#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
FLG	2312	broad.mit.edu	37	1	152282663	152282663	+	Missense_Mutation	SNP	G	G	A	rs529239965		TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr1:152282663G>A	ENST00000368799.1	-	3	4734	c.4699C>T	c.(4699-4701)Cgg>Tgg	p.R1567W	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1567	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R1567R(1)|p.R1567W(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCCGGCCCGAGTGGAAGGT	0.587									Ichthyosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		19149	0.0		0.001	False		,,,				2504	0.0															2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	1											192.0	202.0	199.0					1																	152282663		2203	4300	6503	150549287	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4699C>T	1.37:g.152282663G>A	ENSP00000357789:p.Arg1567Trp	Unknown		x	x	x	150549287	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	8.095	0.775402	0.16051	.	.	ENSG00000143631	ENST00000368799	T	0.03635	3.86	1.7	0.707	0.18139	.	.	.	.	.	T	0.01800	0.0057	N	0.17674	0.51	0.09310	N	1	D	0.76494	0.999	P	0.57324	0.818	T	0.45026	-0.9289	9	0.66056	D	0.02	.	3.8169	0.08819	0.2553:0.0:0.7447:0.0	.	1567	P20930	FILA_HUMAN	W	1567	ENSP00000357789:R1567W	ENSP00000357789:R1567W	R	-	1	2	FLG	150549287	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.537000	0.23144	0.056000	0.16144	0.485000	0.47835	CGG		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
FLG	2312	broad.mit.edu	37	1	152287816	152287816	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr1:152287816C>A	ENST00000368799.1	-	2	152	c.117G>T	c.(115-117)aaG>aaT	p.K39N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	39	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.K39N(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCGAAATTCCTTTTCCAGAA	0.328									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											174.0	178.0	177.0					1																	152287816		2203	4300	6503	150554440	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.117G>T	1.37:g.152287816C>A	ENSP00000357789:p.Lys39Asn	Unknown		x	x	x	150554440	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	12.01	1.810512	0.32053	.	.	ENSG00000143631	ENST00000368799	T	0.13307	2.6	5.2	-10.4	0.00318	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.03095	0.0091	L	0.27053	0.805	0.09310	N	1	P	0.47191	0.891	P	0.48677	0.586	T	0.10636	-1.0621	9	0.31617	T	0.26	0.2843	5.8155	0.18490	0.0953:0.1969:0.0949:0.6129	.	39	P20930	FILA_HUMAN	N	39	ENSP00000357789:K39N	ENSP00000357789:K39N	K	-	3	2	FLG	150554440	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.545000	0.00933	-1.947000	0.01034	-1.120000	0.02017	AAG		0.328	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
RGS7	6000	broad.mit.edu	37	1	240977019	240977019	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr1:240977019A>T	ENST00000407727.1	-	12	854	c.855T>A	c.(853-855)agT>agA	p.S285R	RGS7_ENST00000331110.7_Missense_Mutation_p.S259R|RGS7_ENST00000401882.1_Missense_Mutation_p.S232R|RGS7_ENST00000446183.2_Missense_Mutation_p.S201R|RGS7_ENST00000366565.1_Missense_Mutation_p.S285R|RGS7_ENST00000348120.2_Missense_Mutation_p.S232R|RGS7_ENST00000366563.1_Missense_Mutation_p.S285R|RGS7_ENST00000366562.4_Missense_Mutation_p.S285R|RGS7_ENST00000366564.1_Missense_Mutation_p.S285R			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	285	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.S285R(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GTTCCGTGTAACTTAGTAGAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	89.0	90.0					1																	240977019		2203	4300	6503	239043642	SO:0001583	missense	6000			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.855T>A	1.37:g.240977019A>T	ENSP00000384428:p.Ser285Arg	Unknown		x	x	x	239043642	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	14.50	2.553264	0.45487	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.76	3.36	0.38483	G-protein gamma domain (4);	0.210695	0.51477	D	0.000081	T	0.31638	0.0803	M	0.65498	2.005	0.30785	N	0.741579	P;P;P;B;P;B;P	0.48911	0.752;0.728;0.917;0.313;0.708;0.023;0.544	P;P;P;P;P;B;P	0.50896	0.555;0.653;0.642;0.522;0.522;0.061;0.653	T	0.31447	-0.9943	10	0.45353	T	0.12	-22.8466	4.3099	0.10965	0.6499:0.0:0.1999:0.1503	.	201;259;232;285;285;285;285	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	R	259;285;285;285;116;232;201;285;285;232	ENSP00000331485:S259R;ENSP00000355523:S285R;ENSP00000355522:S285R;ENSP00000355521:S285R;ENSP00000404399:S116R;ENSP00000341242:S232R;ENSP00000390138:S201R;ENSP00000355520:S285R;ENSP00000384428:S285R;ENSP00000385508:S232R	ENSP00000331485:S259R	S	-	3	2	RGS7	239043642	0.979000	0.34478	1.000000	0.80357	0.835000	0.47333	0.183000	0.16919	0.955000	0.37878	0.533000	0.62120	AGT		0.433	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		Missense_Mutation
PLXDC2	84898	broad.mit.edu	37	10	20290850	20290850	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr10:20290850C>A	ENST00000377252.4	+	2	1100	c.259C>A	c.(259-261)Cct>Act	p.P87T	PLXDC2_ENST00000377242.3_Missense_Mutation_p.P87T	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	87					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P87T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						CCAAGACTCTCCTGAGCCCAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	10											80.0	69.0	73.0					10																	20290850		2203	4300	6503	20330856	SO:0001583	missense	84898			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.259C>A	10.37:g.20290850C>A	ENSP00000366460:p.Pro87Thr	Unknown		x	x	x	20330856	Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	8.042	0.764152	0.15914	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000536022	T;T	0.23754	2.0;1.89	5.9	-0.145	0.13436	.	0.828377	0.11364	N	0.571611	T	0.10981	0.0268	N	0.08118	0	0.58432	D	0.999995	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.12967	-1.0527	10	0.87932	D	0	.	2.8608	0.05586	0.2041:0.1965:0.476:0.1234	.	87;87	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	T	87;87;73	ENSP00000366460:P87T;ENSP00000366450:P87T	ENSP00000366450:P87T	P	+	1	0	PLXDC2	20330856	0.016000	0.18221	0.899000	0.35326	0.075000	0.17131	0.743000	0.26231	0.063000	0.16370	-0.182000	0.12963	CCT		0.493	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812		Missense_Mutation
SYT8	90019	broad.mit.edu	37	11	1858460	1858460	+	Silent	SNP	G	G	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:1858460G>T	ENST00000381968.3	+	9	1133	c.1005G>T	c.(1003-1005)ctG>ctT	p.L335L	TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000341958.3_Silent_p.L321L|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381911.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	335	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)	p.L335L(1)		breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACCGCAGCCTGCCGCTCCGAA	0.677																																																1	Substitution - coding silent(1)	ovary(1)	11											25.0	28.0	27.0					11																	1858460		2197	4291	6488	1815036	SO:0001819	synonymous_variant	90019			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1005G>T	11.37:g.1858460G>T		Unknown		x	x	x	1815036	A6NFJ4|Q9NSV9	Silent	SNP	ENST00000381968.3	37	CCDS7726.2	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	g	0.040	-1.289817	0.01387	.	.	ENSG00000149043	ENST00000381978	.	.	.	3.61	-5.44	0.02624	.	.	.	.	.	T	0.17534	0.0421	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27088	-1.0084	4	.	.	.	.	2.0546	0.03578	0.5089:0.1162:0.1411:0.2338	.	.	.	.	S	334	.	.	A	+	1	0	SYT8	1815036	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.970000	0.03810	-0.923000	0.03785	-0.467000	0.05162	GCC		0.677	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4			Silent
ACCSL	390110	broad.mit.edu	37	11	44069884	44069884	+	Missense_Mutation	SNP	G	G	A	rs201604433		TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:44069884G>A	ENST00000378832.1	+	1	354	c.298G>A	c.(298-300)Gac>Aac	p.D100N		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	100					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)	p.D100N(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TCCTTCTGAGGACTCTAGGGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	11						G	ASN/ASP	0,3922		0,0,1961	82.0	86.0	85.0		298	2.8	0.0	11		85	1,8307		0,1,4153	yes	missense	ACCSL	NM_001031854.2	23	0,1,6114	AA,AG,GG		0.012,0.0,0.0082	benign	100/569	44069884	1,12229	1961	4154	6115	44026460	SO:0001583	missense	390110				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.298G>A	11.37:g.44069884G>A	ENSP00000368109:p.Asp100Asn	Unknown		x	x	x	44026460		Missense_Mutation	SNP	ENST00000378832.1	37	CCDS41636.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251298	0.39797	0.0	1.2E-4	ENSG00000205126	ENST00000378832	T	0.69435	-0.4	4.67	2.77	0.32553	.	1.293030	0.04967	N	0.463128	T	0.62708	0.2450	L	0.50333	1.59	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.47898	-0.9081	10	0.40728	T	0.16	-4.0406	8.8557	0.35227	0.1878:0.0:0.8122:0.0	.	100	Q4AC99	1A1L2_HUMAN	N	100	ENSP00000368109:D100N	ENSP00000368109:D100N	D	+	1	0	ACCSL	44026460	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.316000	0.19469	0.496000	0.27904	0.655000	0.94253	GAC		0.562	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854		Missense_Mutation
DGKZ	8525	broad.mit.edu	37	11	46387847	46387847	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:46387847C>T	ENST00000454345.1	+	2	166	c.41C>T	c.(40-42)cCa>cTa	p.P14L	DGKZ_ENST00000318201.8_Intron|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000527911.1_Intron|DGKZ_ENST00000532868.2_Intron|DGKZ_ENST00000421244.2_Intron|DGKZ_ENST00000456247.2_Intron|DGKZ_ENST00000395574.3_Intron|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000343674.6_Intron|DGKZ_ENST00000525434.1_3'UTR	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	14					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GGGAAGGTGCCAGGCCCTGGA	0.682																																																0			11											9.0	11.0	11.0					11																	46387847		1823	3949	5772	46344423	SO:0001583	missense	8525			U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.41C>T	11.37:g.46387847C>T	ENSP00000412178:p.Pro14Leu	Unknown		x	x	x	46344423	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150458	0.37923	.	.	ENSG00000149091	ENST00000454345	T	0.78364	-1.17	4.42	1.23	0.21249	.	0.559164	0.13244	N	0.402657	T	0.62258	0.2413	L	0.27053	0.805	0.26171	N	0.979865	B	0.02656	0.0	B	0.01281	0.0	T	0.54569	-0.8274	10	0.66056	D	0.02	.	5.8758	0.18828	0.1401:0.64:0.1365:0.0833	.	14	Q13574	DGKZ_HUMAN	L	14	ENSP00000412178:P14L	ENSP00000412178:P14L	P	+	2	0	DGKZ	46344423	0.000000	0.05858	0.942000	0.38095	0.689000	0.40095	-0.122000	0.10627	0.355000	0.24131	0.563000	0.77884	CCA		0.682	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540		Missense_Mutation
PACS1	55690	broad.mit.edu	37	11	66000503	66000503	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:66000503G>A	ENST00000320580.4	+	15	1837	c.1804G>A	c.(1804-1806)Gtg>Atg	p.V602M	PACS1_ENST00000529757.1_Missense_Mutation_p.V138M	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	602					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.V602M(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						GGTCCAGGCCGTGCTGTCCGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											153.0	134.0	141.0					11																	66000503		2200	4295	6495	65757079	SO:0001583	missense	55690			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1804G>A	11.37:g.66000503G>A	ENSP00000316454:p.Val602Met	Unknown		x	x	x	65757079	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893877	0.91889	.	.	ENSG00000175115	ENST00000320580;ENST00000529757	T;T	0.52057	0.68;0.68	4.56	4.56	0.56223	.	0.267572	0.35805	N	0.002969	T	0.62877	0.2464	M	0.61703	1.905	0.80722	D	1	D	0.71674	0.998	P	0.61070	0.883	T	0.66771	-0.5839	10	0.62326	D	0.03	-18.9632	16.263	0.82557	0.0:0.0:1.0:0.0	.	602	Q6VY07	PACS1_HUMAN	M	602;138	ENSP00000316454:V602M;ENSP00000432858:V138M	ENSP00000316454:V602M	V	+	1	0	PACS1	65757079	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	9.619000	0.98369	2.386000	0.81285	0.549000	0.68633	GTG		0.627	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026		Missense_Mutation
ANO1	55107	broad.mit.edu	37	11	70028619	70028619	+	Silent	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:70028619C>A	ENST00000355303.5	+	24	2720	c.2415C>A	c.(2413-2415)atC>atA	p.I805I	ANO1_ENST00000531349.1_Silent_p.I514I|ANO1_ENST00000538023.1_Silent_p.I805I|ANO1_ENST00000398543.2_Silent_p.I659I|ANO1_ENST00000525494.1_3'UTR|ANO1_ENST00000530676.1_Silent_p.I659I	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	805					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.I805I(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CCTTCGTGATCTCCTTCACGT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											66.0	71.0	69.0					11																	70028619		2072	4186	6258	69706267	SO:0001819	synonymous_variant	55107			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.2415C>A	11.37:g.70028619C>A		Unknown		x	x	x	69706267	A8KAM3|Q8IYY8|Q8N7V3	Silent	SNP	ENST00000355303.5	37	CCDS44663.1	SNP	32	Broad																																																																																				0.612	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043		Silent
KRTAP5-7	440050	broad.mit.edu	37	11	71238604	71238604	+	Silent	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:71238604C>T	ENST00000398536.4	+	1	292	c.258C>T	c.(256-258)ggC>ggT	p.G86G		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	86	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G86G(1)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						CTAAGGGGGGCTGTGGTTCTT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	11											76.0	101.0	93.0					11																	71238604		2200	4294	6494	70916252	SO:0001819	synonymous_variant	440050			AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.258C>T	11.37:g.71238604C>T		Unknown		x	x	x	70916252	B2RNM3|Q701N5	Silent	SNP	ENST00000398536.4	37	CCDS41682.1	SNP	28	Broad																																																																																				0.647	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1			Silent
GDPD5	81544	broad.mit.edu	37	11	75160025	75160025	+	Silent	SNP	G	G	C			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:75160025G>C	ENST00000336898.3	-	9	1548	c.711C>G	c.(709-711)ccC>ccG	p.P237P	GDPD5_ENST00000376282.3_Silent_p.P118P|GDPD5_ENST00000526177.1_Silent_p.P99P|GDPD5_ENST00000529721.1_Silent_p.P237P|GDPD5_ENST00000533805.1_5'UTR|GDPD5_ENST00000533784.1_Silent_p.P118P|GDPD5_ENST00000443276.2_3'UTR	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	237	GP-PDE.				cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)	p.P237P(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						CACTCACCATGGGGGCCCCGC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	11											38.0	42.0	40.0					11																	75160025		2200	4293	6493	74837673	SO:0001819	synonymous_variant	81544			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.711C>G	11.37:g.75160025G>C		Unknown		x	x	x	74837673	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Silent	SNP	ENST00000336898.3	37	CCDS8238.1	SNP	47	Broad																																																																																				0.597	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792		Silent
DDIAS	220042	broad.mit.edu	37	11	82625793	82625793	+	Nonsense_Mutation	SNP	C	C	T	rs147443808		TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:82625793C>T	ENST00000533655.1	+	3	225	c.13C>T	c.(13-15)Cga>Tga	p.R5*	C11orf82_ENST00000430323.2_Nonsense_Mutation_p.R5*|C11orf82_ENST00000524921.1_Nonsense_Mutation_p.R5*|C11orf82_ENST00000525361.1_Nonsense_Mutation_p.R5*|C11orf82_ENST00000329143.3_5'UTR|C11orf82_ENST00000525388.1_Nonsense_Mutation_p.R5*|C11orf82_ENST00000528759.1_Nonsense_Mutation_p.R5*	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		5					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R5*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						GAACAGAAGACGAAAATTTCT	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		19471	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Nonsense(1)	ovary(1)	11						C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	109.0	101.0	104.0		13	2.9	1.0	11	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	C11orf82	NM_145018.3		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		5/999	82625793	2,13004	2203	4300	6503	82303441	SO:0001587	stop_gained	220042																														ENST00000533655.1:c.13C>T	11.37:g.82625793C>T	ENSP00000435421:p.Arg5*	Unknown		x	x	x	82303441	Q96LK6|Q9H856	Nonsense_Mutation	SNP	ENST00000533655.1	37	CCDS8263.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	38	6.813121	0.97857	2.27E-4	1.16E-4	ENSG00000165490	ENST00000532277;ENST00000524921;ENST00000528759;ENST00000525361;ENST00000430323;ENST00000533655;ENST00000532764;ENST00000532589;ENST00000525388;ENST00000528262	.	.	.	5.26	2.89	0.33648	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1892	0.43017	0.6585:0.3415:0.0:0.0	.	.	.	.	X	5;5;5;5;5;5;66;5;5;5	.	.	R	+	1	2	C11orf82	82303441	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.631000	0.46502	0.301000	0.22738	-0.256000	0.11100	CGA		0.388	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1			Nonsense_Mutation
EXPH5	23086	broad.mit.edu	37	11	108381960	108381960	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr11:108381960G>A	ENST00000265843.4	-	6	4384	c.4274C>T	c.(4273-4275)tCt>tTt	p.S1425F	EXPH5_ENST00000428840.1_Missense_Mutation_p.S1349F|EXPH5_ENST00000443411.1_Missense_Mutation_p.S1237F|EXPH5_ENST00000525344.1_Missense_Mutation_p.S1418F|EXPH5_ENST00000524840.1_5'Flank	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1425					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.S1425F(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TGGAAGACTAGAGGGACCACT	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											108.0	108.0	108.0					11																	108381960		2201	4298	6499	107887170	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4274C>T	11.37:g.108381960G>A	ENSP00000265843:p.Ser1425Phe	Unknown		x	x	x	107887170	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295784	0.23564	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312	T;T;T;T;T	0.04119	3.92;3.85;3.7;3.92;3.74	4.99	1.88	0.25563	.	0.956277	0.08687	N	0.908607	T	0.04543	0.0124	L	0.35723	1.085	0.09310	N	1	B	0.17038	0.02	B	0.17098	0.017	T	0.43491	-0.9388	10	0.52906	T	0.07	-4.322	3.1567	0.06506	0.0921:0.1294:0.4985:0.28	.	1425	Q8NEV8	EXPH5_HUMAN	F	1425;1349;1237;1418;1349	ENSP00000265843:S1425F;ENSP00000391966:S1349F;ENSP00000411390:S1237F;ENSP00000432546:S1418F;ENSP00000432683:S1349F	ENSP00000265843:S1425F	S	-	2	0	EXPH5	107887170	0.001000	0.12720	0.016000	0.15963	0.654000	0.38779	0.960000	0.29253	0.501000	0.28013	0.591000	0.81541	TCT		0.383	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065		Missense_Mutation
ATP5G2	517	broad.mit.edu	37	12	54059178	54059178	+	Missense_Mutation	SNP	C	C	T	rs374457649	byFrequency	TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr12:54059178C>T	ENST00000549164.1	-	5	533	c.346G>A	c.(346-348)Gcc>Acc	p.A116T	ATP5G2_ENST00000602871.1_Missense_Mutation_p.A116T|ATP5G2_ENST00000394349.3_Missense_Mutation_p.A173T|ATP5G2_ENST00000338662.5_Missense_Mutation_p.A132T|ATP5G2_ENST00000550241.1_Intron			Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)	116					ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)|response to ethanol (GO:0045471)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.A132T(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6						CCCAGAATGGCGTAGGAGAAG	0.483													C|||	3	0.000599042	0.0015	0.0	5008	,	,		20103	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12						C	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	62.0	64.0	63.0		394,517	5.3	1.0	12		63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ATP5G2	NM_001002031.2,NM_005176.5	58,58	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign	132/158,173/199	54059178	2,13004	2203	4300	6503	52345445	SO:0001583	missense	517			X69908	CCDS8863.2, CCDS31812.1	12q13.13	2012-10-12	2010-06-11		ENSG00000135390	ENSG00000135390		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	842	protein-coding gene	gene with protein product		603193	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9)"""			8328972	Standard	NM_005176		Approved		uc001sec.3	Q06055	OTTHUMG00000133442	ENST00000549164.1:c.346G>A	12.37:g.54059178C>T	ENSP00000447317:p.Ala116Thr	Unknown		x	x	x	52345445	B3KQQ6	Missense_Mutation	SNP	ENST00000549164.1	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713313	0.89112	2.27E-4	1.16E-4	ENSG00000135390	ENST00000394349;ENST00000549164;ENST00000338662	T;T;T	0.44881	0.91;0.91;0.91	5.32	5.32	0.75619	ATPase, F0/V0 complex, subunit C (3);	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	L	0.52266	1.64	0.58432	D	0.999999	P;P;P	0.45348	0.492;0.856;0.659	B;B;B	0.32342	0.071;0.141;0.144	T	0.43294	-0.9400	10	0.62326	D	0.03	-12.6004	18.3142	0.90213	0.0:1.0:0.0:0.0	.	116;132;173	Q06055;Q06055-3;Q06055-2	AT5G2_HUMAN;.;.	T	173;116;132	ENSP00000377878:A173T;ENSP00000447317:A116T;ENSP00000340315:A132T	ENSP00000340315:A132T	A	-	1	0	ATP5G2	52345445	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.579000	0.82511	2.941000	0.99782	0.655000	0.94253	GCC		0.483	ATP5G2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000407403.1	NM_005176		Missense_Mutation
CRY1	1407	broad.mit.edu	37	12	107395141	107395141	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr12:107395141C>T	ENST00000008527.5	-	5	1468	c.601G>A	c.(601-603)Gat>Aat	p.D201N		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	201					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)	p.D201N(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						CCATCTGTATCAAAACCTACA	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											85.0	88.0	87.0					12																	107395141		2203	4300	6503	105919271	SO:0001583	missense	1407			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.601G>A	12.37:g.107395141C>T	ENSP00000008527:p.Asp201Asn	Unknown		x	x	x	105919271		Missense_Mutation	SNP	ENST00000008527.5	37	CCDS9112.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014792	0.75161	.	.	ENSG00000008405	ENST00000008527	.	.	.	5.72	5.72	0.89469	DNA photolyase, N-terminal (1);	0.043473	0.85682	D	0.000000	T	0.69949	0.3168	M	0.78223	2.4	0.80722	D	1	B	0.14805	0.011	B	0.17098	0.017	T	0.65150	-0.6238	9	0.25106	T	0.35	-24.6757	19.8689	0.96843	0.0:1.0:0.0:0.0	.	201	Q16526	CRY1_HUMAN	N	201	.	ENSP00000008527:D201N	D	-	1	0	CRY1	105919271	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	3.901000	0.56303	2.695000	0.91970	0.557000	0.71058	GAT		0.343	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075		Missense_Mutation
DNAH10	196385	broad.mit.edu	37	12	124283833	124283833	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr12:124283833A>G	ENST00000409039.3	+	13	1875	c.1850A>G	c.(1849-1851)gAg>gGg	p.E617G		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	617	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E435G(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACAATGAAGGAGTATGAAGAC	0.443																																																1	Substitution - Missense(1)	ovary(1)	12											154.0	130.0	138.0					12																	124283833		2203	4300	6503	122849786	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1850A>G	12.37:g.124283833A>G	ENSP00000386770:p.Glu617Gly	Unknown		x	x	x	122849786	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	11.54	1.667764	0.29604	.	.	ENSG00000197653	ENST00000409039	T	0.58210	0.35	5.64	3.14	0.36123	Dynein heavy chain, domain-1 (1);	0.325197	0.25981	N	0.027069	T	0.47673	0.1458	L	0.57536	1.79	0.33353	D	0.571326	B;B;B	0.25235	0.021;0.014;0.121	B;B;B	0.30943	0.022;0.035;0.122	T	0.57359	-0.7825	10	0.48119	T	0.1	.	8.1625	0.31207	0.7953:0.1346:0.0701:0.0	.	617;492;617	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	G	617	ENSP00000386770:E617G	ENSP00000386770:E617G	E	+	2	0	DNAH10	122849786	1.000000	0.71417	0.968000	0.41197	0.221000	0.24807	4.728000	0.62000	0.969000	0.38237	0.528000	0.53228	GAG		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			Missense_Mutation
GPR133	283383	broad.mit.edu	37	12	131466490	131466490	+	Silent	SNP	G	G	A	rs145796361	byFrequency	TCGA-24-1434-01	TCGA-24-1434-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr12:131466490G>A	ENST00000261654.5	+	5	931	c.372G>A	c.(370-372)gcG>gcA	p.A124A	GPR133_ENST00000535015.1_Silent_p.A156A	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	124					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A124A(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCCCTTCTGCGTATGGGGGAC	0.507													g|||	8	0.00159744	0.0008	0.0043	5008	,	,		18530	0.0		0.001	False		,,,				2504	0.0031															1	Substitution - coding silent(1)	ovary(1)	12								0,4406		0,0,2203	134.0	124.0	127.0		372	-7.9	0.0	12	dbSNP_134	127	3,8597	3.7+/-12.6	0,3,4297	yes	coding-synonymous	GPR133	NM_198827.3		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		124/875	131466490	3,13003	2203	4300	6503	130032443	SO:0001819	synonymous_variant	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.372G>A	12.37:g.131466490G>A		Somatic		x	x	x	130032443	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	37	CCDS9272.1	SNP	40	Broad																																																																																				0.507	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		Silent
DDX51	317781	broad.mit.edu	37	12	132627283	132627283	+	Silent	SNP	G	G	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr12:132627283G>T	ENST00000397333.3	-	3	698	c.660C>A	c.(658-660)tcC>tcA	p.S220S	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	220					rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.S220S(1)		endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		CTGGAAAGTAGGACGAGATGC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	12											60.0	67.0	65.0					12																	132627283		2071	4196	6267	131193236	SO:0001819	synonymous_variant	317781			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.660C>A	12.37:g.132627283G>T		Unknown		x	x	x	131193236	A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Silent	SNP	ENST00000397333.3	37	CCDS41865.1	SNP	35	Broad																																																																																				0.632	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398978.1	NM_175066		Silent
ZNF605	100289635	broad.mit.edu	37	12	133503655	133503655	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr12:133503655T>C	ENST00000360187.4	-	5	578	c.230A>G	c.(229-231)aAa>aGa	p.K77R	ZNF605_ENST00000331711.7_5'UTR|ZNF605_ENST00000392321.3_Missense_Mutation_p.K108R	NM_183238.3	NP_899061.1	Q86T29	ZN605_HUMAN	zinc finger protein 605	77	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K77R(1)		breast(1)|kidney(16)|large_intestine(5)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		ATTAAATATTTTTCCAAAAAC	0.338																																																1	Substitution - Missense(1)	ovary(1)	12											1.0	1.0	1.0					12																	133503655		4	10	14	132013728	SO:0001583	missense	100289635			AL832623	CCDS31938.1, CCDS53850.1	12q24.33	2013-01-08	2009-09-11	2009-09-11		ENSG00000196458		"""Zinc fingers, C2H2-type"", ""-"""	28068	protein-coding gene	gene with protein product							Standard	NM_183238		Approved		uc001uli.3	Q86T29		ENST00000360187.4:c.230A>G	12.37:g.133503655T>C	ENSP00000353314:p.Lys77Arg	Unknown		x	x	x	132013728	B3KVG4|D3DXJ0|Q86T91	Missense_Mutation	SNP	ENST00000360187.4	37	CCDS31938.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	1.406	-0.576875	0.03854	.	.	ENSG00000196458	ENST00000360187;ENST00000392321	T;T	0.11063	2.81;2.97	3.78	0.214	0.15249	Krueppel-associated box (1);	0.485574	0.15441	N	0.262201	T	0.09992	0.0245	L	0.60455	1.87	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.24190	-1.0167	10	0.56958	D	0.05	.	4.6129	0.12411	0.0:0.2971:0.165:0.5379	.	108;77	B3KVG4;Q86T29	.;ZN605_HUMAN	R	77;108	ENSP00000353314:K77R;ENSP00000376135:K108R	ENSP00000353314:K77R	K	-	2	0	ZNF605	132013728	0.740000	0.28207	0.793000	0.32043	0.050000	0.14768	1.511000	0.35801	0.183000	0.20059	-0.415000	0.06103	AAA		0.338	ZNF605-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397135.2	NM_183238		Missense_Mutation
RNF17	56163	broad.mit.edu	37	13	25374504	25374504	+	Splice_Site	SNP	A	A	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr13:25374504A>T	ENST00000255324.5	+	13	1642	c.1590A>T	c.(1588-1590)ggA>ggT	p.G530G	RNF17_ENST00000381921.1_Splice_Site_p.G530G|RNF17_ENST00000255325.6_Splice_Site_p.G530G	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	530					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G530G(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTTCTCCTAGAGTTGTTGATA	0.318																																																1	Substitution - coding silent(1)	ovary(1)	13											92.0	96.0	95.0					13																	25374504		2203	4300	6503	24272504	SO:0001630	splice_region_variant	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1590-1A>T	13.37:g.25374504A>T		Unknown		x	x	x	24272504	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	37	CCDS9308.2	SNP	11	Broad																																																																																				0.318	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	Silent	Silent
PCDH9	5101	broad.mit.edu	37	13	67205409	67205409	+	Silent	SNP	G	G	A	rs372281341		TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr13:67205409G>A	ENST00000377865.2	-	3	3407	c.3273C>T	c.(3271-3273)gaC>gaT	p.D1091D	PCDH9_ENST00000328454.5_Silent_p.D1057D|PCDH9_ENST00000456367.1_Silent_p.D1057D|RNU7-87P_ENST00000459343.1_RNA|PCDH9_ENST00000544246.1_Silent_p.D1091D			Q9HC56	PCDH9_HUMAN	protocadherin 9	1091					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1091D(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CATAGAATTCGTCCTGTGGCT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	13						G	,	1,4405	2.1+/-5.4	0,1,2202	127.0	116.0	120.0		3171,3273	5.6	1.0	13		120	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PCDH9	NM_020403.4,NM_203487.2	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	1057/1204,1091/1238	67205409	2,13004	2203	4300	6503	66103410	SO:0001819	synonymous_variant	5101			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3273C>T	13.37:g.67205409G>A		Unknown		x	x	x	66103410	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Silent	SNP	ENST00000377865.2	37	CCDS9444.1	SNP	40	Broad																																																																																				0.537	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487		Silent
DOCK9	23348	broad.mit.edu	37	13	99452646	99452646	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr13:99452646C>G	ENST00000376460.1	-	53	5934	c.5854G>C	c.(5854-5856)Gac>Cac	p.D1952H	DOCK9_ENST00000339416.2_Missense_Mutation_p.D1939H	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1953	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTCATCTCGTCAATGGCCACC	0.567																																																0			13											59.0	61.0	60.0					13																	99452646		2143	4248	6391	98250647	SO:0001583	missense	23348			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.5854G>C	13.37:g.99452646C>G	ENSP00000365643:p.Asp1952His	Unknown		x	x	x	98250647	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	SNP	29	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	28.8|28.8|28.8	4.950080|4.950080|4.950080	0.92660|0.92660|0.92660	.|.|.	.|.|.	ENSG00000088387|ENSG00000088387|ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453|ENST00000419908|ENST00000400228	T;T|.|.	0.17691|.|.	2.26;2.26|.|.	5.32|5.32|5.32	5.32|5.32|5.32	0.75619|0.75619|0.75619	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	D|D|.	0.85344|0.85344|.	0.5675|0.5675|.	M|M|M	0.89904|0.89904|0.89904	3.07|3.07|3.07	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0;0.973;1.0;1.0|.|.	D;D;D;D;D;D|.|.	0.91635|.|.	0.999;0.998;0.995;0.93;0.999;0.998|.|.	D|D|.	0.87524|0.87524|.	0.2448|0.2448|.	10|5|.	0.87932|.|.	D|.|.	0|.|.	.|.|.	19.3791|19.3791|19.3791	0.94525|0.94525|0.94525	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	658;571;1952;1953;608;570|.|.	B7Z6H5;B7Z2J2;Q9BZ29-5;Q9BZ29;B7Z6G9;F5H1Q4|.|.	.;.;.;DOCK9_HUMAN;.;.|.|.	H|F|S	1952;1953;1945;1930;1952;860;1939;570|355|514	ENSP00000365643:D1952H;ENSP00000341086:D1939H|.|.	ENSP00000341086:D1939H|.|.	D|L|X	-|-|-	1|3|2	0|2|2	DOCK9|DOCK9|DOCK9	98250647|98250647|98250647	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.995000|0.995000|0.995000	0.50966|0.50966|0.50966	0.990000|0.990000|0.990000	0.78478|0.78478|0.78478	7.445000|7.445000|7.445000	0.80570|0.80570|0.80570	2.644000|2.644000|2.644000	0.89710|0.89710|0.89710	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAC|TTG|TGA		0.567	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296		Missense_Mutation
OR4K13	390433	broad.mit.edu	37	14	20502317	20502317	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr14:20502317C>A	ENST00000315693.2	-	1	602	c.601G>T	c.(601-603)Gct>Tct	p.A201S	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A201S(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		CCACTGTCAGCAATGACCAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	14											117.0	116.0	116.0					14																	20502317		2203	4300	6503	19572157	SO:0001583	missense	390433				CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.601G>T	14.37:g.20502317C>A	ENSP00000319322:p.Ala201Ser	Unknown		x	x	x	19572157	Q6IF13	Missense_Mutation	SNP	ENST00000315693.2	37	CCDS32028.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	.	7.762	0.705699	0.15172	.	.	ENSG00000176253	ENST00000315693	T	0.00130	8.69	3.46	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38778	U	0.001565	T	0.00109	0.0003	L	0.33485	1.01	0.22317	N	0.999202	B	0.19200	0.034	B	0.26864	0.074	T	0.09930	-1.0652	10	0.18276	T	0.48	.	10.0056	0.41955	0.3225:0.6775:0.0:0.0	.	201	Q8NH42	OR4KD_HUMAN	S	201	ENSP00000319322:A201S	ENSP00000319322:A201S	A	-	1	0	OR4K13	19572157	0.000000	0.05858	0.996000	0.52242	0.138000	0.21146	-1.059000	0.03479	1.757000	0.51966	0.514000	0.50259	GCT		0.488	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410344.1			Missense_Mutation
PAK6	56924	broad.mit.edu	37	15	40557179	40557179	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr15:40557179C>A	ENST00000542403.2	+	2	304	c.193C>A	c.(193-195)Cag>Aag	p.Q65K	PAK6_ENST00000455577.2_Missense_Mutation_p.Q65K|PAK6_ENST00000453867.1_Missense_Mutation_p.Q65K|PAK6_ENST00000260404.4_Missense_Mutation_p.Q65K|PAK6_ENST00000441369.1_Missense_Mutation_p.Q65K|RP11-133K1.2_ENST00000558658.1_Silent_p.S158S|PAK6_ENST00000560346.1_Missense_Mutation_p.Q65K	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	65	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q65K(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GGTGCAGCTCCAGCCCATGAA	0.612																																																1	Substitution - Missense(1)	ovary(1)	15											42.0	40.0	41.0					15																	40557179		2203	4300	6503	38344471	SO:0001583	missense	56924			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.193C>A	15.37:g.40557179C>A	ENSP00000439597:p.Gln65Lys	Unknown		x	x	x	38344471	A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342515	0.24339	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.72942	-0.67;-0.67;-0.7;-0.67;-0.67	5.44	5.44	0.79542	.	0.223477	0.41500	D	0.000880	T	0.44477	0.1295	N	0.03608	-0.345	0.37492	D	0.916429	B;B	0.18461	0.028;0.023	B;B	0.20767	0.031;0.018	T	0.48581	-0.9023	10	0.02654	T	1	.	14.4776	0.67557	0.147:0.853:0.0:0.0	.	65;65	Q9NQU5;G5E9R2	PAK6_HUMAN;.	K	65	ENSP00000406873:Q65K;ENSP00000401153:Q65K;ENSP00000409465:Q65K;ENSP00000260404:Q65K;ENSP00000439597:Q65K	ENSP00000260404:Q65K	Q	+	1	0	PAK6	38344471	0.996000	0.38824	0.998000	0.56505	0.995000	0.86356	2.386000	0.44380	2.728000	0.93425	0.655000	0.94253	CAG		0.612	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			Missense_Mutation
IL4R	3566	broad.mit.edu	37	16	27374954	27374954	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr16:27374954G>A	ENST00000395762.2	+	11	2540	c.2281G>A	c.(2281-2283)Gcc>Acc	p.A761T	IL4R_ENST00000543915.2_Missense_Mutation_p.A761T|IL4R_ENST00000170630.2_Missense_Mutation_p.A761T|IL4R_ENST00000380922.3_Missense_Mutation_p.A746T	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	761					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)	p.A761T(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						CCCCCTGAGGGCCCCAGACCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	16											26.0	31.0	29.0					16																	27374954		2197	4300	6497	27282455	SO:0001583	missense	3566			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.2281G>A	16.37:g.27374954G>A	ENSP00000379111:p.Ala761Thr	Unknown		x	x	x	27282455	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	CCDS10629.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647803	0.29336	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	4.3	-6.31	0.02001	.	1.979650	0.02272	N	0.068589	T	0.10121	0.0248	L	0.50333	1.59	0.09310	N	1	B;B;B	0.21520	0.02;0.057;0.02	B;B;B	0.12837	0.008;0.008;0.008	T	0.24083	-1.0170	10	0.31617	T	0.26	-30.623	0.6781	0.00870	0.3429:0.1199:0.2948:0.2424	.	746;761;761	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	T	761;761;746;761	ENSP00000379111:A761T;ENSP00000441667:A761T;ENSP00000370309:A746T;ENSP00000170630:A761T	ENSP00000170630:A761T	A	+	1	0	IL4R	27282455	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.268000	0.08607	-1.011000	0.03391	-0.229000	0.12294	GCC		0.637	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4			Missense_Mutation
MVP	9961	broad.mit.edu	37	16	29853155	29853155	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr16:29853155G>A	ENST00000357402.5	+	9	1568	c.1430G>A	c.(1429-1431)cGa>cAa	p.R477Q	MVP_ENST00000395353.1_Missense_Mutation_p.R477Q|MVP_ENST00000452209.2_3'UTR	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	477					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)	p.R477Q(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						CGAGAGAAGCGAGCCCGGTGA	0.667																																																1	Substitution - Missense(1)	ovary(1)	16											38.0	41.0	40.0					16																	29853155		2197	4300	6497	29760656	SO:0001583	missense	9961			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.1430G>A	16.37:g.29853155G>A	ENSP00000349977:p.Arg477Gln	Unknown		x	x	x	29760656	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720193	0.30503	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.29917	1.55;1.55	5.92	-7.35	0.01422	.	0.776476	0.12489	N	0.464390	T	0.16128	0.0388	L	0.27053	0.805	0.09310	N	0.999993	B	0.34061	0.436	B	0.21151	0.033	T	0.00839	-1.1545	10	0.29301	T	0.29	-0.5316	17.3887	0.87424	0.838:0.0:0.162:0.0	.	477	Q14764	MVP_HUMAN	Q	477	ENSP00000349977:R477Q;ENSP00000378760:R477Q	ENSP00000349977:R477Q	R	+	2	0	MVP	29760656	0.004000	0.15560	0.066000	0.19879	0.307000	0.27823	-0.317000	0.08060	-1.477000	0.01872	-0.792000	0.03331	CGA		0.667	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115		Missense_Mutation
GAS8	2622	broad.mit.edu	37	16	90103716	90103716	+	Missense_Mutation	SNP	G	G	T	rs117053233	byFrequency	TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr16:90103716G>T	ENST00000268699.4	+	7	955	c.833G>T	c.(832-834)cGc>cTc	p.R278L	GAS8_ENST00000536122.1_Missense_Mutation_p.R253L|GAS8_ENST00000540721.1_3'UTR	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	278					cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.R278L(1)|p.R278H(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		CAGAACAAGCGCCTGGCAGAC	0.592																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	16											64.0	63.0	63.0					16																	90103716		2198	4300	6498	88631217	SO:0001583	missense	2622			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.833G>T	16.37:g.90103716G>T	ENSP00000268699:p.Arg278Leu	Unknown		x	x	x	88631217	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558459	0.65538	.	.	ENSG00000141013	ENST00000536122;ENST00000268699;ENST00000540721	T;T	0.49432	0.78;0.78	5.49	4.53	0.55603	.	0.361218	0.32548	N	0.005942	T	0.68165	0.2971	M	0.87456	2.885	0.36411	D	0.863732	D;D	0.65815	0.995;0.966	D;P	0.62955	0.909;0.814	T	0.77978	-0.2384	9	.	.	.	-6.8185	11.0258	0.47744	0.0688:0.0:0.8019:0.1293	.	249;278	B7Z1X3;O95995	.;GAS8_HUMAN	L	253;278;249	ENSP00000440977:R253L;ENSP00000268699:R278L	.	R	+	2	0	GAS8	88631217	0.991000	0.36638	0.997000	0.53966	0.469000	0.32828	2.568000	0.45965	1.307000	0.44944	0.563000	0.77884	CGC		0.592	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2			Missense_Mutation
DNM2	1785	broad.mit.edu	37	19	10897342	10897342	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr19:10897342C>T	ENST00000355667.6	+	7	1032	c.952C>T	c.(952-954)Cgg>Tgg	p.R318W	DNM2_ENST00000408974.4_Missense_Mutation_p.R318W|DNM2_ENST00000314646.5_Missense_Mutation_p.R318W|DNM2_ENST00000359692.6_Missense_Mutation_p.R318W|DNM2_ENST00000585892.1_Missense_Mutation_p.R318W|DNM2_ENST00000389253.4_Missense_Mutation_p.R318W	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	318					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)	p.R318W(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CAAGAACTTTCGGCCCGACGA	0.622			"""F, N, Splice, Mis, O"""		ETP ALL																																		Rec	yes		19	19p13.2	1785	dynamin 2		L	1	Substitution - Missense(1)	ovary(1)	19											110.0	95.0	100.0					19																	10897342		2203	4300	6503	10758342	SO:0001583	missense	1785				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.952C>T	19.37:g.10897342C>T	ENSP00000347890:p.Arg318Trp	Somatic		x	x	x	10758342	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	ENST00000355667.6	37	CCDS45968.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.299892	0.95574	.	.	ENSG00000079805	ENST00000389252;ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646	T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72	5.03	5.03	0.67393	Dynamin central domain (1);	0.125811	0.53938	D	0.000056	D	0.84656	0.5520	M	0.81802	2.56	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.997;0.999;1.0	D;P;D;P;D	0.72982	0.967;0.842;0.916;0.842;0.979	D	0.87138	0.2201	10	0.87932	D	0	-0.4021	17.1447	0.86763	0.0:1.0:0.0:0.0	.	51;318;318;318;318	B4DJ53;A8K1B6;P50570-2;P50570;E9PEQ4	.;.;.;DYN2_HUMAN;.	W	307;318;318;318;318;318	ENSP00000386192:R318W;ENSP00000347890:R318W;ENSP00000352721:R318W;ENSP00000373905:R318W;ENSP00000313164:R318W	ENSP00000313164:R318W	R	+	1	2	DNM2	10758342	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.858000	0.62947	2.325000	0.78763	0.655000	0.94253	CGG		0.622	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945		Missense_Mutation
KCNN1	3780	broad.mit.edu	37	19	18085960	18085960	+	Silent	SNP	G	G	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr19:18085960G>T	ENST00000222249.9	+	4	781	c.462G>T	c.(460-462)ctG>ctT	p.L154L		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	154					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.L171L(1)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CCATCCTGCTGGGTCTCGTTG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	19											101.0	105.0	104.0					19																	18085960		2091	4215	6306	17946960	SO:0001819	synonymous_variant	3780			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.462G>T	19.37:g.18085960G>T		Unknown		x	x	x	17946960	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37		SNP	47	Broad																																																																																				0.582	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248		Silent
PSG1	5669	broad.mit.edu	37	19	43376096	43376096	+	Missense_Mutation	SNP	A	A	T	rs199602373		TCGA-24-1434-01	TCGA-24-1434-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr19:43376096A>T	ENST00000436291.2	-	3	648	c.532T>A	c.(532-534)Tac>Aac	p.Y178N	PSG1_ENST00000595356.1_Missense_Mutation_p.Y178N|PSG1_ENST00000595124.1_Intron|PSG1_ENST00000244296.2_Missense_Mutation_p.Y178N|PSG1_ENST00000312439.6_Missense_Mutation_p.Y178N|PSG1_ENST00000403380.3_Intron	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	178	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.Y178N(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CACCACAGGTAGCTTGCGTCT	0.522																																																2	Substitution - Missense(2)	ovary(2)	19											259.0	248.0	252.0					19																	43376096		2201	4298	6499	48067936	SO:0001583	missense	5669				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.532T>A	19.37:g.43376096A>T	ENSP00000413041:p.Tyr178Asn	Somatic		x	x	x	48067936	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	37	CCDS54275.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	N	12.01	1.810474	0.32053	.	.	ENSG00000231924	ENST00000436291;ENST00000312439;ENST00000244296	T;T;T	0.14022	2.54;2.54;2.54	1.46	1.46	0.22682	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38321	0.1036	M	0.90019	3.08	0.09310	N	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.997;1.0;0.997;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.991;1.0;0.975;0.995;0.987;1.0;1.0	T	0.09840	-1.0656	9	0.87932	D	0	.	4.9592	0.14057	1.0:0.0:0.0:0.0	.	178;178;178;178;178;50;178;178	O75238;P11464-4;P11464;P11464-3;Q9UPK8;B4DTG5;O75237;P11464-2	.;.;PSG1_HUMAN;.;.;.;.;.	N	178	ENSP00000413041:Y178N;ENSP00000308970:Y178N;ENSP00000244296:Y178N	ENSP00000244296:Y178N	Y	-	1	0	PSG1	48067936	0.003000	0.15002	0.029000	0.17559	0.023000	0.10783	0.106000	0.15354	0.652000	0.30806	0.155000	0.16302	TAC		0.522	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1			Missense_Mutation
MITD1	129531	broad.mit.edu	37	2	99786056	99786056	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr2:99786056A>G	ENST00000289359.2	-	6	687	c.611T>C	c.(610-612)aTg>aCg	p.M204T	MITD1_ENST00000466880.1_5'Flank|MRPL30_ENST00000410042.1_Intron	NM_138798.1	NP_620153.1	Q8WV92	MITD1_HUMAN	MIT, microtubule interacting and transport, domain containing 1	204	Important for association with membranes.				cytokinetic cell separation (GO:0000920)|mitotic cytokinesis (GO:0000281)|mitotic cytokinetic cell separation (GO:1902409)|negative regulation of protein binding (GO:0032091)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)	phosphatidylinositol binding (GO:0035091)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)	p.M204T(1)		large_intestine(3)|lung(2)|ovary(1)	6						AATCTTAATCATCCATCCATT	0.294																																																1	Substitution - Missense(1)	ovary(1)	2											64.0	68.0	67.0					2																	99786056		2203	4293	6496	99152488	SO:0001583	missense	129531			BC018453	CCDS2040.1	2q11.2	2006-07-14			ENSG00000158411	ENSG00000158411			25207	protein-coding gene	gene with protein product						16730941	Standard	NM_138798		Approved	LOC129531	uc002szs.1	Q8WV92	OTTHUMG00000130638	ENST00000289359.2:c.611T>C	2.37:g.99786056A>G	ENSP00000289359:p.Met204Thr	Unknown		x	x	x	99152488	Q69YV0	Missense_Mutation	SNP	ENST00000289359.2	37	CCDS2040.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	12.87	2.066095	0.36470	.	.	ENSG00000158411	ENST00000422537;ENST00000289359;ENST00000409107	T;T	0.39997	1.07;1.05	5.64	4.46	0.54185	.	0.417145	0.31624	N	0.007327	T	0.27663	0.0680	N	0.25485	0.75	0.50467	D	0.999874	B	0.12013	0.005	B	0.08055	0.003	T	0.05835	-1.0861	10	0.14656	T	0.56	-0.7367	11.3488	0.49575	0.8642:0.0:0.0:0.1358	.	204	Q8WV92	MITD1_HUMAN	T	186;204;175	ENSP00000289359:M204T;ENSP00000387316:M175T	ENSP00000289359:M204T	M	-	2	0	MITD1	99152488	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	4.813000	0.62620	1.110000	0.41699	0.528000	0.53228	ATG		0.294	MITD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253126.1	NM_138798		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179612039	179612039	+	Intron	SNP	T	T	G			TCGA-24-1434-01	TCGA-24-1434-10			T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr2:179612039T>G	ENST00000591111.1	-	46	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.T5030P|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T5030P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTAAAGGTGTGGAATATCTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	60.0	59.0					2																	179612039		2203	4300	6503	179320284	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5391A>C	2.37:g.179612039T>G		Somatic		x	x	x	179320284	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	13.72	2.320985	0.41096	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.59083	0.29	5.96	3.47	0.39725	.	.	.	.	.	T	0.51686	0.1689	M	0.62723	1.935	0.23809	N	0.996784	B	0.13145	0.007	B	0.14578	0.011	T	0.41106	-0.9527	9	0.27785	T	0.31	.	8.6229	0.33872	0.1284:0.0:0.1347:0.7368	.	5030	Q8WZ42-6	.	P	5030;344	ENSP00000354117:T5030P	ENSP00000304714:T344P	T	-	1	0	TTN	179320284	0.902000	0.30710	0.006000	0.13384	0.989000	0.77384	2.032000	0.41127	0.444000	0.26612	0.533000	0.62120	ACA		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
DOCK3	1795	broad.mit.edu	37	3	51400103	51400103	+	Missense_Mutation	SNP	G	G	A	rs375984390		TCGA-24-1434-01	TCGA-24-1434-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr3:51400103G>A	ENST00000266037.9	+	49	5314	c.5291G>A	c.(5290-5292)cGa>cAa	p.R1764Q		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1764	Ser-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R1764Q(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCCAGTGCCCGAGGTAAGGAT	0.562																																																1	Substitution - Missense(1)	ovary(1)	3											45.0	46.0	46.0					3																	51400103		2033	4194	6227	51375143	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5291G>A	3.37:g.51400103G>A	ENSP00000266037:p.Arg1764Gln	Somatic		x	x	x	51375143	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.281009	0.95489	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.22134	1.97	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.44808	0.1311	M	0.72118	2.19	0.58432	D	0.999997	D	0.89917	1.0	D	0.79108	0.992	T	0.23868	-1.0176	10	0.11794	T	0.64	.	19.2304	0.93836	0.0:0.0:1.0:0.0	.	1764	Q8IZD9	DOCK3_HUMAN	Q	1764;560	ENSP00000266037:R1764Q	ENSP00000266037:R1764Q	R	+	2	0	DOCK3	51375143	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.395000	0.97266	2.605000	0.88082	0.563000	0.77884	CGA		0.562	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947		Missense_Mutation
SPICE1	152185	broad.mit.edu	37	3	113187693	113187693	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr3:113187693C>T	ENST00000295872.4	-	9	1064	c.805G>A	c.(805-807)Gaa>Aaa	p.E269K		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	269					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)		p.E269K(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GTAGATTCTTCAGGCTGAAGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											96.0	86.0	89.0					3																	113187693		2203	4300	6503	114670383	SO:0001583	missense	152185			AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.805G>A	3.37:g.113187693C>T	ENSP00000295872:p.Glu269Lys	Unknown		x	x	x	114670383	D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	37	CCDS2973.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675739	0.29783	.	.	ENSG00000163611	ENST00000295872	T	0.35605	1.3	5.05	4.18	0.49190	.	0.683462	0.15173	N	0.276533	T	0.39009	0.1062	M	0.64997	1.995	0.36419	D	0.864189	B;B	0.30634	0.288;0.137	B;B	0.29942	0.109;0.109	T	0.50849	-0.8779	10	0.72032	D	0.01	-8.2372	14.2705	0.66149	0.0:0.8513:0.1487:0.0	.	165;269	B3KX77;Q8N0Z3	.;SPICE_HUMAN	K	269	ENSP00000295872:E269K	ENSP00000295872:E269K	E	-	1	0	SPICE1	114670383	1.000000	0.71417	0.212000	0.23672	0.041000	0.13682	1.175000	0.31944	1.253000	0.44018	-0.226000	0.12346	GAA		0.418	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718		Missense_Mutation
SIDT1	54847	broad.mit.edu	37	3	113327010	113327010	+	Silent	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr3:113327010G>A	ENST00000264852.4	+	16	2274	c.1548G>A	c.(1546-1548)ttG>ttA	p.L516L	SIDT1_ENST00000393830.3_Silent_p.L516L|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	516					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.L516L(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TGATAGTCTTGCGCCGCGACA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	3											159.0	140.0	146.0					3																	113327010		2203	4300	6503	114809700	SO:0001819	synonymous_variant	54847			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1548G>A	3.37:g.113327010G>A		Unknown		x	x	x	114809700	Q17RR4	Silent	SNP	ENST00000264852.4	37	CCDS2974.1	SNP	46	Broad																																																																																				0.537	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699		Silent
ZNF80	7634	broad.mit.edu	37	3	113955519	113955519	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr3:113955519A>C	ENST00000482457.2	-	1	906	c.403T>G	c.(403-405)Tgc>Ggc	p.C135G	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C135G(1)		NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				CACTCGCTGCACTCATAGGGC	0.532																																					GBM(23;986 1114 21716)											1	Substitution - Missense(1)	ovary(1)	3											71.0	70.0	70.0					3																	113955519		2203	4300	6503	115438209	SO:0001583	missense	7634			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.403T>G	3.37:g.113955519A>C	ENSP00000417192:p.Cys135Gly	Unknown		x	x	x	115438209	Q6NSW4|Q6NT14	Missense_Mutation	SNP	ENST00000482457.2	37	CCDS2979.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	15.11	2.735256	0.48939	.	.	ENSG00000174255	ENST00000482457	D	0.85258	-1.96	3.23	0.615	0.17608	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92437	0.7599	M	0.93808	3.46	0.09310	N	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.81913	-0.0715	9	0.87932	D	0	.	4.9325	0.13925	0.6281:0.1892:0.0:0.1827	.	135	P51504	ZNF80_HUMAN	G	135	ENSP00000417192:C135G	ENSP00000309812:C135G	C	-	1	0	ZNF80	115438209	1.000000	0.71417	0.001000	0.08648	0.054000	0.15201	5.124000	0.64709	0.114000	0.18032	0.533000	0.62120	TGC		0.532	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136		Missense_Mutation
CD86	942	broad.mit.edu	37	3	121825047	121825047	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1434-01	TCGA-24-1434-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr3:121825047A>C	ENST00000330540.2	+	4	519	c.403A>C	c.(403-405)Aac>Cac	p.N135H	CD86_ENST00000264468.5_Intron|CD86_ENST00000493101.1_Missense_Mutation_p.N23H|CD86_ENST00000393627.2_Missense_Mutation_p.N129H|CD86_ENST00000469710.1_Missense_Mutation_p.N53H	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	135					aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)	p.N135H(1)		breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	GCTTTCAGCTAACTTCAGTCA	0.358																																					GBM(67;1379 1389 36064 39806)											1	Substitution - Missense(1)	ovary(1)	3											29.0	29.0	29.0					3																	121825047		2201	4300	6501	123307737	SO:0001583	missense	942				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.403A>C	3.37:g.121825047A>C	ENSP00000332049:p.Asn135His	Somatic		x	x	x	123307737	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	ENST00000330540.2	37	CCDS3009.1	SNP	13	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.53|17.53	3.412611|3.412611	0.62511|0.62511	.|.	.|.	ENSG00000114013|ENSG00000114013	ENST00000469710;ENST00000493101;ENST00000330540;ENST00000482356;ENST00000393627|ENST00000478741	T;T;T;T;T|.	0.19250|.	3.19;2.16;4.38;3.56;4.38|.	5.65|5.65	3.2|3.2	0.36748|0.36748	.|.	0.202552|.	0.35525|.	N|.	0.003152|.	T|.	0.70919|.	0.3279|.	M|M	0.78801|0.78801	2.425|2.425	0.80722|0.80722	D|D	1|1	D;P|.	0.64830|.	0.994;0.939|.	P;P|.	0.55011|.	0.766;0.556|.	T|.	0.70769|.	-0.4782|.	10|.	0.59425|.	D|.	0.04|.	-30.0793|-30.0793	9.502|9.502	0.39024|0.39024	0.6237:0.3763:0.0:0.0|0.6237:0.3763:0.0:0.0	.|.	23;135|.	E9PC27;P42081|.	.;CD86_HUMAN|.	H|S	53;23;135;129;129|130	ENSP00000418988:N53H;ENSP00000420230:N23H;ENSP00000332049:N135H;ENSP00000419116:N129H;ENSP00000377248:N129H|.	ENSP00000332049:N135H|.	N|X	+|+	1|2	0|2	CD86|CD86	123307737|123307737	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	2.955000|2.955000	0.49121|0.49121	1.118000|1.118000	0.41863|0.41863	0.533000|0.533000	0.62120|0.62120	AAC|TAA		0.358	CD86-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355671.1	NM_006889		Missense_Mutation
KIAA1109	84162	broad.mit.edu	37	4	123167884	123167884	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr4:123167884C>T	ENST00000264501.4	+	34	5604	c.5231C>T	c.(5230-5232)aCg>aTg	p.T1744M	KIAA1109_ENST00000388738.3_Missense_Mutation_p.T1744M|KIAA1109_ENST00000455637.1_Missense_Mutation_p.T1744M			Q2LD37	K1109_HUMAN	KIAA1109	1744					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T1744M(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCTCCAACTACGGCTCCTAGT	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											128.0	126.0	127.0					4																	123167884		1872	4101	5973	123387334	SO:0001583	missense	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.5231C>T	4.37:g.123167884C>T	ENSP00000264501:p.Thr1744Met	Unknown		x	x	x	123387334	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	SNP	19	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.80|16.80	3.222785|3.222785	0.58668|0.58668	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000446180|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.23147	.|2.5;2.5;1.92	6.1|6.1	5.26|5.26	0.73747|0.73747	.|.	.|0.674078	.|0.11514	.|U	.|0.556464	T|T	0.16428|0.16428	0.0395|0.0395	N|N	0.14661|0.14661	0.345|0.345	0.26886|0.26886	N|N	0.967421|0.967421	.|P;B	.|0.36733	.|0.567;0.349	.|B;B	.|0.29785	.|0.107;0.072	T|T	0.12192|0.12192	-1.0557|-1.0557	5|10	.|0.72032	.|D	.|0.01	.|.	13.0846|13.0846	0.59133|0.59133	0.0:0.8676:0.0:0.1324|0.0:0.8676:0.0:0.1324	.|.	.|1743;1744	.|Q2LD37-2;Q2LD37	.|.;K1109_HUMAN	W|M	317|1744	.|ENSP00000264501:T1744M;ENSP00000373390:T1744M;ENSP00000389925:T1744M	.|ENSP00000264501:T1744M	R|T	+|+	1|2	2|0	KIAA1109|KIAA1109	123387334|123387334	0.922000|0.922000	0.31269|0.31269	0.999000|0.999000	0.59377|0.59377	0.981000|0.981000	0.71138|0.71138	1.958000|1.958000	0.40402|0.40402	1.586000|1.586000	0.49944|0.49944	0.650000|0.650000	0.86243|0.86243	CGG|ACG		0.378	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		Missense_Mutation
TAS2R1	50834	broad.mit.edu	37	5	9629601	9629601	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr5:9629601C>A	ENST00000382492.2	-	1	862	c.544G>T	c.(544-546)Gag>Tag	p.E182*	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	182					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.E182*(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						ACTGAGAACTCAGCAACAAAA	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	5											74.0	82.0	79.0					5																	9629601		2203	4300	6503	9682601	SO:0001587	stop_gained	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.544G>T	5.37:g.9629601C>A	ENSP00000371932:p.Glu182*	Unknown		x	x	x	9682601	Q646G8	Nonsense_Mutation	SNP	ENST00000382492.2	37	CCDS3876.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	27.5	4.832636	0.91036	.	.	ENSG00000169777	ENST00000382492	.	.	.	5.4	3.59	0.41128	.	1.874700	0.02882	N	0.132952	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8491	0.35188	0.0:0.7663:0.1514:0.0823	.	.	.	.	X	182	.	.	E	-	1	0	TAS2R1	9682601	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.514000	0.22786	0.808000	0.34231	0.655000	0.94253	GAG		0.428	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			Nonsense_Mutation
NADK2	133686	broad.mit.edu	37	5	36197738	36197738	+	Silent	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr5:36197738G>A	ENST00000381937.4	-	11	1094	c.1095C>T	c.(1093-1095)ctC>ctT	p.L365L	NADK2_ENST00000514504.1_Silent_p.L333L|NADK2_ENST00000282512.3_Silent_p.L202L|NADK2_ENST00000506945.1_Silent_p.L224L|NADK2_ENST00000397338.1_Silent_p.L202L|NADK2_ENST00000511613.1_5'UTR	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	365					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)	p.L202L(1)									CCGGACTGTAGAGCAGTGATT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	5											74.0	69.0	71.0					5																	36197738		2203	4299	6502	36233495	SO:0001819	synonymous_variant	133686			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.1095C>T	5.37:g.36197738G>A		Unknown		x	x	x	36233495	B5MC93|Q6UTX5|Q96NM0	Silent	SNP	ENST00000381937.4	37	CCDS47197.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	9.221	1.033298	0.19590	.	.	ENSG00000152620	ENST00000502355	.	.	.	5.44	-1.58	0.08479	.	.	.	.	.	T	0.55226	0.1907	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51284	-0.8725	4	.	.	.	-11.2326	9.8514	0.41059	0.0598:0.4919:0.3473:0.101	.	.	.	.	F	60	.	.	S	-	2	0	NADKD1	36233495	0.911000	0.30947	0.977000	0.42913	0.966000	0.64601	-0.200000	0.09478	-0.181000	0.10619	0.591000	0.81541	TCT		0.343	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1	NM_153013		Silent
PCDHB4	56131	broad.mit.edu	37	5	140503174	140503174	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr5:140503174G>A	ENST00000194152.1	+	1	1594	c.1594G>A	c.(1594-1596)Gcc>Acc	p.A532T	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	532	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A532T(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGCGTGGGCGCCTCAGACCG	0.667																																																1	Substitution - Missense(1)	ovary(1)	5											58.0	65.0	63.0					5																	140503174		2203	4298	6501	140483358	SO:0001583	missense	56131			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1594G>A	5.37:g.140503174G>A	ENSP00000194152:p.Ala532Thr	Unknown		x	x	x	140483358	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497869	0.85069	.	.	ENSG00000081818	ENST00000194152	T	0.75589	-0.95	3.88	3.88	0.44766	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.89836	0.6830	H	0.95712	3.71	0.53688	D	0.999978	D	0.89917	1.0	D	0.79784	0.993	D	0.93230	0.6616	9	0.87932	D	0	.	16.0646	0.80863	0.0:0.0:1.0:0.0	.	532	Q9Y5E5	PCDB4_HUMAN	T	532	ENSP00000194152:A532T	ENSP00000194152:A532T	A	+	1	0	PCDHB4	140483358	1.000000	0.71417	0.986000	0.45419	0.829000	0.46940	9.415000	0.97375	2.189000	0.69895	0.485000	0.47835	GCC		0.667	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		Missense_Mutation
CPLX2	10814	broad.mit.edu	37	5	175306958	175306958	+	Silent	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr5:175306958C>T	ENST00000359546.4	+	5	958	c.315C>T	c.(313-315)tgC>tgT	p.C105C	CPLX2_ENST00000515094.1_Silent_p.C105C|CPLX2_ENST00000393745.3_Silent_p.C105C	NM_001008220.1|NM_006650.3	NP_001008221.1|NP_006641.1	Q6PUV4	CPLX2_HUMAN	complexin 2	105					cell differentiation (GO:0030154)|mast cell degranulation (GO:0043303)|nervous system development (GO:0007399)|positive regulation of synaptic plasticity (GO:0031915)|regulation of exocytosis (GO:0017157)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking involved in exocytosis (GO:0006904)	dendrite (GO:0030425)|mast cell granule (GO:0042629)|neuronal cell body (GO:0043025)|synapse (GO:0045202)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin II complex (GO:0070033)|synaptobrevin 2-SNAP-25-syntaxin-3-complexin complex (GO:0070554)		p.C105C(1)		endometrium(3)|kidney(2)|lung(3)|ovary(2)	10	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CTGCGGGCTGCGGGGACGAGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	5											36.0	39.0	38.0					5																	175306958		2203	4300	6503	175239564	SO:0001819	synonymous_variant	10814			U35100	CCDS4396.1	5q35.2	2008-05-23			ENSG00000145920	ENSG00000145920			2310	protein-coding gene	gene with protein product		605033				7553862, 16162394	Standard	XM_005265798		Approved	CPX-2, DKFZp547D155	uc003mdf.1	Q6PUV4	OTTHUMG00000130665	ENST00000359546.4:c.315C>T	5.37:g.175306958C>T		Unknown		x	x	x	175239564	B2RAG2|O09056|Q13329|Q28184|Q52M15|Q64386	Silent	SNP	ENST00000359546.4	37	CCDS4396.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	8.874	0.949997	0.18431	.	.	ENSG00000145920	ENST00000393746	.	.	.	5.14	0.437	0.16555	.	.	.	.	.	T	0.60945	0.2308	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60188	-0.7312	5	0.72032	D	0.01	.	7.5687	0.27894	0.0:0.2746:0.0:0.7254	.	.	.	.	W	87	.	ENSP00000377347:R87W	R	+	1	2	CPLX2	175239564	0.140000	0.22579	1.000000	0.80357	0.961000	0.63080	-0.524000	0.06222	0.125000	0.18397	0.454000	0.30748	CGG		0.627	CPLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253157.2			Silent
TAP2	6891	broad.mit.edu	37	6	32803463	32803463	+	Silent	SNP	G	G	T			TCGA-24-1434-01	TCGA-24-1434-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr6:32803463G>T	ENST00000452392.2	-	4	869	c.696C>A	c.(694-696)tcC>tcA	p.S232S	TAP2_ENST00000374897.2_Silent_p.S232S|TAP2_ENST00000374899.4_Silent_p.S232S|TAP2_ENST00000485701.1_5'Flank			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.S232S(1)								Vitamin E(DB00163)	GGCGCAGCAGGGAGGAGAAAA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	6											85.0	81.0	83.0					6																	32803463		1508	2708	4216	32911441	SO:0001819	synonymous_variant	6891			M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.696C>A	6.37:g.32803463G>T		Somatic		x	x	x	32911441	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000452392.2	37		SNP	43	Broad																																																																																				0.592	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000361828.1	NM_000544		Silent
TTBK1	84630	broad.mit.edu	37	6	43251672	43251672	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr6:43251672C>G	ENST00000259750.4	+	14	3277	c.3194C>G	c.(3193-3195)aCg>aGg	p.T1065R		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1065					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T1065R(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GAGGAGGACACGGGCTCGGAG	0.667																																																1	Substitution - Missense(1)	ovary(1)	6											24.0	23.0	24.0					6																	43251672		2174	4242	6416	43359650	SO:0001583	missense	84630			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.3194C>G	6.37:g.43251672C>G	ENSP00000259750:p.Thr1065Arg	Unknown		x	x	x	43359650	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832358	0.50845	.	.	ENSG00000146216	ENST00000259750	T	0.58060	0.36	5.24	5.24	0.73138	.	0.361849	0.26804	N	0.022414	T	0.56277	0.1974	L	0.58101	1.795	0.80722	D	1	D	0.55800	0.973	P	0.54401	0.751	T	0.61352	-0.7080	10	0.72032	D	0.01	.	17.5926	0.88001	0.0:1.0:0.0:0.0	.	1065	Q5TCY1	TTBK1_HUMAN	R	1065	ENSP00000259750:T1065R	ENSP00000259750:T1065R	T	+	2	0	TTBK1	43359650	1.000000	0.71417	0.930000	0.37139	0.104000	0.19210	7.464000	0.80887	2.445000	0.82738	0.455000	0.32223	ACG		0.667	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			Missense_Mutation
EPHA7	2045	broad.mit.edu	37	6	94120434	94120434	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1434-01	TCGA-24-1434-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr6:94120434C>A	ENST00000369303.4	-	3	801	c.617G>T	c.(616-618)tGg>tTg	p.W206L	EPHA7_ENST00000369297.1_Missense_Mutation_p.W206L	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	206	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.W206L(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		AATAATGGACCAGCACTTCTT	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											80.0	85.0	83.0					6																	94120434		2203	4300	6503	94177155	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.617G>T	6.37:g.94120434C>A	ENSP00000358309:p.Trp206Leu	Somatic		x	x	x	94177155	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	14.17	2.457004	0.43634	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.70749	-0.51;4.52	5.66	5.66	0.87406	Tyrosine-protein kinase, receptor class V, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.26846	0.0657	N	0.00347	-1.61	0.49798	D	0.999825	P;B;B;B	0.36535	0.557;0.001;0.002;0.001	B;B;B;B	0.32864	0.154;0.004;0.005;0.002	T	0.54957	-0.8215	10	0.56958	D	0.05	.	20.1041	0.97884	0.0:1.0:0.0:0.0	.	206;206;206;206	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	L	206	ENSP00000358309:W206L;ENSP00000358303:W206L	ENSP00000358303:W206L	W	-	2	0	EPHA7	94177155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.948000	0.56660	2.826000	0.97356	0.655000	0.94253	TGG		0.438	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			Missense_Mutation
AP5Z1	9907	broad.mit.edu	37	7	4823018	4823018	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr7:4823018G>C	ENST00000348624.4	+	4	532	c.438G>C	c.(436-438)gaG>gaC	p.E146D	AP5Z1_ENST00000401897.1_Missense_Mutation_p.E146D	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	146					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E857D(1)									GGCAGCCTGAGGGACCCAGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	7											34.0	45.0	41.0					7																	4823018		2051	4203	6254	4789544	SO:0001583	missense	9907			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.438G>C	7.37:g.4823018G>C	ENSP00000297562:p.Glu146Asp	Unknown		x	x	x	4789544	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823404	0.32237	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.63913	-0.07;0.87	4.9	3.05	0.35203	.	0.068454	0.64402	D	0.000006	T	0.56187	0.1968	M	0.62723	1.935	0.44241	D	0.997088	B	0.29805	0.257	B	0.33339	0.162	T	0.49652	-0.8917	10	0.37606	T	0.19	.	7.3524	0.26700	0.0924:0.1699:0.7377:0.0	.	146	O43299	K0415_HUMAN	D	146	ENSP00000297562:E146D;ENSP00000384980:E146D	ENSP00000297562:E146D	E	+	3	2	KIAA0415	4789544	1.000000	0.71417	0.978000	0.43139	0.513000	0.34164	1.647000	0.37260	0.455000	0.26910	0.462000	0.41574	GAG		0.672	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1			Missense_Mutation
ZAN	7455	broad.mit.edu	37	7	100364276	100364276	+	RNA	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr7:100364276C>T	ENST00000348028.3	+	0	4764				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1533G(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GTATCTATGGCTGCCATGCCC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	7											29.0	31.0	30.0					7																	100364276		2045	4180	6225	100202212			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100364276C>T		Unknown		x	x	x	100202212	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37		SNP	28	Broad																																																																																				0.592	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		Silent
KMT2E	55904	broad.mit.edu	37	7	104752974	104752974	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1434-01	TCGA-24-1434-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr7:104752974C>G	ENST00000311117.3	+	27	5316	c.4771C>G	c.(4771-4773)Cct>Gct	p.P1591A	KMT2E_ENST00000257745.4_Missense_Mutation_p.P1591A|KMT2E_ENST00000334877.4_Missense_Mutation_p.P1549A|SRPK2_ENST00000493638.1_Intron	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1591	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.P1591A(1)									TCAAGCACTTCCTGGCACCAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											138.0	128.0	131.0					7																	104752974		2203	4300	6503	104540210	SO:0001583	missense	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4771C>G	7.37:g.104752974C>G	ENSP00000312379:p.Pro1591Ala	Somatic		x	x	x	104540210	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	3.422	-0.117949	0.06838	.	.	ENSG00000005483	ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.92249	-3.0;-2.86;-3.0	3.34	3.34	0.38264	.	0.320112	0.22346	N	0.061262	D	0.85208	0.5644	N	0.24115	0.695	0.80722	D	1	B;B	0.19935	0.04;0.005	B;B	0.20384	0.029;0.003	T	0.81254	-0.1016	10	0.36615	T	0.2	.	11.9271	0.52825	0.0:0.823:0.177:0.0	.	1511;1591	F8W6H1;Q8IZD2	.;MLL5_HUMAN	A	1591;1549;1511;1591	ENSP00000312379:P1591A;ENSP00000335599:P1549A;ENSP00000257745:P1591A	ENSP00000257745:P1591A	P	+	1	0	MLL5	104540210	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.557000	0.36299	1.578000	0.49821	0.305000	0.20034	CCT		0.468	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			Missense_Mutation
SGK223	157285	broad.mit.edu	37	8	8234804	8234804	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr8:8234804G>A	ENST00000520004.1	-	3	1379	c.1115C>T	c.(1114-1116)cCa>cTa	p.P372L	SGK223_ENST00000330777.4_Missense_Mutation_p.P372L			Q86YV5	SG223_HUMAN		374							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.P372L(1)									CTGCTTCTCTGGGGCAGGTTC	0.692																																					GBM(34;731 755 10259 33573 33867)											1	Substitution - Missense(1)	ovary(1)	8											14.0	18.0	17.0					8																	8234804		1893	4082	5975	8272214	SO:0001583	missense	157285																														ENST00000520004.1:c.1115C>T	8.37:g.8234804G>A	ENSP00000428054:p.Pro372Leu	Unknown		x	x	x	8272214	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	1.560	-0.536956	0.04082	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.55052	0.54;0.54	4.5	-1.77	0.07982	.	0.624373	0.13414	N	0.389634	T	0.26666	0.0652	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15235	-1.0444	10	0.87932	D	0	.	0.8275	0.01124	0.4052:0.1226:0.222:0.2503	.	372	Q86YV5	SG223_HUMAN	L	372	ENSP00000330930:P372L;ENSP00000428054:P372L	ENSP00000330930:P372L	P	-	2	0	AC068353.1	8272214	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-0.503000	0.06383	-0.243000	0.09653	0.655000	0.94253	CCA		0.692	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1			Missense_Mutation
ZNF169	169841	broad.mit.edu	37	9	97062480	97062480	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr9:97062480C>T	ENST00000395395.2	+	5	730	c.640C>T	c.(640-642)Cgt>Tgt	p.R214C	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R214C(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				AGCAGTCATACGTGGAAACTA	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											63.0	57.0	59.0					9																	97062480		2203	4300	6503	96102301	SO:0001583	missense	169841			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.640C>T	9.37:g.97062480C>T	ENSP00000378792:p.Arg214Cys	Unknown		x	x	x	96102301	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	ENST00000395395.2	37	CCDS6709.2	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	8.441	0.850743	0.17034	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.07444	3.19	2.59	0.293	0.15742	.	.	.	.	.	T	0.01905	0.0060	N	0.00321	-1.65	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45220	-0.9276	9	0.31617	T	0.26	.	5.2952	0.15749	0.0:0.3123:0.0:0.6877	.	214	Q14929	ZN169_HUMAN	C	214;23	ENSP00000378792:R214C	ENSP00000340711:R23C	R	+	1	0	ZNF169	96102301	0.000000	0.05858	0.000000	0.03702	0.436000	0.31835	-0.048000	0.11944	0.056000	0.16144	-0.438000	0.05819	CGT		0.512	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7573995	7573995	+	Frame_Shift_Del	DEL	C	C	-			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chr17:7573995delC	ENST00000269305.4	-	10	1221	c.1032delG	c.(1030-1032)ctgfs	p.L344fs	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Frame_Shift_Del_p.L344fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	344	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		L -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|L -> R (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L344fs*23(2)|p.L344fs*22(1)|p.?(1)|p.R342_N345delRELN(1)|p.N345fs*25(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCCTCATTCAGCTCTCGGA	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	15	Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(1)|Deletion - In frame(1)	bone(4)|upper_aerodigestive_tract(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	17											64.0	49.0	54.0					17																	7573995		2203	4300	6503	7514720	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1032delG	17.37:g.7573995delC	ENSP00000269305:p.Leu344fs	Unknown		Capture	Illumina GAIIx	Phase_I	7514720	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	29	Broad																																																																																				0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
KDM5C	8242	broad.mit.edu	37	X	53239653	53239654	+	Frame_Shift_Ins	INS	-	-	A			TCGA-24-1434-01	TCGA-24-1434-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1434-01	TCGA-24-1434-10	g.chrX:53239653_53239654insA	ENST00000375401.3	-	12	2220_2221	c.1688_1689insT	c.(1687-1689)ctcfs	p.L563fs	KDM5C_ENST00000452825.3_Frame_Shift_Ins_p.L496fs|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000375379.3_Frame_Shift_Ins_p.L563fs|KDM5C_ENST00000404049.3_Frame_Shift_Ins_p.L562fs|KDM5C_ENST00000465402.1_5'UTR|KDM5C_ENST00000375383.3_Frame_Shift_Ins_p.L522fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	563	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.L564fs*58(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GTTGGTGCAGGAGGTCAGGCTG	0.53			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Insertion - Frameshift(1)	ovary(1)	X																																								53256379	SO:0001589	frameshift_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1689dupT	X.37:g.53239654_53239654dupA	ENSP00000364550:p.Leu563fs	Unknown		Capture	Illumina GAIIx	Phase_I	53256378	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Ins	INS	ENST00000375401.3	37	CCDS14351.1	INS	41	Broad																																																																																				0.530	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		Frame_Shift_Ins
