary(1)	7											117.0	113.0	115.0					7																	26233226		2203	4300	6503	26199751	SO:0001819	synonymous_variant	3181			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.846C>G	7.37:g.26233226G>C		Somatic		Capture	Illumina GAIIx	4	26199751	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	CCDS43557.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	1.634	-0.518198	0.04171	.	.	ENSG00000122566	ENST00000409814	.	.	.	6.07	5.2	0.72013	.	.	.	.	.	T	0.69717	0.3142	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68842	-0.5302	4	.	.	.	.	13.3415	0.60547	0.0731:0.0:0.9269:0.0	.	.	.	.	G	216	.	.	A	-	2	0	HNRNPA2B1	26199751	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	1.904000	0.39868	1.587000	0.49959	-0.136000	0.14681	GCT		0.448	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137		Missense_Mutation
RABEP2	79874	genome.wustl.edu	37	16	28936427	28936427	+	Missense_Mutation	SNP	C	C	A	rs115529621	byFrequency	TCGA-24-1103-01	TCGA-24-1103-10	C	C	A	A	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr16:28936427C>A	ENST00000358201.4	-	1	646	c.58G>T	c.(58-60)Gct>Tct	p.A20S	RABEP2_ENST00000544477.1_Missense_Mutation_p.A20S|RABEP2_ENST00000561803.1_5'UTR|RABEP2_ENST00000357573.6_Missense_Mutation_p.A20S	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	20					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CACGTACCAGCCCCCGgccgc	0.736													C|||	330	0.0658946	0.2375	0.0202	5008	,	,		7493	0.0		0.002	False		,,,				2504	0.0				Pancreas(66;639 1284 10093 31061 49099)											0			16											2.0	3.0	3.0					16																	28936427		1453	3364	4817	28843928	SO:0001583	missense	79874			AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.58G>T	16.37:g.28936427C>A	ENSP00000350934:p.Ala20Ser	Germline		Capture	Illumina GAIIx	4	28843928		Missense_Mutation	SNP	ENST00000358201.4	37	CCDS42140.1	SNP	26	WashU	123	0.05631868131868132	109	0.22154471544715448	9	0.024861878453038673	2	0.0034965034965034965	3	0.00395778364116095	c	16.42	3.117592	0.56505	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.59638	0.91;0.91;0.25	3.65	0.43	0.16515	.	0.671878	0.12297	N	0.481506	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.13098	-1.0522	9	0.27785	T	0.31	.	2.6187	0.04910	0.4012:0.3544:0.0:0.2444	.	20;20;20;20	B4DHR0;Q9H5N1-2;Q49AT6;Q9H5N1	.;.;.;RABE2_HUMAN	S	20	ENSP00000350934:A20S;ENSP00000350186:A20S;ENSP00000442798:A20S	ENSP00000350186:A20S	A	-	1	0	RABEP2	28843928	0.097000	0.21791	0.089000	0.20774	0.144000	0.21451	-0.053000	0.11846	0.299000	0.22661	0.449000	0.29647	GCT		0.736	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432691.1	NM_024816		Missense_Mutation
FNDC8	54752	genome.wustl.edu	37	17	33457378	33457378	+	Silent	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr17:33457378C>T	ENST00000158009.5	+	4	1015	c.900C>T	c.(898-900)ccC>ccT	p.P300P	NLE1_ENST00000586869.1_3'UTR	NM_017559.2	NP_060029.1	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	300						nucleus (GO:0005634)		p.P300P(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	11		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		GCAAGGAACCCCGGCAAAAGA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	17											66.0	66.0	66.0					17																	33457378		2203	4300	6503	30481491	SO:0001819	synonymous_variant	54752			BC024002	CCDS11290.1	17q12	2013-02-11			ENSG00000073598	ENSG00000073598		"""Fibronectin type III domain containing"""	25286	protein-coding gene	gene with protein product						12477932	Standard	XM_005257993		Approved	DKFZp434H2215	uc002hix.3	Q8TC99	OTTHUMG00000132932	ENST00000158009.5:c.900C>T	17.37:g.33457378C>T		Somatic		Capture	Illumina GAIIx	4	30481491	B2R9G6|Q9UFC2	Silent	SNP	ENST00000158009.5	37	CCDS11290.1	SNP	22	WashU																																																																																				0.572	FNDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256459.2	NM_017559		Silent
BRCA2	675	genome.wustl.edu	37	13	32913404	32913404	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1103-01	TCGA-24-1103-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr13:32913404A>G	ENST00000380152.3	+	11	5145	c.4912A>G	c.(4912-4914)Aaa>Gaa	p.K1638E	BRCA2_ENST00000544455.1_Missense_Mutation_p.K1638E			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1638	Interaction with POLH.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.K1638E(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTTGAAAGTTAAAGTACATGA	0.323			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Substitution - Missense(1)	ovary(1)	13											34.0	37.0	36.0					13																	32913404		2200	4297	6497	31811404	SO:0001583	missense	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4912A>G	13.37:g.32913404A>G	ENSP00000369497:p.Lys1638Glu	Somatic		Capture	Illumina GAIIx	4	31811404	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	10.73	1.432088	0.25813	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.01145	5.27;5.27	5.82	2.03	0.26663	.	1.053530	0.07338	N	0.880304	T	0.01627	0.0052	L	0.53249	1.67	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.49670	-0.8915	10	0.30078	T	0.28	.	5.2312	0.15422	0.5578:0.1439:0.2983:0.0	.	1638	P51587	BRCA2_HUMAN	E	1638	ENSP00000369497:K1638E;ENSP00000439902:K1638E	ENSP00000369497:K1638E	K	+	1	0	BRCA2	31811404	0.031000	0.19500	0.050000	0.19076	0.660000	0.38997	0.058000	0.14301	0.107000	0.17824	0.533000	0.62120	AAA		0.323	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		Missense_Mutation
EVA1C	59271	genome.wustl.edu	37	21	33887379	33887379	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr21:33887379G>T	ENST00000300255.2	+	8	1678	c.1205G>T	c.(1204-1206)aGt>aTt	p.S402I	EVA1C_ENST00000485488.1_3'UTR|EVA1C_ENST00000382699.3_Missense_Mutation_p.S399I|EVA1C_ENST00000401402.3_Missense_Mutation_p.S354I	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	402						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S402I(1)									CCTATATACAGTTCCATAGAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	21											100.0	111.0	107.0					21																	33887379		2203	4300	6503	32809250	SO:0001583	missense	59271			AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.1205G>T	21.37:g.33887379G>T	ENSP00000300255:p.Ser402Ile	Somatic		Capture	Illumina GAIIx	4	32809250	A6ND58|Q8IXZ0	Missense_Mutation	SNP	ENST00000300255.2	37	CCDS13614.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113251	0.56398	.	.	ENSG00000166979	ENST00000300255;ENST00000401402;ENST00000382699	T;T;T	0.46063	0.88;0.88;0.88	5.67	4.76	0.60689	.	0.421443	0.29253	N	0.012686	T	0.38161	0.1030	M	0.68317	2.08	0.27093	N	0.962801	P;P	0.47302	0.893;0.893	B;B	0.41619	0.361;0.361	T	0.46610	-0.9179	10	0.48119	T	0.1	-7.5604	5.0178	0.14345	0.1815:0.1902:0.6283:0.0	.	399;402	A6ND58;P58658	.;CU063_HUMAN	I	402;354;399	ENSP00000300255:S402I;ENSP00000384594:S354I;ENSP00000372146:S399I	ENSP00000300255:S402I	S	+	2	0	C21orf63	32809250	0.169000	0.23002	0.996000	0.52242	0.971000	0.66376	1.686000	0.37669	1.332000	0.45431	0.655000	0.94253	AGT		0.507	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139403.1	NM_058187		Missense_Mutation
FAM83C	128876	genome.wustl.edu	37	20	33874443	33874443	+	Silent	SNP	C	C	G			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr20:33874443C>G	ENST00000374408.3	-	4	2235	c.2139G>C	c.(2137-2139)ctG>ctC	p.L713L	EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374443.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA|EIF6_ENST00000374436.3_5'Flank	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	713								p.L713L(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CATCCCTGACCAGGTCACTGT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	20											110.0	103.0	106.0					20																	33874443		2203	4300	6503	33337857	SO:0001819	synonymous_variant	128876			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.2139G>C	20.37:g.33874443C>G		Somatic		Capture	Illumina GAIIx	4	33337857	Q14D67|Q5JWN6|Q8N276	Silent	SNP	ENST00000374408.3	37	CCDS13251.1	SNP	21	WashU																																																																																				0.552	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3			Silent
PRLR	5618	genome.wustl.edu	37	5	35084596	35084596	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr5:35084596G>T	ENST00000382002.5	-	5	775	c.349C>A	c.(349-351)Ctt>Att	p.L117I	PRLR_ENST00000397391.3_Missense_Mutation_p.L46I|PRLR_ENST00000342362.5_Intron|PRLR_ENST00000511486.1_Intron|PRLR_ENST00000310101.5_Missense_Mutation_p.L117I|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000513753.1_Missense_Mutation_p.L117I|PRLR_ENST00000348262.3_Missense_Mutation_p.L117I|PRLR_ENST00000542609.1_Missense_Mutation_p.L117I|PRLR_ENST00000231423.3_Missense_Mutation_p.L117I	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	117	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.L117I(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	TCCACATAAAGTTCATCCGAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	5											233.0	217.0	222.0					5																	35084596		2203	4300	6503	35120353	SO:0001583	missense	5618				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.349C>A	5.37:g.35084596G>T	ENSP00000371432:p.Leu117Ile	Somatic		Capture	Illumina GAIIx	4	35120353	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	CCDS3909.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	2.245	-0.372885	0.05034	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000397391;ENST00000542609;ENST00000382002;ENST00000310101;ENST00000514206	D;D;D;T;D;D;D;D	0.84660	-1.88;-1.88;-1.88;1.59;-1.88;-1.88;-1.88;-1.88	5.68	1.95	0.26073	Fibronectin, type III (2);Growth hormone/erythropoietin receptor, ligand binding (1);Immunoglobulin-like fold (1);	1.121610	0.06390	N	0.716852	T	0.73118	0.3546	N	0.25957	0.775	0.09310	N	1	B;B;B;B;B;B	0.12630	0.0;0.0;0.006;0.001;0.0;0.001	B;B;B;B;B;B	0.19666	0.003;0.008;0.026;0.01;0.006;0.007	T	0.55560	-0.8122	10	0.23302	T	0.38	0.3436	1.0342	0.01544	0.2994:0.1483:0.3992:0.1531	.	117;117;46;117;117;117	P16471-3;P16471;Q8TD76;P16471-7;P16471-6;P16471-4	.;PRLR_HUMAN;.;.;.;.	I	117;117;117;46;117;117;117;117	ENSP00000231423:L117I;ENSP00000424841:L117I;ENSP00000311613:L117I;ENSP00000380546:L46I;ENSP00000441813:L117I;ENSP00000371432:L117I;ENSP00000309008:L117I;ENSP00000423493:L117I	ENSP00000231423:L117I	L	-	1	0	PRLR	35120353	0.005000	0.15991	0.001000	0.08648	0.002000	0.02628	0.163000	0.16520	0.351000	0.24027	-0.152000	0.13540	CTT		0.453	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2			Missense_Mutation
FAM83D	81610	genome.wustl.edu	37	20	37580833	37580833	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr20:37580833G>T	ENST00000217429.4	+	4	1559	c.1518G>T	c.(1516-1518)aaG>aaT	p.K506N		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	476					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.K506N(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CCAGTTTGAAGTCTTCCTCCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	20											91.0	89.0	90.0					20																	37580833		1958	4144	6102	37014247	SO:0001583	missense	81610			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.1518G>T	20.37:g.37580833G>T	ENSP00000217429:p.Lys506Asn	Somatic		Capture	Illumina GAIIx	4	37014247	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991943	0.35131	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.12774	2.65	5.49	3.56	0.40772	.	0.734380	0.13069	N	0.416256	T	0.12008	0.0292	L	0.43152	1.355	0.29107	N	0.881104	B	0.31125	0.309	B	0.29785	0.107	T	0.14035	-1.0487	10	0.42905	T	0.14	.	7.2166	0.25963	0.1539:0.1398:0.7063:0.0	.	476	Q9H4H8	FA83D_HUMAN	N	506;460	ENSP00000217429:K506N	ENSP00000217429:K506N	K	+	3	2	FAM83D	37014247	0.158000	0.22850	0.873000	0.34254	0.703000	0.40648	0.559000	0.23485	0.802000	0.34089	0.655000	0.94253	AAG		0.483	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1			Missense_Mutation
PRKD3	23683	genome.wustl.edu	37	2	37518122	37518122	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr2:37518122A>C	ENST00000379066.1	-	4	1210	c.448T>G	c.(448-450)Ttc>Gtc	p.F150V	PRKD3_ENST00000234179.2_Missense_Mutation_p.F150V			O94806	KPCD3_HUMAN	protein kinase D3	150					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.F150V(1)		breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				CGAATCTGGAAGTCTTCTACT	0.383																																					Melanoma(80;621 1355 8613 11814 51767)											1	Substitution - Missense(1)	ovary(1)	2											148.0	144.0	145.0					2																	37518122		2203	4300	6503	37371626	SO:0001583	missense	23683			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.448T>G	2.37:g.37518122A>C	ENSP00000368356:p.Phe150Val	Somatic		Capture	Illumina GAIIx	4	37371626	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	37	CCDS1789.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	9.805	1.181573	0.21787	.	.	ENSG00000115825	ENST00000379066;ENST00000234179;ENST00000443187	D;D;D	0.83914	-1.78;-1.78;-1.78	4.83	3.65	0.41850	.	0.000000	0.85682	D	0.000000	T	0.73931	0.3650	L	0.37630	1.12	0.54753	D	0.999989	B;B	0.28026	0.198;0.024	B;B	0.29862	0.108;0.028	T	0.65129	-0.6243	10	0.20519	T	0.43	-15.5789	11.1514	0.48462	0.862:0.0:0.0:0.138	.	150;150	O94806-2;O94806	.;KPCD3_HUMAN	V	150;150;46	ENSP00000368356:F150V;ENSP00000234179:F150V;ENSP00000401839:F46V	ENSP00000234179:F150V	F	-	1	0	PRKD3	37371626	1.000000	0.71417	0.986000	0.45419	0.968000	0.65278	7.277000	0.78572	0.774000	0.33427	0.528000	0.53228	TTC		0.383	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813		Missense_Mutation
XIRP1	165904	genome.wustl.edu	37	3	39227071	39227071	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1103-01	TCGA-24-1103-10	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:39227071T>A	ENST00000340369.3	-	2	4094	c.3866A>T	c.(3865-3867)gAc>gTc	p.D1289V	XIRP1_ENST00000396251.1_3'UTR|XIRP1_ENST00000421646.1_5'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1289	Pro-rich.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.D1289V(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		AAGAAGGGGGTCCTTCAGGGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											46.0	56.0	53.0					3																	39227071		2192	4294	6486	39202075	SO:0001583	missense	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3866A>T	3.37:g.39227071T>A	ENSP00000343140:p.Asp1289Val	Somatic		Capture	Illumina GAIIx	4	39202075	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	2.844	-0.239918	0.05944	.	.	ENSG00000168334	ENST00000340369	T	0.03635	3.86	3.87	-0.109	0.13584	.	0.209202	0.29892	U	0.010934	T	0.02929	0.0087	L	0.51422	1.61	0.09310	N	0.999998	B	0.26002	0.139	B	0.19666	0.026	T	0.40079	-0.9582	10	0.33940	T	0.23	.	1.0316	0.01539	0.1901:0.1086:0.1971:0.5042	.	1289	Q702N8	XIRP1_HUMAN	V	1289	ENSP00000343140:D1289V	ENSP00000343140:D1289V	D	-	2	0	XIRP1	39202075	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.272000	0.18644	-0.015000	0.14150	0.533000	0.62120	GAC		0.612	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		Missense_Mutation
BMP8B	656	genome.wustl.edu	37	1	40230371	40230371	+	Silent	SNP	T	T	C			TCGA-24-1103-01	TCGA-24-1103-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:40230371T>C	ENST00000372827.3	-	4	1167	c.792A>G	c.(790-792)gcA>gcG	p.A264A	BMP8B_ENST00000397360.2_Silent_p.A289A	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b	264					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)		p.A264A(1)		endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GTGGCCTCACTGCCCGAGGGG	0.672																																																1	Substitution - coding silent(1)	ovary(1)	1											70.0	75.0	73.0					1																	40230371		2199	4298	6497	40002958	SO:0001819	synonymous_variant	656			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.792A>G	1.37:g.40230371T>C		Somatic		Capture	Illumina GAIIx	4	40002958	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Silent	SNP	ENST00000372827.3	37	CCDS444.1	SNP	55	WashU																																																																																				0.672	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025641.1	NM_001720		Silent
MX2	4600	genome.wustl.edu	37	21	42749907	42749907	+	Splice_Site	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr21:42749907C>T	ENST00000330714.3	+	3	625	c.441C>T	c.(439-441)agC>agT	p.S147S	MX2_ENST00000543692.1_Splice_Site_p.S147S	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	147	Dynamin-type G.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S147S(1)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CCAGAGGCAGCGGTAAGTTCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	21											48.0	45.0	46.0					21																	42749907		2203	4300	6503	41671777	SO:0001630	splice_region_variant	4600				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.442+1C>T	21.37:g.42749907C>T		Somatic		Capture	Illumina GAIIx	4	41671777	B7Z5D3|D3DSI7	Silent	SNP	ENST00000330714.3	37	CCDS13672.1	SNP	27	WashU																																																																																				0.627	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	Silent	Silent
UMODL1	89766	genome.wustl.edu	37	21	43533871	43533871	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr21:43533871C>A	ENST00000408910.2	+	13	2293	c.2293C>A	c.(2293-2295)Cac>Aac	p.H765N	UMODL1_ENST00000400427.1_Missense_Mutation_p.H821N|UMODL1_ENST00000400424.2_Missense_Mutation_p.H693N|UMODL1_ENST00000408989.2_Missense_Mutation_p.H893N	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	765	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.H693N(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TGGGGTCTTGCACCTGGTTGA	0.532																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)											1	Substitution - Missense(1)	ovary(1)	21											62.0	63.0	62.0					21																	43533871		1986	4160	6146	42406940	SO:0001583	missense	89766				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.2293C>A	21.37:g.43533871C>A	ENSP00000386147:p.His765Asn	Somatic		Capture	Illumina GAIIx	4	42406940	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	5.738	0.320701	0.10845	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	4.7	-3.6	0.04570	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.903581	0.09300	N	0.821066	T	0.41003	0.1140	L	0.29908	0.895	0.09310	N	1	P;P	0.46912	0.886;0.867	B;B	0.44044	0.439;0.249	T	0.41752	-0.9491	9	.	.	.	-12.5618	12.772	0.57426	0.0:0.1827:0.0:0.8173	.	893;765	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	N	821;693;893;765	ENSP00000383279:H821N;ENSP00000383276:H693N;ENSP00000386126:H893N;ENSP00000386147:H765N	.	H	+	1	0	UMODL1	42406940	0.000000	0.05858	0.026000	0.17262	0.145000	0.21501	-0.407000	0.07178	-0.607000	0.05738	0.556000	0.70494	CAC		0.532	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2			Missense_Mutation
TCEB3B	51224	genome.wustl.edu	37	18	44560049	44560049	+	Silent	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr18:44560049C>T	ENST00000332567.4	-	1	1939	c.1587G>A	c.(1585-1587)ctG>ctA	p.L529L	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	529	Activation domain. {ECO:0000250}.|Interacting with Elongin BC complex. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L529L(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						ACTGCTGGCGCAGCGTCGGCA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	18											69.0	76.0	73.0					18																	44560049		2203	4300	6503	42814047	SO:0001819	synonymous_variant	51224			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1587G>A	18.37:g.44560049C>T		Somatic		Capture	Illumina GAIIx	4	42814047	Q9P2V9	Silent	SNP	ENST00000332567.4	37	CCDS11932.1	SNP	25	WashU																																																																																				0.617	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427		Silent
ZNF197	10168	genome.wustl.edu	37	3	44684347	44684347	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:44684347C>A	ENST00000396058.1	+	5	1892	c.1725C>A	c.(1723-1725)ttC>ttA	p.F575L	ZNF197_ENST00000344387.4_Missense_Mutation_p.F575L|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Intron|ZNF197_ENST00000383744.4_Intron			O14709	ZN197_HUMAN	zinc finger protein 197	575					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F575L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		GAAAAGTTTTCATTCGAAGCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											58.0	60.0	60.0					3																	44684347		2203	4300	6503	44659351	SO:0001583	missense	10168			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.1725C>A	3.37:g.44684347C>A	ENSP00000379370:p.Phe575Leu	Somatic		Capture	Illumina GAIIx	4	44659351	B2RAH8|Q86VG0	Missense_Mutation	SNP	ENST00000396058.1	37	CCDS2717.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588990	0.46110	.	.	ENSG00000186448	ENST00000344387;ENST00000396058	T;T	0.46063	0.88;0.88	3.57	2.7	0.31948	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36555	U	0.002535	T	0.67126	0.2860	M	0.92555	3.32	0.31059	N	0.714318	D	0.67145	0.996	D	0.77557	0.99	T	0.70475	-0.4861	10	0.87932	D	0	.	7.858	0.29493	0.0:0.7911:0.0:0.2089	.	575	O14709	ZN197_HUMAN	L	575	ENSP00000345809:F575L;ENSP00000379370:F575L	ENSP00000345809:F575L	F	+	3	2	ZNF197	44659351	0.002000	0.14202	1.000000	0.80357	0.889000	0.51656	0.078000	0.14761	1.086000	0.41228	-0.269000	0.10298	TTC		0.398	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991		Missense_Mutation
BSN	8927	genome.wustl.edu	37	3	49689686	49689686	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:49689686C>A	ENST00000296452.4	+	5	2811	c.2697C>A	c.(2695-2697)caC>caA	p.H899Q		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	899					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.H899Q(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCCTGCCCCACAATGCCACCA	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											23.0	25.0	24.0					3																	49689686		2203	4300	6503	49664690	SO:0001583	missense	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.2697C>A	3.37:g.49689686C>A	ENSP00000296452:p.His899Gln	Somatic		Capture	Illumina GAIIx	4	49664690	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	8.345	0.829579	0.16749	.	.	ENSG00000164061	ENST00000296452	T	0.18502	2.21	4.81	1.96	0.26148	.	0.235221	0.42294	D	0.000736	T	0.27278	0.0669	L	0.45581	1.43	0.27053	N	0.963744	D	0.76494	0.999	D	0.66196	0.942	T	0.06552	-1.0820	10	0.33940	T	0.23	.	8.8394	0.35133	0.0:0.667:0.0:0.333	.	899	Q9UPA5	BSN_HUMAN	Q	899	ENSP00000296452:H899Q	ENSP00000296452:H899Q	H	+	3	2	BSN	49664690	0.935000	0.31712	0.999000	0.59377	0.995000	0.86356	0.120000	0.15647	0.085000	0.17107	0.561000	0.74099	CAC		0.657	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		Missense_Mutation
CLPTM1	1209	genome.wustl.edu	37	19	45477794	45477794	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr19:45477794G>T	ENST00000337392.5	+	4	558	c.408G>T	c.(406-408)tgG>tgT	p.W136C	CLPTM1_ENST00000541297.2_Missense_Mutation_p.W122C|CLPTM1_ENST00000546079.1_Missense_Mutation_p.W34C	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	136					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.W136C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		ATGGCGACTGGACTAGCGGCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											140.0	113.0	122.0					19																	45477794		2203	4300	6503	50169634	SO:0001583	missense	1209			AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.408G>T	19.37:g.45477794G>T	ENSP00000336994:p.Trp136Cys	Somatic		Capture	Illumina GAIIx	4	50169634	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	ENST00000337392.5	37	CCDS12651.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574542	0.86542	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.85340	0.5674	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.87513	0.2441	9	0.56958	D	0.05	-14.7161	16.5186	0.84307	0.0:0.0:1.0:0.0	.	122;136;136	F5H8J3;B3KQH2;O96005	.;.;CLPT1_HUMAN	C	34;122;136;136	.	ENSP00000336994:W136C	W	+	3	0	CLPTM1	50169634	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.844000	0.92147	2.755000	0.94549	0.650000	0.86243	TGG		0.562	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294		Missense_Mutation
DDC	1644	genome.wustl.edu	37	7	50596924	50596924	+	Silent	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr7:50596924C>T	ENST00000444124.2	-	5	752	c.552G>A	c.(550-552)gtG>gtA	p.V184V	DDC_ENST00000431062.1_Intron|DDC_ENST00000380984.4_Silent_p.V184V|DDC_ENST00000357936.5_Silent_p.V184V|DDC_ENST00000426377.1_Silent_p.V106V|DDC_ENST00000489162.1_5'UTR|AC018705.5_ENST00000454521.1_RNA	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	184					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.V184V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	ATGAGTAAGCCACCAGCTTCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	7											87.0	82.0	83.0					7																	50596924		2203	4300	6503	50564418	SO:0001819	synonymous_variant	1644				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.552G>A	7.37:g.50596924C>T		Somatic		Capture	Illumina GAIIx	4	50564418	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Silent	SNP	ENST00000444124.2	37	CCDS5511.1	SNP	21	WashU																																																																																				0.547	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1			Silent
OR2AP1	121129	genome.wustl.edu	37	12	55968828	55968828	+	Silent	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr12:55968828G>A	ENST00000321688.1	+	1	630	c.630G>A	c.(628-630)gtG>gtA	p.V210V	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001258285.1	NP_001245214.1	Q8NGE2	O2AP1_HUMAN	olfactory receptor, family 2, subfamily AP, member 1	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V210V(1)		lung(2)|ovary(1)	3						TCACTCTGGTGCTAGTGATTC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	12																																								54255095	SO:0001819	synonymous_variant				BK004260	CCDS58241.1	12q13.2	2012-08-09	2004-12-10	2004-03-10	ENSG00000179615	ENSG00000179615		"""GPCR / Class A : Olfactory receptors"""	15335	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AP, member 1 pseudogene"""	OR2AP1P			Standard	NM_001258285		Approved		uc031qhr.1	Q8NGE2	OTTHUMG00000169960	ENST00000321688.1:c.630G>A	12.37:g.55968828G>A		Somatic		Capture	Illumina GAIIx	4	54255095		Silent	SNP	ENST00000321688.1	37	CCDS58241.1	SNP	46	WashU																																																																																				0.463	OR2AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406679.1			Silent
EXOC1	55763	genome.wustl.edu	37	4	56763055	56763055	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr4:56763055T>G	ENST00000381295.2	+	16	2474	c.2126T>G	c.(2125-2127)gTa>gGa	p.V709G	EXOC1_ENST00000349598.6_Missense_Mutation_p.V694G|EXOC1_ENST00000346134.7_Missense_Mutation_p.V709G	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	709					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V709G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					ATCAGAGGAGTATTTGTTAAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											68.0	70.0	69.0					4																	56763055		2203	4300	6503	56457812	SO:0001583	missense	55763			AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.2126T>G	4.37:g.56763055T>G	ENSP00000370695:p.Val709Gly	Somatic		Capture	Illumina GAIIx	4	56457812	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	CCDS3502.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	22.6	4.314817	0.81358	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.77928	0.4204	M	0.68952	2.095	0.80722	D	1	D;D	0.63880	0.993;0.993	P;D	0.72982	0.865;0.979	T	0.80044	-0.1547	9	0.87932	D	0	.	16.3756	0.83387	0.0:0.0:0.0:1.0	.	694;709	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	G	709;709;694	.	ENSP00000326514:V709G	V	+	2	0	EXOC1	56457812	1.000000	0.71417	0.960000	0.40013	0.973000	0.67179	7.698000	0.84413	2.270000	0.75569	0.460000	0.39030	GTA		0.348	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261		Missense_Mutation
AASDH	132949	genome.wustl.edu	37	4	57215995	57215995	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr4:57215995C>A	ENST00000205214.6	-	11	2102	c.1922G>T	c.(1921-1923)aGt>aTt	p.S641I	AASDH_ENST00000451613.1_Missense_Mutation_p.S641I|AASDH_ENST00000502617.1_Missense_Mutation_p.S641I|AASDH_ENST00000513376.1_Missense_Mutation_p.S541I|AASDH_ENST00000602986.1_Missense_Mutation_p.S488I|AASDH_ENST00000434343.2_Missense_Mutation_p.S156I	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	641					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.S641I(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TGTGGCACAACTCTTCCTGAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											193.0	166.0	175.0					4																	57215995		2203	4300	6503	56910752	SO:0001583	missense	132949			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1922G>T	4.37:g.57215995C>A	ENSP00000205214:p.Ser641Ile	Somatic		Capture	Illumina GAIIx	4	56910752	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	37	CCDS3504.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662177	0.29515	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64	6.06	2.19	0.27852	.	0.805159	0.12194	N	0.490902	T	0.07863	0.0197	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.23806	0.091;0.009;0.02;0.002	B;B;B;B	0.21546	0.026;0.014;0.035;0.001	T	0.38329	-0.9666	10	0.36615	T	0.2	-2.6864	2.1684	0.03843	0.1299:0.4515:0.1278:0.2909	.	488;641;641;641	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	I	641;541;156;641;488;641	ENSP00000205214:S641I;ENSP00000423760:S541I;ENSP00000392158:S156I;ENSP00000409656:S641I;ENSP00000421171:S641I	ENSP00000205214:S641I	S	-	2	0	AASDH	56910752	0.000000	0.05858	0.006000	0.13384	0.836000	0.47400	0.119000	0.15626	0.081000	0.16988	0.655000	0.94253	AGT		0.408	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806		Missense_Mutation
POLR2B	5431	genome.wustl.edu	37	4	57865797	57865797	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr4:57865797T>A	ENST00000381227.1	+	8	1163	c.750T>A	c.(748-750)agT>agA	p.S250R	POLR2B_ENST00000431623.2_Missense_Mutation_p.S175R|POLR2B_ENST00000314595.5_Missense_Mutation_p.S250R|POLR2B_ENST00000441246.2_Missense_Mutation_p.S243R			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	250					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)	p.S250R(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					CCAAGAAGAGTGCTATTGGTC	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											112.0	102.0	106.0					4																	57865797		2203	4300	6503	57560554	SO:0001583	missense	5431				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.750T>A	4.37:g.57865797T>A	ENSP00000370625:p.Ser250Arg	Somatic		Capture	Illumina GAIIx	4	57560554	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	12.15	1.850879	0.32699	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.66	2.92	0.33932	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	L	0.56769	1.78	0.80722	D	1	B;B	0.27765	0.083;0.188	B;B	0.36186	0.219;0.219	T	0.54309	-0.8313	10	0.27785	T	0.31	.	10.8005	0.46485	0.0:0.1497:0.0:0.8503	.	175;250	C9J4M6;P30876	.;RPB2_HUMAN	R	250;175;243;250	ENSP00000370625:S250R;ENSP00000391096:S175R;ENSP00000391452:S243R;ENSP00000312735:S250R	ENSP00000312735:S250R	S	+	3	2	POLR2B	57560554	0.997000	0.39634	1.000000	0.80357	0.753000	0.42808	0.387000	0.20718	0.980000	0.38523	-0.388000	0.06559	AGT		0.348	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938		Missense_Mutation
OR5B21	219968	genome.wustl.edu	37	11	58275032	58275032	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr11:58275032G>C	ENST00000360374.2	-	1	546	c.547C>G	c.(547-549)Ctg>Gtg	p.L183V		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L183V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GAGAGAGCCAGGAGTGGGGGA	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											53.0	50.0	51.0					11																	58275032		2201	4295	6496	58031608	SO:0001583	missense	219968				CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283		"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product							Standard	NM_001005218		Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.547C>G	11.37:g.58275032G>C	ENSP00000353537:p.Leu183Val	Somatic		Capture	Illumina GAIIx	4	58031608		Missense_Mutation	SNP	ENST00000360374.2	37	CCDS31552.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	8.062	0.768280	0.15983	.	.	ENSG00000198283	ENST00000360374	T	0.00304	8.19	5.22	-4.11	0.03928	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29335	U	0.012450	T	0.00210	0.0006	L	0.54323	1.7	0.09310	N	1	B	0.22983	0.078	B	0.27608	0.081	T	0.43972	-0.9358	10	0.54805	T	0.06	-4.8057	13.0369	0.58877	0.5545:0.0:0.4455:0.0	.	183	A6NL26	OR5BL_HUMAN	V	183	ENSP00000353537:L183V	ENSP00000353537:L183V	L	-	1	2	OR5B21	58031608	0.000000	0.05858	0.057000	0.19452	0.547000	0.35210	-2.811000	0.00755	-0.618000	0.05656	0.563000	0.77884	CTG		0.478	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394891.1	NM_001005218		Missense_Mutation
LRRC7	57554	genome.wustl.edu	37	1	70573490	70573490	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:70573490C>A	ENST00000035383.5	+	24	4517	c.4487C>A	c.(4486-4488)cCt>cAt	p.P1496H	LRRC7_ENST00000310961.5_Missense_Mutation_p.P1454H|LRRC7_ENST00000415775.2_Missense_Mutation_p.P780H	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1496	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.P1496H(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CTACTGCAGCCTGGTGATAAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	131.0	135.0					1																	70573490		2203	4300	6503	70346078	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4487C>A	1.37:g.70573490C>A	ENSP00000035383:p.Pro1496His	Somatic		Capture	Illumina GAIIx	4	70346078	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558299	0.86231	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.29397	1.57;1.57;1.57	5.62	5.62	0.85841	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.58991	0.2161	M	0.89353	3.025	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.66416	-0.5929	10	0.72032	D	0.01	.	19.2394	0.93875	0.0:1.0:0.0:0.0	.	780;1449;1496	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	H	1454;1496;780;1272	ENSP00000309245:P1454H;ENSP00000035383:P1496H;ENSP00000394867:P780H	ENSP00000035383:P1496H	P	+	2	0	LRRC7	70346078	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.113000	0.77095	2.634000	0.89283	0.655000	0.94253	CCT		0.388	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		Missense_Mutation
TAF1	6872	genome.wustl.edu	37	X	70712322	70712322	+	Intron	SNP	G	G	T	rs76395257		TCGA-24-1103-01	TCGA-24-1103-10	G	G	T	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chrX:70712322G>T	ENST00000461764.1	+	9	1008				Y_RNA_ENST00000362881.1_RNA|INGX_ENST00000489074.2_RNA			P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CTCCGCCTGCGCGTCCGCCTC	0.687													G|||	34	0.00900662	0.025	0.0014	3775	,	,		10902	0.0		0.0	False		,,,				2504	0.0															0			X																																								70629047	SO:0001627	intron_variant					CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000461764.1:c.1008+31669G>T	X.37:g.70712322G>T		Germline		Capture	Illumina GAIIx	4	70629047	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Silent	SNP	ENST00000461764.1	37		SNP	38	WashU																																																																																				0.687	TAF1-021	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000081821.1	NM_004606		Silent
QRICH2	84074	genome.wustl.edu	37	17	74288004	74288004	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr17:74288004C>A	ENST00000262765.5	-	4	2485	c.2306G>T	c.(2305-2307)gGt>gTt	p.G769V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	769								p.G769V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						AGGATAGGCACCAGGTTGTAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	17											187.0	179.0	181.0					17																	74288004		2203	4300	6503	71799599	SO:0001583	missense	84074			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.2306G>T	17.37:g.74288004C>A	ENSP00000262765:p.Gly769Val	Somatic		Capture	Illumina GAIIx	4	71799599	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456917	0.43634	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.13901	2.55	4.8	3.81	0.43845	.	.	.	.	.	T	0.31482	0.0798	L	0.58101	1.795	0.21950	N	0.999458	D;D	0.89917	0.992;1.0	D;D	0.76071	0.936;0.987	T	0.04930	-1.0917	9	0.48119	T	0.1	-1.9699	11.2216	0.48857	0.0:0.8142:0.1858:0.0	.	769;769	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	769	ENSP00000262765:G769V	ENSP00000262765:G769V	G	-	2	0	QRICH2	71799599	0.000000	0.05858	0.142000	0.22268	0.604000	0.37047	0.707000	0.25704	1.103000	0.41568	0.448000	0.29417	GGT		0.527	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		Missense_Mutation
KIAA2022	340533	genome.wustl.edu	37	X	73959989	73959989	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chrX:73959989T>C	ENST00000055682.6	-	3	5014	c.4403A>G	c.(4402-4404)gAg>gGg	p.E1468G		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1468					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.E1468G(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTGTTCTCGCTCCATGTGCTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											209.0	164.0	179.0					X																	73959989		2203	4300	6503	73876714	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4403A>G	X.37:g.73959989T>C	ENSP00000055682:p.Glu1468Gly	Somatic		Capture	Illumina GAIIx	4	73876714	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	19.14	3.769015	0.69992	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.39997	1.05;1.05	5.36	5.36	0.76844	.	0.154190	0.56097	D	0.000022	T	0.43055	0.1230	L	0.29908	0.895	0.52099	D	0.999942	D	0.53312	0.959	P	0.50659	0.647	T	0.44112	-0.9349	10	0.87932	D	0	-10.3741	14.4375	0.67293	0.0:0.0:0.0:1.0	.	1468	Q5QGS0	K2022_HUMAN	G	1468	ENSP00000362567:E1468G;ENSP00000055682:E1468G	ENSP00000055682:E1468G	E	-	2	0	KIAA2022	73876714	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.698000	0.84413	1.789000	0.52484	0.441000	0.28932	GAG		0.473	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Missense_Mutation
ALDH1A1	216	genome.wustl.edu	37	9	75543929	75543929	+	Silent	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr9:75543929C>T	ENST00000297785.3	-	4	375	c.321G>A	c.(319-321)gaG>gaA	p.E107E	ALDH1A1_ENST00000376939.1_Silent_p.E107E|ALDH1A1_ENST00000482210.1_5'UTR	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	107					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)	p.E107E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	CATTCATTGACTCCATTGTCT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	9											106.0	90.0	95.0					9																	75543929		2203	4300	6503	74733749	SO:0001819	synonymous_variant	216			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.321G>A	9.37:g.75543929C>T		Somatic		Capture	Illumina GAIIx	4	74733749	O00768|Q5SYR1	Silent	SNP	ENST00000297785.3	37	CCDS6644.1	SNP	20	WashU																																																																																				0.358	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052679.1			Silent
C17orf70	80233	genome.wustl.edu	37	17	79517853	79517853	+	Missense_Mutation	SNP	C	C	A	rs147464163	byFrequency	TCGA-24-1103-01	TCGA-24-1103-10	C	C	A	A	C	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr17:79517853C>A	ENST00000327787.8	-	3	713	c.667G>T	c.(667-669)Gcc>Tcc	p.A223S	C17orf70_ENST00000537152.1_Missense_Mutation_p.A72S|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	223					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CCGAAGAGGGCGTCCTCCAGC	0.642													C|||	16	0.00319489	0.0113	0.0014	5008	,	,		17395	0.0		0.0	False		,,,				2504	0.0															0			17						C	SER/ALA	37,4365		0,37,2164	20.0	23.0	22.0		667	-1.6	0.0	17	dbSNP_134	22	0,8594		0,0,4297	yes	missense	C17orf70	NM_025161.5	99	0,37,6461	AA,AC,CC		0.0,0.8405,0.2847	possibly-damaging	223/882	79517853	37,12959	2201	4297	6498	77128295	SO:0001583	missense	80233			BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.667G>T	17.37:g.79517853C>A	ENSP00000333283:p.Ala223Ser	LOH		Capture	Illumina GAIIx	4	77128295	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	ENST00000327787.8	37	CCDS32765.2	SNP	27	WashU	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	C	12.58	1.981637	0.34942	0.008405	0.0	ENSG00000185504	ENST00000327787;ENST00000537152;ENST00000541246;ENST00000544302;ENST00000536161	T;T	0.30714	1.52;1.52	4.21	-1.58	0.08479	.	0.735765	0.12718	N	0.444938	T	0.06508	0.0167	L	0.31664	0.95	0.09310	N	1	P	0.38020	0.615	B	0.35727	0.209	T	0.14090	-1.0485	10	0.10377	T	0.69	.	1.106	0.01693	0.1334:0.2729:0.2198:0.374	.	223	Q0VG06	FP100_HUMAN	S	223;72;72;72;163	ENSP00000333283:A223S;ENSP00000440151:A72S	ENSP00000333283:A223S	A	-	1	0	C17orf70	77128295	0.010000	0.17322	0.001000	0.08648	0.393000	0.30537	-0.049000	0.11924	0.100000	0.17581	0.462000	0.41574	GCC		0.642	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161		Missense_Mutation
ALG8	79053	genome.wustl.edu	37	11	77838457	77838457	+	Missense_Mutation	SNP	G	G	C	rs200888240		TCGA-24-1103-01	TCGA-24-1103-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr11:77838457G>C	ENST00000299626.5	-	2	192	c.121C>G	c.(121-123)Cga>Gga	p.R41G	ALG8_ENST00000532552.2_Intron|ALG8_ENST00000376156.3_Missense_Mutation_p.R41G	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	41					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)	p.R41*(1)|p.R41G(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			AGCCAGTTTCGGTGTACTTCA	0.294																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|large_intestine(1)	11											87.0	84.0	85.0					11																	77838457		2200	4292	6492	77516105	SO:0001583	missense	79053			AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.121C>G	11.37:g.77838457G>C	ENSP00000299626:p.Arg41Gly	Somatic		Capture	Illumina GAIIx	4	77516105	A6NDW6|O60860	Missense_Mutation	SNP	ENST00000299626.5	37	CCDS8258.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591780	0.66219	.	.	ENSG00000159063	ENST00000299626;ENST00000376156;ENST00000530454;ENST00000530910;ENST00000525761	D;D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93;-2.93	5.26	4.27	0.50696	.	0.000000	0.85682	D	0.000000	D	0.96852	0.8972	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97315	0.9940	10	0.87932	D	0	-5.172	12.7775	0.57457	0.0:0.0:0.6858:0.3142	.	41;41	Q9BVK2;A6NDW6	ALG8_HUMAN;.	G	41;41;42;32;15	ENSP00000299626:R41G;ENSP00000365326:R41G;ENSP00000434660:R42G;ENSP00000437033:R32G;ENSP00000431357:R15G	ENSP00000299626:R41G	R	-	1	2	ALG8	77516105	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.713000	0.47194	2.458000	0.83093	0.460000	0.39030	CGA		0.294	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390637.1	NM_024079		Missense_Mutation
KCNMA1	3778	genome.wustl.edu	37	10	78944639	78944639	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr10:78944639A>C	ENST00000286628.8	-	4	637	c.638T>G	c.(637-639)tTc>tGc	p.F213C	KCNMA1_ENST00000372440.1_Missense_Mutation_p.F213C|KCNMA1_ENST00000406533.3_Missense_Mutation_p.F213C|KCNMA1_ENST00000286627.5_Missense_Mutation_p.F213C|KCNMA1_ENST00000372443.1_Missense_Mutation_p.F213C|KCNMA1_ENST00000404857.1_Missense_Mutation_p.F213C|KCNMA1_ENST00000354353.5_Missense_Mutation_p.F213C|KCNMA1_ENST00000404771.3_Missense_Mutation_p.F213C	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	213					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.F213C(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CTGTAATGTGAAATCTTTGTA	0.418																																																1	Substitution - Missense(1)	ovary(1)	10											171.0	154.0	160.0					10																	78944639		2203	4300	6503	78614645	SO:0001583	missense	3778			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.638T>G	10.37:g.78944639A>C	ENSP00000286628:p.Phe213Cys	Somatic		Capture	Illumina GAIIx	4	78614645	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		SNP	9	WashU	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	18.17|18.17|18.17	3.564517|3.564517|3.564517	0.65651|0.65651|0.65651	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857|ENST00000372421|ENST00000372403	T;T;T;T;T;T;T;T;T|.|.	0.41400|.|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.|.	5.31|5.31|5.31	5.31|5.31|5.31	0.75309|0.75309|0.75309	.|.|.	0.053287|0.053287|.	0.85682|0.85682|.	D|D|.	0.000000|0.000000|.	T|T|T	0.39708|0.39708|0.39708	0.1088|0.1088|0.1088	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;P;P;P;P;P|.|.	0.54047|.|.	0.964;0.67;0.867;0.67;0.88;0.67|.|.	P;P;P;P;P;P|.|.	0.52267|.|.	0.694;0.497;0.694;0.497;0.694;0.497|.|.	T|T|T	0.32719|0.32719|0.32719	-0.9896|-0.9896|-0.9896	10|6|5	0.39692|.|.	T|.|.	0.17|.|.	-20.8216|-20.8216|-20.8216	15.9692|15.9692|15.9692	0.79998|0.79998|0.79998	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	213;213;213;213;213;213|.|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7|.|.	.;.;.;KCMA1_HUMAN;.;.|.|.	C|L|A	213;150;148;187;150;213;213;187;213;213;213|201|164	ENSP00000361517:F213C;ENSP00000361485:F150C;ENSP00000361514:F148C;ENSP00000396608:F187C;ENSP00000361520:F213C;ENSP00000286627:F213C;ENSP00000385552:F213C;ENSP00000346321:F213C;ENSP00000385806:F213C|.|.	ENSP00000286627:F213C|.|.	F|F|S	-|-|-	2|3|1	0|2|0	KCNMA1|KCNMA1|KCNMA1	78614645|78614645|78614645	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	9.216000|9.216000|9.216000	0.95154|0.95154|0.95154	2.302000|2.302000|2.302000	0.77476|0.77476|0.77476	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TTC|TTT|TCA		0.418	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247		Missense_Mutation
PDE8A	5151	genome.wustl.edu	37	15	85669589	85669589	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr15:85669589A>C	ENST00000310298.4	+	21	2489	c.2237A>C	c.(2236-2238)gAa>gCa	p.E746A	PDE8A_ENST00000557957.1_Missense_Mutation_p.E674A|PDE8A_ENST00000339708.5_Missense_Mutation_p.E700A|PDE8A_ENST00000394553.1_Missense_Mutation_p.E746A			O60658	PDE8A_HUMAN	phosphodiesterase 8A	746	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.E746A(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	CGCATTTCGGAAGAATATTTT	0.433																																																1	Substitution - Missense(1)	ovary(1)	15											75.0	75.0	75.0					15																	85669589		2203	4299	6502	83470593	SO:0001583	missense	5151			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.2237A>C	15.37:g.85669589A>C	ENSP00000311453:p.Glu746Ala	Somatic		Capture	Illumina GAIIx	4	83470593	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	37	CCDS10336.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	23.8	4.453964	0.84209	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.78924	-1.22;-1.22;-1.22	5.27	5.27	0.74061	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.88448	0.6439	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.993;0.998	D	0.89692	0.3898	10	0.59425	D	0.04	.	13.2495	0.60043	1.0:0.0:0.0:0.0	.	700;746	O60658-2;O60658	.;PDE8A_HUMAN	A	746;746;700	ENSP00000311453:E746A;ENSP00000378056:E746A;ENSP00000340679:E700A	ENSP00000311453:E746A	E	+	2	0	PDE8A	83470593	1.000000	0.71417	0.951000	0.38953	0.931000	0.56810	8.775000	0.91772	2.221000	0.72209	0.524000	0.50904	GAA		0.433	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605		Missense_Mutation
AGTPBP1	23287	genome.wustl.edu	37	9	88307703	88307703	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr9:88307703C>T	ENST00000357081.3	-	3	202	c.58G>A	c.(58-60)Gga>Aga	p.G20R	AGTPBP1_ENST00000376081.4_Missense_Mutation_p.G20R|AGTPBP1_ENST00000337006.4_5'UTR|AGTPBP1_ENST00000376080.1_5'Flank|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.G20R|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.G72R			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	20					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.G20R(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						GCCAGGAGTCCTACGATCCTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	9											112.0	99.0	104.0					9																	88307703		2203	4300	6503	87497523	SO:0001583	missense	23287			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.58G>A	9.37:g.88307703C>T	ENSP00000349592:p.Gly20Arg	Somatic		Capture	Illumina GAIIx	4	87497523	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37		SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809505	0.50421	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000376081	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.65	3.74	0.42951	Armadillo-type fold (1);	0.492066	0.21691	N	0.070568	T	0.27349	0.0671	N	0.22421	0.69	0.80722	D	1	P;P;B	0.37276	0.589;0.528;0.302	B;B;B	0.38616	0.154;0.277;0.154	T	0.09552	-1.0669	10	0.62326	D	0.03	-18.3816	5.3957	0.16268	0.0:0.7133:0.0:0.2867	.	72;20;20	Q9UPW5-3;Q9UPW5;Q9UPW5-2	.;CBPC1_HUMAN;.	R	20;20;72;20	ENSP00000349592:G20R;ENSP00000365251:G20R;ENSP00000365277:G72R;ENSP00000365249:G20R	ENSP00000349592:G20R	G	-	1	0	AGTPBP1	87497523	0.837000	0.29446	1.000000	0.80357	0.965000	0.64279	1.033000	0.30191	2.127000	0.65507	0.561000	0.74099	GGA		0.393	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239		Missense_Mutation
RIPK2	8767	genome.wustl.edu	37	8	90782139	90782139	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr8:90782139T>A	ENST00000220751.4	+	4	937	c.623T>A	c.(622-624)aTc>aAc	p.I208N	RIPK2_ENST00000540020.1_Missense_Mutation_p.I71N	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	208	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.I208N(1)		kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			AGGGCCAGTATCAAGCACGAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	8											96.0	97.0	97.0					8																	90782139		2203	4300	6503	90851276	SO:0001583	missense	8767			AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.623T>A	8.37:g.90782139T>A	ENSP00000220751:p.Ile208Asn	Somatic		Capture	Illumina GAIIx	4	90851276	B7Z748|Q6UWF0	Missense_Mutation	SNP	ENST00000220751.4	37	CCDS6247.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	22.9	4.353603	0.82243	.	.	ENSG00000104312	ENST00000220751;ENST00000540020	T;T	0.64618	-0.11;-0.11	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.386589	0.18772	N	0.131597	T	0.56877	0.2015	N	0.13299	0.325	0.40513	D	0.980751	P	0.49961	0.93	P	0.50791	0.65	T	0.63171	-0.6697	10	0.54805	T	0.06	-8.6172	15.5959	0.76578	0.0:0.0:0.0:1.0	.	208	O43353	RIPK2_HUMAN	N	208;71	ENSP00000220751:I208N;ENSP00000441623:I71N	ENSP00000220751:I208N	I	+	2	0	RIPK2	90851276	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.621000	0.83083	2.277000	0.76020	0.528000	0.53228	ATC		0.388	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375686.1			Missense_Mutation
SLC26A7	115111	genome.wustl.edu	37	8	92307822	92307822	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr8:92307822T>G	ENST00000276609.3	+	4	607	c.368T>G	c.(367-369)aTg>aGg	p.M123R	SLC26A7_ENST00000309536.2_Missense_Mutation_p.M123R|SLC26A7_ENST00000523719.1_Missense_Mutation_p.M123R	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.M123R(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CCTCAGAACATGCAGAATCTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	8											168.0	139.0	149.0					8																	92307822		2203	4300	6503	92376998	SO:0001583	missense	115111			AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.368T>G	8.37:g.92307822T>G	ENSP00000276609:p.Met123Arg	Somatic		Capture	Illumina GAIIx	4	92376998		Missense_Mutation	SNP	ENST00000276609.3	37	CCDS6254.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	0.094	-1.162834	0.01673	.	.	ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536	D;D;D;D	0.92397	-2.8;-3.03;-3.03;-3.03	5.48	-1.15	0.09709	.	0.939018	0.09099	N	0.848762	T	0.79470	0.4451	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.62812	-0.6775	10	0.16420	T	0.52	.	1.8096	0.03087	0.2042:0.1032:0.4224:0.2702	.	123;123	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	R	123	ENSP00000428881:M123R;ENSP00000428849:M123R;ENSP00000276609:M123R;ENSP00000309504:M123R	ENSP00000276609:M123R	M	+	2	0	SLC26A7	92376998	0.012000	0.17670	0.014000	0.15608	0.171000	0.22731	0.598000	0.24074	-0.607000	0.05738	-0.376000	0.06991	ATG		0.483	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			Missense_Mutation
TRRAP	8295	genome.wustl.edu	37	7	98601890	98601890	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr7:98601890G>C	ENST00000359863.4	+	67	10554	c.10345G>C	c.(10345-10347)Gag>Cag	p.E3449Q	TRRAP_ENST00000355540.3_Missense_Mutation_p.E3420Q|TRRAP_ENST00000446306.3_Missense_Mutation_p.E3438Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3449					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.E3420Q(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CAAAATCTTGGAGGCCAAGAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											87.0	99.0	95.0					7																	98601890		2203	4300	6503	98439826	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10345G>C	7.37:g.98601890G>C	ENSP00000352925:p.Glu3449Gln	Somatic		Capture	Illumina GAIIx	4	98439826	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	SNP	41	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.067014|5.067014	0.93898|0.93898	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.81415|.	-1.49;-1.49|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70657|0.70657	0.3249|0.3249	L|L	0.49571|0.49571	1.57|1.57	0.80722|0.80722	D|D	1|1	D;D;D|.	0.57899|.	0.981;0.968;0.968|.	P;P;P|.	0.52554|.	0.702;0.53;0.53|.	T|T	0.66571|0.66571	-0.5890|-0.5890	10|5	0.38643|.	T|.	0.18|.	.|.	19.3185|19.3185	0.94226|0.94226	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3420;3177;3449|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	Q|C	3449;3420;3437|3177	ENSP00000352925:E3449Q;ENSP00000347733:E3420Q|.	ENSP00000347733:E3420Q|.	E|W	+|+	1|3	0|0	TRRAP|TRRAP	98439826|98439826	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	9.869000|9.869000	0.99810|0.99810	2.574000|2.574000	0.86865|0.86865	0.650000|0.650000	0.86243|0.86243	GAG|TGG		0.393	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		Missense_Mutation
DNM1P47	100216544	genome.wustl.edu	37	15	102304869	102304869	+	RNA	SNP	T	T	C	rs202067427		TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	C	T	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr15:102304869T>C	ENST00000561463.1	+	0	12915									DNM1 pseudogene 47																		GTCCAACCTGTACTCGCGTGG	0.572																																																0			15																																								100122392						AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304869T>C		Germline		Capture	Illumina GAIIx	4	100122392		Missense_Mutation	SNP	ENST00000561463.1	37		SNP	57	WashU																																																																																				0.572	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149		Missense_Mutation
AHNAK2	113146	genome.wustl.edu	37	14	105406647	105406647	+	Silent	SNP	A	A	C			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr14:105406647A>C	ENST00000333244.5	-	7	15260	c.15141T>G	c.(15139-15141)ccT>ccG	p.P5047P	AHNAK2_ENST00000557457.1_Silent_p.P45P	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5047						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P17P(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TAGAAAGGGAAGGATCCACGT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	14											112.0	116.0	115.0					14																	105406647		2018	4189	6207	104477692	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.15141T>G	14.37:g.105406647A>C		Somatic		Capture	Illumina GAIIx	4	104477692	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	3	WashU																																																																																				0.547	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Silent
VAV3	10451	genome.wustl.edu	37	1	108313293	108313293	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:108313293C>A	ENST00000370056.4	-	6	887	c.613G>T	c.(613-615)Gaa>Taa	p.E205*	VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Nonsense_Mutation_p.E205*|VAV3_ENST00000371846.4_Nonsense_Mutation_p.E140*	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	205	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.E205*(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GTATATTTTTCTTCTGTCTGC	0.279																																																1	Substitution - Nonsense(1)	ovary(1)	1											119.0	122.0	121.0					1																	108313293		2201	4298	6499	108114816	SO:0001587	stop_gained	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.613G>T	1.37:g.108313293C>A	ENSP00000359073:p.Glu205*	Somatic		Capture	Illumina GAIIx	4	108114816	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Nonsense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	SNP	32	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.834150|5.834150	0.97003|0.97003	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.052398|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75781	.|0.3896	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73084	.|-0.4094	.|3	0.33940|.	T|.	0.23|.	.|.	20.0706|20.0706	0.97721|0.97721	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|N	205;205;140|199	.|.	ENSP00000359073:E205X|.	E|K	-|-	1|3	0|2	VAV3|VAV3	108114816|108114816	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	7.229000|7.229000	0.78088|0.78088	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	GAA|AAG		0.279	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		Nonsense_Mutation
CHIA	27159	genome.wustl.edu	37	1	111861300	111861300	+	Splice_Site	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:111861300G>A	ENST00000369740.1	+	9	1018	c.915G>A	c.(913-915)gaG>gaA	p.E305E	CHIA_ENST00000451398.2_Splice_Site_p.E144E|CHIA_ENST00000343320.6_Splice_Site_p.E305E|CHIA_ENST00000353665.6_Splice_Site_p.E144E|CHIA_ENST00000430615.1_Splice_Site_p.E197E|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Splice_Site_p.E144E	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	305					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)	p.E197E(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CTTACTACGAGGTATGTAGAT	0.517																																																1	Substitution - coding silent(1)	ovary(1)	1											110.0	109.0	109.0					1																	111861300		2203	4300	6503	111662823	SO:0001630	splice_region_variant	27159			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.915+1G>A	1.37:g.111861300G>A		Somatic		Capture	Illumina GAIIx	4	111662823	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	ENST00000369740.1	37	CCDS41368.1	SNP	35	WashU																																																																																				0.517	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		Silent	Silent
DRD3	1814	genome.wustl.edu	37	3	113890742	113890742	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:113890742G>T	ENST00000460779.1	-	3	387	c.98C>A	c.(97-99)gCc>gAc	p.A33D	DRD3_ENST00000467632.1_Missense_Mutation_p.A33D|DRD3_ENST00000295881.7_Missense_Mutation_p.A33D|DRD3_ENST00000383673.2_Missense_Mutation_p.A33D	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	33					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)	p.A33D(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTAGGAGAGGGCATAGTAGGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											55.0	49.0	51.0					3																	113890742		2203	4300	6503	115373432	SO:0001583	missense	1814				CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.98C>A	3.37:g.113890742G>T	ENSP00000419402:p.Ala33Asp	Somatic		Capture	Illumina GAIIx	4	115373432	A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	CCDS2978.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.160755	0.94727	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.52948	0.1766	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.981	D;D;D;P	0.87578	0.998;0.998;0.998;0.704	T	0.58792	-0.7574	10	0.87932	D	0	.	18.4938	0.90856	0.0:0.0:1.0:0.0	.	33;33;33;33	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	D	33	ENSP00000419402:A33D;ENSP00000420662:A33D;ENSP00000373169:A33D;ENSP00000295881:A33D	ENSP00000281274:A33D	A	-	2	0	DRD3	115373432	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.597000	0.98273	2.603000	0.88011	0.655000	0.94253	GCC		0.617	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3		Missense_Mutation
DPP10	57628	genome.wustl.edu	37	2	116447457	116447457	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr2:116447457T>A	ENST00000410059.1	+	7	1016	c.536T>A	c.(535-537)gTc>gAc	p.V179D	DPP10_ENST00000488208.1_3'UTR|DPP10_ENST00000393147.2_Missense_Mutation_p.V183D|DPP10_ENST00000409163.1_Missense_Mutation_p.V129D|DPP10_ENST00000310323.8_Missense_Mutation_p.V172D	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	179						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.V172D(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GAGGACTCCGTCTTGCAGTAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											84.0	91.0	89.0					2																	116447457		2203	4300	6503	116163927	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.536T>A	2.37:g.116447457T>A	ENSP00000386565:p.Val179Asp	Somatic		Capture	Illumina GAIIx	4	116163927	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	14.11	2.436658	0.43224	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	5.44	5.44	0.79542	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.225321	0.36778	N	0.002414	T	0.33235	0.0856	N	0.17872	0.535	0.58432	D	0.999996	B;D;P;P	0.61697	0.409;0.99;0.464;0.464	B;P;P;B	0.58780	0.243;0.845;0.456;0.356	T	0.05971	-1.0853	10	0.23302	T	0.38	-12.1613	13.2317	0.59947	0.0:0.0:0.0:1.0	.	172;183;175;179	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	D	179;129;175;183;172;129	ENSP00000386565:V179D;ENSP00000387038:V129D;ENSP00000376854:V175D;ENSP00000376855:V183D;ENSP00000309066:V172D	ENSP00000309066:V172D	V	+	2	0	DPP10	116163927	0.767000	0.28508	0.968000	0.41197	0.968000	0.65278	4.987000	0.63857	2.058000	0.61347	0.477000	0.44152	GTC		0.438	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		Missense_Mutation
ATP1A1	476	genome.wustl.edu	37	1	116932964	116932964	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:116932964C>T	ENST00000295598.5	+	9	1405	c.1153C>T	c.(1153-1155)Cgg>Tgg	p.R385W	ATP1A1_ENST00000369496.4_Missense_Mutation_p.R354W|ATP1A1_ENST00000537345.1_Missense_Mutation_p.R385W	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	385					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.R385W(1)		NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	GACTCAGAACCGGATGACAGT	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	74.0	77.0					1																	116932964		2203	4300	6503	116734487	SO:0001583	missense	476			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1153C>T	1.37:g.116932964C>T	ENSP00000295598:p.Arg385Trp	Somatic		Capture	Illumina GAIIx	4	116734487	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730188	0.89390	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	D;D;D	0.96334	-3.98;-3.98;-3.98	4.87	4.87	0.63330	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.98695	0.9562	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99675	1.0997	10	0.87932	D	0	.	18.2082	0.89861	0.0:1.0:0.0:0.0	.	385;385	F5H3A1;P05023	.;AT1A1_HUMAN	W	385;385;384;354	ENSP00000295598:R385W;ENSP00000445306:R385W;ENSP00000358508:R354W	ENSP00000295598:R385W	R	+	1	2	ATP1A1	116734487	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.790000	0.38734	2.558000	0.86282	0.650000	0.86243	CGG		0.493	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233		Missense_Mutation
DOCK11	139818	genome.wustl.edu	37	X	117699974	117699974	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chrX:117699974A>G	ENST00000276202.7	+	8	763	c.700A>G	c.(700-702)Aaa>Gaa	p.K234E	DOCK11_ENST00000276204.6_Missense_Mutation_p.K234E	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	234	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K234E(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CTAGTGCCCCAAAATGCGCCG	0.353																																																1	Substitution - Missense(1)	ovary(1)	X											126.0	126.0	126.0					X																	117699974		2203	4300	6503	117584002	SO:0001583	missense	139818			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.700A>G	X.37:g.117699974A>G	ENSP00000276202:p.Lys234Glu	Somatic		Capture	Illumina GAIIx	4	117584002	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	24.6	4.547337	0.86022	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.02916	4.11;4.11	5.48	5.48	0.80851	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.048021	0.85682	D	0.000000	T	0.11324	0.0276	L	0.54323	1.7	0.58432	D	0.999999	P	0.52842	0.956	D	0.68765	0.96	T	0.01791	-1.1273	10	0.46703	T	0.11	-9.585	14.3048	0.66377	1.0:0.0:0.0:0.0	.	234	Q5JSL3	DOC11_HUMAN	E	234	ENSP00000276204:K234E;ENSP00000276202:K234E	ENSP00000276202:K234E	K	+	1	0	DOCK11	117584002	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.013000	0.76373	1.837000	0.53436	0.345000	0.21793	AAA		0.353	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		Missense_Mutation
DCBLD1	285761	genome.wustl.edu	37	6	117853527	117853527	+	Silent	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr6:117853527G>T	ENST00000338728.5	+	6	810	c.690G>T	c.(688-690)ggG>ggT	p.G230G	GOPC_ENST00000467125.1_Intron|DCBLD1_ENST00000296955.8_Silent_p.G230G|DCBLD1_ENST00000368503.4_Silent_p.G230G			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	230	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G230G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		GATATGAAGGGATTCTGGCCA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	6											236.0	193.0	208.0					6																	117853527		2203	4300	6503	117960220	SO:0001819	synonymous_variant	285761			AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.690G>T	6.37:g.117853527G>T		Somatic		Capture	Illumina GAIIx	4	117960220	Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Silent	SNP	ENST00000338728.5	37		SNP	41	WashU																																																																																				0.433	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000041979.2	NM_173674		Silent
SPAG17	200162	genome.wustl.edu	37	1	118506476	118506476	+	Silent	SNP	T	T	C			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:118506476T>C	ENST00000336338.5	-	48	6683	c.6618A>G	c.(6616-6618)acA>acG	p.T2206T	WDR3_ENST00000349139.5_3'UTR	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	2206						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.T2206T(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		AGGAATAAATTGTAGAAGTTC	0.348																																																1	Substitution - coding silent(1)	ovary(1)	1											116.0	120.0	119.0					1																	118506476		2203	4300	6503	118307999	SO:0001819	synonymous_variant	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.6618A>G	1.37:g.118506476T>C		Somatic		Capture	Illumina GAIIx	4	118307999	Q8NAZ1|Q9NT21	Silent	SNP	ENST00000336338.5	37	CCDS899.1	SNP	63	WashU																																																																																				0.348	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		Silent
AACS	65985	genome.wustl.edu	37	12	125609498	125609498	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr12:125609498C>T	ENST00000316519.6	+	12	1443	c.1237C>T	c.(1237-1239)Cca>Tca	p.P413S	AACS_ENST00000261686.6_Missense_Mutation_p.P413S|AACS_ENST00000545511.1_5'UTR|AACS_ENST00000316543.10_Missense_Mutation_p.P11S	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	413					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)	p.P413S(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		CACTGGCTCCCCACTGAAAGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	87.0	89.0					12																	125609498		2203	4300	6503	124175451	SO:0001583	missense	65985			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1237C>T	12.37:g.125609498C>T	ENSP00000324842:p.Pro413Ser	Somatic		Capture	Illumina GAIIx	4	124175451	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	37	CCDS9263.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883264	0.91740	.	.	ENSG00000081760	ENST00000316519;ENST00000261686;ENST00000441247;ENST00000316543;ENST00000538851	T;T;T;T;T	0.56275	2.51;2.51;0.47;2.51;0.47	4.85	4.85	0.62838	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.81600	-0.0859	10	0.62326	D	0.03	.	17.9935	0.89176	0.0:1.0:0.0:0.0	.	413;413	Q86V21-2;Q86V21	.;AACS_HUMAN	S	413;413;232;11;78	ENSP00000324842:P413S;ENSP00000261686:P413S;ENSP00000392967:P232S;ENSP00000324929:P11S;ENSP00000441686:P78S	ENSP00000261686:P413S	P	+	1	0	AACS	124175451	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	7.007000	0.76335	2.237000	0.73441	0.462000	0.41574	CCA		0.557	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928		Missense_Mutation
FER1L6	654463	genome.wustl.edu	37	8	125109589	125109589	+	Silent	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr8:125109589G>A	ENST00000522917.1	+	36	4979	c.4773G>A	c.(4771-4773)agG>agA	p.R1591R	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Silent_p.R1591R	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1591	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)		p.R1591R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCTCTCCAAGGCGACCCAAAG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	8											84.0	80.0	81.0					8																	125109589		1943	4163	6106	125178770	SO:0001819	synonymous_variant	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4773G>A	8.37:g.125109589G>A		Somatic		Capture	Illumina GAIIx	4	125178770		Silent	SNP	ENST00000522917.1	37	CCDS43767.1	SNP	42	WashU																																																																																				0.483	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		Silent
MKI67	4288	genome.wustl.edu	37	10	129901238	129901238	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr10:129901238G>C	ENST00000368654.3	-	13	9241	c.8866C>G	c.(8866-8868)Cta>Gta	p.L2956V	MKI67_ENST00000368653.3_Missense_Mutation_p.L2596V	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2956					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.L2956V(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GATATTTTTAGAGGTTTTCCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	10											91.0	98.0	96.0					10																	129901238		2203	4300	6503	129791228	SO:0001583	missense	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8866C>G	10.37:g.129901238G>C	ENSP00000357643:p.Leu2956Val	Somatic		Capture	Illumina GAIIx	4	129791228	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	10.26	1.302197	0.23736	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01838	4.65;4.61	3.91	3.01	0.34805	.	1.287800	0.06003	N	0.648194	T	0.01695	0.0054	N	0.12746	0.255	0.09310	N	1	B;B;P	0.43750	0.172;0.311;0.816	B;B;B	0.36766	0.058;0.147;0.232	T	0.49771	-0.8904	10	0.24483	T	0.36	.	8.9845	0.35986	0.0:0.2887:0.7113:0.0	.	2955;2596;2956	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	V	2956;2596;2955	ENSP00000357643:L2956V;ENSP00000357642:L2596V	ENSP00000357642:L2596V	L	-	1	2	MKI67	129791228	0.004000	0.15560	0.012000	0.15200	0.011000	0.07611	0.562000	0.23531	0.997000	0.38969	0.561000	0.74099	CTA		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		Missense_Mutation
FAM135B	51059	genome.wustl.edu	37	8	139153454	139153454	+	Silent	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr8:139153454G>C	ENST00000395297.1	-	17	3947	c.3777C>G	c.(3775-3777)acC>acG	p.T1259T		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1259								p.T1259T(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TACTAACCAGGGTGCTGTTGT	0.542										HNSCC(54;0.14)																																						2	Substitution - coding silent(2)	ovary(2)	8											117.0	122.0	120.0					8																	139153454		1932	4128	6060	139222636	SO:0001819	synonymous_variant	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3777C>G	8.37:g.139153454G>C		Somatic		Capture	Illumina GAIIx	4	139222636	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	CCDS6375.2	SNP	43	WashU																																																																																				0.542	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		Silent
DZIP1L	199221	genome.wustl.edu	37	3	137822448	137822448	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:137822448C>G	ENST00000327532.2	-	2	728	c.366G>C	c.(364-366)caG>caC	p.Q122H	DZIP1L_ENST00000469243.1_Missense_Mutation_p.Q122H	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	122					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)	p.Q122H(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						GACCACGCTGCTGCTGGCCCA	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											21.0	18.0	19.0					3																	137822448		2202	4298	6500	139305138	SO:0001583	missense	199221			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.366G>C	3.37:g.137822448C>G	ENSP00000332148:p.Gln122His	Somatic		Capture	Illumina GAIIx	4	139305138	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	6.255	0.415183	0.11870	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.42131	1.1;0.98	5.19	1.01	0.19927	.	0.320133	0.26489	N	0.024084	T	0.20820	0.0501	N	0.22421	0.69	0.09310	N	1	B;B	0.27192	0.054;0.171	B;B	0.29785	0.065;0.107	T	0.10636	-1.0621	10	0.15499	T	0.54	-21.1265	1.7533	0.02976	0.1291:0.3938:0.252:0.2252	.	122;122	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	H	122	ENSP00000332148:Q122H;ENSP00000419486:Q122H	ENSP00000332148:Q122H	Q	-	3	2	DZIP1L	139305138	0.998000	0.40836	0.620000	0.29132	0.882000	0.50991	0.753000	0.26376	0.175000	0.19841	0.655000	0.94253	CAG		0.657	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1	NM_173543		Missense_Mutation
PCDHGA12	26025	genome.wustl.edu	37	5	140890625	140890625	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr5:140890625T>G	ENST00000252085.3	+	4	2826	c.2684T>G	c.(2683-2685)gTc>gGc	p.V895G	PCDHGB6_ENST00000520790.1_Missense_Mutation_p.V893G|PCDHGA4_ENST00000571252.1_Missense_Mutation_p.V894G|PCDHGA11_ENST00000398587.2_Missense_Mutation_p.V898G|PCDHGA5_ENST00000518069.1_Missense_Mutation_p.V894G|PCDHGB4_ENST00000519479.1_Missense_Mutation_p.V886G|PCDHGB3_ENST00000576222.1_Missense_Mutation_p.V892G|PCDHGA6_ENST00000517434.1_Missense_Mutation_p.V895G|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.V713G|PCDHGB2_ENST00000522605.1_Missense_Mutation_p.V894G|PCDHGA8_ENST00000398604.2_Missense_Mutation_p.V895G|PCDHGA7_ENST00000518325.1_Missense_Mutation_p.V895G|PCDHGC3_ENST00000308177.3_Missense_Mutation_p.V897G|PCDHGA2_ENST00000394576.2_Missense_Mutation_p.V895G|PCDHGB1_ENST00000523390.1_Missense_Mutation_p.V890G|PCDHGC5_ENST00000252087.1_Missense_Mutation_p.V907G|PCDHGC4_ENST00000306593.1_Missense_Mutation_p.V901G|PCDHGB7_ENST00000398594.2_Missense_Mutation_p.V892G|PCDHGA10_ENST00000398610.2_Missense_Mutation_p.V899G|PCDHGA3_ENST00000253812.6_Missense_Mutation_p.V895G|PCDHGA1_ENST00000517417.1_Missense_Mutation_p.V894G|PCDHGA9_ENST00000573521.1_Missense_Mutation_p.V895G	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	895					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V897G(2)|p.V907G(2)|p.V895G(2)|p.V901G(1)|p.V892G(1)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCAGAATGTCTACATCCCA	0.642																																																8	Substitution - Missense(8)	ovary(8)	5											93.0	91.0	91.0					5																	140890625		2203	4300	6503	140870809	SO:0001583	missense	56097			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2684T>G	5.37:g.140890625T>G	ENSP00000252085:p.Val895Gly	Somatic		Capture	Illumina GAIIx	4	140870809	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222860	0.79464	.	.	ENSG00000204956;ENSG00000081853;ENSG00000254245;ENSG00000254221;ENSG00000253910;ENSG00000253485;ENSG00000253731;ENSG00000253537;ENSG00000253953;ENSG00000253767;ENSG00000253305;ENSG00000253846;ENSG00000254122;ENSG00000253873;ENSG00000253873;ENSG00000253159;ENSG00000240184;ENSG00000242419;ENSG00000240764	ENST00000517417;ENST00000394576;ENST00000253812;ENST00000523390;ENST00000522605;ENST00000518069;ENST00000517434;ENST00000518325;ENST00000519479;ENST00000398604;ENST00000520790;ENST00000398610;ENST00000398594;ENST00000398587;ENST00000518882;ENST00000252085;ENST00000308177;ENST00000306593;ENST00000252087	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.65916	0.4;0.34;0.43;0.29;0.29;0.37;0.53;0.33;0.26;0.35;0.3;0.35;0.28;0.45;-0.18;0.37;0.34;0.22;0.35	4.9	4.9	0.64082	.	0.000000	0.42821	D	0.000659	T	0.73353	0.3576	L	0.47716	1.5	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;0.999;0.993;1.0;0.981;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.986;1.0;1.0;0.751	D;D;D;D;D;D;D;D;D;P;D;P;D;D;D;D;D;D;D;D;P;D;D;P	0.97110	0.98;0.984;0.998;0.973;0.986;0.994;0.993;0.984;0.98;0.738;0.996;0.599;0.999;0.984;0.999;0.999;0.984;0.999;0.984;0.999;0.738;0.992;1.0;0.488	T	0.76479	-0.2944	10	0.87932	D	0	.	14.6811	0.69017	0.0:0.0:0.0:1.0	.	907;901;97;897;895;898;713;892;899;893;895;886;895;886;895;895;892;894;894;894;890;895;895;894	Q9Y5F6;Q9Y5F7;Q9BR81;Q9UN70;O60330;Q9Y5H2;Q9Y5H2-3;Q9Y5F8;Q9Y5H3;Q9Y5F9;Q9Y5G4;Q9Y5G0;Q9Y5G5;Q9UN71;Q9Y5G6;Q9Y5G7;Q9Y5G1;Q9Y5G8;Q9Y5G2;Q9Y5G9;Q9Y5G3;Q9Y5H0;Q9Y5H1;Q9Y5H4	PCDGM_HUMAN;PCDGL_HUMAN;.;PCDGK_HUMAN;PCDGC_HUMAN;PCDGB_HUMAN;.;PCDGJ_HUMAN;PCDGA_HUMAN;PCDGI_HUMAN;PCDG9_HUMAN;PCDGH_HUMAN;PCDG8_HUMAN;PCDGG_HUMAN;PCDG7_HUMAN;PCDG6_HUMAN;PCDGF_HUMAN;PCDG5_HUMAN;PCDGE_HUMAN;PCDG4_HUMAN;PCDGD_HUMAN;PCDG3_HUMAN;PCDG2_HUMAN;PCDG1_HUMAN	G	894;895;895;890;894;894;895;895;886;895;893;899;892;898;713;895;897;901;907	ENSP00000431083:V894G;ENSP00000378077:V895G;ENSP00000253812:V895G;ENSP00000429273:V890G;ENSP00000429018:V894G;ENSP00000429834:V894G;ENSP00000429601:V895G;ENSP00000430024:V895G;ENSP00000428288:V886G;ENSP00000381605:V895G;ENSP00000428603:V893G;ENSP00000381611:V899G;ENSP00000381594:V892G;ENSP00000381589:V898G;ENSP00000428333:V713G;ENSP00000252085:V895G;ENSP00000312070:V897G;ENSP00000306918:V901G;ENSP00000252087:V907G	ENSP00000381611:V899G	V	+	2	0	PCDHGA12;PCDHGA10;PCDHGA11;PCDHGB7;PCDHGA8;PCDHGC5;PCDHGA7;PCDHGB6;PCDHGC4;PCDHGA6;PCDHGC3;PCDHGA5;PCDHGA3;PCDHGB2;PCDHGA2;PCDHGA1;PCDHGB4;PCDHGB1	140870809	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.441000	0.80485	2.054000	0.61138	0.418000	0.28097	GTC		0.642	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735		Missense_Mutation
ZBTB38	253461	genome.wustl.edu	37	3	141164553	141164553	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:141164553C>A	ENST00000514251.1	+	4	3602	c.3323C>A	c.(3322-3324)aCc>aAc	p.T1108N	ZBTB38_ENST00000321464.5_Missense_Mutation_p.T1109N|ZBTB38_ENST00000441582.2_Missense_Mutation_p.T1108N					zinc finger and BTB domain containing 38									p.T1108N(1)		breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						TATCTCTCCACCAAAAGGAAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											88.0	83.0	85.0					3																	141164553		1908	4133	6041	142647243	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.3323C>A	3.37:g.141164553C>A	ENSP00000426387:p.Thr1108Asn	Somatic		Capture	Illumina GAIIx	4	142647243		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565998	0.65651	.	.	ENSG00000177311	ENST00000514251;ENST00000441582;ENST00000321464	T;T;T	0.09163	3.01;3.01;3.02	5.81	5.81	0.92471	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23249	0.0562	L	0.28649	0.875	0.40009	D	0.975264	D;D	0.76494	0.999;0.999	D;D	0.68765	0.96;0.96	T	0.01021	-1.1478	9	.	.	.	-27.2877	20.0826	0.97783	0.0:1.0:0.0:0.0	.	1109;1108	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	N	1108;1108;1109	ENSP00000426387:T1108N;ENSP00000406955:T1108N;ENSP00000372635:T1109N	.	T	+	2	0	ZBTB38	142647243	1.000000	0.71417	0.964000	0.40570	0.991000	0.79684	5.951000	0.70273	2.746000	0.94184	0.655000	0.94253	ACC		0.458	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			Missense_Mutation
RASA2	5922	genome.wustl.edu	37	3	141231095	141231095	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:141231095G>A	ENST00000452898.1	+	2	259	c.224G>A	c.(223-225)cGt>cAt	p.R75H	RASA2_ENST00000286364.3_Missense_Mutation_p.R75H	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	75	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.R75H(1)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						GAAGTTTATCGTACCCAAGTT	0.308																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	72.0	71.0					3																	141231095		2203	4298	6501	142713785	SO:0001583	missense	5922			AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.224G>A	3.37:g.141231095G>A	ENSP00000391677:p.Arg75His	Somatic		Capture	Illumina GAIIx	4	142713785	A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Missense_Mutation	SNP	ENST00000452898.1	37		SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	28.1	4.894393	0.91889	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	T;T	0.73469	-0.75;-0.75	5.37	5.37	0.77165	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.89667	0.6781	M	0.92923	3.36	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.92012	0.5619	10	0.87932	D	0	.	17.8765	0.88826	0.0:0.0:1.0:0.0	.	75;75;75	A8K7K1;G3V0F9;Q15283	.;.;RASA2_HUMAN	H	75	ENSP00000286364:R75H;ENSP00000391677:R75H	ENSP00000286364:R75H	R	+	2	0	RASA2	142713785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.184000	0.89702	2.513000	0.84729	0.655000	0.94253	CGT		0.308	RASA2-201	KNOWN	basic	protein_coding	protein_coding		NM_006506		Missense_Mutation
F8	2157	genome.wustl.edu	37	X	154133086	154133086	+	Splice_Site	SNP	C	C	A			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chrX:154133086C>A	ENST00000360256.4	-	16	5786	c.5586G>T	c.(5584-5586)ctG>ctT	p.L1862L		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1862	F5/8 type A 3.|Plastocyanin-like 5.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.L1862L(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	ACCTGCTTACCAGGTCAACAT	0.373																																																2	Substitution - coding silent(2)	ovary(2)	X	GRCh37	CS910427	F8	S							92.0	76.0	81.0					X																	154133086		2203	4300	6503	153786280	SO:0001630	splice_region_variant	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5586+1G>T	X.37:g.154133086C>A		Somatic		Capture	Illumina GAIIx	4	153786280	Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	CCDS35457.1	SNP	21	WashU																																																																																				0.373	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		Silent	Silent
NTRK1	4914	genome.wustl.edu	37	1	156837923	156837923	+	Silent	SNP	T	T	C			TCGA-24-1103-01	TCGA-24-1103-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:156837923T>C	ENST00000524377.1	+	5	497	c.456T>C	c.(454-456)tgT>tgC	p.C152C	NTRK1_ENST00000392302.2_Silent_p.C122C|NTRK1_ENST00000358660.3_Silent_p.C152C|NTRK1_ENST00000368196.3_Silent_p.C152C	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	152	LRRCT.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.C152C(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CTCTGCACTGTTCTTGTGCCC	0.637			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	1	Substitution - coding silent(1)	ovary(1)	1											65.0	71.0	69.0					1																	156837923		2203	4300	6503	155104547	SO:0001819	synonymous_variant	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.456T>C	1.37:g.156837923T>C		Somatic		Capture	Illumina GAIIx	4	155104547	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	ENST00000524377.1	37	CCDS1161.1	SNP	60	WashU																																																																																				0.637	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529		Silent
ITK	3702	genome.wustl.edu	37	5	156635998	156635998	+	Silent	SNP	G	G	A	rs201403794	byFrequency	TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr5:156635998G>A	ENST00000422843.3	+	2	389	c.237G>A	c.(235-237)ccG>ccA	p.P79P	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	79	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.P79P(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	ATAAATACCCGTTTCAGGTAA	0.488			T	SYK	peripheral T-cell lymphoma								G|||	2	0.000399361	0.0	0.0	5008	,	,		19090	0.0		0.001	False		,,,				2504	0.001				Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - coding silent(1)	ovary(1)	5						G		0,4406		0,0,2203	112.0	96.0	101.0		237	-10.6	0.9	5		101	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ITK	NM_005546.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		79/621	156635998	2,13004	2203	4300	6503	156568576	SO:0001819	synonymous_variant	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.237G>A	5.37:g.156635998G>A		Somatic		Capture	Illumina GAIIx	4	156568576	B2R752|Q32ML7	Silent	SNP	ENST00000422843.3	37	CCDS4336.1	SNP	40	WashU																																																																																				0.488	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			Silent
MLLT4	4301	genome.wustl.edu	37	6	168352358	168352358	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1103-01	TCGA-24-1103-10	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr6:168352358A>T	ENST00000447894.2	+	29	4303	c.4303A>T	c.(4303-4305)Aga>Tga	p.R1435*	MLLT4_ENST00000366806.2_Nonsense_Mutation_p.R1435*|MLLT4_ENST00000392108.3_Nonsense_Mutation_p.R1435*|MLLT4_ENST00000392112.1_Nonsense_Mutation_p.R1418*|MLLT4_ENST00000351017.4_Nonsense_Mutation_p.R1442*|MLLT4_ENST00000400822.3_Nonsense_Mutation_p.R1434*|MLLT4_ENST00000344191.4_Nonsense_Mutation_p.R1435*			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1435					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.R1419*(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GAGGAAGCGGAGAGAGCAGGA	0.577			T	MLL	AL																																		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	1	Substitution - Nonsense(1)	ovary(1)	6											114.0	102.0	106.0					6																	168352358		2203	4300	6503	168095207	SO:0001587	stop_gained	4301			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4303A>T	6.37:g.168352358A>T	ENSP00000404595:p.Arg1435*	Somatic		Capture	Illumina GAIIx	4	168095207	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Nonsense_Mutation	SNP	ENST00000447894.2	37		SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	40	7.991058	0.98599	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	.	.	.	5.39	-4.33	0.03677	.	0.061991	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5143	22.3932	0.99971	0.1974:0.8026:0.0:0.0	.	.	.	.	X	1435;1442;1435;1435;1418;1435;1434;1435	.	ENSP00000345834:R1435X	R	+	1	2	MLLT4	168095207	0.008000	0.16893	0.000000	0.03702	0.003000	0.03518	0.004000	0.13106	-1.374000	0.02131	-0.488000	0.04728	AGA		0.577	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936		Nonsense_Mutation
HNRNPA3	220988	genome.wustl.edu	37	2	178082496	178082496	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr2:178082496G>T	ENST00000392524.2	+	8	1121	c.884G>T	c.(883-885)gGa>gTa	p.G295V	HNRNPA3_ENST00000411529.2_Missense_Mutation_p.G273V|HNRNPA3_ENST00000435711.1_Missense_Mutation_p.G295V			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	295	Gly-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G295V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						GGTGGACCAGGATATGGAAAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											163.0	154.0	157.0					2																	178082496		2203	4297	6500	177790742	SO:0001583	missense	220988			AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.884G>T	2.37:g.178082496G>T	ENSP00000376309:p.Gly295Val	Somatic		Capture	Illumina GAIIx	4	177790742	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	ENST00000392524.2	37	CCDS2273.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	g	15.22	2.769835	0.49680	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711	D;D;D	0.91295	-2.82;-2.82;-2.82	4.42	4.42	0.53409	.	0.000000	0.40222	U	0.001144	D	0.90003	0.6879	M	0.86740	2.835	0.80722	D	1	P;P	0.43287	0.614;0.802	B;B	0.37550	0.253;0.253	D	0.88920	0.3365	10	0.19590	T	0.45	.	14.0005	0.64431	0.0:0.1526:0.8474:0.0	.	273;295	B4DDB6;P51991	.;ROA3_HUMAN	V	295;273;239;240;295	ENSP00000376309:G295V;ENSP00000408487:G273V;ENSP00000416340:G295V	ENSP00000376309:G295V	G	+	2	0	HNRNPA3	177790742	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.782000	0.85680	2.215000	0.71742	0.472000	0.43445	GGA		0.438	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255729.3	NM_194247		Missense_Mutation
FAT1	2195	genome.wustl.edu	37	4	187630513	187630513	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr4:187630513A>G	ENST00000441802.2	-	2	678	c.469T>C	c.(469-471)Tct>Cct	p.S157P		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	157	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S157P(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCAGGTAAAGAAACGCTGTAT	0.448										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											184.0	191.0	189.0					4																	187630513		2162	4272	6434	187867507	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.469T>C	4.37:g.187630513A>G	ENSP00000406229:p.Ser157Pro	Somatic		Capture	Illumina GAIIx	4	187867507		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	18.61	3.660715	0.67586	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	T;T	0.56444	0.46;0.46	5.1	5.1	0.69264	Cadherin (3);Cadherin-like (1);	0.051794	0.85682	D	0.000000	T	0.73505	0.3595	M	0.85041	2.73	0.58432	D	0.999999	D	0.61697	0.99	D	0.65773	0.938	T	0.77928	-0.2404	10	0.56958	D	0.05	.	14.6965	0.69126	1.0:0.0:0.0:0.0	.	157	Q14517	FAT1_HUMAN	P	157	ENSP00000406229:S157P;ENSP00000423736:S157P	ENSP00000260147:S157P	S	-	1	0	FAT1	187867507	1.000000	0.71417	0.257000	0.24404	0.984000	0.73092	4.919000	0.63383	2.146000	0.66826	0.482000	0.46254	TCT		0.448	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
MAP2	4133	genome.wustl.edu	37	2	210517973	210517973	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr2:210517973C>G	ENST00000360351.4	+	4	585	c.79C>G	c.(79-81)Cat>Gat	p.H27D	MAP2_ENST00000392194.1_Missense_Mutation_p.H27D|MAP2_ENST00000199940.6_Missense_Mutation_p.H27D|MAP2_ENST00000361559.4_Missense_Mutation_p.H27D|MAP2_ENST00000447185.1_Missense_Mutation_p.H27D	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	27					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.H27D(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TGCACACTCACATCCACCTGA	0.512																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											105.0	76.0	86.0					2																	210517973		2203	4300	6503	210226218	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.79C>G	2.37:g.210517973C>G	ENSP00000353508:p.His27Asp	Somatic		Capture	Illumina GAIIx	4	210226218	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688683	0.68271	.	.	ENSG00000078018	ENST00000199940;ENST00000392193;ENST00000360351;ENST00000361559;ENST00000445941;ENST00000392194;ENST00000447185	T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000009	T	0.30916	0.0780	L	0.27053	0.805	0.49582	D	0.999807	P;D;D;P;P;P	0.61080	0.604;0.989;0.972;0.932;0.611;0.801	B;D;P;P;B;B	0.75020	0.392;0.985;0.615;0.84;0.219;0.258	T	0.01889	-1.1253	10	0.06891	T	0.86	-11.3105	18.5411	0.91029	0.0:1.0:0.0:0.0	.	27;27;28;27;27;27	P11137-3;P11137-2;Q59FX9;E7EV03;P11137;Q8IUX2	.;.;.;.;MAP2_HUMAN;.	D	27	ENSP00000199940:H27D;ENSP00000376031:H27D;ENSP00000353508:H27D;ENSP00000355290:H27D;ENSP00000409969:H27D;ENSP00000376032:H27D;ENSP00000392164:H27D	ENSP00000199940:H27D	H	+	1	0	MAP2	210226218	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.741000	0.55090	2.621000	0.88768	0.655000	0.94253	CAT		0.512	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		Missense_Mutation
GPBAR1	151306	genome.wustl.edu	37	2	219128185	219128185	+	Silent	SNP	C	C	G			TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr2:219128185C>G	ENST00000522678.1	+	2	1606	c.738C>G	c.(736-738)ctC>ctG	p.L246L	GPBAR1_ENST00000479077.1_Silent_p.L246L|GPBAR1_ENST00000519574.1_Silent_p.L246L|GPBAR1_ENST00000521462.1_Silent_p.L246L	NM_001077191.1	NP_001070659.1	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1	246					cell surface bile acid receptor signaling pathway (GO:0038184)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid receptor activity (GO:0038181)|G-protein coupled bile acid receptor activity (GO:0038182)	p.L246L(1)		cervix(1)|kidney(1)|large_intestine(1)|ovary(1)	4		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACTGCTCCTCTCAGTCCTGG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	2											10.0	12.0	11.0					2																	219128185		1965	4090	6055	218836429	SO:0001819	synonymous_variant	151306			AB086170	CCDS46515.1	2q35	2012-08-08			ENSG00000179921	ENSG00000179921			19680	protein-coding gene	gene with protein product		610147				12419312	Standard	NM_170699		Approved	BG37, GPCR, TGR5, M-BAR, GPCR19, GPR131, MGC40597	uc010zjw.1	Q8TDU6	OTTHUMG00000155203	ENST00000522678.1:c.738C>G	2.37:g.219128185C>G		Somatic		Capture	Illumina GAIIx	4	218836429	B3KV35	Missense_Mutation	SNP	ENST00000522678.1	37	CCDS46515.1	SNP	32	WashU																																																																																				0.682	GPBAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338767.3	NM_001077191		Missense_Mutation
GALNT2	2590	genome.wustl.edu	37	1	230386265	230386265	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1103-01	TCGA-24-1103-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:230386265A>T	ENST00000366672.4	+	10	1040	c.968A>T	c.(967-969)aAg>aTg	p.K323M	GALNT2_ENST00000541865.1_Intron|GALNT2_ENST00000543760.1_Missense_Mutation_p.K285M	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	323	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K323M(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GAACTGGGGAAGTACGACATG	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											182.0	166.0	171.0					1																	230386265		2203	4300	6503	228452888	SO:0001583	missense	2590			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.968A>T	1.37:g.230386265A>T	ENSP00000355632:p.Lys323Met	Somatic		Capture	Illumina GAIIx	4	228452888	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	ENST00000366672.4	37	CCDS1582.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	17.01	3.279523	0.59758	.	.	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000543291	T;T	0.58940	0.3;0.3	4.43	4.43	0.53597	.	0.136038	0.64402	D	0.000007	T	0.60392	0.2265	M	0.85099	2.735	0.80722	D	1	B;B	0.30686	0.29;0.12	B;B	0.24541	0.04;0.054	T	0.66424	-0.5927	10	0.59425	D	0.04	.	13.6391	0.62239	1.0:0.0:0.0:0.0	.	323;285	Q10471;G3V1S6	GALT2_HUMAN;.	M	285;323;204	ENSP00000445017:K285M;ENSP00000355632:K323M	ENSP00000355632:K323M	K	+	2	0	GALNT2	228452888	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	7.001000	0.76297	1.761000	0.52028	0.379000	0.24179	AAG		0.502	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481		Missense_Mutation
ADSS	159	genome.wustl.edu	37	1	244579368	244579368	+	Silent	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr1:244579368G>C	ENST00000366535.3	-	11	1399	c.1083C>G	c.(1081-1083)acC>acG	p.T361T	ADSS_ENST00000462358.1_5'Flank	NM_001126.3	NP_001117.2			adenylosuccinate synthase									p.T361T(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			TATCCAACTTGGTAAGTGCCA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	1											75.0	68.0	70.0					1																	244579368		2203	4299	6502	242645991	SO:0001819	synonymous_variant	159			BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.1083C>G	1.37:g.244579368G>C		Somatic		Capture	Illumina GAIIx	4	242645991		Silent	SNP	ENST00000366535.3	37	CCDS1624.1	SNP	47	WashU																																																																																				0.338	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096697.1	NM_001126		Silent
ZNF791	163049	genome.wustl.edu	37	19	12739521	12739522	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-24-1103-01	TCGA-24-1103-10	TC	TC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr19:12739521_12739522delTC	ENST00000343325.4	+	4	1340_1341	c.1178_1179delTC	c.(1177-1179)ttcfs	p.F393fs	AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000458122.3_Frame_Shift_Del_p.F361fs|ZNF791_ENST00000540038.1_Frame_Shift_Del_p.F284fs|ZNF791_ENST00000446165.1_3'UTR|ZNF490_ENST00000465656.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F393fs*1(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						GGGAAAACTTTCAATTATCCTC	0.366																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								12600522	SO:0001589	frameshift_variant	163049			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1178_1179delTC	19.37:g.12739521_12739522delTC	ENSP00000342974:p.Phe393fs	Somatic		Capture	Illumina GAIIx	4	12600521	B7Z586|Q8NC99	Frame_Shift_Del	DEL	ENST00000343325.4	37	CCDS12273.1	DEL	62	WashU																																																																																				0.366	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358		Frame_Shift_Del
ZFPM2	23414	genome.wustl.edu	37	8	106814742	106814749	+	Frame_Shift_Del	DEL	TTTCCAAA	TTTCCAAA	-			TCGA-24-1103-01	TCGA-24-1103-10	TTTCCAAA	TTTCCAAA	TTTCCAAA	-	TTTCCAAA	TTTCCAAA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr8:106814742_106814749delTTTCCAAA	ENST00000407775.2	+	8	2682_2689	c.2432_2439delTTTCCAAA	c.(2431-2439)gtttccaaafs	p.VSK811fs	ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000520492.1_Frame_Shift_Del_p.VSK679fs|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000378472.4_Frame_Shift_Del_p.VSK542fs|ZFPM2_ENST00000517361.1_Frame_Shift_Del_p.VSK679fs|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	811					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S812fs*1(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TGTGTTCCAGTTTCCAAATGTGATACTA	0.457																																																1	Deletion - Frameshift(1)	ovary(1)	8																																								106883925	SO:0001589	frameshift_variant	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2432_2439delTTTCCAAA	8.37:g.106814742_106814749delTTTCCAAA	ENSP00000384179:p.Val811fs	Somatic		Capture	Illumina GAIIx	4	106883918	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Frame_Shift_Del	DEL	ENST00000407775.2	37	CCDS47908.1	DEL	60	WashU																																																																																				0.457	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			Frame_Shift_Del
ANKAR	150709	genome.wustl.edu	37	2	190602523	190602523	+	Missense_Mutation	SNP	C	C	G	rs368191509		TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr2:190602523C>G	ENST00000520309.1	+	18	3626	c.3538C>G	c.(3538-3540)Ctt>Gtt	p.L1180V	ANKAR_ENST00000431575.2_Missense_Mutation_p.L1109V|ANKAR_ENST00000281412.6_3'UTR|ANKAR_ENST00000438402.2_3'UTR|ANKAR_ENST00000313581.4_Missense_Mutation_p.L1180V	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1180						integral component of membrane (GO:0016021)		p.L1109V(1)		breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TGAACGTTTTCTTGAATCAAC	0.308																																																1	Substitution - Missense(1)	ovary(1)	2						C	VAL/LEU	0,4406		0,0,2203	68.0	66.0	67.0		3538	4.2	1.0	2		67	1,8593	1.2+/-3.3	0,1,4296	no	missense	ANKAR	NM_144708.3	32	0,1,6499	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging	1180/1435	190602523	1,12999	2203	4297	6500	190310768	SO:0001583	missense	150709			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.3538C>G	2.37:g.190602523C>G	ENSP00000427882:p.Leu1180Val	Somatic		Capture	Illumina GAIIx	4	190310768	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	ENST00000520309.1	37	CCDS33351.2	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120117	0.37436	0.0	1.16E-4	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000431575;ENST00000374838	T;T;T	0.61158	0.13;0.13;0.13	6.01	4.22	0.49857	.	0.221269	0.29838	N	0.011061	T	0.74382	0.3709	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75164	-0.3414	10	0.52906	T	0.07	-18.733	11.8715	0.52523	0.0:0.8569:0.0:0.1431	.	256	E9PHS9	.	V	1180;1180;1109;256	ENSP00000427882:L1180V;ENSP00000313513:L1180V;ENSP00000393043:L1109V	ENSP00000313513:L1180V	L	+	1	0	ANKAR	190310768	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	1.820000	0.39032	0.885000	0.36088	-0.145000	0.13849	CTT		0.308	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708		Missense_Mutation
AIFM3	150209	genome.wustl.edu	37	22	21328884	21328884	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr22:21328884G>A	ENST00000399167.2	+	7	821	c.581G>A	c.(580-582)aGc>aAc	p.S194N	AIFM3_ENST00000399163.2_Missense_Mutation_p.S194N|AIFM3_ENST00000465606.1_3'UTR|AIFM3_ENST00000333607.6_Missense_Mutation_p.S194N|AIFM3_ENST00000405089.1_Missense_Mutation_p.S200N|AIFM3_ENST00000440238.2_Missense_Mutation_p.S194N|AIFM3_ENST00000335375.5_Missense_Mutation_p.S182N	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	194					cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)	p.S194N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TACAGCAGTAGCACCAATGTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	22											148.0	120.0	129.0					22																	21328884		2203	4300	6503	19658884	SO:0001583	missense	150209			AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.581G>A	22.37:g.21328884G>A	ENSP00000382120:p.Ser194Asn	Somatic		Capture	Illumina GAIIx	4	19658884	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Missense_Mutation	SNP	ENST00000399167.2	37	CCDS13786.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750852	0.31046	.	.	ENSG00000183773	ENST00000399167;ENST00000399163;ENST00000434714;ENST00000405089;ENST00000335375;ENST00000440238;ENST00000333607	T;T;D;T;T;T;T	0.82711	0.78;0.78;-1.64;0.77;0.74;0.78;0.78	5.05	5.05	0.67936	.	0.113450	0.56097	D	0.000028	T	0.66567	0.2802	N	0.08118	0	0.35487	D	0.798644	B;B;B;B;B	0.21753	0.06;0.035;0.022;0.022;0.013	B;B;B;B;B	0.18561	0.013;0.017;0.022;0.022;0.01	T	0.67534	-0.5646	10	0.18276	T	0.48	-8.0494	13.8919	0.63744	0.0:0.0:1.0:0.0	.	182;182;200;194;194	B7Z9S7;B7Z376;Q96NN9-2;Q96NN9-3;Q96NN9	.;.;.;.;AIFM3_HUMAN	N	194;194;194;200;182;194;194	ENSP00000382120:S194N;ENSP00000382116:S194N;ENSP00000399657:S194N;ENSP00000385800:S200N;ENSP00000335369:S182N;ENSP00000390798:S194N;ENSP00000327671:S194N	ENSP00000327671:S194N	S	+	2	0	AIFM3	19658884	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.634000	0.46528	2.322000	0.78497	0.561000	0.74099	AGC		0.602	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320150.1	NM_144704		Missense_Mutation
Unknown	0	genome.wustl.edu	37	3	154156	154156	+	IGR	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr3:154156G>C								AY269186.2 (58127 upstream) : CHL1-AS2 (83284 downstream)																							atcaAAGATAGAGAGATTGAA	0.448																																																0			3																																								129156	SO:0001628	intergenic_variant																																3.37:g.154156G>C		Somatic		Capture	Illumina GAIIx	4	129156		Silent	SNP		37		SNP	33	WashU																																																																																			0	0.448									Silent
ZNF595	152687	genome.wustl.edu	37	4	53721	53721	+	Intron	SNP	C	C	T	rs368400828		TCGA-24-1103-01	TCGA-24-1103-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr4:53721C>T	ENST00000509152.2	+	1	188				ZNF595_ENST00000526473.2_Intron|ZNF595_ENST00000339368.6_Intron			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ttaccctgttcggaatgagat	0.632																																																0			4																																								43721	SO:0001627	intron_variant	3166			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.3+336C>T	4.37:g.53721C>T		Somatic		Capture	Illumina GAIIx	4	43721		Silent	SNP	ENST00000509152.2	37		SNP	31	WashU																																																																																				0.632	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524		Silent
PPP1R35	221908	genome.wustl.edu	37	7	100033062	100033062	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr7:100033062G>C	ENST00000292330.2	-	4	873	c.683C>G	c.(682-684)cCt>cGt	p.P228R	PPP1R35_ENST00000476185.1_5'UTR|RP11-758P17.2_ENST00000492523.1_RNA|RP11-758P17.3_ENST00000475250.1_RNA	NM_145030.2	NP_659467.1	Q8TAP8	PPR35_HUMAN	protein phosphatase 1, regulatory subunit 35	228					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.P228R(1)									AAGTCGGAGAGGGGGCAGACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	7											81.0	78.0	79.0					7																	100033062		2203	4300	6503	99870998	SO:0001583	missense	221908			BC026269	CCDS5694.1	7q22.1	2012-04-17	2011-10-11	2011-10-11	ENSG00000160813	ENSG00000160813		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28320	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 47"""	C7orf47		12477932	Standard	NM_145030		Approved	MGC22793	uc003uuy.1	Q8TAP8	OTTHUMG00000159540	ENST00000292330.2:c.683C>G	7.37:g.100033062G>C	ENSP00000292330:p.Pro228Arg	Somatic		Capture	Illumina GAIIx	4	99870998	A4D2C5	Missense_Mutation	SNP	ENST00000292330.2	37	CCDS5694.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472209	0.43942	.	.	ENSG00000160813	ENST00000292330	.	.	.	4.28	1.37	0.22104	.	0.907929	0.09371	N	0.811354	T	0.24353	0.0590	N	0.14661	0.345	0.22171	N	0.999315	B	0.12630	0.006	B	0.19391	0.025	T	0.24977	-1.0145	9	0.51188	T	0.08	-4.2502	4.3852	0.11312	0.2132:0.1885:0.5983:0.0	.	228	Q8TAP8	PPR35_HUMAN	R	228	.	ENSP00000292330:P228R	P	-	2	0	C7orf47	99870998	0.833000	0.29383	0.969000	0.41365	0.570000	0.35934	1.091000	0.30915	0.449000	0.26747	-0.479000	0.04858	CCT		0.597	PPP1R35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356095.2	NM_145030		Missense_Mutation
THBS2	7058	genome.wustl.edu	37	6	169622375	169622376	+	Frame_Shift_Ins	INS	-	-	C			TCGA-24-1103-01	TCGA-24-1103-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr6:169622375_169622376insC	ENST00000366787.3	-	20	3438_3439	c.3189_3190insG	c.(3187-3192)gtgtccfs	p.S1064fs	THBS2_ENST00000488355.1_5'UTR|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1064	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.S1064fs*48(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ACCTTGAGGGACACGCCGGAGT	0.649																																					Esophageal Squamous(91;219 1934 18562 44706)											1	Insertion - Frameshift(1)	ovary(1)	6																																								169364301	SO:0001589	frameshift_variant	7058				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3190dupG	6.37:g.169622376_169622376dupC	ENSP00000355751:p.Ser1064fs	Somatic		Capture	Illumina GAIIx	PhaseIII	169364300	A6H8N1|A7E232|Q5RI52	Frame_Shift_Ins	INS	ENST00000366787.3	37	CCDS34574.1	INS	10	WashU																																																																																				0.649	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		Frame_Shift_Ins
NDUFV2	4729	genome.wustl.edu	37	18	9122597	9122597	+	Silent	SNP	G	G	A			TCGA-24-1103-01	TCGA-24-1103-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1103-01	TCGA-24-1103-10	g.chr18:9122597G>A	ENST00000318388.6	+	5	501	c.387G>A	c.(385-387)aaG>aaA	p.K129K	NDUFV2_ENST00000465096.1_3'UTR|RP11-21J18.1_ENST00000579126.1_RNA|NDUFV2_ENST00000400033.1_Silent_p.K132K|RP11-143J12.2_ENST00000582375.1_RNA|RP11-143J12.2_ENST00000583081.1_RNA	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	129					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.K129K(1)		breast(1)|lung(4)|ovary(1)|stomach(1)	7						CAGTTGGAAAGTATCACATTC	0.383																																																1	Substitution - coding silent(1)	ovary(1)	18											122.0	110.0	114.0					18																	9122597		2203	4300	6503	9112597	SO:0001819	synonymous_variant	4729			X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.387G>A	18.37:g.9122597G>A		Somatic		Capture	Illumina GAIIx	PhaseIII	9112597	Q9BV41	Silent	SNP	ENST00000318388.6	37	CCDS11842.1	SNP	36	WashU																																																																																				0.383	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254475.2	NM_021074		Silent
