#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
TP53	7157	genome.wustl.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	T	C	rs587780073		TCGA-24-1425-01	TCGA-24-1425-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr17:7577580T>C	ENST00000269305.4	-	7	890	c.701A>G	c.(700-702)tAc>tGc	p.Y234C	TP53_ENST00000359597.4_Missense_Mutation_p.Y234C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.Y234C|TP53_ENST00000420246.2_Missense_Mutation_p.Y234C|TP53_ENST00000445888.2_Missense_Mutation_p.Y234C|TP53_ENST00000455263.2_Missense_Mutation_p.Y234C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y234C(94)|p.Y234S(9)|p.Y141C(8)|p.0?(8)|p.?(5)|p.Y234del(3)|p.Y141S(2)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234F(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234R(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.I232fs*5(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGTAGTTGTAGTGGATGGT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	141	Substitution - Missense(115)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(5)	lung(32)|haematopoietic_and_lymphoid_tissue(17)|breast(17)|ovary(15)|central_nervous_system(10)|urinary_tract(9)|upper_aerodigestive_tract(8)|oesophagus(7)|biliary_tract(6)|large_intestine(5)|kidney(4)|bone(4)|cervix(2)|stomach(2)|adrenal_gland(1)|skin(1)|liver(1)	17	GRCh37	CM035576	TP53	M							119.0	95.0	103.0					17																	7577580		2203	4300	6503	7518305	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.701A>G	17.37:g.7577580T>C	ENSP00000269305:p.Tyr234Cys	Somatic		Capture	Illumina GAIIx	4	7518305	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146603	0.57044	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99826	-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98	4.62	3.49	0.39957	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.211900	0.41823	D	0.000804	D	0.99778	0.9908	M	0.88105	2.93	0.51012	D	0.999909	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.982;0.998;0.997;0.985;0.994;0.999	D	0.98045	1.0384	10	0.87932	D	0	-10.1131	9.0203	0.36195	0.1783:0.0:0.0:0.8216	.	234;234;141;234;234;234	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	234;234;234;234;234;234;223;141;102;141	ENSP00000410739:Y234C;ENSP00000352610:Y234C;ENSP00000269305:Y234C;ENSP00000398846:Y234C;ENSP00000391127:Y234C;ENSP00000391478:Y234C;ENSP00000425104:Y102C;ENSP00000423862:Y141C	ENSP00000269305:Y234C	Y	-	2	0	TP53	7518305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.037000	0.41174	0.835000	0.34877	0.379000	0.24179	TAC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CEP192	55125	genome.wustl.edu	37	18	13056381	13056381	+	Silent	SNP	G	G	T	rs546519115		TCGA-24-1425-01	TCGA-24-1425-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr18:13056381G>T	ENST00000325971.8	+	17	3597	c.2004G>T	c.(2002-2004)cgG>cgT	p.R668R	CEP192_ENST00000430049.2_Silent_p.R789R|CEP192_ENST00000506447.1_Silent_p.R1264R			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	668					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTGCTCAGCGGTATTTGGGAA	0.562																																																0			18											92.0	75.0	80.0					18																	13056381		2203	4300	6503	13046381	SO:0001819	synonymous_variant	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.2004G>T	18.37:g.13056381G>T		Somatic		Capture	Illumina GAIIx	4	13046381	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Silent	SNP	ENST00000325971.8	37		SNP	44	WashU																																																																																				0.562	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		Silent
NHLRC1	378884	genome.wustl.edu	37	6	18121902	18121902	+	Silent	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr6:18121902C>T	ENST00000340650.3	-	1	949	c.936G>A	c.(934-936)ctG>ctA	p.L312L		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	312					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			AGTAGAGGCTCAGCCCAAAGG	0.527																																																0			6											76.0	71.0	73.0					6																	18121902		2203	4300	6503	18229881	SO:0001819	synonymous_variant	378884			AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.936G>A	6.37:g.18121902C>T		Somatic		Capture	Illumina GAIIx	4	18229881	Q3SYB1|Q5VUK7|Q6IMH1	Silent	SNP	ENST00000340650.3	37	CCDS4542.1	SNP	29	WashU																																																																																				0.527	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039958.1			Silent
TUBA3C	7278	genome.wustl.edu	37	13	19748050	19748051	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-24-1425-01	TCGA-24-1425-10	CC	CC	CC	AA	CC	CC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr13:19748050_19748051CC>AA	ENST00000400113.3	-	5	1409_1410	c.1305_1306GG>TT	c.(1303-1308)gtGGgc>gtTTgc	p.G436C		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	436					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GAATCCACGCCCACCTCTTCAT	0.609																																																0			13																																								18646051	SO:0001583	missense	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1305_1306delinsAA	13.37:g.19748050_19748051delinsAA	ENSP00000382982:p.Gly436Cys	Somatic		Capture	Illumina GAIIx	4	18646050	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense	DNP	ENST00000400113.3	37	CCDS9284.1	DNP	22	WashU																																																																																				0.609	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		Missense
SEZ6L	23544	genome.wustl.edu	37	22	26688759	26688759	+	Missense_Mutation	SNP	C	C	T	rs201671037	byFrequency	TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr22:26688759C>T	ENST00000248933.6	+	2	577	c.482C>T	c.(481-483)aCg>aTg	p.T161M	SEZ6L_ENST00000529632.2_Missense_Mutation_p.T161M|SEZ6L_ENST00000404234.3_Missense_Mutation_p.T161M|SEZ6L_ENST00000360929.3_Missense_Mutation_p.T161M|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000343706.4_Missense_Mutation_p.T161M			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	161	O-glycosylated at one site.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.T161K(1)|p.T161M(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TCCTCCTCCACGGAGAAGCCT	0.677													C|||	44	0.00878594	0.0	0.0	5008	,	,		16440	0.0		0.0	False		,,,				2504	0.045															2	Substitution - Missense(2)	ovary(1)|lung(1)	22											43.0	41.0	42.0					22																	26688759		2203	4300	6503	25018759	SO:0001583	missense	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.482C>T	22.37:g.26688759C>T	ENSP00000248933:p.Thr161Met	Somatic		Capture	Illumina GAIIx	4	25018759	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001308	0.35320	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.28895	1.81;1.94;2.01;1.82;1.59	3.57	1.41	0.22369	.	0.655352	0.12550	N	0.459133	T	0.22936	0.0554	N	0.08118	0	0.09310	N	1	P;P;D;D;P;P	0.63046	0.918;0.918;0.992;0.992;0.918;0.918	P;P;P;P;P;P	0.54499	0.475;0.475;0.754;0.754;0.475;0.475	T	0.09164	-1.0687	10	0.66056	D	0.02	.	5.5725	0.17204	0.1569:0.6553:0.0:0.1878	.	161;161;161;161;161;161	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	M	161	ENSP00000384772:T161M;ENSP00000437037:T161M;ENSP00000354185:T161M;ENSP00000248933:T161M;ENSP00000342661:T161M	ENSP00000248933:T161M	T	+	2	0	SEZ6L	25018759	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	0.883000	0.28200	0.288000	0.22398	0.508000	0.49915	ACG		0.677	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			Missense_Mutation
MTIF3	219402	genome.wustl.edu	37	13	28009711	28009711	+	IGR	SNP	G	G	A			TCGA-24-1425-01	TCGA-24-1425-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr13:28009711G>A	ENST00000381116.1	-	0	1104				MTIF3_ENST00000461838.1_5'Flank|GTF3A_ENST00000381140.4_Missense_Mutation_p.V359I|GTF3A_ENST00000470606.1_3'UTR			Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3						formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		GCTCTCGACAGTTGCAGTACT	0.448																																																0			13											97.0	83.0	88.0					13																	28009711		1568	3582	5150	26907711	SO:0001628	intergenic_variant	2971			BC046166	CCDS9322.1	13q12.2	2007-05-03			ENSG00000122033	ENSG00000122033			29788	protein-coding gene	gene with protein product						12095986	Standard	NM_152912		Approved	IF-3mt, IF3(mt)	uc001uri.3	Q9H2K0	OTTHUMG00000016633		13.37:g.28009711G>A		Somatic		Capture	Illumina GAIIx	4	26907711	Q05BL8|Q5W0V0|Q86X68	Missense_Mutation	SNP	ENST00000381116.1	37	CCDS9322.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	13.19	2.161800	0.38217	.	.	ENSG00000122034	ENST00000381140;ENST00000439403	T;T	0.09255	3.0;3.07	5.55	5.55	0.83447	.	0.743246	0.13065	N	0.416576	T	0.09379	0.0231	L	0.34521	1.04	0.23906	N	0.996504	P;P	0.38827	0.649;0.518	B;B	0.33454	0.164;0.079	T	0.27739	-1.0065	9	0.21540	T	0.41	-3.2265	15.0241	0.71653	0.0:0.1419:0.8581:0.0	.	334;359	Q92664-2;Q92664	.;TF3A_HUMAN	I	359;172	ENSP00000370532:V359I;ENSP00000393050:V172I	ENSP00000370532:V359I	V	+	1	0	GTF3A	26907711	0.246000	0.23909	0.006000	0.13384	0.003000	0.03518	3.577000	0.53885	2.605000	0.88082	0.655000	0.94253	GTT		0.448	MTIF3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044300.1	NM_152912		Missense_Mutation
CHN2	1124	genome.wustl.edu	37	7	29440168	29440168	+	Silent	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr7:29440168C>T	ENST00000222792.6	+	6	830	c.300C>T	c.(298-300)aaC>aaT	p.N100N	CHN2_ENST00000539406.1_Silent_p.N175N|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000495789.2_Silent_p.N113N|CHN2_ENST00000539389.1_Intron|CHN2_ENST00000546235.1_Silent_p.N85N	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	100	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.N100N(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GGTTTGGAAACCAGACCTTAA	0.433																																					Ovarian(1;44 48 13232 18918 31480)											1	Substitution - coding silent(1)	ovary(1)	7											88.0	84.0	85.0					7																	29440168		2203	4300	6503	29406693	SO:0001819	synonymous_variant	1124			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.300C>T	7.37:g.29440168C>T		Somatic		Capture	Illumina GAIIx	4	29406693	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	SNP	18	WashU																																																																																				0.433	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067		Missense_Mutation
ZCCHC7	84186	genome.wustl.edu	37	9	37304239	37304239	+	Missense_Mutation	SNP	G	G	C	rs560856435		TCGA-24-1425-01	TCGA-24-1425-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr9:37304239G>C	ENST00000336755.5	+	4	815	c.709G>C	c.(709-711)Gcc>Ccc	p.A237P	ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_5'UTR	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	237						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A237P(1)		central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		GTACTATTCAGCCAACAAAAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	9											98.0	95.0	96.0					9																	37304239		2203	4300	6503	37294239	SO:0001583	missense	84186			AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.709G>C	9.37:g.37304239G>C	ENSP00000337839:p.Ala237Pro	Somatic		Capture	Illumina GAIIx	4	37294239	B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Missense_Mutation	SNP	ENST00000336755.5	37	CCDS6608.2	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	11.23	1.578065	0.28180	.	.	ENSG00000147905	ENST00000336755	T	0.32515	1.45	5.57	3.72	0.42706	Zinc finger, CCHC retroviral-type (1);	0.632453	0.15401	N	0.264304	T	0.28366	0.0701	L	0.27053	0.805	0.36205	D	0.850997	D	0.62365	0.991	P	0.52109	0.69	T	0.17137	-1.0379	10	0.33141	T	0.24	-11.5768	7.8777	0.29603	0.1525:0.1331:0.7144:0.0	.	237	Q8N3Z6	ZCHC7_HUMAN	P	237	ENSP00000337839:A237P	ENSP00000337839:A237P	A	+	1	0	ZCCHC7	37294239	0.886000	0.30341	0.914000	0.36105	0.313000	0.28021	1.111000	0.31159	1.375000	0.46248	0.650000	0.86243	GCC		0.378	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052453.2	NM_032226		Missense_Mutation
GFAP	2670	genome.wustl.edu	37	17	42991126	42991126	+	Silent	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr17:42991126C>T	ENST00000253408.5	-	3	653	c.588G>A	c.(586-588)gaG>gaA	p.E196E	GFAP_ENST00000588735.1_Intron|GFAP_ENST00000435360.2_Silent_p.E196E|GFAP_ENST00000586793.1_Silent_p.E196E|GFAP_ENST00000591327.1_5'UTR	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	196	Coil 1B.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)	p.E196E(1)		endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				AGAACCGGATCTCCTCCTCCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	17											175.0	175.0	175.0					17																	42991126		2203	4300	6503	40346652	SO:0001819	synonymous_variant	2670			S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.588G>A	17.37:g.42991126C>T		Somatic		Capture	Illumina GAIIx	4	40346652	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Silent	SNP	ENST00000253408.5	37	CCDS11491.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549063	0.45383	.	.	ENSG00000131095	ENST00000376990	D	0.88354	-2.37	4.71	1.29	0.21616	.	.	.	.	.	D	0.90324	0.6973	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.87626	0.2513	6	0.49607	T	0.09	.	11.2267	0.48888	0.0:0.8162:0.0:0.1838	.	.	.	.	K	176	ENSP00000366189:R176K	ENSP00000366189:R176K	R	-	2	0	GFAP	40346652	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.620000	0.46410	0.157000	0.19338	0.462000	0.41574	AGA		0.582	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055		Silent
R3HDML	140902	genome.wustl.edu	37	20	42972127	42972127	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1425-01	TCGA-24-1425-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr20:42972127C>A	ENST00000217043.2	+	3	663	c.491C>A	c.(490-492)cCc>cAc	p.P164H	Y_RNA_ENST00000364493.1_RNA	NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	164	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			TGCGATGGCCCCACCTGCTCC	0.572																																																0			20											86.0	64.0	71.0					20																	42972127		2203	4300	6503	42405541	SO:0001583	missense	140902			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.491C>A	20.37:g.42972127C>A	ENSP00000217043:p.Pro164His	Somatic		Capture	Illumina GAIIx	4	42405541		Missense_Mutation	SNP	ENST00000217043.2	37	CCDS13329.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616698	0.28801	.	.	ENSG00000101074	ENST00000217043	T	0.07800	3.16	5.09	4.08	0.47627	CAP domain (3);	0.446898	0.23650	N	0.045938	T	0.11665	0.0284	L	0.56280	1.765	0.38853	D	0.95632	B	0.25390	0.125	B	0.29598	0.104	T	0.06552	-1.0820	10	0.56958	D	0.05	.	14.294	0.66300	0.1493:0.8507:0.0:0.0	.	164	Q9H3Y0	CRSPL_HUMAN	H	164	ENSP00000217043:P164H	ENSP00000217043:P164H	P	+	2	0	R3HDML	42405541	0.377000	0.25106	0.945000	0.38365	0.004000	0.04260	4.901000	0.63259	2.516000	0.84829	0.650000	0.86243	CCC		0.572	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491		Missense_Mutation
TRIM37	4591	genome.wustl.edu	37	17	57128679	57128679	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1425-01	TCGA-24-1425-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr17:57128679G>C	ENST00000262294.7	-	14	1469	c.1210C>G	c.(1210-1212)Cgt>Ggt	p.R404G	TRIM37_ENST00000393065.2_Missense_Mutation_p.R370G|TRIM37_ENST00000393066.3_Missense_Mutation_p.R404G|TRIM37_ENST00000376149.3_Missense_Mutation_p.R282G	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	404					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R404G(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GTTGGTGAACGTACCTGAAAC	0.343									Mulibrey Nanism																																							1	Substitution - Missense(1)	ovary(1)	17											87.0	86.0	86.0					17																	57128679		2203	4300	6503	54483461	SO:0001583	missense	4591	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.1210C>G	17.37:g.57128679G>C	ENSP00000262294:p.Arg404Gly	Somatic		Capture	Illumina GAIIx	4	54483461	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	CCDS32694.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	28.9	4.964193	0.92791	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.76	5.76	0.90799	TRAF-type (1);TRAF-like (1);	0.000000	0.85682	D	0.000000	T	0.81678	0.4873	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.994;0.999	T	0.83131	-0.0113	10	0.87932	D	0	-4.8988	19.9504	0.97197	0.0:0.0:1.0:0.0	.	370;282;404	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	G	404;404;282;370	ENSP00000376785:R404G;ENSP00000262294:R404G;ENSP00000365319:R282G;ENSP00000376784:R370G	ENSP00000262294:R404G	R	-	1	0	TRIM37	54483461	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.869000	0.99810	2.720000	0.93068	0.591000	0.81541	CGT		0.343	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294		Missense_Mutation
MED13	9969	genome.wustl.edu	37	17	60033047	60033047	+	Missense_Mutation	SNP	T	T	G	rs367999509		TCGA-24-1425-01	TCGA-24-1425-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr17:60033047T>G	ENST00000397786.2	-	25	5852	c.5776A>C	c.(5776-5778)Atg>Ctg	p.M1926L		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1926					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TAACCTGGCATAATAACAAAA	0.343																																																0			17											70.0	69.0	69.0					17																	60033047		1834	4094	5928	57387829	SO:0001583	missense	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5776A>C	17.37:g.60033047T>G	ENSP00000380888:p.Met1926Leu	Somatic		Capture	Illumina GAIIx	4	57387829	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	19.01	3.744052	0.69418	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.83755	-1.76	5.51	5.51	0.81932	.	0.035169	0.85682	D	0.000000	D	0.84848	0.5563	M	0.84433	2.695	0.80722	D	1	B	0.26445	0.149	B	0.22386	0.039	D	0.84066	0.0377	10	0.59425	D	0.04	-10.0966	15.6167	0.76773	0.0:0.0:0.0:1.0	.	1926	Q9UHV7	MED13_HUMAN	L	1926;1925	ENSP00000380888:M1926L	ENSP00000262436:M1925L	M	-	1	0	MED13	57387829	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.698000	0.84413	2.101000	0.63845	0.383000	0.25322	ATG		0.343	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		Missense_Mutation
FLNB	2317	genome.wustl.edu	37	3	58109125	58109125	+	Silent	SNP	G	G	A			TCGA-24-1425-01	TCGA-24-1425-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr3:58109125G>A	ENST00000295956.4	+	21	3597	c.3432G>A	c.(3430-3432)gaG>gaA	p.E1144E	FLNB_ENST00000490882.1_Silent_p.E1144E|FLNB_ENST00000348383.5_Silent_p.E1144E|FLNB_ENST00000429972.2_Silent_p.E1144E|FLNB_ENST00000493452.1_Silent_p.E975E|FLNB_ENST00000419752.2_Silent_p.E975E|FLNB_ENST00000358537.3_Silent_p.E1144E|FLNB_ENST00000357272.4_Silent_p.E1144E	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1144	Interaction with FBLP1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.E1144E(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CAGGTCTCGAGCACGGGAAGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	3											76.0	86.0	83.0					3																	58109125		2203	4300	6503	58084165	SO:0001819	synonymous_variant	2317			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.3432G>A	3.37:g.58109125G>A		Somatic		Capture	Illumina GAIIx	4	58084165	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	CCDS2885.1	SNP	34	WashU																																																																																				0.592	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		Silent
SDHAF2	54949	genome.wustl.edu	37	11	61205565	61205565	+	Missense_Mutation	SNP	A	A	G	rs151040226		TCGA-24-1425-01	TCGA-24-1425-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr11:61205565A>G	ENST00000301761.2	+	3	424	c.350A>G	c.(349-351)gAt>gGt	p.D117G	RP11-286N22.8_ENST00000543044.1_Missense_Mutation_p.D105G|SDHAF2_ENST00000542074.1_Intron|SDHAF2_ENST00000534878.1_Missense_Mutation_p.D117G|RP11-286N22.8_ENST00000544880.1_3'UTR|SDHAF2_ENST00000537782.1_Missense_Mutation_p.D117G|SDHAF2_ENST00000543265.1_Intron	NM_017841.2	NP_060311.1			succinate dehydrogenase complex assembly factor 2									p.D117G(1)		large_intestine(3)|lung(4)|ovary(2)	9						AATGACTGGGATATTTACTAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	11						A	GLY/ASP	0,4404		0,0,2202	143.0	134.0	137.0		350	5.9	1.0	11	dbSNP_134	137	1,8597	1.2+/-3.3	0,1,4298	no	missense	SDHAF2	NM_017841.2	94	0,1,6500	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging	117/167	61205565	1,13001	2202	4299	6501	60962141	SO:0001583	missense	54949			AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000301761.2:c.350A>G	11.37:g.61205565A>G	ENSP00000301761:p.Asp117Gly	Somatic		Capture	Illumina GAIIx	4	60962141		Missense_Mutation	SNP	ENST00000301761.2	37	CCDS8007.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	20.7	4.027136	0.75390	0.0	1.16E-4	ENSG00000256591;ENSG00000167985	ENST00000541135;ENST00000301761	D;D	0.81996	-1.56;-1.56	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.89511	0.6736	H	0.97365	3.99	0.80722	D	1	B	0.30281	0.275	B	0.29785	0.107	D	0.89917	0.4056	10	0.66056	D	0.02	-16.4925	15.3309	0.74208	1.0:0.0:0.0:0.0	.	117	Q9NX18	SDHF2_HUMAN	G	117	ENSP00000443130:D117G;ENSP00000301761:D117G	ENSP00000440939:D117G	D	+	2	0	SDHAF2;RP11-286N22.8	60962141	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.106000	0.89555	2.254000	0.74563	0.533000	0.62120	GAT		0.398	SDHAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398438.1	NM_017841		Missense_Mutation
ERBB2IP	55914	genome.wustl.edu	37	5	65350083	65350083	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr5:65350083C>G	ENST00000284037.5	+	21	3326	c.2937C>G	c.(2935-2937)atC>atG	p.I979M	ERBB2IP_ENST00000506030.1_Missense_Mutation_p.I979M|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.I979M|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.I979M|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.I979M|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.I979M|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.I979M|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.I975M|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.I979M	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	979					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)	p.I979M(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		AGTATAATATCCAATACAGTA	0.433																																																1	Substitution - Missense(1)	ovary(1)	5											63.0	69.0	67.0					5																	65350083		2202	4300	6502	65385839	SO:0001583	missense	55914				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2937C>G	5.37:g.65350083C>G	ENSP00000284037:p.Ile979Met	Somatic		Capture	Illumina GAIIx	4	65385839	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	37	CCDS58953.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892408	0.33442	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.39406	1.27;1.27;1.27;1.47;1.08;1.34;1.27;1.31;1.08	5.76	-0.238	0.13055	.	0.147163	0.64402	D	0.000014	T	0.33000	0.0848	L	0.29908	0.895	0.43793	D	0.996336	P;P;B;B;P;P;P	0.46987	0.677;0.822;0.399;0.351;0.747;0.888;0.483	B;P;B;B;P;P;B	0.53360	0.426;0.534;0.418;0.125;0.499;0.724;0.246	T	0.18808	-1.0325	10	0.27082	T	0.32	.	2.6661	0.05051	0.1118:0.3751:0.1092:0.4039	.	979;979;979;975;979;979;979	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	M	979;979;979;979;979;979;975;979;979	ENSP00000284037:I979M;ENSP00000370330:I979M;ENSP00000370326:I979M;ENSP00000370323:I979M;ENSP00000370322:I979M;ENSP00000370325:I979M;ENSP00000422766:I975M;ENSP00000426632:I979M;ENSP00000422015:I979M	ENSP00000284037:I979M	I	+	3	3	ERBB2IP	65385839	0.999000	0.42202	0.944000	0.38274	0.994000	0.84299	0.665000	0.25083	-0.369000	0.08028	0.655000	0.94253	ATC		0.433	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695		Missense_Mutation
SLC9A5	6553	genome.wustl.edu	37	16	67298296	67298296	+	Silent	SNP	G	G	A	rs369514722		TCGA-24-1425-01	TCGA-24-1425-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr16:67298296G>A	ENST00000299798.11	+	13	1949	c.1884G>A	c.(1882-1884)gcG>gcA	p.A628A	CTC-277H1.7_ENST00000573063.1_RNA	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	628					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.A628A(1)		breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CAGAGGATGCGCAGGAGCGGC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	16						G		1,4365		0,1,2182	29.0	34.0	32.0		1884	-10.7	0.7	16		32	0,8580		0,0,4290	no	coding-synonymous	SLC9A5	NM_004594.2		0,1,6472	AA,AG,GG		0.0,0.0229,0.0077		628/897	67298296	1,12945	2183	4290	6473	65855797	SO:0001819	synonymous_variant	6553				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.1884G>A	16.37:g.67298296G>A		Somatic		Capture	Illumina GAIIx	4	65855797	A5PKY7|Q9Y626	Missense_Mutation	SNP	ENST00000299798.11	37	CCDS42178.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318075	0.23994	2.29E-4	0.0	ENSG00000135740	ENST00000360183	.	.	.	5.33	-10.7	0.00240	.	.	.	.	.	T	0.32585	0.0834	.	.	.	0.43919	D	0.996561	.	.	.	.	.	.	T	0.37407	-0.9707	5	0.21540	T	0.41	.	3.9632	0.09420	0.4141:0.3194:0.1859:0.0806	.	.	.	.	H	142	.	ENSP00000353311:R142H	R	+	2	0	SLC9A5	65855797	0.002000	0.14202	0.675000	0.29917	0.955000	0.61496	-0.965000	0.03829	-1.626000	0.01552	-0.291000	0.09656	CGC		0.572	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421386.1			Missense_Mutation
AUTS2	26053	genome.wustl.edu	37	7	70228152	70228152	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1425-01	TCGA-24-1425-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr7:70228152G>A	ENST00000342771.4	+	7	1360	c.1039G>A	c.(1039-1041)Gag>Aag	p.E347K	AUTS2_ENST00000406775.2_Missense_Mutation_p.E347K	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	347								p.E347K(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GGGCCCTCCTGAGGCCCAGCT	0.677																																																1	Substitution - Missense(1)	ovary(1)	7											33.0	38.0	36.0					7																	70228152		2203	4300	6503	69866088	SO:0001583	missense	26053			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1039G>A	7.37:g.70228152G>A	ENSP00000344087:p.Glu347Lys	Somatic		Capture	Illumina GAIIx	4	69866088	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587221	0.66105	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.30714	1.52;1.53	5.51	4.62	0.57501	.	0.371292	0.31210	N	0.008054	T	0.19805	0.0476	N	0.22421	0.69	0.80722	D	1	B;B	0.33807	0.426;0.426	B;B	0.32090	0.14;0.14	T	0.04930	-1.0917	9	.	.	.	-22.8021	12.6812	0.56922	0.0811:0.0:0.9189:0.0	.	347;347	Q8WXX7-2;Q8WXX7	.;AUTS2_HUMAN	K	347	ENSP00000385263:E347K;ENSP00000344087:E347K	.	E	+	1	0	AUTS2	69866088	0.999000	0.42202	0.985000	0.45067	0.555000	0.35460	3.289000	0.51747	2.584000	0.87258	0.563000	0.77884	GAG		0.677	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			Missense_Mutation
SLCO5A1	81796	genome.wustl.edu	37	8	70585479	70585479	+	Silent	SNP	A	A	G			TCGA-24-1425-01	TCGA-24-1425-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr8:70585479A>G	ENST00000260126.4	-	10	2878	c.2172T>C	c.(2170-2172)ggT>ggC	p.G724G	SLCO5A1_ENST00000524945.1_3'UTR|SLCO5A1_ENST00000530307.1_Silent_p.G669G	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	724						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.G724G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CCCAGCAAGAACCCTGCACAC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	8											164.0	164.0	164.0					8																	70585479		2203	4300	6503	70748033	SO:0001819	synonymous_variant	81796			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2172T>C	8.37:g.70585479A>G		Somatic		Capture	Illumina GAIIx	4	70748033	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Silent	SNP	ENST00000260126.4	37	CCDS6205.1	SNP	2	WashU																																																																																				0.473	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		Silent
CASD1	64921	genome.wustl.edu	37	7	94167156	94167156	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1425-01	TCGA-24-1425-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr7:94167156A>G	ENST00000297273.4	+	9	1503	c.1216A>G	c.(1216-1218)Att>Gtt	p.I406V		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	406						integral component of membrane (GO:0016021)		p.I406V(1)		NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CTTTATTCCAATTATCTACAT	0.303																																																1	Substitution - Missense(1)	ovary(1)	7											52.0	59.0	56.0					7																	94167156		2201	4296	6497	94005092	SO:0001583	missense	64921			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1216A>G	7.37:g.94167156A>G	ENSP00000297273:p.Ile406Val	Somatic		Capture	Illumina GAIIx	4	94005092	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	3.496	-0.102803	0.06967	.	.	ENSG00000127995	ENST00000297273	T	0.42900	0.96	5.51	5.51	0.81932	.	0.053282	0.85682	D	0.000000	T	0.27063	0.0663	N	0.24115	0.695	0.47123	D	0.999326	B;B	0.26775	0.159;0.159	B;B	0.23852	0.049;0.049	T	0.09596	-1.0667	10	0.02654	T	1	.	15.9173	0.79531	1.0:0.0:0.0:0.0	.	406;406	Q8WZ77;Q96PB1	.;CASD1_HUMAN	V	406	ENSP00000297273:I406V	ENSP00000297273:I406V	I	+	1	0	CASD1	94005092	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.147000	0.64851	2.226000	0.72624	0.477000	0.44152	ATT		0.303	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900		Missense_Mutation
ASNS	440	genome.wustl.edu	37	7	97498311	97498311	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1425-01	TCGA-24-1425-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr7:97498311A>G	ENST00000394309.3	-	3	629	c.158T>C	c.(157-159)gTt>gCt	p.V53A	ASNS_ENST00000394308.3_Missense_Mutation_p.V53A|ASNS_ENST00000455086.1_Intron|ASNS_ENST00000444334.1_Missense_Mutation_p.V32A|ASNS_ENST00000437628.1_Intron|ASNS_ENST00000422745.1_Missense_Mutation_p.V32A|ASNS_ENST00000175506.4_Missense_Mutation_p.V53A	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	53	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.|Glutamine binding. {ECO:0000250}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)	p.V53A(1)		ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CAGCGGGTCAACTACCGCCAA	0.448																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)											1	Substitution - Missense(1)	ovary(1)	7											79.0	68.0	72.0					7																	97498311		2203	4300	6503	97336247	SO:0001583	missense	440			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.158T>C	7.37:g.97498311A>G	ENSP00000377846:p.Val53Ala	Somatic		Capture	Illumina GAIIx	4	97336247	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	16.23	3.064198	0.55432	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000394308;ENST00000422745;ENST00000444334;ENST00000442734;ENST00000437657;ENST00000448127;ENST00000453600	T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.72;0.72;0.72	3.77	3.77	0.43336	Glutamine amidotransferase, type II (1);	0.193450	0.43747	N	0.000539	T	0.70500	0.3231	H	0.95917	3.74	0.58432	D	0.999998	P	0.50066	0.931	P	0.54210	0.745	T	0.79374	-0.1830	10	0.87932	D	0	-24.2744	10.7845	0.46397	1.0:0.0:0.0:0.0	.	53	P08243	ASNS_HUMAN	A	53;53;53;32;32;53;53;53;32	ENSP00000175506:V53A;ENSP00000377846:V53A;ENSP00000377845:V53A;ENSP00000414901:V32A;ENSP00000406994:V32A;ENSP00000400422:V53A	ENSP00000175506:V53A	V	-	2	0	ASNS	97336247	1.000000	0.71417	0.920000	0.36463	0.090000	0.18270	8.404000	0.90210	1.723000	0.51488	0.454000	0.30748	GTT		0.448	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356		Missense_Mutation
RNF19A	25897	genome.wustl.edu	37	8	101299871	101299871	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr8:101299871C>T	ENST00000519449.1	-	3	848	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K	RNF19A_ENST00000341084.2_Missense_Mutation_p.E178K	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	178					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E178K(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			TCAGTACATTCTGGGCAACTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	8											117.0	122.0	120.0					8																	101299871		2203	4300	6503	101369047	SO:0001583	missense	25897			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.532G>A	8.37:g.101299871C>T	ENSP00000428968:p.Glu178Lys	Somatic		Capture	Illumina GAIIx	4	101369047	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	CCDS6286.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	33	5.263183	0.95399	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.85171	-1.95;-1.95	5.57	5.57	0.84162	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.93848	0.8032	M	0.90483	3.12	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.93974	0.7252	10	0.51188	T	0.08	.	19.1651	0.93553	0.0:1.0:0.0:0.0	.	178	Q9NV58	RN19A_HUMAN	K	178	ENSP00000428968:E178K;ENSP00000342667:E178K	ENSP00000342667:E178K	E	-	1	0	RNF19A	101369047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.606000	0.88127	0.650000	0.86243	GAA		0.358	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435		Missense_Mutation
AHNAK2	113146	genome.wustl.edu	37	14	105413217	105413217	+	Silent	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr14:105413217C>T	ENST00000333244.5	-	7	8690	c.8571G>A	c.(8569-8571)aaG>aaA	p.K2857K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2857						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.K2857K(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCAGTGGTCTTAAGATCCC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	14											124.0	142.0	136.0					14																	105413217		1962	4157	6119	104484262	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8571G>A	14.37:g.105413217C>T		Somatic		Capture	Illumina GAIIx	4	104484262	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	32	WashU																																																																																				0.642	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Silent
ABRA	137735	genome.wustl.edu	37	8	107773533	107773533	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1425-01	TCGA-24-1425-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr8:107773533G>T	ENST00000311955.3	-	2	932	c.878C>A	c.(877-879)aCc>aAc	p.T293N		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.T293N(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			AGCAGTTTTGGTTCCTTCTTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	8											130.0	104.0	113.0					8																	107773533		2203	4300	6503	107842709	SO:0001583	missense	137735			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.878C>A	8.37:g.107773533G>T	ENSP00000311436:p.Thr293Asn	Somatic		Capture	Illumina GAIIx	4	107842709		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276921	0.59758	.	.	ENSG00000174429	ENST00000311955	.	.	.	6.06	3.12	0.35913	.	0.093651	0.64402	D	0.000001	T	0.70281	0.3206	M	0.62723	1.935	0.51233	D	0.999911	P	0.51653	0.947	P	0.51657	0.676	T	0.74592	-0.3614	9	0.87932	D	0	-18.5985	17.7654	0.88476	0.0:0.4137:0.5863:0.0	.	293	Q8N0Z2	ABRA_HUMAN	N	293	.	ENSP00000311436:T293N	T	-	2	0	ABRA	107842709	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.014000	0.49590	0.329000	0.23460	0.655000	0.94253	ACC		0.512	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166		Missense_Mutation
NPHP1	4867	genome.wustl.edu	37	2	110927403	110927403	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr2:110927403C>G	ENST00000393272.3	-	5	599	c.502G>C	c.(502-504)Gtt>Ctt	p.V168L	NPHP1_ENST00000417665.1_Missense_Mutation_p.V168L|NPHP1_ENST00000445609.2_Missense_Mutation_p.V168L|NPHP1_ENST00000355301.4_Missense_Mutation_p.V106L|NPHP1_ENST00000316534.4_Missense_Mutation_p.V168L	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	168	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.V168L(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						AGATCTCCAACTTGCTGAGCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											153.0	140.0	144.0					2																	110927403		2203	4300	6503	110284692	SO:0001583	missense	4867			AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.502G>C	2.37:g.110927403C>G	ENSP00000376953:p.Val168Leu	Somatic		Capture	Illumina GAIIx	4	110284692	O14837	Missense_Mutation	SNP	ENST00000393272.3	37	CCDS46385.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	9.195	1.026932	0.19512	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.34	3.49	0.39957	Src homology-3 domain (4);	1.321340	0.05133	N	0.492981	T	0.33381	0.0861	N	0.14661	0.345	0.21802	N	0.999534	B;B;B;B;B;B	0.23650	0.035;0.017;0.007;0.03;0.028;0.089	B;B;B;B;B;B	0.25140	0.058;0.05;0.009;0.05;0.034;0.047	T	0.24584	-1.0156	10	0.30854	T	0.27	-1.3815	8.2112	0.31483	0.0:0.7435:0.0:0.2565	.	168;168;106;168;168;168	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	L	168;168;168;106;168	ENSP00000313169:V168L;ENSP00000389879:V168L;ENSP00000376953:V168L;ENSP00000347452:V106L;ENSP00000402176:V168L	ENSP00000313169:V168L	V	-	1	0	NPHP1	110284692	0.836000	0.29430	0.513000	0.27749	0.636000	0.38137	1.727000	0.38095	1.220000	0.43490	0.484000	0.47621	GTT		0.413	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272		Missense_Mutation
CSMD3	114788	genome.wustl.edu	37	8	113585841	113585841	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1425-01	TCGA-24-1425-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr8:113585841T>G	ENST00000297405.5	-	24	4175	c.3931A>C	c.(3931-3933)Act>Cct	p.T1311P	CSMD3_ENST00000343508.3_Missense_Mutation_p.T1271P|CSMD3_ENST00000352409.3_Missense_Mutation_p.T1311P|CSMD3_ENST00000455883.2_Missense_Mutation_p.T1207P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1311	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T1311P(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GATGCACCAGTAAAAGCACCT	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											120.0	120.0	120.0					8																	113585841		2203	4300	6503	113655017	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3931A>C	8.37:g.113585841T>G	ENSP00000297405:p.Thr1311Pro	Somatic		Capture	Illumina GAIIx	4	113655017	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	22.7	4.323870	0.81580	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	4.85	4.85	0.62838	CUB (5);	0.000000	0.85682	D	0.000000	T	0.63988	0.2558	M	0.93507	3.425	0.43076	D	0.994725	D;D;D	0.76494	0.996;0.996;0.999	D;D;D	0.68621	0.931;0.959;0.953	T	0.74481	-0.3651	10	0.54805	T	0.06	.	14.5953	0.68400	0.0:0.0:0.0:1.0	.	1207;1311;1271	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	P	1271;1311;651;1207;1311	ENSP00000345799:T1271P;ENSP00000297405:T1311P;ENSP00000341558:T651P;ENSP00000412263:T1207P;ENSP00000343124:T1311P	ENSP00000297405:T1311P	T	-	1	0	CSMD3	113655017	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.944000	0.70219	2.019000	0.59389	0.482000	0.46254	ACT		0.338	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
AFAP1L2	84632	genome.wustl.edu	37	10	116060281	116060281	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr10:116060281C>T	ENST00000304129.4	-	14	1740	c.1711G>A	c.(1711-1713)Gcc>Acc	p.A571T	AFAP1L2_ENST00000369271.3_Missense_Mutation_p.A571T|AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000545353.1_Missense_Mutation_p.A624T			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	571					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)	p.A571T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GCCGGGAGGGCCTCAGTTGCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	10											69.0	68.0	68.0					10																	116060281		2203	4300	6503	116050271	SO:0001583	missense	84632			BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.1711G>A	10.37:g.116060281C>T	ENSP00000303042:p.Ala571Thr	Somatic		Capture	Illumina GAIIx	4	116050271	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	ENST00000304129.4	37	CCDS31286.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	9.416	1.081740	0.20309	.	.	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000545353	T;T;T	0.13901	2.55;2.55;2.55	5.62	1.18	0.20946	.	1.332960	0.04602	N	0.398675	T	0.07143	0.0181	N	0.13043	0.29	0.09310	N	1	B;B;B;B;B;B;B	0.10296	0.003;0.0;0.002;0.002;0.0;0.001;0.0	B;B;B;B;B;B;B	0.10450	0.003;0.005;0.001;0.003;0.002;0.001;0.0	T	0.36841	-0.9731	10	0.11182	T	0.66	-6.859	2.6632	0.05032	0.209:0.4014:0.0:0.3895	.	624;137;625;93;599;571;571	F5GZE1;B7Z363;B7Z2Q0;Q8N4X5-3;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;.;.;AF1L2_HUMAN	T	571;571;598;624	ENSP00000358276:A571T;ENSP00000303042:A571T;ENSP00000444511:A624T	ENSP00000303042:A571T	A	-	1	0	AFAP1L2	116050271	0.001000	0.12720	0.006000	0.13384	0.157000	0.22087	-0.177000	0.09796	0.704000	0.31869	0.655000	0.94253	GCC		0.627	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550		Missense_Mutation
SLC35F1	222553	genome.wustl.edu	37	6	118606452	118606452	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1425-01	TCGA-24-1425-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr6:118606452C>G	ENST00000360388.4	+	7	1154	c.953C>G	c.(952-954)aCa>aGa	p.T318R		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	318					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		TCCTTGCTCACAGCAGACTTG	0.443											OREG0017635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			6											351.0	314.0	326.0					6																	118606452		2203	4300	6503	118713145	SO:0001583	missense	222553			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.953C>G	6.37:g.118606452C>G	ENSP00000353557:p.Thr318Arg	Somatic	1489	Capture	Illumina GAIIx	4	118713145	E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	ENST00000360388.4	37	CCDS34524.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071603	0.76301	.	.	ENSG00000196376	ENST00000360388	.	.	.	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.82162	0.4977	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85220	0.1026	9	0.72032	D	0.01	.	17.9713	0.89113	0.0:1.0:0.0:0.0	.	318	Q5T1Q4	S35F1_HUMAN	R	318	.	ENSP00000353557:T318R	T	+	2	0	SLC35F1	118713145	1.000000	0.71417	0.984000	0.44739	0.599000	0.36880	7.609000	0.82925	2.549000	0.85964	0.655000	0.94253	ACA		0.443	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041991.2	XM_167044		Missense_Mutation
ENPP2	5168	genome.wustl.edu	37	8	120629708	120629708	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1425-01	TCGA-24-1425-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr8:120629708A>T	ENST00000075322.6	-	6	633	c.575T>A	c.(574-576)cTa>cAa	p.L192Q	ENPP2_ENST00000427067.2_Missense_Mutation_p.L188Q|ENPP2_ENST00000522826.1_Missense_Mutation_p.L192Q|ENPP2_ENST00000259486.6_Missense_Mutation_p.L192Q	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	192					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTACTTACTTAGTTTTTCAAT	0.413																																					Melanoma(20;305 879 2501 4818 31020)											0			8											68.0	67.0	68.0					8																	120629708		2203	4300	6503	120698889	SO:0001583	missense	5168			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.575T>A	8.37:g.120629708A>T	ENSP00000075322:p.Leu192Gln	Somatic		Capture	Illumina GAIIx	4	120698889	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	SNP	15	WashU	.	.	.	.	.	.	.	.	.	.	A	17.24	3.338741	0.60963	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522826;ENST00000075322;ENST00000520066	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	5.81	5.81	0.92471	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.95069	0.8403	M	0.92169	3.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.96083	0.9055	10	0.87932	D	0	.	16.1677	0.81782	1.0:0.0:0.0:0.0	.	192;192;192	E9PHP7;Q13822;Q13822-2	.;ENPP2_HUMAN;.	Q	192;188;192;192;174	ENSP00000259486:L192Q;ENSP00000403315:L188Q;ENSP00000428291:L192Q;ENSP00000075322:L192Q;ENSP00000428304:L174Q	ENSP00000075322:L192Q	L	-	2	0	ENPP2	120698889	1.000000	0.71417	0.458000	0.27068	0.120000	0.20174	9.339000	0.96797	2.218000	0.71995	0.528000	0.53228	CTA		0.413	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			Missense_Mutation
ROBO3	64221	genome.wustl.edu	37	11	124750383	124750383	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr11:124750383C>T	ENST00000397801.1	+	27	4220	c.4028C>T	c.(4027-4029)aCg>aTg	p.T1343M	ROBO3_ENST00000543966.1_Missense_Mutation_p.T106M|ROBO3_ENST00000538940.1_Missense_Mutation_p.T1321M|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1343					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.T1343M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		ACATGTTCCACGGCCGGCAGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	11																																								124255593	SO:0001583	missense	64221			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4028C>T	11.37:g.124750383C>T	ENSP00000380903:p.Thr1343Met	Somatic		Capture	Illumina GAIIx	4	124255593		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230615	0.79688	.	.	ENSG00000154134	ENST00000397801;ENST00000538940;ENST00000543966	T;T;T	0.71103	-0.54;-0.52;0.14	5.62	5.62	0.85841	.	0.000000	0.38897	N	0.001539	T	0.82093	0.4962	L	0.59436	1.845	0.40259	D	0.978155	D	0.89917	1.0	D	0.65987	0.94	D	0.83648	0.0154	10	0.87932	D	0	.	19.6592	0.95857	0.0:1.0:0.0:0.0	.	1343	Q96MS0	ROBO3_HUMAN	M	1343;1321;106	ENSP00000380903:T1343M;ENSP00000441797:T1321M;ENSP00000438799:T106M	ENSP00000380903:T1343M	T	+	2	0	ROBO3	124255593	1.000000	0.71417	0.983000	0.44433	0.756000	0.42949	4.768000	0.62293	2.653000	0.90120	0.655000	0.94253	ACG		0.672	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663		Missense_Mutation
PCDHA3	56145	genome.wustl.edu	37	5	140182396	140182396	+	Silent	SNP	C	C	T	rs539786276		TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr5:140182396C>T	ENST00000522353.2	+	1	1614	c.1614C>T	c.(1612-1614)cgC>cgT	p.R538R	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Silent_p.R538R|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R538R(1)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGTGCGCGCGATGCGGGCG	0.672																																																1	Substitution - coding silent(1)	ovary(1)	5											85.0	86.0	85.0					5																	140182396		2203	4298	6501	140162580	SO:0001819	synonymous_variant	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1614C>T	5.37:g.140182396C>T		Somatic		Capture	Illumina GAIIx	4	140162580	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1	SNP	27	WashU																																																																																				0.672	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		Silent
TCHHL1	126637	genome.wustl.edu	37	1	152059508	152059508	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1425-01	TCGA-24-1425-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr1:152059508T>A	ENST00000368806.1	-	3	714	c.650A>T	c.(649-651)aAg>aTg	p.K217M		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	217							calcium ion binding (GO:0005509)	p.K217M(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			ACTGCTGGTCTTTTTTGATCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											137.0	122.0	127.0					1																	152059508		2203	4300	6503	150326132	SO:0001583	missense	126637				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.650A>T	1.37:g.152059508T>A	ENSP00000357796:p.Lys217Met	Somatic		Capture	Illumina GAIIx	4	150326132	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	ENST00000368806.1	37	CCDS30857.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	.	12.69	2.014394	0.35511	.	.	ENSG00000182898	ENST00000368806	T	0.25912	1.77	5.1	5.1	0.69264	.	0.666605	0.12399	N	0.472275	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.14578	0.011	T	0.32745	-0.9895	10	0.48119	T	0.1	0.1954	11.272	0.49144	0.0:0.0:0.0:1.0	.	217	Q5QJ38	TCHL1_HUMAN	M	217	ENSP00000357796:K217M	ENSP00000357796:K217M	K	-	2	0	TCHHL1	150326132	0.173000	0.23056	0.021000	0.16686	0.004000	0.04260	2.330000	0.43885	1.910000	0.55303	0.455000	0.32223	AAG		0.448	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104		Missense_Mutation
PLEKHG1	57480	genome.wustl.edu	37	6	151055101	151055101	+	Nonsense_Mutation	SNP	C	C	G			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr6:151055101C>G	ENST00000358517.2	+	2	495	c.284C>G	c.(283-285)tCa>tGa	p.S95*	PLEKHG1_ENST00000367328.1_Nonsense_Mutation_p.S95*			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	95							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S95*(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		AGAGTGGACTCAAACGGGGCA	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	6											46.0	51.0	49.0					6																	151055101		2203	4300	6503	151096794	SO:0001587	stop_gained	57480			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.284C>G	6.37:g.151055101C>G	ENSP00000351318:p.Ser95*	Somatic		Capture	Illumina GAIIx	4	151096794	Q5T1F2	Nonsense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	31	5.073781	0.94000	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	.	.	.	5.27	4.4	0.53042	.	0.656672	0.16283	N	0.221268	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3003	0.49302	0.0:0.8527:0.0:0.1473	.	.	.	.	X	95	.	.	S	+	2	0	PLEKHG1	151096794	0.001000	0.12720	0.002000	0.10522	0.000000	0.00434	1.632000	0.37102	1.379000	0.46325	-0.136000	0.14681	TCA		0.582	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1			Nonsense_Mutation
NUP210L	91181	genome.wustl.edu	37	1	154029383	154029383	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1425-01	TCGA-24-1425-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr1:154029383G>A	ENST00000368559.3	-	23	3219	c.3148C>T	c.(3148-3150)Ctt>Ttt	p.L1050F	NUP210L_ENST00000271854.3_Missense_Mutation_p.L1050F|NUP210L_ENST00000368553.1_5'Flank	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1050					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.L1050I(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GTAGCTCGAAGAATATAATTT	0.408																																																1	Substitution - Missense(1)	large_intestine(1)	1											132.0	121.0	124.0					1																	154029383		1852	4101	5953	152296007	SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3148C>T	1.37:g.154029383G>A	ENSP00000357547:p.Leu1050Phe	Somatic		Capture	Illumina GAIIx	4	152296007	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812190	0.50527	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.10382	3.14;2.88	4.95	4.03	0.46877	.	0.113829	0.39834	N	0.001248	T	0.18509	0.0444	L	0.57536	1.79	0.39450	D	0.967389	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.01136	-1.1440	10	0.62326	D	0.03	-26.3058	13.3739	0.60728	0.0:0.1581:0.8419:0.0	.	1050;1050	E7EP56;Q5VU65	.;P210L_HUMAN	F	1050	ENSP00000357547:L1050F;ENSP00000271854:L1050F	ENSP00000271854:L1050F	L	-	1	0	NUP210L	152296007	0.995000	0.38212	0.922000	0.36590	0.942000	0.58702	2.278000	0.43426	1.280000	0.44463	0.650000	0.86243	CTT		0.408	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308		Missense_Mutation
PYHIN1	149628	genome.wustl.edu	37	1	158908895	158908895	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1425-01	TCGA-24-1425-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr1:158908895A>G	ENST00000368140.1	+	4	682	c.437A>G	c.(436-438)gAg>gGg	p.E146G	PYHIN1_ENST00000392252.3_Missense_Mutation_p.E137G|PYHIN1_ENST00000392254.2_Missense_Mutation_p.E146G|PYHIN1_ENST00000368138.3_Missense_Mutation_p.E137G|PYHIN1_ENST00000368135.4_Missense_Mutation_p.E146G	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	146					cell cycle (GO:0007049)	nucleus (GO:0005634)		p.E146G(1)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TCTGAAGAAGAGACTGGAACC	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	65.0	66.0					1																	158908895		2203	4300	6503	157175519	SO:0001583	missense	149628			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.437A>G	1.37:g.158908895A>G	ENSP00000357122:p.Glu146Gly	Somatic		Capture	Illumina GAIIx	4	157175519	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	10.39	1.338101	0.24253	.	.	ENSG00000163564	ENST00000458222;ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252;ENST00000368135	T;T;T;T;T;T	0.35421	1.31;3.39;3.4;3.4;3.42;1.68	2.27	-2.21	0.06973	.	.	.	.	.	T	0.14960	0.0361	L	0.43152	1.355	0.09310	N	1	B;B;B;B;P	0.40834	0.095;0.095;0.095;0.057;0.73	B;B;B;B;P	0.44394	0.049;0.077;0.049;0.022;0.448	T	0.19418	-1.0306	9	0.35671	T	0.21	.	8.2877	0.31939	0.3589:0.6411:0.0:0.0	.	137;146;137;146;146	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9;Q6K0P9-5	.;.;.;IFIX_HUMAN;.	G	146;146;137;146;137;146	ENSP00000407616:E146G;ENSP00000357122:E146G;ENSP00000357120:E137G;ENSP00000376083:E146G;ENSP00000376082:E137G;ENSP00000357117:E146G	ENSP00000357117:E146G	E	+	2	0	PYHIN1	157175519	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.132000	0.10467	-0.520000	0.06435	-0.472000	0.04984	GAG		0.443	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		Missense_Mutation
KCNMB2	10242	genome.wustl.edu	37	3	178560615	178560615	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr3:178560615C>G	ENST00000432997.1	+	5	950	c.598C>G	c.(598-600)Ctc>Gtc	p.L200V	RP11-385J1.2_ENST00000437488.1_RNA|KCNMB2_ENST00000452583.1_Missense_Mutation_p.L200V|RP11-385J1.2_ENST00000451742.1_RNA|KCNMB2_ENST00000420517.2_Missense_Mutation_p.L200V|RP11-385J1.2_ENST00000425330.1_RNA|RP11-385J1.2_ENST00000432385.1_RNA|KCNMB2_ENST00000358316.3_Missense_Mutation_p.L200V	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2	214					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)	p.L200V(1)		NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	GTTCCATTCACTCTTCTGGCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	87.0	88.0					3																	178560615		2203	4300	6503	180043309	SO:0001583	missense	10242			AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.598C>G	3.37:g.178560615C>G	ENSP00000407592:p.Leu200Val	Somatic		Capture	Illumina GAIIx	4	180043309	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	ENST00000432997.1	37	CCDS3223.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128214	0.56721	.	.	ENSG00000197584	ENST00000420517;ENST00000452583;ENST00000432997;ENST00000358316;ENST00000457763	T;T;T;T	0.15017	2.46;2.46;2.46;2.46	6.17	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.34600	0.0903	L	0.50333	1.59	0.58432	D	0.999995	D	0.76494	0.999	D	0.85130	0.997	T	0.04400	-1.0954	10	0.54805	T	0.06	-15.6833	11.7155	0.51650	0.0:0.8656:0.0:0.1344	.	200	Q9Y691	KCMB2_HUMAN	V	200;200;200;200;181	ENSP00000408252:L200V;ENSP00000397483:L200V;ENSP00000407592:L200V;ENSP00000351068:L200V	ENSP00000351068:L200V	L	+	1	0	KCNMB2	180043309	0.992000	0.36948	0.997000	0.53966	0.981000	0.71138	2.928000	0.48908	1.627000	0.50400	0.655000	0.94253	CTC		0.468	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348251.1	NM_181361		Missense_Mutation
USH2A	7399	genome.wustl.edu	37	1	215901553	215901553	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1425-01	TCGA-24-1425-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr1:215901553T>C	ENST00000307340.3	-	61	12271	c.11885A>G	c.(11884-11886)gAa>gGa	p.E3962G	USH2A_ENST00000366943.2_Missense_Mutation_p.E3962G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3962	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.E3962G(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGTGGAGCTTCCAGAGTTTG	0.493										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											89.0	88.0	88.0					1																	215901553		2203	4300	6503	213968176	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11885A>G	1.37:g.215901553T>C	ENSP00000305941:p.Glu3962Gly	Somatic		Capture	Illumina GAIIx	4	213968176	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	28.6	4.938556	0.92526	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55588	0.51;0.51	5.53	5.53	0.82687	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.149852	0.30068	N	0.010497	T	0.68504	0.3008	M	0.87180	2.865	0.50813	D	0.999891	P	0.52577	0.954	P	0.50352	0.638	T	0.76258	-0.3025	10	0.87932	D	0	.	15.6565	0.77140	0.0:0.0:0.0:1.0	.	3962	O75445	USH2A_HUMAN	G	3962	ENSP00000305941:E3962G;ENSP00000355910:E3962G	ENSP00000305941:E3962G	E	-	2	0	USH2A	213968176	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	5.944000	0.70219	2.085000	0.62840	0.482000	0.46254	GAA		0.493	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
COL6A3	1293	genome.wustl.edu	37	2	238280958	238280958	+	Silent	SNP	C	C	A			TCGA-24-1425-01	TCGA-24-1425-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr2:238280958C>A	ENST00000295550.4	-	9	4154	c.3702G>T	c.(3700-3702)gtG>gtT	p.V1234V	COL6A3_ENST00000472056.1_Silent_p.V627V|COL6A3_ENST00000346358.4_Silent_p.V1034V|COL6A3_ENST00000409809.1_Silent_p.V1028V|COL6A3_ENST00000392004.3_Silent_p.V1028V|COL6A3_ENST00000347401.3_Silent_p.V1033V|COL6A3_ENST00000353578.4_Silent_p.V1028V|COL6A3_ENST00000392003.2_Silent_p.V827V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1234	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V1234V(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGAGAAAGACCACGTCCCTCT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	2											82.0	76.0	78.0					2																	238280958		2203	4300	6503	237945697	SO:0001819	synonymous_variant	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3702G>T	2.37:g.238280958C>A		Somatic		Capture	Illumina GAIIx	4	237945697	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	21	WashU																																																																																				0.537	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Silent
CRTAC1	55118	genome.wustl.edu	37	10	99644060	99644060	+	Missense_Mutation	SNP	A	A	C	rs368269510		TCGA-24-1425-01	TCGA-24-1425-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1425-01	TCGA-24-1425-10	g.chr10:99644060A>C	ENST00000370597.3	-	12	1890	c.1535T>G	c.(1534-1536)aTg>aGg	p.M512R	CRTAC1_ENST00000298819.4_Missense_Mutation_p.M512R|CRTAC1_ENST00000468549.1_5'UTR|CRTAC1_ENST00000370591.2_Missense_Mutation_p.M512R	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	512						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.M512R(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CCGGCTCACCATCTTGCCATC	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											75.0	50.0	58.0					10																	99644060		2195	4277	6472	99634050	SO:0001583	missense	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1535T>G	10.37:g.99644060A>C	ENSP00000359629:p.Met512Arg	Somatic		Capture	Illumina GAIIx	4	99634050	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	8.444	0.851515	0.17034	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.72725	1.56;-0.68;1.57;0.17;0.16	5.54	5.54	0.83059	ASPIC/UnbV (1);	0.362247	0.29707	N	0.011418	T	0.43166	0.1235	N	0.01438	-0.865	0.36422	D	0.864358	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.0;0.0;0.001	T	0.49725	-0.8909	10	0.12766	T	0.61	-19.7847	15.3462	0.74340	1.0:0.0:0.0:0.0	.	512;512;408	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	R	408;512;512;504;512	ENSP00000408445:M408R;ENSP00000359629:M512R;ENSP00000298819:M512R;ENSP00000310810:M504R;ENSP00000359623:M512R	ENSP00000298819:M512R	M	-	2	0	CRTAC1	99634050	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.911000	0.75746	2.122000	0.65172	0.260000	0.18958	ATG		0.617	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058		Missense_Mutation
