#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PDE6B	5158	genome.wustl.edu	37	4	647931	647931	+	Silent	SNP	G	G	A	rs75695239	byFrequency	TCGA-24-1413-01	TCGA-24-1413-10	G	G	A	A	G	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr4:647931G>A	ENST00000496514.1	+	5	936	c.915G>A	c.(913-915)acG>acA	p.T305T	RP11-1191J2.2_ENST00000489312.1_RNA|PDE6B_ENST00000255622.6_Silent_p.T305T|RP11-1191J2.2_ENST00000599030.1_RNA|PDE6B_ENST00000429163.2_Silent_p.T26T|RP11-1191J2.2_ENST00000468356.1_RNA|RP11-1191J2.2_ENST00000598370.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	305	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GCCCACGCACGCCTGATGGCC	0.642													.|||	207	0.0413339	0.09	0.0259	5008	,	,		16841	0.003		0.0487	False		,,,				2504	0.0184				GBM(71;463 1194 9848 25922 46834)											0			4						G	,,	323,4083	166.9+/-198.0	15,293,1895	40.0	44.0	43.0		915,915,78	-10.2	0.5	4	dbSNP_131	43	391,8207	123.9+/-182.7	10,371,3918	no	coding-synonymous,coding-synonymous,coding-synonymous	PDE6B	NM_000283.3,NM_001145291.1,NM_001145292.1	,,	25,664,5813	AA,AG,GG		4.5476,7.3309,5.4906	,,	305/855,305/854,26/576	647931	714,12290	2203	4299	6502	637931	SO:0001819	synonymous_variant	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.915G>A	4.37:g.647931G>A		LOH		Capture	Illumina GAIIx	4	637931	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Silent	SNP	ENST00000496514.1	37	CCDS33932.1	SNP	38	WashU																																																																																				0.642	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		Silent
CNTN4	152330	genome.wustl.edu	37	3	3078974	3078974	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:3078974C>A	ENST00000397461.1	+	17	2438	c.2054C>A	c.(2053-2055)cCc>cAc	p.P685H	CNTN4_ENST00000427331.1_Missense_Mutation_p.P685H|CNTN4_ENST00000448906.2_Missense_Mutation_p.P357H|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000397459.2_Missense_Mutation_p.P357H|CNTN4_ENST00000358480.3_Missense_Mutation_p.P466H|CNTN4_ENST00000418658.1_Missense_Mutation_p.P685H	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	685	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.P357H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		ATTGGGGAGCCCAGCCGCCCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	3											162.0	173.0	169.0					3																	3078974		2203	4300	6503	3053974	SO:0001583	missense	152330			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2054C>A	3.37:g.3078974C>A	ENSP00000380602:p.Pro685His	Somatic		Capture	Illumina GAIIx	4	3053974	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	CCDS43041.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042273	0.93685	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38	5.48	5.48	0.80851	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83894	0.5353	H	0.97852	4.09	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.996;0.996;1.0	D	0.89921	0.4059	10	0.87932	D	0	.	19.387	0.94560	0.0:1.0:0.0:0.0	.	684;685;685	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	H	685;685;685;466;357;357	ENSP00000396010:P685H;ENSP00000380602:P685H;ENSP00000413642:P685H;ENSP00000351267:P466H;ENSP00000380600:P357H;ENSP00000392077:P357H	ENSP00000351267:P466H	P	+	2	0	CNTN4	3053974	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.642000	0.83385	2.572000	0.86782	0.655000	0.94253	CCC		0.522	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			Missense_Mutation
Unknown	0	genome.wustl.edu	37	7	7118642	7118642	+	IGR	SNP	C	C	A			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr7:7118642C>A								AC092104.4 (10107 upstream) : Y_RNA (23561 downstream)																							AAACGCTTTTCACATTCTTTA	0.383																																																0			7																																								7085167	SO:0001628	intergenic_variant																																7.37:g.7118642C>A		Somatic		Capture	Illumina GAIIx	4	7085167		Nonsense_Mutation	SNP		37		SNP	29	WashU																																																																																			0	0.383									Nonsense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578257	7578257	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1413-01	TCGA-24-1413-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr17:7578257C>A	ENST00000269305.4	-	6	781	c.592G>T	c.(592-594)Gaa>Taa	p.E198*	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.E198*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E198*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E198*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E198*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E198*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	198	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E198*(27)|p.0?(8)|p.E198K(5)|p.?(5)|p.P191_E198>Q(3)|p.E105*(3)|p.E66*(3)|p.E198fs*11(2)|p.E198Q(2)|p.E198fs*7(1)|p.E198fs*49(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAATTTCCTTCCACTCGGATA	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	64	Substitution - Nonsense(33)|Whole gene deletion(8)|Substitution - Missense(7)|Complex - deletion inframe(5)|Unknown(5)|Insertion - Frameshift(2)|Deletion - Frameshift(2)|Deletion - In frame(1)|Complex - frameshift(1)	urinary_tract(9)|breast(7)|ovary(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|lung(5)|prostate(5)|bone(4)|central_nervous_system(3)|oesophagus(3)|skin(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(2)|stomach(1)|soft_tissue(1)	17											112.0	100.0	104.0					17																	7578257		2203	4300	6503	7518982	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.592G>T	17.37:g.7578257C>A	ENSP00000269305:p.Glu198*	Somatic		Capture	Illumina GAIIx	4	7518982	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950903	0.53186	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.9371	16.7921	0.85592	0.0:1.0:0.0:0.0	.	.	.	.	X	198;198;198;198;198;198;187;105;66;105;66	.	ENSP00000269305:E198X	E	-	1	0	TP53	7518982	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GAA		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
MYH10	4628	genome.wustl.edu	37	17	8421974	8421974	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1413-01	TCGA-24-1413-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr17:8421974C>T	ENST00000269243.4	-	19	2524	c.2386G>A	c.(2386-2388)Gtt>Att	p.V796I	MYH10_ENST00000360416.3_Missense_Mutation_p.V827I|MYH10_ENST00000396239.1_Missense_Mutation_p.V817I|MYH10_ENST00000379980.4_Missense_Mutation_p.V812I	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	796	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.V796I(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CCTCTGCAAACGGCCTGGAAG	0.423																																																1	Substitution - Missense(1)	ovary(1)	17											87.0	79.0	81.0					17																	8421974		2203	4300	6503	8362699	SO:0001583	missense	4628			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.2386G>A	17.37:g.8421974C>T	ENSP00000269243:p.Val796Ile	Somatic		Capture	Illumina GAIIx	4	8362699	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	13.34	2.207240	0.39003	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	4.93	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	L	0.36672	1.1	0.42502	D	0.992937	B;B;B	0.20988	0.05;0.04;0.05	B;B;B	0.18561	0.022;0.013;0.022	T	0.04216	-1.0968	10	0.29301	T	0.29	.	14.8644	0.70404	0.1436:0.8564:0.0:0.0	.	805;827;796	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	I	796;827;817;812	ENSP00000269243:V796I;ENSP00000353590:V827I;ENSP00000379539:V817I;ENSP00000369315:V812I	ENSP00000269243:V796I	V	-	1	0	MYH10	8362699	0.391000	0.25221	0.978000	0.43139	0.967000	0.64934	2.405000	0.44548	2.570000	0.86706	0.644000	0.83932	GTT		0.423	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2			Missense_Mutation
TPTE	7179	genome.wustl.edu	37	21	10941945	10941945	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr21:10941945G>T	ENST00000361285.4	-	14	1087	c.758C>A	c.(757-759)tCt>tAt	p.S253Y	TPTE_ENST00000298232.7_Missense_Mutation_p.S235Y|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.S215Y	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	253	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S235Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCTTCCAGAAGATGGAAATGA	0.284																																																1	Substitution - Missense(1)	ovary(1)	21											216.0	208.0	211.0					21																	10941945		2203	4298	6501	9963816	SO:0001583	missense	7179			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.758C>A	21.37:g.10941945G>T	ENSP00000355208:p.Ser253Tyr	Somatic		Capture	Illumina GAIIx	4	9963816	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	.	10.88	1.475634	0.26511	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	T;T;T	0.33438	1.41;1.41;1.41	1.8	1.8	0.24995	Phosphatase tensin type (1);	0.000000	0.85682	U	0.000000	T	0.62183	0.2407	H	0.95151	3.63	0.54753	D	0.999989	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.81914	0.995;0.995;0.959	T	0.70949	-0.4733	10	0.87932	D	0	-19.379	9.6369	0.39814	0.0:0.0:1.0:0.0	.	215;235;253	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	Y	235;253;215	ENSP00000298232:S235Y;ENSP00000355208:S253Y;ENSP00000344441:S215Y	ENSP00000298232:S235Y	S	-	2	0	TPTE	9963816	1.000000	0.71417	0.998000	0.56505	0.096000	0.18686	7.245000	0.78237	1.318000	0.45170	0.194000	0.17425	TCT		0.284	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			Missense_Mutation
DNAH5	1767	genome.wustl.edu	37	5	13864743	13864743	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr5:13864743A>T	ENST00000265104.4	-	28	4463	c.4359T>A	c.(4357-4359)tgT>tgA	p.C1453*	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1453	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C1453*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GAAGCTTTCGACATCTGTGAA	0.463									Kartagener syndrome																																							1	Substitution - Nonsense(1)	ovary(1)	5											58.0	59.0	58.0					5																	13864743		2203	4300	6503	13917743	SO:0001587	stop_gained	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4359T>A	5.37:g.13864743A>T	ENSP00000265104:p.Cys1453*	Somatic		Capture	Illumina GAIIx	4	13917743	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	45	11.795652	0.99604	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.32	5.32	0.75619	.	0.047985	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.7592	0.18190	0.7874:0.0:0.2126:0.0	.	.	.	.	X	1453	.	ENSP00000265104:C1453X	C	-	3	2	DNAH5	13917743	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	2.380000	0.44327	2.014000	0.59158	0.514000	0.50259	TGT		0.463	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Nonsense_Mutation
DNAH5	1767	genome.wustl.edu	37	5	13894789	13894789	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr5:13894789C>T	ENST00000265104.4	-	16	2505	c.2401G>A	c.(2401-2403)Gct>Act	p.A801T	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	801	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A801T(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCTAAATAAGCCTCAATATTC	0.403									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											129.0	122.0	124.0					5																	13894789		2203	4300	6503	13947789	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2401G>A	5.37:g.13894789C>T	ENSP00000265104:p.Ala801Thr	Somatic		Capture	Illumina GAIIx	4	13947789	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	2.002	-0.429190	0.04701	.	.	ENSG00000039139	ENST00000265104	T	0.53640	0.61	5.23	-9.97	0.00440	Dynein heavy chain, domain-1 (1);	0.924046	0.09224	N	0.831446	T	0.15696	0.0378	N	0.03224	-0.385	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20371	-1.0277	10	0.16420	T	0.52	.	7.2127	0.25943	0.1754:0.3697:0.0:0.4549	.	801	Q8TE73	DYH5_HUMAN	T	801	ENSP00000265104:A801T	ENSP00000265104:A801T	A	-	1	0	DNAH5	13947789	0.001000	0.12720	0.000000	0.03702	0.019000	0.09904	0.346000	0.19997	-1.750000	0.01328	-1.817000	0.00601	GCT		0.403	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
MKL2	57496	genome.wustl.edu	37	16	14339512	14339512	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1413-01	TCGA-24-1413-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr16:14339512T>G	ENST00000341243.5	+	9	1174	c.1174T>G	c.(1174-1176)Tta>Gta	p.L392V	MKL2_ENST00000318282.5_Missense_Mutation_p.L403V|MKL2_ENST00000571589.1_Missense_Mutation_p.L403V|MKL2_ENST00000574045.1_Missense_Mutation_p.L403V			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	392	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.L403V(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCTGGATGACTTAAAGGTGAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	16											156.0	139.0	144.0					16																	14339512		2197	4300	6497	14247013	SO:0001583	missense	57496			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1174T>G	16.37:g.14339512T>G	ENSP00000345841:p.Leu392Val	Somatic		Capture	Illumina GAIIx	4	14247013	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	19.72	3.880876	0.72294	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.98	2.56	0.30785	.	0.054127	0.64402	D	0.000002	T	0.71525	0.3350	M	0.82433	2.59	0.36839	D	0.88729	D;D	0.71674	0.984;0.998	P;D	0.77557	0.726;0.99	T	0.71547	-0.4560	9	0.59425	D	0.04	-10.7223	4.6123	0.12408	0.1298:0.2111:0.0:0.6592	.	403;403	B4DGT8;Q9ULH7-4	.;.	V	403;392	.	ENSP00000339086:L403V	L	+	1	2	MKL2	14247013	0.974000	0.33945	0.999000	0.59377	0.991000	0.79684	0.010000	0.13242	0.168000	0.19655	0.533000	0.62120	TTA		0.433	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048		Missense_Mutation
PADI4	23569	genome.wustl.edu	37	1	17685855	17685855	+	Silent	SNP	C	C	T			TCGA-24-1413-01	TCGA-24-1413-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr1:17685855C>T	ENST00000375448.4	+	15	1736	c.1710C>T	c.(1708-1710)ctC>ctT	p.L570L		NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	570					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.L570L(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	TCCCGCAGCTCTTCAAGCTCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											93.0	94.0	93.0					1																	17685855		2203	4300	6503	17558442	SO:0001819	synonymous_variant	23569			AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1710C>T	1.37:g.17685855C>T		Somatic		Capture	Illumina GAIIx	4	17558442	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Silent	SNP	ENST00000375448.4	37	CCDS180.1	SNP	32	WashU																																																																																				0.582	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387		Silent
OR4N4	283694	genome.wustl.edu	37	15	22383320	22383320	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr15:22383320A>T	ENST00000328795.4	+	1	939	c.848A>T	c.(847-849)aAt>aTt	p.N283I	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N283I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CCATTGATGAATCCTATGATT	0.403																																																1	Substitution - Missense(1)	ovary(1)	15											135.0	123.0	127.0					15																	22383320		2188	4259	6447	19884684	SO:0001583	missense	283694			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.848A>T	15.37:g.22383320A>T	ENSP00000332500:p.Asn283Ile	Somatic		Capture	Illumina GAIIx	4	19884684	Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	37	CCDS32173.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	.	14.49	2.551925	0.45487	.	.	ENSG00000183706	ENST00000328795	T	0.59638	0.25	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.71600	0.3359	M	0.84326	2.69	0.38631	D	0.951388	D	0.67145	0.996	P	0.60682	0.878	T	0.77512	-0.2560	10	0.87932	D	0	-4.4181	9.7407	0.40416	1.0:0.0:0.0:0.0	.	283	Q8N0Y3	OR4N4_HUMAN	I	283	ENSP00000332500:N283I	ENSP00000332500:N283I	N	+	2	0	OR4N4	19884684	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	8.318000	0.89990	1.454000	0.47793	0.332000	0.21555	AAT		0.403	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			Missense_Mutation
KCNJ12	3768	genome.wustl.edu	37	17	21318782	21318782	+	Missense_Mutation	SNP	G	G	A	rs78117732	byFrequency	TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	A	G	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr17:21318782G>A	ENST00000583088.1	+	3	1023	c.128G>A	c.(127-129)cGc>cAc	p.R43H	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R43H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	43				R -> H (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CGCAGGTGCCGCAACCGCTTC	0.602										Prostate(3;0.18)																																						0			17																																								21259375	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.128G>A	17.37:g.21318782G>A	ENSP00000463778:p.Arg43His	Germline		Capture	Illumina GAIIx	4	21259375	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	SNP	38	WashU	1089	0.49862637362637363	246	0.5	180	0.4972375690607735	286	0.5	377	0.4973614775725594	G	17.56	3.420800	0.62622	.	.	ENSG00000184185	ENST00000331718	T	0.35789	1.29	5.33	4.37	0.52481	Potassium channel, inwardly rectifying, Kir, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.49350	1.555	0.58432	D	0.999997	B	0.27594	0.182	B	0.20184	0.028	T	0.52997	-0.8500	10	0.54805	T	0.06	.	14.0406	0.64672	0.0731:0.0:0.9269:0.0	.	43	Q14500	IRK12_HUMAN	H	43	ENSP00000328150:R43H	ENSP00000328150:R43H	R	+	2	0	KCNJ12	21259375	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.690000	0.98676	1.265000	0.44215	0.591000	0.81541	CGC		0.602	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		Missense_Mutation
IFNA1	3439	genome.wustl.edu	37	9	21440580	21440580	+	Missense_Mutation	SNP	A	A	G	rs375932242		TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr9:21440580A>G	ENST00000276927.1	+	1	141	c.74A>G	c.(73-75)gAt>gGt	p.D25G		NM_024013.2	NP_076918.1	P01562	IFNA1_HUMAN	interferon, alpha 1	25					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.D25G(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(2)	7				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CTGGGCTGTGATCTCCCTGAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	9						A	GLY/ASP	1,4405	2.1+/-5.4	0,1,2202	84.0	80.0	81.0		74	2.0	0.5	9		81	0,8596		0,0,4298	no	missense	IFNA1	NM_024013.2	94	0,1,6500	GG,GA,AA		0.0,0.0227,0.0077	benign	25/190	21440580	1,13001	2203	4298	6501	21430580	SO:0001583	missense	3439				CCDS6508.1	9p22	2010-12-10			ENSG00000197919	ENSG00000197919		"""Interferons"""	5417	protein-coding gene	gene with protein product	"""IFN-alpha 1b"", ""interferon alpha 1b"""	147660				1385305	Standard	NM_024013		Approved	IFNA@, IFL, IFN, IFN-ALPHA, IFNA13, IFN-alphaD	uc003zpd.2	P01562	OTTHUMG00000019673	ENST00000276927.1:c.74A>G	9.37:g.21440580A>G	ENSP00000276927:p.Asp25Gly	Somatic		Capture	Illumina GAIIx	4	21430580	D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	ENST00000276927.1	37	CCDS6508.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124443	0.56613	2.27E-4	0.0	ENSG00000197919	ENST00000276927	T	0.05717	3.4	3.27	2.05	0.26809	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.565659	0.18375	N	0.143150	T	0.11922	0.0290	M	0.88512	2.96	0.28334	N	0.921641	B	0.24618	0.107	B	0.31614	0.133	T	0.17349	-1.0372	10	0.66056	D	0.02	.	3.4033	0.07331	0.6289:0.2406:0.1304:0.0	.	25	P01562	IFNA1_HUMAN	G	25	ENSP00000276927:D25G	ENSP00000276927:D25G	D	+	2	0	IFNA1	21430580	0.080000	0.21391	0.480000	0.27341	0.785000	0.44390	1.868000	0.39509	0.415000	0.25817	0.438000	0.28831	GAT		0.532	IFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051902.1	NM_024013		Missense_Mutation
ATAD5	79915	genome.wustl.edu	37	17	29162262	29162262	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr17:29162262C>T	ENST00000321990.4	+	2	1541	c.1163C>T	c.(1162-1164)tCt>tTt	p.S388F	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	388					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.S388F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GCTGGAAGTTCTGAAGCTGTG	0.363																																																1	Substitution - Missense(1)	ovary(1)	17											61.0	65.0	64.0					17																	29162262		2203	4300	6503	26186388	SO:0001583	missense	79915				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1163C>T	17.37:g.29162262C>T	ENSP00000313171:p.Ser388Phe	Somatic		Capture	Illumina GAIIx	4	26186388	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	9.885	1.202583	0.22121	.	.	ENSG00000176208	ENST00000321990	T	0.11169	2.8	5.91	5.91	0.95273	.	0.465436	0.24771	N	0.035725	T	0.22742	0.0549	L	0.59436	1.845	0.32867	D	0.508686	D;P	0.57571	0.98;0.93	P;P	0.56700	0.804;0.467	T	0.12553	-1.0543	10	0.56958	D	0.05	.	11.5421	0.50672	0.0:0.8626:0.0:0.1374	.	388;388	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	F	388	ENSP00000313171:S388F	ENSP00000313171:S388F	S	+	2	0	ATAD5	26186388	0.807000	0.29009	1.000000	0.80357	0.973000	0.67179	1.181000	0.32017	2.813000	0.96785	0.655000	0.94253	TCT		0.363	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		Missense_Mutation
BAZ1A	11177	genome.wustl.edu	37	14	35331430	35331430	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1413-01	TCGA-24-1413-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr14:35331430T>A	ENST00000382422.2	-	2	539	c.212A>T	c.(211-213)gAa>gTa	p.E71V	BAZ1A_ENST00000553853.1_5'UTR|BAZ1A_ENST00000360310.1_Missense_Mutation_p.E71V|BAZ1A_ENST00000358716.4_Missense_Mutation_p.E71V			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	71	Required for association with the CHRAC1/POLE3 complex.|Required for interaction with NCOR1.|WAC. {ECO:0000255|PROSITE- ProRule:PRU00475}.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)	p.E71V(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TGCTTTTTTTTCTGACTCAAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	14											156.0	159.0	158.0					14																	35331430		2203	4300	6503	34401181	SO:0001583	missense	11177			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.212A>T	14.37:g.35331430T>A	ENSP00000371859:p.Glu71Val	Somatic		Capture	Illumina GAIIx	4	34401181	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	27.4	4.829154	0.90955	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310	D;D;D	0.97850	-4.45;-4.57;-4.57	5.47	5.47	0.80525	WSTF/Acf1/Cbp146 (2);	0.094831	0.64402	D	0.000001	D	0.98947	0.9642	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.99737	1.1014	10	0.87932	D	0	.	15.8475	0.78903	0.0:0.0:0.0:1.0	.	71;71	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	V	71	ENSP00000351555:E71V;ENSP00000371859:E71V;ENSP00000353458:E71V	ENSP00000351555:E71V	E	-	2	0	BAZ1A	34401181	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.612000	0.82975	2.201000	0.70794	0.528000	0.53228	GAA		0.428	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			Missense_Mutation
PPIEL	728448	genome.wustl.edu	37	1	40020020	40020020	+	IGR	SNP	C	C	A	rs79473113	byFrequency	TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	A	C	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr1:40020020C>A								RP11-69E11.4 (8161 upstream) : PABPC4 (6467 downstream)																							AAACTTCTTACCTCTGCCAAC	0.393													C|||	113	0.0225639	0.0023	0.0274	5008	,	,		18113	0.0		0.0408	False		,,,				2504	0.0511															0			1																																								39792607	SO:0001628	intergenic_variant	728448																															1.37:g.40020020C>A		Germline		Capture	Illumina GAIIx	4	39792607		Splice_Site_SNP	SNP		37		SNP	18	WashU																																																																																			0	0.393									Splice_Site_SNP
CCR9	10803	genome.wustl.edu	37	3	45943248	45943248	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:45943248G>T	ENST00000357632.2	+	3	1148	c.968G>T	c.(967-969)aGa>aTa	p.R323I	LZTFL1_ENST00000539217.1_Intron|CCR9_ENST00000355983.2_Missense_Mutation_p.R311I|CCR9_ENST00000422395.1_3'UTR|Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Missense_Mutation_p.R311I|LZTFL1_ENST00000536047.1_Intron	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	323					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.R323I(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		GTGGGTGAGAGATTCCGCCGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	100.0	103.0					3																	45943248		2203	4300	6503	45918252	SO:0001583	missense	10803			AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.968G>T	3.37:g.45943248G>T	ENSP00000350256:p.Arg323Ile	Somatic		Capture	Illumina GAIIx	4	45918252	Q4VBM3|Q549E0|Q9UQQ6	Missense_Mutation	SNP	ENST00000357632.2	37	CCDS2732.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845447	0.71603	.	.	ENSG00000173585	ENST00000357632;ENST00000395963;ENST00000355983	T;T;T	0.38560	1.13;1.13;1.13	4.96	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	L	0.60455	1.87	0.80722	D	1	D	0.63046	0.992	D	0.68353	0.957	T	0.57027	-0.7881	10	0.87932	D	0	.	9.0593	0.36425	0.2137:0.0:0.7863:0.0	.	323	P51686	CCR9_HUMAN	I	323;311;311	ENSP00000350256:R323I;ENSP00000379292:R311I;ENSP00000348260:R311I	ENSP00000348260:R311I	R	+	2	0	CCR9	45918252	1.000000	0.71417	0.983000	0.44433	0.969000	0.65631	3.324000	0.52022	2.289000	0.77006	0.563000	0.77884	AGA		0.522	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257323.2			Missense_Mutation
PKHD1	5314	genome.wustl.edu	37	6	51890338	51890338	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr6:51890338C>G	ENST00000371117.3	-	32	4545	c.4270G>C	c.(4270-4272)Gac>Cac	p.D1424H	PKHD1_ENST00000340994.4_Missense_Mutation_p.D1424H	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1424	IPT/TIG 9.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.D1424H(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCCGAGAGGTCAACCCGAACT	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											101.0	107.0	105.0					6																	51890338		2203	4300	6503	51998297	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4270G>C	6.37:g.51890338C>G	ENSP00000360158:p.Asp1424His	Somatic		Capture	Illumina GAIIx	4	51998297	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	0.422	-0.907979	0.02434	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.76060	-0.99;-0.99	5.87	1.94	0.25998	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.641780	0.16332	N	0.219063	T	0.61098	0.2320	M	0.70595	2.14	0.09310	N	1	B;P	0.38335	0.046;0.627	B;P	0.46362	0.03;0.514	T	0.58819	-0.7569	10	0.56958	D	0.05	.	4.5736	0.12223	0.2516:0.3086:0.3678:0.0719	.	1424;1424	P08F94-2;P08F94	.;PKHD1_HUMAN	H	1424	ENSP00000360158:D1424H;ENSP00000341097:D1424H	ENSP00000341097:D1424H	D	-	1	0	PKHD1	51998297	0.010000	0.17322	0.000000	0.03702	0.020000	0.10135	0.479000	0.22228	0.058000	0.16222	-0.152000	0.13540	GAC		0.527	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Missense_Mutation
TCF12	6938	genome.wustl.edu	37	15	57574749	57574749	+	Silent	SNP	G	G	C			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr15:57574749G>C	ENST00000267811.5	+	19	2317	c.2013G>C	c.(2011-2013)ggG>ggC	p.G671G	TCF12_ENST00000537840.1_Silent_p.G435G|TCF12_ENST00000543579.1_Silent_p.G525G|TCF12_ENST00000452095.2_Silent_p.G691G|TCF12_ENST00000557843.1_Silent_p.G671G|TCF12_ENST00000343827.3_Silent_p.G501G|TCF12_ENST00000438423.2_Silent_p.G695G|TCF12_ENST00000333725.5_Silent_p.G695G|TCF12_ENST00000559710.1_Silent_p.G305G|TCF12_ENST00000559703.1_Silent_p.G328G	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	671					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.G695G(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CCCATCCTGGGCTTAGTGAAA	0.463			T	TEC	extraskeletal myxoid chondrosarcoma																																		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	1	Substitution - coding silent(1)	ovary(1)	15											140.0	138.0	139.0					15																	57574749		2192	4292	6484	55362041	SO:0001819	synonymous_variant	6938			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.2013G>C	15.37:g.57574749G>C		Somatic		Capture	Illumina GAIIx	4	55362041	Q7Z3D9|Q86TC1|Q86VM2	Silent	SNP	ENST00000267811.5	37	CCDS10159.1	SNP	42	WashU																																																																																				0.463	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205		Silent
PPM1H	57460	genome.wustl.edu	37	12	63087767	63087767	+	Silent	SNP	G	G	A			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr12:63087767G>A	ENST00000228705.6	-	7	1386	c.1086C>T	c.(1084-1086)acC>acT	p.T362T	PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	362	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)	p.T362T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CATCCTCAATGGTTTTGTATG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	12											62.0	66.0	64.0					12																	63087767		1930	4131	6061	61374034	SO:0001819	synonymous_variant	57460			AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1086C>T	12.37:g.63087767G>A		Somatic		Capture	Illumina GAIIx	4	61374034	B1Q2A9|B2RXG4|Q6PI86	Silent	SNP	ENST00000228705.6	37	CCDS44934.1	SNP	47	WashU																																																																																				0.483	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700		Silent
SLC22A25	387601	genome.wustl.edu	37	11	62931459	62931459	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr11:62931459C>T	ENST00000306494.6	-	9	1480	c.1481G>A	c.(1480-1482)cGa>cAa	p.R494Q	SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25									p.R494Q(1)		NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						GGGCAGGGGTCGAGAATATAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											154.0	161.0	158.0					11																	62931459		2201	4298	6499	62688035	SO:0001583	missense	387601			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.1481G>A	11.37:g.62931459C>T	ENSP00000307443:p.Arg494Gln	Somatic		Capture	Illumina GAIIx	4	62688035		Missense_Mutation	SNP	ENST00000306494.6	37	CCDS31592.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686591	0.68157	.	.	ENSG00000196600	ENST00000306494	T	0.58358	0.34	4.56	-0.00587	0.14015	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.401085	0.26792	N	0.022468	T	0.27629	0.0679	N	0.16037	0.36	0.09310	N	1	B	0.17465	0.022	B	0.04013	0.001	T	0.09335	-1.0679	10	0.52906	T	0.07	.	3.3652	0.07201	0.0854:0.1386:0.3502:0.4259	.	494	Q6T423	S22AP_HUMAN	Q	494	ENSP00000307443:R494Q	ENSP00000307443:R494Q	R	-	2	0	SLC22A25	62688035	0.005000	0.15991	0.000000	0.03702	0.009000	0.06853	0.932000	0.28884	-0.497000	0.06641	-0.193000	0.12794	CGA		0.498	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352		Missense_Mutation
GPHB5	122876	genome.wustl.edu	37	14	63779817	63779817	+	RNA	SNP	T	T	C			TCGA-24-1413-01	TCGA-24-1413-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr14:63779817T>C	ENST00000539258.1	-	0	273							Q86YW7	GPHB5_HUMAN	glycoprotein hormone beta 5						regulation of thyroid hormone mediated signaling pathway (GO:0002155)	extracellular region (GO:0005576)		p.E72G(1)		breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		ATAGGGGGGTTCCAGAATGGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	14											66.0	70.0	69.0					14																	63779817		1870	4120	5990	62849570			122876			AF467770	CCDS73643.1	14q23.3	2006-09-25				ENSG00000179600			18055	protein-coding gene	gene with protein product		609652					Standard	NM_145171		Approved	ZLUT1, GPB5	uc021rud.1	Q86YW7			14.37:g.63779817T>C		Somatic		Capture	Illumina GAIIx	4	62849570	Q6NTD0|Q8NFW2	Missense_Mutation	SNP	ENST00000539258.1	37		SNP	62	WashU																																																																																				0.433	GPHB5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000400582.1	NM_145171		Missense_Mutation
ZNF446	55663	genome.wustl.edu	37	19	58988591	58988591	+	Silent	SNP	A	A	G			TCGA-24-1413-01	TCGA-24-1413-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr19:58988591A>G	ENST00000594369.1	+	2	387	c.6A>G	c.(4-6)ccA>ccG	p.P2P	ZNF446_ENST00000596341.1_Silent_p.P2P|ZNF446_ENST00000335841.4_Silent_p.P2P|CTD-2619J13.23_ENST00000598051.1_RNA	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	2					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P2P(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CAAGAATGCCATCCCCTCTGG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	19											98.0	112.0	107.0					19																	58988591		2198	4292	6490	63680403	SO:0001819	synonymous_variant	55663				CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.6A>G	19.37:g.58988591A>G		Somatic		Capture	Illumina GAIIx	4	63680403		Silent	SNP	ENST00000594369.1	37	CCDS12982.1	SNP	8	WashU																																																																																				0.607	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467052.1	NM_017908		Silent
GAL3ST3	89792	genome.wustl.edu	37	11	65811100	65811100	+	Silent	SNP	C	C	T	rs147282818	byFrequency	TCGA-24-1413-01	TCGA-24-1413-10	C	C	T	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr11:65811100C>T	ENST00000312006.4	-	3	455	c.174G>A	c.(172-174)ccG>ccA	p.P58P	GAL3ST3_ENST00000527878.1_Silent_p.P58P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	58					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGGCGCGGCGGCGAGTTCC	0.647													C|||	24	0.00479233	0.0	0.013	5008	,	,		16141	0.0		0.0139	False		,,,				2504	0.001															0			11						C		14,4360		0,14,2173	25.0	21.0	22.0		174	-2.8	0.0	11	dbSNP_134	22	173,8387		2,169,4109	no	coding-synonymous	GAL3ST3	NM_033036.2		2,183,6282	TT,TC,CC		2.021,0.3201,1.4458		58/432	65811100	187,12747	2187	4280	6467	65567676	SO:0001819	synonymous_variant	89792			AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.174G>A	11.37:g.65811100C>T		Germline		Capture	Illumina GAIIx	4	65567676	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1	SNP	27	WashU																																																																																				0.647	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036		Silent
KBTBD8	84541	genome.wustl.edu	37	3	67058594	67058594	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:67058594C>G	ENST00000417314.2	+	4	1640	c.1591C>G	c.(1591-1593)Cag>Gag	p.Q531E	KBTBD8_ENST00000295568.4_Missense_Mutation_p.Q505E|KBTBD8_ENST00000460576.1_Missense_Mutation_p.Q89E			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	531						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)		p.Q505E(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GGTACTTTTCCAGAACAAACT	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											117.0	113.0	114.0					3																	67058594		2203	4300	6503	67141284	SO:0001583	missense	84541			AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.1591C>G	3.37:g.67058594C>G	ENSP00000401878:p.Gln531Glu	Somatic		Capture	Illumina GAIIx	4	67141284	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	37	CCDS2906.2	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	7.217	0.596674	0.13875	.	.	ENSG00000163376	ENST00000295568;ENST00000460576;ENST00000417314	T;T;T	0.65549	-0.16;-0.16;-0.16	5.57	3.64	0.41730	Kelch-type beta propeller (1);	0.332540	0.35349	N	0.003272	T	0.42245	0.1194	N	0.19112	0.55	0.44587	D	0.997559	B;B	0.10296	0.001;0.003	B;B	0.10450	0.001;0.005	T	0.30880	-0.9963	10	0.32370	T	0.25	.	7.7872	0.29099	0.3601:0.5226:0.1173:0.0	.	89;531	B4DTW6;Q8NFY9	.;KBTB8_HUMAN	E	505;89;531	ENSP00000295568:Q505E;ENSP00000419738:Q89E;ENSP00000401878:Q531E	ENSP00000295568:Q505E	Q	+	1	0	KBTBD8	67141284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.873000	0.48475	2.629000	0.89072	0.650000	0.86243	CAG		0.363	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505		Missense_Mutation
ADHFE1	137872	genome.wustl.edu	37	8	67357524	67357524	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr8:67357524C>A	ENST00000396623.3	+	6	456	c.425C>A	c.(424-426)aCc>aAc	p.T142N	ADHFE1_ENST00000415254.1_Missense_Mutation_p.T94N|ADHFE1_ENST00000379385.4_Missense_Mutation_p.T142N|ADHFE1_ENST00000496501.1_3'UTR	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	142					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)	p.T94N(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GGTGGCTCTACCATGGACACC	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											198.0	168.0	178.0					8																	67357524		2203	4300	6503	67520078	SO:0001583	missense	137872			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.425C>A	8.37:g.67357524C>A	ENSP00000379865:p.Thr142Asn	Somatic		Capture	Illumina GAIIx	4	67520078	B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Missense_Mutation	SNP	ENST00000396623.3	37	CCDS6190.2	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195352	0.58126	.	.	ENSG00000147576	ENST00000523113;ENST00000379385;ENST00000396623;ENST00000415254	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.85	4.98	0.66077	Alcohol dehydrogenase, iron-type (1);	0.293961	0.36555	N	0.002522	T	0.42108	0.1188	L	0.39397	1.21	0.30301	N	0.789429	B	0.34313	0.448	P	0.45794	0.493	T	0.51317	-0.8721	10	0.72032	D	0.01	-9.6334	6.9602	0.24593	0.0:0.7134:0.0:0.2866	.	142	Q8IWW8	HOT_HUMAN	N	77;142;142;94	ENSP00000428055:T77N;ENSP00000368695:T142N;ENSP00000379865:T142N;ENSP00000407115:T94N	ENSP00000368695:T142N	T	+	2	0	ADHFE1	67520078	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.818000	0.55678	1.484000	0.48361	0.655000	0.94253	ACC		0.463	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316867.3	NM_144650		Missense_Mutation
UGT2A1	10941	genome.wustl.edu	37	4	70465031	70465031	+	Missense_Mutation	SNP	C	C	T	rs374804650		TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr4:70465031C>T	ENST00000503640.1	-	2	852	c.797G>A	c.(796-798)cGt>cAt	p.R266H	UGT2A1_ENST00000286604.4_Missense_Mutation_p.R310H|UGT2A1_ENST00000514019.1_Missense_Mutation_p.R476H|UGT2A2_ENST00000457664.2_Missense_Mutation_p.R275H|UGT2A1_ENST00000502343.1_5'UTR|UGT2A1_ENST00000512704.1_Missense_Mutation_p.R266H	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	266					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.R266H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TAAGTATGGACGAGGAAATTC	0.403													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15702	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	4						C	HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	78.0	72.0	74.0		824,797	2.9	1.0	4		74	0,8600		0,0,4300	no	missense,missense	UGT2A1,UGT2A2	NM_001105677.2,NM_006798.2	29,29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	275/537,266/528	70465031	2,13004	2203	4300	6503	70499620	SO:0001583	missense	10941			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.797G>A	4.37:g.70465031C>T	ENSP00000424478:p.Arg266His	Somatic		Capture	Illumina GAIIx	4	70499620	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	37	CCDS3529.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	9.277	1.047051	0.19827	4.54E-4	0.0	ENSG00000173610	ENST00000457664;ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T;T	0.66460	0.13;0.13;-0.21;-0.21;-0.18	4.64	2.92	0.33932	.	0.115242	0.64402	N	0.000011	T	0.69753	0.3146	L	0.42487	1.325	.	.	.	D;P;D;B;B	0.89917	1.0;0.864;1.0;0.257;0.159	D;B;D;B;B	0.70935	0.95;0.189;0.971;0.023;0.071	T	0.72054	-0.4406	9	0.27785	T	0.31	.	7.8913	0.29680	0.1594:0.7545:0.0:0.0861	.	476;476;266;275;266	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1-2;Q9Y4X1	.;.;.;.;UD2A1_HUMAN	H	275;266;266;476;310	ENSP00000387888:R275H;ENSP00000424478:R266H;ENSP00000421432:R266H;ENSP00000425497:R476H;ENSP00000286604:R310H	ENSP00000286604:R310H	R	-	2	0	UGT2A1	70499620	1.000000	0.71417	0.968000	0.41197	0.246000	0.25737	5.648000	0.67930	0.685000	0.31468	-0.217000	0.12591	CGT		0.403	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798		Missense_Mutation
TRPA1	8989	genome.wustl.edu	37	8	72950287	72950287	+	Silent	SNP	A	A	G			TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr8:72950287A>G	ENST00000262209.4	-	20	2523	c.2316T>C	c.(2314-2316)acT>acC	p.T772T	TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000537896.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	772					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.T772T(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AAATCATACAAGTTTTTATTA	0.259																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	8											22.0	23.0	23.0					8																	72950287		2188	4260	6448	73112841	SO:0001819	synonymous_variant	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2316T>C	8.37:g.72950287A>G		Somatic		Capture	Illumina GAIIx	4	73112841	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1	SNP	3	WashU																																																																																				0.259	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		Silent
OR7E22P	9431	genome.wustl.edu	37	3	75406451	75406451	+	IGR	SNP	C	C	G			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:75406451C>G								AC117481.1 (11085 upstream) : AC139453.1 (11958 downstream)														p.D47H(1)									AGGTGGGAGTCAGAGCTGACA	0.582																																																1	Substitution - Missense(1)	ovary(1)	3																																								75489141	SO:0001628	intergenic_variant																																3.37:g.75406451C>G		Somatic		Capture	Illumina GAIIx	4	75489141		Missense_Mutation	SNP		37		SNP	29	WashU																																																																																			0	0.582									Missense_Mutation
NARS2	79731	genome.wustl.edu	37	11	78279748	78279748	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr11:78279748C>G	ENST00000281038.5	-	3	677	c.302G>C	c.(301-303)aGt>aCt	p.S101T	NARS2_ENST00000528850.1_5'UTR	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	101					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)	p.S101T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	TTTGGATGGACTTTTTATCAG	0.343																																																1	Substitution - Missense(1)	ovary(1)	11											177.0	170.0	173.0					11																	78279748		2200	4291	6491	77957396	SO:0001583	missense	79731			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.302G>C	11.37:g.78279748C>G	ENSP00000281038:p.Ser101Thr	Somatic		Capture	Illumina GAIIx	4	77957396	G3V178	Missense_Mutation	SNP	ENST00000281038.5	37	CCDS8261.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549321	0.86127	.	.	ENSG00000137513	ENST00000281038;ENST00000529880	T;T	0.21191	2.02;2.02	5.56	4.64	0.57946	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	L	0.50919	1.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08046	-1.0741	10	0.27785	T	0.31	-13.8573	15.3253	0.74157	0.0:0.8592:0.1408:0.0	.	101	Q96I59	SYNM_HUMAN	T	101	ENSP00000281038:S101T;ENSP00000432240:S101T	ENSP00000281038:S101T	S	-	2	0	NARS2	77957396	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.495000	0.73665	1.326000	0.45319	0.650000	0.86243	AGT		0.343	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391138.2	NM_024678		Missense_Mutation
GRID1	2894	genome.wustl.edu	37	10	87966324	87966324	+	Missense_Mutation	SNP	G	G	A	rs201908927		TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr10:87966324G>A	ENST00000327946.7	-	3	402	c.317C>T	c.(316-318)aCg>aTg	p.T106M		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	106					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.T106M(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CATGGCATCCGTGAGGGACTG	0.612										Multiple Myeloma(13;0.14)																																						1	Substitution - Missense(1)	ovary(1)	10											138.0	86.0	103.0					10																	87966324		2203	4300	6503	87956304	SO:0001583	missense	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.317C>T	10.37:g.87966324G>A	ENSP00000330148:p.Thr106Met	Somatic		Capture	Illumina GAIIx	4	87956304	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862897	0.91511	.	.	ENSG00000182771	ENST00000327946	D	0.83250	-1.7	5.92	5.92	0.95590	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90072	0.6899	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.90169	0.4234	10	0.87932	D	0	.	19.2962	0.94122	0.0:0.0:1.0:0.0	.	106	Q9ULK0	GRID1_HUMAN	M	106	ENSP00000330148:T106M	ENSP00000330148:T106M	T	-	2	0	GRID1	87956304	1.000000	0.71417	0.940000	0.37924	0.919000	0.55068	9.854000	0.99522	2.795000	0.96236	0.655000	0.94253	ACG		0.612	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		Missense_Mutation
IGKV4-1	28908	genome.wustl.edu	37	2	89185449	89185449	+	RNA	SNP	G	G	T	rs371960591		TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr2:89185449G>T	ENST00000390243.2	+	0	318							P06312	KV401_HUMAN	immunoglobulin kappa variable 4-1						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										TCCAGCCAGAGTGTTTTATAC	0.532																																																0			2											93.0	93.0	93.0					2																	89185449		1969	4154	6123	88966564						Z00023		2p11.2	2012-02-08			ENSG00000211598	ENSG00000211598		"""Immunoglobulins / IGK locus"""	5834	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV41, B3		P06312	OTTHUMG00000151533		2.37:g.89185449G>T		Somatic		Capture	Illumina GAIIx	4	88966564		Missense_Mutation	SNP	ENST00000390243.2	37		SNP	36	WashU																																																																																				0.532	IGKV4-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323037.2	NG_000834		Missense_Mutation
Unknown	0	genome.wustl.edu	37	11	89500140	89500140	+	IGR	SNP	A	A	G			TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr11:89500140A>G								RP11-313I2.11 (12019 upstream) : TRIM49 (30682 downstream)																							AAATAGTCAGATCTGTCAGAA	0.478																																																0			11																																								89139788	SO:0001628	intergenic_variant																																11.37:g.89500140A>G		Somatic		Capture	Illumina GAIIx	4	89139788		Missense_Mutation	SNP		37		SNP	12	WashU																																																																																			0	0.478									Missense_Mutation
EPHA3	2042	genome.wustl.edu	37	3	89499497	89499497	+	Silent	SNP	G	G	A			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:89499497G>A	ENST00000336596.2	+	15	2892	c.2667G>A	c.(2665-2667)aaG>aaA	p.K889K	EPHA3_ENST00000494014.1_Silent_p.K889K	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	889					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.K889K(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCAGCCTGAAGATCATCACCA	0.438										TSP Lung(6;0.00050)																																						1	Substitution - coding silent(1)	ovary(1)	3											68.0	63.0	65.0					3																	89499497		2203	4300	6503	89582187	SO:0001819	synonymous_variant	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2667G>A	3.37:g.89499497G>A		Somatic		Capture	Illumina GAIIx	4	89582187	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1	SNP	33	WashU																																																																																				0.438	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		Silent
TRIM4	89122	genome.wustl.edu	37	7	99489913	99489913	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr7:99489913A>G	ENST00000355947.2	-	7	1505	c.1376T>C	c.(1375-1377)tTc>tCc	p.F459S	TRIM4_ENST00000349062.2_Missense_Mutation_p.F433S	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	459	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.F459S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				AGCGCTGTAGAAGGAGACATT	0.537																																																1	Substitution - Missense(1)	ovary(1)	7											147.0	142.0	144.0					7																	99489913		2203	4300	6503	99327849	SO:0001583	missense	89122			AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.1376T>C	7.37:g.99489913A>G	ENSP00000348216:p.Phe459Ser	Somatic		Capture	Illumina GAIIx	4	99327849	A4D298|Q75MK1|Q96F06|Q9C036	Missense_Mutation	SNP	ENST00000355947.2	37	CCDS5679.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580308	0.65992	.	.	ENSG00000146833	ENST00000355947;ENST00000349062;ENST00000542799	D;D	0.89552	-2.53;-2.53	2.47	2.47	0.30058	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.95166	0.8433	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.976;0.986	D	0.94680	0.7864	9	0.87932	D	0	.	8.7975	0.34887	1.0:0.0:0.0:0.0	.	433;459	Q9C037-2;Q9C037	.;TRIM4_HUMAN	S	459;433;289	ENSP00000348216:F459S;ENSP00000275736:F433S	ENSP00000275736:F433S	F	-	2	0	TRIM4	99327849	1.000000	0.71417	0.917000	0.36280	0.878000	0.50629	5.503000	0.66962	1.397000	0.46682	0.533000	0.62120	TTC		0.537	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017		Missense_Mutation
ADH1C	126	genome.wustl.edu	37	4	100257932	100257932	+	RNA	SNP	T	T	C			TCGA-24-1413-01	TCGA-24-1413-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr4:100257932T>C	ENST00000515683.1	-	0	1456					NM_000669.3	NP_000660.1	P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	ACGGTACGGATACTGCAATAG	0.423																																																0			4											190.0	176.0	181.0					4																	100257932		2203	4300	6503	100476955			126			M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100257932T>C		Somatic		Capture	Illumina GAIIx	4	100476955	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	Missense_Mutation	SNP	ENST00000515683.1	37		SNP	49	WashU																																																																																				0.423	ADH1C-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000364877.2	NM_000669		Missense_Mutation
RHOF	54509	genome.wustl.edu	37	12	122217458	122217458	+	Missense_Mutation	SNP	G	G	C	rs377473825		TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr12:122217458G>C	ENST00000267205.2	-	5	1210	c.582C>G	c.(580-582)agC>agG	p.S194R	TMEM120B_ENST00000538055.1_3'UTR|TMEM120B_ENST00000449592.2_3'UTR|RHOF_ENST00000537265.1_Missense_Mutation_p.S94R	NM_019034.2	NP_061907.2	Q9HBH0	RHOF_HUMAN	ras homolog family member F (in filopodia)	194					actin filament organization (GO:0007015)|GTP catabolic process (GO:0006184)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S194R(1)		large_intestine(1)|lung(1)|ovary(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		TCTTCAGAGCGCTGAGAGCCA	0.637																																																1	Substitution - Missense(1)	ovary(1)	12											57.0	57.0	57.0					12																	122217458		2203	4300	6503	120701841	SO:0001583	missense	54509			AK000254	CCDS9222.1	12q24.31	2013-09-23	2012-02-27	2004-03-24	ENSG00000139725	ENSG00000139725			15703	protein-coding gene	gene with protein product			"""ras homolog gene family, member F (in filopodia)"""	ARHF		11084341	Standard	NM_019034		Approved	FLJ20247, RIF	uc001ubb.3	Q9HBH0	OTTHUMG00000169077	ENST00000267205.2:c.582C>G	12.37:g.122217458G>C	ENSP00000267205:p.Ser194Arg	Somatic		Capture	Illumina GAIIx	4	120701841	Q8WVB1|Q9NXH6	Missense_Mutation	SNP	ENST00000267205.2	37	CCDS9222.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	g	3.676	-0.066522	0.07273	.	.	ENSG00000139725	ENST00000267205	T	0.69175	-0.38	4.88	-9.76	0.00503	.	0.290468	0.38058	N	0.001829	T	0.50222	0.1603	L	0.42245	1.32	0.09310	N	0.999997	B	0.10296	0.003	B	0.20184	0.028	T	0.26395	-1.0104	10	0.24483	T	0.36	.	15.0132	0.71565	0.289:0.0893:0.6217:0.0	.	194	Q9HBH0	RHOF_HUMAN	R	194	ENSP00000267205:S194R	ENSP00000267205:S194R	S	-	3	2	RHOF	120701841	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-4.726000	0.00193	-4.278000	0.00059	-4.371000	0.00006	AGC		0.637	RHOF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402165.1			Missense_Mutation
ACPP	55	genome.wustl.edu	37	3	132075676	132075676	+	Missense_Mutation	SNP	G	G	T	rs151032097		TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:132075676G>T	ENST00000336375.5	+	10	1205	c.1115G>T	c.(1114-1116)tGt>tTt	p.C372F	ACPP_ENST00000475741.1_Missense_Mutation_p.C339F|ACPP_ENST00000351273.7_Missense_Mutation_p.C372F	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	372				C -> V (in Ref. 3; AAA60022). {ECO:0000305}.	adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)	p.C372F(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TCCACGGAGTGTATGACCACA	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											144.0	124.0	131.0					3																	132075676		2203	4300	6503	133558366	SO:0001583	missense	55				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.1115G>T	3.37:g.132075676G>T	ENSP00000337471:p.Cys372Phe	Somatic		Capture	Illumina GAIIx	4	133558366	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	37	CCDS3073.1	SNP	48	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.75|17.75	3.466300|3.466300	0.63625|0.63625	.|.	.|.	ENSG00000014257|ENSG00000014257	ENST00000336375;ENST00000475741;ENST00000351273|ENST00000507647	D;D;D|.	0.96200|.	-3.94;-3.94;-3.94|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85448|0.85448	0.5699|0.5699	M|M	0.93106|0.93106	3.38|3.38	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;0.999|.	D|D	0.88514|0.88514	0.3091|0.3091	10|5	0.87932|.	D|.	0|.	.|.	15.2731|15.2731	0.73720|0.73720	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	372;372;339|.	P15309;P15309-2;Q5FBY0|.	PPAP_HUMAN;.;.|.	F|L	372;339;372|57	ENSP00000337471:C372F;ENSP00000417744:C339F;ENSP00000323036:C372F|.	ENSP00000337471:C372F|.	C|V	+|+	2|1	0|0	ACPP|ACPP	133558366|133558366	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.670000|0.670000	0.39368|0.39368	5.307000|5.307000	0.65762|0.65762	2.677000|2.677000	0.91161|0.91161	0.655000|0.655000	0.94253|0.94253	TGT|GTA		0.537	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099		Missense_Mutation
SSBP1	6742	genome.wustl.edu	37	7	141443442	141443442	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1413-01	TCGA-24-1413-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr7:141443442T>G	ENST00000481508.1	+	4	602	c.167T>G	c.(166-168)aTa>aGa	p.I56R	SSBP1_ENST00000465582.1_Missense_Mutation_p.I56R|SSBP1_ENST00000484178.1_Missense_Mutation_p.I56R|SSBP1_ENST00000265304.6_Missense_Mutation_p.I56R|SSBP1_ENST00000498107.1_Missense_Mutation_p.I56R|SSBP1_ENST00000469123.1_3'UTR	NM_001256510.1	NP_001243439.1	Q04837	SSBP_HUMAN	single-stranded DNA binding protein 1, mitochondrial	56	SSB.				DNA replication (GO:0006260)|mitochondrion morphogenesis (GO:0070584)|positive regulation of helicase activity (GO:0051096)	extracellular vesicular exosome (GO:0070062)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)	p.I56R(1)		large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|skin(1)	7	Melanoma(164;0.0171)					CCAGTCACAATATTTTCTCTA	0.433																																																1	Substitution - Missense(1)	ovary(1)	7											132.0	131.0	131.0					7																	141443442		2203	4300	6503	141089911	SO:0001583	missense	6742			M94556	CCDS5866.1	7q34	2012-05-25	2012-05-25		ENSG00000106028	ENSG00000106028			11317	protein-coding gene	gene with protein product		600439	"""single-stranded DNA-binding protein"", ""single-stranded DNA binding protein 1"""			7789991	Standard	NM_001256510		Approved	SSBP, mtSSB	uc031szi.1	Q04837	OTTHUMG00000157572	ENST00000481508.1:c.167T>G	7.37:g.141443442T>G	ENSP00000419665:p.Ile56Arg	Somatic		Capture	Illumina GAIIx	4	141089911		Missense_Mutation	SNP	ENST00000481508.1	37	CCDS5866.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384287	0.82792	.	.	ENSG00000106028	ENST00000265304;ENST00000498107;ENST00000467681;ENST00000465582;ENST00000463093;ENST00000484178;ENST00000481508	.	.	.	5.66	5.66	0.87406	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	N	0.11560	0.145	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.70716	0.97;0.946	T	0.67745	-0.5591	9	0.62326	D	0.03	-41.2488	15.8917	0.79303	0.0:0.0:0.0:1.0	.	56;56	B7Z268;Q04837	.;SSBP_HUMAN	R	56	.	ENSP00000265304:I56R	I	+	2	0	SSBP1	141089911	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	7.043000	0.76572	2.158000	0.67659	0.459000	0.35465	ATA		0.433	SSBP1-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349187.1	NM_003143		Missense_Mutation
HCN3	57657	genome.wustl.edu	37	1	155254337	155254337	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr1:155254337C>T	ENST00000368358.3	+	4	886	c.878C>T	c.(877-879)tCg>tTg	p.S293L	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	293					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.S293L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAGAACCACTCGTGGGGCCGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											57.0	52.0	53.0					1																	155254337		2203	4300	6503	153520961	SO:0001583	missense	57657			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.878C>T	1.37:g.155254337C>T	ENSP00000357342:p.Ser293Leu	Somatic		Capture	Illumina GAIIx	4	153520961	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	ENST00000368358.3	37	CCDS1108.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	30	5.056221	0.93793	.	.	ENSG00000143630	ENST00000368358	D	0.98666	-5.06	5.35	5.35	0.76521	Ion transport (1);	0.000000	0.44902	D	0.000409	D	0.98937	0.9639	M	0.89478	3.035	0.58432	D	0.999996	D	0.61080	0.989	P	0.57204	0.815	D	0.99016	1.0816	10	0.48119	T	0.1	.	16.9105	0.86139	0.0:1.0:0.0:0.0	.	293	Q9P1Z3	HCN3_HUMAN	L	293	ENSP00000357342:S293L	ENSP00000357342:S293L	S	+	2	0	HCN3	153520961	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.776000	0.85560	2.653000	0.90120	0.557000	0.71058	TCG		0.592	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087388.1	NM_020897		Missense_Mutation
ADIPOQ	9370	genome.wustl.edu	37	3	186572201	186572201	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr3:186572201G>T	ENST00000412955.2	+	3	584	c.443G>T	c.(442-444)gGt>gTt	p.G148V	ADIPOQ_ENST00000444204.2_Missense_Mutation_p.G148V|ADIPOQ_ENST00000320741.2_Missense_Mutation_p.G148V|ADIPOQ-AS1_ENST00000422718.1_RNA			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	148	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)	p.G148V(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		GGCTCCACTGGTAAATTCCAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											194.0	172.0	180.0					3																	186572201		2203	4300	6503	188054895	SO:0001583	missense	9370			D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.443G>T	3.37:g.186572201G>T	ENSP00000405611:p.Gly148Val	Somatic		Capture	Illumina GAIIx	4	188054895	Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	37	CCDS3284.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479953	0.84747	.	.	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	D;D;D	0.90324	-2.65;-2.65;-2.65	5.25	5.25	0.73442	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.061993	0.64402	D	0.000005	D	0.97046	0.9035	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98179	1.0456	10	0.87932	D	0	.	16.6983	0.85342	0.0:0.0:1.0:0.0	.	148	Q15848	ADIPO_HUMAN	V	148	ENSP00000405611:G148V;ENSP00000320709:G148V;ENSP00000389814:G148V	ENSP00000320709:G148V	G	+	2	0	ADIPOQ	188054895	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.006000	0.88564	2.631000	0.89168	0.561000	0.74099	GGT		0.453	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797		Missense_Mutation
DIEXF	27042	genome.wustl.edu	37	1	210015727	210015728	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-24-1413-01	TCGA-24-1413-10	GG	GG	GG	CT	GG	GG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr1:210015727_210015728GG>CT	ENST00000491415.2	+	9	1660_1661	c.1603_1604GG>CT	c.(1603-1605)GGg>CTg	p.G535L		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	535					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						ACTGCTATTTGGGGCCCTTCAG	0.495																																																0			1																																								208082351	SO:0001583	missense	27042			BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	Exception_encountered	1.37:g.210015727_210015728delinsCT	ENSP00000419005:p.Gly535Leu	Somatic		Capture	Illumina GAIIx	4	208082350	O75992|Q4VY00|Q63HL9	Missense	DNP	ENST00000491415.2	37	CCDS1493.1	DNP	47	WashU																																																																																				0.495	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388		Missense
ILKAP	80895	genome.wustl.edu	37	2	239102952	239102952	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1413-01	TCGA-24-1413-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr2:239102952A>G	ENST00000254654.3	-	3	317	c.142T>C	c.(142-144)Ttt>Ctt	p.F48L	ILKAP_ENST00000490837.1_5'Flank	NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	48					protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.F48L(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		AGATCATCAAAAAGCAAAGGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											77.0	75.0	75.0					2																	239102952		2203	4300	6503	238767691	SO:0001583	missense	80895			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.142T>C	2.37:g.239102952A>G	ENSP00000254654:p.Phe48Leu	Somatic		Capture	Illumina GAIIx	4	238767691	B3KM39	Missense_Mutation	SNP	ENST00000254654.3	37	CCDS2526.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	26.5	4.747135	0.89663	.	.	ENSG00000132323	ENST00000254654;ENST00000457149	T;T	0.50001	1.93;0.76	5.8	5.8	0.92144	.	0.194072	0.45361	D	0.000374	T	0.33673	0.0871	N	0.19112	0.55	0.49130	D	0.99975	P	0.34977	0.478	B	0.31442	0.13	T	0.29971	-0.9994	10	0.72032	D	0.01	0.7114	13.6667	0.62401	1.0:0.0:0.0:0.0	.	48	Q9H0C8	ILKAP_HUMAN	L	48	ENSP00000254654:F48L;ENSP00000395301:F48L	ENSP00000254654:F48L	F	-	1	0	ILKAP	238767691	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.210000	0.65214	2.212000	0.71576	0.528000	0.53228	TTT		0.428	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768		Missense_Mutation
EXO1	9156	genome.wustl.edu	37	1	242016670	242016670	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1413-01	TCGA-24-1413-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr1:242016670G>A	ENST00000366548.3	+	6	885	c.292G>A	c.(292-294)Gcc>Acc	p.A98T	EXO1_ENST00000518483.1_Missense_Mutation_p.A98T|EXO1_ENST00000348581.5_Missense_Mutation_p.A98T|EXO1_ENST00000493702.1_3'UTR	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	98	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)	p.A98T(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AAGACGACAAGCCAATCTTCT	0.413								Editing and processing nucleases																																								1	Substitution - Missense(1)	ovary(1)	1											74.0	81.0	79.0					1																	242016670		2203	4300	6503	240083293	SO:0001583	missense	9156			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.292G>A	1.37:g.242016670G>A	ENSP00000355506:p.Ala98Thr	Somatic		Capture	Illumina GAIIx	4	240083293	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	37	CCDS1620.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401551	0.25291	.	.	ENSG00000174371	ENST00000366548;ENST00000423131;ENST00000523590;ENST00000348581;ENST00000366547;ENST00000518483;ENST00000437497;ENST00000450748	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.51	0.76	0.18442	XPG N-terminal (2);	0.366531	0.33477	N	0.004864	T	0.23846	0.0577	N	0.17474	0.49	0.40035	D	0.975578	B;B;B	0.13594	0.004;0.002;0.008	B;B;B	0.09377	0.003;0.002;0.004	T	0.04855	-1.0922	10	0.19147	T	0.46	1.1907	5.3604	0.16085	0.4128:0.0:0.4554:0.1319	.	98;98;98	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	T	98;58;58;98;58;98;58;98	ENSP00000355506:A98T;ENSP00000415531:A58T;ENSP00000430082:A58T;ENSP00000311873:A98T;ENSP00000430251:A98T;ENSP00000412041:A58T;ENSP00000406652:A98T	ENSP00000311873:A98T	A	+	1	0	EXO1	240083293	1.000000	0.71417	0.999000	0.59377	0.856000	0.48823	1.189000	0.32114	0.188000	0.20168	0.655000	0.94253	GCC		0.413	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027		Missense_Mutation
CACNA2D4	93589	genome.wustl.edu	37	12	1996218	1996218	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1413-01	TCGA-24-1413-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1413-01	TCGA-24-1413-10	g.chr12:1996218C>A	ENST00000382722.5	-	7	1161	c.799G>T	c.(799-801)Gat>Tat	p.D267Y	CACNA2D4_ENST00000586184.1_Missense_Mutation_p.D267Y|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.D203Y|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.D203Y|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.D267Y	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	267					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.D267Y(1)		endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCATTCTCATCAGGTGTCCAT	0.517																																					Colon(2;101 179 21030 23310 28141)											1	Substitution - Missense(1)	ovary(1)	12											58.0	56.0	56.0					12																	1996218		1858	4097	5955	1866479	SO:0001583	missense	93589			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.799G>T	12.37:g.1996218C>A	ENSP00000372169:p.Asp267Tyr	Somatic		Capture	Illumina GAIIx	4	1866479	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	CCDS44785.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675122	0.88445	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.08896	3.04	5.32	5.32	0.75619	.	0.043371	0.85682	D	0.000000	T	0.34542	0.0901	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.23013	-1.0200	10	0.87932	D	0	.	18.9993	0.92826	0.0:1.0:0.0:0.0	.	267	Q7Z3S7	CA2D4_HUMAN	Y	203;267;267	ENSP00000372169:D267Y	ENSP00000280663:D267Y	D	-	1	0	CACNA2D4	1866479	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.703000	0.84585	2.490000	0.84030	0.555000	0.69702	GAT		0.517	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2			Missense_Mutation
