#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
LYPLA2	11313	broad.mit.edu	37	1	24121071	24121071	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr1:24121071T>C	ENST00000374514.3	+	9	933	c.626T>C	c.(625-627)aTg>aCg	p.M209T	LYPLA2_ENST00000374501.1_Missense_Mutation_p.M142T|LYPLA2_ENST00000374505.2_3'UTR|LYPLA2_ENST00000495365.1_3'UTR|LYPLA2_ENST00000400061.1_3'UTR|LYPLA2_ENST00000374503.3_Silent_p.H167H|LYPLA2_ENST00000374502.3_3'UTR	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II	209					fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)	p.M209T(1)		endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		CCGGGTGTCATGCACAGCTCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	70.0	73.0					1																	24121071		2203	4300	6503	23993658	SO:0001583	missense	11313			AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961	ENST00000374514.3:c.626T>C	1.37:g.24121071T>C	ENSP00000363638:p.Met209Thr	Unknown		x	x	x	23993658	Q7Z4Z2	Missense_Mutation	SNP	ENST00000374514.3	37	CCDS241.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	2.206	-0.381948	0.04966	.	.	ENSG00000011009	ENST00000374514;ENST00000374506;ENST00000374501	T;T	0.20881	2.04;2.04	4.9	4.9	0.64082	Phospholipase/carboxylesterase/thioesterase (1);	0.131358	0.64402	D	0.000002	T	0.16342	0.0393	N	0.21142	0.635	0.80722	D	1	B;B	0.25904	0.043;0.137	B;B	0.32805	0.153;0.062	T	0.08146	-1.0736	10	0.15066	T	0.55	.	14.5106	0.67784	0.0:0.0:0.0:1.0	.	186;209	E9PH41;O95372	.;LYPA2_HUMAN	T	209;186;142	ENSP00000363638:M209T;ENSP00000363625:M142T	ENSP00000363625:M142T	M	+	2	0	LYPLA2	23993658	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.550000	0.45811	1.840000	0.53500	0.379000	0.24179	ATG		0.612	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008245.1			Missense_Mutation
CD1B	910	broad.mit.edu	37	1	158298760	158298760	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr1:158298760G>A	ENST00000368168.3	-	5	1038	c.931C>T	c.(931-933)Cct>Tct	p.P311S		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	311					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.P311S(1)		breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					AGCAAGGAAGGCACTATTATT	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	106.0	109.0					1																	158298760		2203	4300	6503	156565384	SO:0001583	missense	910			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.931C>T	1.37:g.158298760G>A	ENSP00000357150:p.Pro311Ser	Unknown		x	x	x	156565384	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	37	CCDS1176.1	SNP	42	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.053|8.053	0.766323|0.766323	0.15983|0.15983	.|.	.|.	ENSG00000158485|ENSG00000158485	ENST00000451207|ENST00000368168	.|T	.|0.01272	.|5.07	4.05|4.05	1.93|1.93	0.25924|0.25924	.|.	.|0.724348	.|0.11957	.|N	.|0.513139	T|T	0.01061|0.01061	0.0035|0.0035	L|L	0.33668|0.33668	1.02|1.02	0.09310|0.09310	N|N	1|1	.|B;D	.|0.89917	.|0.007;1.0	.|B;D	.|0.64321	.|0.007;0.924	T|T	0.53578|0.53578	-0.8419|-0.8419	5|10	.|0.14656	.|T	.|0.56	-6.4051|-6.4051	8.3298|8.3298	0.32180|0.32180	0.0:0.0:0.57:0.43|0.0:0.0:0.57:0.43	.|.	.|311;256	.|P29016;P29016-2	.|CD1B_HUMAN;.	V|S	223|311	.|ENSP00000357150:P311S	.|ENSP00000357150:P311S	A|P	-|-	2|1	0|0	CD1B|CD1B	156565384|156565384	0.000000|0.000000	0.05858|0.05858	0.365000|0.365000	0.25901|0.25901	0.130000|0.130000	0.20726|0.20726	0.302000|0.302000	0.19192|0.19192	1.011000|1.011000	0.39340|0.39340	0.655000|0.655000	0.94253|0.94253	GCC|CCT		0.418	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764		Missense_Mutation
DPT	1805	broad.mit.edu	37	1	168683529	168683529	+	Missense_Mutation	SNP	C	C	G	rs143369045	byFrequency	TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr1:168683529C>G	ENST00000367817.3	-	2	450	c.361G>C	c.(361-363)Gag>Cag	p.E121Q		NM_001937.4	NP_001928.2	Q07507	DERM_HUMAN	dermatopontin	121	2 X 53-55 AA tandem repeats.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].				cell adhesion (GO:0007155)|collagen fibril organization (GO:0030199)|negative regulation of cell proliferation (GO:0008285)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.E121Q(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)	12	all_hematologic(923;0.208)					AGCACTGACTCGAAGTAGCGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	78.0	82.0					1																	168683529		2203	4300	6503	166950153	SO:0001583	missense	1805			BC033736	CCDS1275.1	1q12-q23	2008-02-05			ENSG00000143196	ENSG00000143196			3011	protein-coding gene	gene with protein product		125597				8104875	Standard	NM_001937		Approved		uc001gfp.3	Q07507	OTTHUMG00000034554	ENST00000367817.3:c.361G>C	1.37:g.168683529C>G	ENSP00000356791:p.Glu121Gln	Unknown		x	x	x	166950153	A8K981|Q8N4R2|Q9UIX8	Missense_Mutation	SNP	ENST00000367817.3	37	CCDS1275.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445989	0.84101	.	.	ENSG00000143196	ENST00000367817	T	0.44881	0.91	5.81	5.81	0.92471	.	0.100428	0.64402	D	0.000003	T	0.39545	0.1082	L	0.53249	1.67	0.42268	D	0.992047	D	0.53619	0.961	P	0.53401	0.725	T	0.12167	-1.0558	9	0.26408	T	0.33	-4.618	15.0533	0.71891	0.0:0.8573:0.1427:0.0	.	121	Q07507	DERM_HUMAN	Q	121	ENSP00000356791:E121Q	ENSP00000356791:E121Q	E	-	1	0	DPT	166950153	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.248000	0.58760	2.746000	0.94184	0.655000	0.94253	GAG		0.542	DPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083618.1	NM_001937		Missense_Mutation
HMCN1	83872	broad.mit.edu	37	1	185833716	185833716	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr1:185833716C>A	ENST00000271588.4	+	3	683	c.454C>A	c.(454-456)Ctc>Atc	p.L152I	HMCN1_ENST00000367492.2_Missense_Mutation_p.L152I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	152	VWFA.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.L152I(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGATTACCGGCTCACCCATGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	97.0	100.0					1																	185833716		2203	4300	6503	184100339	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.454C>A	1.37:g.185833716C>A	ENSP00000271588:p.Leu152Ile	Unknown		x	x	x	184100339	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626180	0.87560	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.97620	-4.46;-4.46	5.43	4.5	0.54988	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.98343	0.9450	M	0.85542	2.76	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.98368	1.0552	10	0.51188	T	0.08	.	14.5537	0.68086	0.0:0.9284:0.0:0.0715	.	152	Q96RW7	HMCN1_HUMAN	I	152	ENSP00000271588:L152I;ENSP00000356462:L152I	ENSP00000271588:L152I	L	+	1	0	HMCN1	184100339	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	4.938000	0.63519	2.533000	0.85409	0.655000	0.94253	CTC		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Missense_Mutation
DENND1B	163486	broad.mit.edu	37	1	197481075	197481075	+	IGR	SNP	C	C	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr1:197481075C>T								CRB1 (33490 upstream) : DENND1B (40309 downstream)														p.?(1)									AGAAGATAACCTGAAGAAAAA	0.368																																																1	Unknown(1)	ovary(1)	1											55.0	56.0	55.0					1																	197481075		2203	4297	6500	195747698	SO:0001628	intergenic_variant	163486																															1.37:g.197481075C>T		Unknown		x	x	x	195747698		Splice_Site_SNP	SNP		37		SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	13.93	2.382758	0.42207	.	.	ENSG00000213047	ENST00000391979;ENST00000542760;ENST00000450419	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.844	0.96702	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND1B	195747698	1.000000	0.71417	0.630000	0.29268	0.110000	0.19582	6.982000	0.76173	2.690000	0.91761	0.650000	0.86243	.	0	0.368									Splice_Site_SNP
SUV39H2	79723	broad.mit.edu	37	10	14939160	14939160	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1466-01	TCGA-24-1466-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr10:14939160C>G	ENST00000354919.6	+	3	493	c.493C>G	c.(493-495)Cca>Gca	p.P165A	SUV39H2_ENST00000378325.3_Intron|SUV39H2_ENST00000313519.5_Missense_Mutation_p.P105A	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	165					cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.P105A(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						TTTAGAGGGCCCACCTTCAGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	10											94.0	92.0	93.0					10																	14939160		2203	4300	6503	14979166	SO:0001583	missense	79723			AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	ENST00000354919.6:c.493C>G	10.37:g.14939160C>G	ENSP00000346997:p.Pro165Ala	Somatic		x	x	x	14979166	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	SNP	ENST00000354919.6	37	CCDS53494.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663313	0.67700	.	.	ENSG00000152455	ENST00000354919;ENST00000313519;ENST00000420416	D;D;D	0.90504	-2.68;-2.68;-2.68	5.76	5.76	0.90799	Pre-SET domain (1);	0.000000	0.85682	D	0.000000	D	0.91436	0.7297	M	0.75150	2.29	0.80722	D	1	P	0.49185	0.92	P	0.45794	0.493	D	0.88900	0.3352	10	0.18276	T	0.48	.	19.3309	0.94288	0.0:1.0:0.0:0.0	.	165	Q9H5I1	SUV92_HUMAN	A	165;105;105	ENSP00000346997:P165A;ENSP00000319208:P105A;ENSP00000392201:P105A	ENSP00000319208:P105A	P	+	1	0	SUV39H2	14979166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.674000	0.83992	2.880000	0.98712	0.650000	0.86243	CCA		0.378	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670		Missense_Mutation
SORBS1	10580	broad.mit.edu	37	10	97096845	97096845	+	Silent	SNP	T	T	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr10:97096845T>A	ENST00000361941.3	-	28	3098	c.3072A>T	c.(3070-3072)tcA>tcT	p.S1024S	SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000371227.4_Silent_p.S978S|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000277982.5_Intron|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000371246.2_Intron|SORBS1_ENST00000371247.2_Silent_p.S1024S	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TGGCCCTTGGTGACAAGGCGA	0.607																																																0			10											78.0	70.0	73.0					10																	97096845		2203	4300	6503	97086835	SO:0001819	synonymous_variant	10580			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3072A>T	10.37:g.97096845T>A		Unknown		x	x	x	97086835		Silent	SNP	ENST00000361941.3	37	CCDS31255.1	SNP	59	Broad																																																																																				0.607	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1			Silent
CDON	50937	broad.mit.edu	37	11	125893310	125893310	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr11:125893310G>C	ENST00000392693.3	-	2	189	c.62C>G	c.(61-63)tCt>tGt	p.S21C	CDON_ENST00000263577.7_Missense_Mutation_p.S21C	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	21					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S21C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ACTCACAGAAGAGCACAGAAT	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											138.0	135.0	136.0					11																	125893310		2201	4299	6500	125398520	SO:0001583	missense	50937			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.62C>G	11.37:g.125893310G>C	ENSP00000376458:p.Ser21Cys	Unknown		x	x	x	125398520	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.99	2.400650	0.42613	.	.	ENSG00000064309	ENST00000392693;ENST00000263577;ENST00000531586;ENST00000527967;ENST00000534818	T;T;T;T;T	0.78364	-0.53;-0.54;0.07;-0.31;-1.17	5.65	5.65	0.86999	.	0.255981	0.28057	N	0.016775	T	0.73489	0.3593	N	0.25380	0.74	0.19575	N	0.999964	P;P;D	0.55385	0.938;0.951;0.971	P;P;P	0.49752	0.541;0.518;0.621	T	0.69540	-0.5118	10	0.62326	D	0.03	-8.4027	13.6395	0.62241	0.075:0.0:0.925:0.0	.	21;21;21	E9PRD8;Q4KMG0;Q4KMG0-2	.;CDON_HUMAN;.	C	21	ENSP00000376458:S21C;ENSP00000263577:S21C;ENSP00000434212:S21C;ENSP00000436940:S21C;ENSP00000437176:S21C	ENSP00000263577:S21C	S	-	2	0	CDON	125398520	1.000000	0.71417	0.995000	0.50966	0.539000	0.34962	6.507000	0.73717	2.656000	0.90262	0.591000	0.81541	TCT		0.423	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952		Missense_Mutation
NECAP1	25977	broad.mit.edu	37	12	8245638	8245638	+	Silent	SNP	A	A	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr12:8245638A>G	ENST00000339754.5	+	6	741	c.663A>G	c.(661-663)ggA>ggG	p.G221G		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	221					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)		p.G221G(1)		cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		CTAACCATGGAGGCAGTGATG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	12											158.0	145.0	149.0					12																	8245638		2203	4300	6503	8136905	SO:0001819	synonymous_variant	25977			AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.663A>G	12.37:g.8245638A>G		Unknown		x	x	x	8136905	Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Silent	SNP	ENST00000339754.5	37	CCDS8589.1	SNP	11	Broad																																																																																				0.443	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400244.1	NM_015509		Silent
SCN8A	6334	broad.mit.edu	37	12	52184247	52184247	+	Silent	SNP	G	G	C			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr12:52184247G>C	ENST00000354534.6	+	25	4663	c.4485G>C	c.(4483-4485)ctG>ctC	p.L1495L	SCN8A_ENST00000545061.1_Silent_p.L1454L	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1495					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.L1495L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TGAAAAAGCTGGGCTCAAAGA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	12											56.0	57.0	57.0					12																	52184247		2032	4224	6256	50470514	SO:0001819	synonymous_variant	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.4485G>C	12.37:g.52184247G>C		Unknown		x	x	x	50470514	B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	ENST00000354534.6	37	CCDS44891.1	SNP	47	Broad																																																																																				0.458	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		Silent
NBEA	26960	broad.mit.edu	37	13	35615220	35615220	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr13:35615220C>T	ENST00000400445.3	+	2	979	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	NBEA_ENST00000310336.4_Missense_Mutation_p.R149W|NBEA_ENST00000540320.1_Missense_Mutation_p.R149W|NBEA_ENST00000379939.2_Missense_Mutation_p.R149W	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	149					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R149W(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AAAAAGTGTTCGGAATTTACA	0.403																																																1	Substitution - Missense(1)	ovary(1)	13											92.0	85.0	87.0					13																	35615220		1890	4150	6040	34513220	SO:0001583	missense	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.445C>T	13.37:g.35615220C>T	ENSP00000383295:p.Arg149Trp	Unknown		x	x	x	34513220	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.092595	0.94149	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000001	T	0.75664	0.3880	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78663	-0.2116	10	0.72032	D	0.01	.	19.2626	0.93974	0.0:1.0:0.0:0.0	.	149	Q5T321	.	W	149	ENSP00000440951:R149W;ENSP00000383295:R149W;ENSP00000369271:R149W;ENSP00000308534:R149W	ENSP00000308534:R149W	R	+	1	2	NBEA	34513220	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.544000	0.85801	0.585000	0.79938	CGG		0.403	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		Missense_Mutation
LRRK1	79705	broad.mit.edu	37	15	101593134	101593134	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr15:101593134C>G	ENST00000388948.3	+	25	4056	c.3697C>G	c.(3697-3699)Ctg>Gtg	p.L1233V	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Missense_Mutation_p.L1230V	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.L1245V(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CAGGCTCTTCCTGGAGAACAG	0.692																																																1	Substitution - Missense(1)	ovary(1)	15											20.0	29.0	26.0					15																	101593134		2177	4272	6449	99410657	SO:0001583	missense	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3697C>G	15.37:g.101593134C>G	ENSP00000373600:p.Leu1233Val	Unknown		x	x	x	99410657		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096011	0.56075	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.75154	-0.89;-0.91	5.08	0.989	0.19802	Protein kinase-like domain (1);	0.180333	0.37219	N	0.002200	T	0.64438	0.2598	N	0.19112	0.55	0.32360	N	0.557289	P	0.51351	0.944	P	0.49708	0.62	T	0.70313	-0.4906	10	0.54805	T	0.06	.	10.2613	0.43427	0.0:0.5954:0.0:0.4046	.	1233	Q38SD2	LRRK1_HUMAN	V	1233;1230	ENSP00000373600:L1233V;ENSP00000284395:L1230V	ENSP00000284395:L1230V	L	+	1	2	LRRK1	99410657	0.987000	0.35691	1.000000	0.80357	0.883000	0.51084	0.383000	0.20651	0.251000	0.21505	0.644000	0.83932	CTG		0.692	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		Missense_Mutation
PALB2	79728	broad.mit.edu	37	16	23646411	23646411	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1466-01	TCGA-24-1466-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr16:23646411T>C	ENST00000261584.4	-	4	1608	c.1456A>G	c.(1456-1458)Aaa>Gaa	p.K486E		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	486	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K486E(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GAGCTGACTTTAGTTAATGAG	0.453			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	1	Substitution - Missense(1)	ovary(1)	16											128.0	129.0	128.0					16																	23646411		2197	4300	6497	23553912	SO:0001583	missense	79728				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1456A>G	16.37:g.23646411T>C	ENSP00000261584:p.Lys486Glu	Somatic		x	x	x	23553912	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	1.819	-0.472741	0.04445	.	.	ENSG00000083093	ENST00000261584	T	0.11604	2.76	5.67	3.73	0.42828	.	0.368370	0.26338	N	0.024942	T	0.02970	0.0088	N	0.01668	-0.77	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44513	-0.9323	10	0.02654	T	1	-6.3112	8.445	0.32836	0.0:0.8171:0.0:0.1829	.	486	Q86YC2	PALB2_HUMAN	E	486	ENSP00000261584:K486E	ENSP00000261584:K486E	K	-	1	0	PALB2	23553912	0.002000	0.14202	0.033000	0.17914	0.108000	0.19459	0.657000	0.24963	0.854000	0.35336	-0.242000	0.12053	AAA		0.453	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675		Missense_Mutation
SNX20	124460	broad.mit.edu	37	16	50711383	50711383	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr16:50711383A>G	ENST00000330943.4	-	2	226	c.55T>C	c.(55-57)Tgc>Cgc	p.C19R	SNX20_ENST00000300590.3_Missense_Mutation_p.C19R|SNX20_ENST00000423026.2_Missense_Mutation_p.C19R	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	19					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)	p.C19R(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						CTTGCCGTGCACTGGGTTATG	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											83.0	80.0	81.0					16																	50711383		2198	4300	6498	49268884	SO:0001583	missense	124460			AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.55T>C	16.37:g.50711383A>G	ENSP00000332062:p.Cys19Arg	Unknown		x	x	x	49268884	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	37	CCDS10745.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	13.34	2.207575	0.39003	.	.	ENSG00000167208	ENST00000300590;ENST00000423026;ENST00000330943;ENST00000413750	T;T;T	0.45276	0.9;0.94;1.57	4.2	-2.5	0.06384	.	0.860582	0.10206	N	0.702694	T	0.26268	0.0641	L	0.27053	0.805	0.19300	N	0.999976	B;B;B	0.29432	0.1;0.244;0.009	B;B;B	0.26517	0.027;0.07;0.016	T	0.19549	-1.0302	10	0.59425	D	0.04	-10.0974	8.2121	0.31490	0.2818:0.624:0.0942:0.0	.	19;19;19	Q7Z614-3;Q7Z614;Q7Z614-4	.;SNX20_HUMAN;.	R	19	ENSP00000300590:C19R;ENSP00000388875:C19R;ENSP00000332062:C19R	ENSP00000300590:C19R	C	-	1	0	SNX20	49268884	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-1.557000	0.02166	-0.502000	0.06596	-0.648000	0.03929	TGC		0.632	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337		Missense_Mutation
MMP2	4313	broad.mit.edu	37	16	55523684	55523684	+	Silent	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr16:55523684G>A	ENST00000219070.4	+	7	1637	c.1128G>A	c.(1126-1128)gcG>gcA	p.A376A	MMP2_ENST00000543485.1_Silent_p.A300A|MMP2_ENST00000437642.2_Silent_p.A326A|MMP2_ENST00000570308.1_Silent_p.A300A	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	376	Collagen-binding.|Fibronectin type-II 3. {ECO:0000255|PROSITE-ProRule:PRU00479}.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.A376A(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	TGTGGTGTGCGACCACAGCCA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	16											110.0	91.0	98.0					16																	55523684		2198	4300	6498	54081185	SO:0001819	synonymous_variant	4313				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1128G>A	16.37:g.55523684G>A		Unknown		x	x	x	54081185	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	ENST00000219070.4	37	CCDS10752.1	SNP	37	Broad																																																																																				0.587	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			Silent
TP53	7157	broad.mit.edu	37	17	7577536	7577536	+	Missense_Mutation	SNP	T	T	C	rs587782082		TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr17:7577536T>C	ENST00000269305.4	-	7	934	c.745A>G	c.(745-747)Agg>Ggg	p.R249G	TP53_ENST00000413465.2_Missense_Mutation_p.R249G|TP53_ENST00000445888.2_Missense_Mutation_p.R249G|TP53_ENST00000455263.2_Missense_Mutation_p.R249G|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R249G|TP53_ENST00000420246.2_Missense_Mutation_p.R249G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249W(37)|p.R249G(30)|p.0?(8)|p.?(5)|p.M246_P250delMNRRP(2)|p.R249R(1)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.N247_R248delNR(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.G245fs*14(1)|p.R249fs*15(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.R249fs*19(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGATGGGCCTCCGGTTCATG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	95	Substitution - Missense(67)|Deletion - In frame(9)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Substitution - coding silent(1)	lung(22)|upper_aerodigestive_tract(10)|urinary_tract(9)|large_intestine(7)|breast(7)|central_nervous_system(5)|biliary_tract(5)|oesophagus(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|endometrium(3)|ovary(3)|soft_tissue(2)|skin(2)|peritoneum(1)|small_intestine(1)|pancreas(1)|liver(1)	17											153.0	113.0	126.0					17																	7577536		2203	4300	6503	7518261	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.745A>G	17.37:g.7577536T>C	ENSP00000269305:p.Arg249Gly	Unknown		x	x	x	7518261	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	17.88	3.496716	0.64186	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.62	-0.0234	0.13943	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.92367	3.3	0.48185	D	0.9996	D;D;D;D;D	0.89917	0.998;1.0;0.998;0.995;0.999	D;D;D;D;D	0.81914	0.976;0.995;0.99;0.967;0.988	D	0.97987	1.0352	10	0.87932	D	0	-3.0658	12.7443	0.57273	0.0:0.0:0.4175:0.5825	.	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	G	249;249;249;249;249;249;238;117	ENSP00000410739:R249G;ENSP00000352610:R249G;ENSP00000269305:R249G;ENSP00000398846:R249G;ENSP00000391127:R249G;ENSP00000391478:R249G;ENSP00000425104:R117G	ENSP00000269305:R249G	R	-	1	2	TP53	7518261	0.009000	0.17119	0.995000	0.50966	0.814000	0.46013	0.039000	0.13884	-0.029000	0.13827	-0.648000	0.03929	AGG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CDK12	51755	broad.mit.edu	37	17	37676233	37676233	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1466-01	TCGA-24-1466-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr17:37676233A>T	ENST00000447079.4	+	11	3021	c.2988A>T	c.(2986-2988)ttA>ttT	p.L996F	CDK12_ENST00000430627.2_Missense_Mutation_p.L996F	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	996	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.L996F(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CACTTGATTTATTGGACCACA	0.428			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	1	Substitution - Missense(1)	ovary(1)	17											239.0	204.0	216.0					17																	37676233		2203	4300	6503	34929759	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2988A>T	17.37:g.37676233A>T	ENSP00000398880:p.Leu996Phe	Somatic		x	x	x	34929759	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909615	0.72868	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.60171	0.21;0.21	5.56	3.21	0.36854	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.32703	N	0.005752	T	0.62024	0.2394	L	0.41079	1.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.62324	-0.6878	10	0.87932	D	0	-5.079	4.7256	0.12939	0.5422:0.0:0.4578:0.0	.	995;996;996	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	F	996	ENSP00000407720:L996F;ENSP00000398880:L996F	ENSP00000407720:L996F	L	+	3	2	CDK12	34929759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.926000	0.56491	0.895000	0.36342	0.533000	0.62120	TTA		0.428	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		Missense_Mutation
DLGAP1	9229	broad.mit.edu	37	18	3879507	3879507	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr18:3879507G>A	ENST00000315677.3	-	4	1157	c.562C>T	c.(562-564)Cgc>Tgc	p.R188C	DLGAP1_ENST00000584874.1_Missense_Mutation_p.R188C|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R188C|DLGAP1_ENST00000515196.2_Missense_Mutation_p.R188C	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	188					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.R188C(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGCTCCGCGCGCCGCTCCTTG	0.711																																																1	Substitution - Missense(1)	ovary(1)	18											52.0	62.0	59.0					18																	3879507		2201	4298	6499	3869507	SO:0001583	missense	9229			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.562C>T	18.37:g.3879507G>A	ENSP00000316377:p.Arg188Cys	Unknown		x	x	x	3869507	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	CCDS11836.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507343	0.64410	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.18502	2.21;2.21	5.51	3.57	0.40892	.	0.262401	0.39146	N	0.001455	T	0.26231	0.0640	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.99	P;P;P	0.62014	0.791;0.897;0.608	T	0.03807	-1.1002	10	0.87932	D	0	-16.2908	13.4022	0.60889	0.0:0.0:0.5081:0.4919	.	188;188;188	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	C	188	ENSP00000316377:R188C;ENSP00000445973:R188C	ENSP00000316377:R188C	R	-	1	0	DLGAP1	3869507	1.000000	0.71417	0.930000	0.37139	0.784000	0.44337	2.586000	0.46119	1.297000	0.44761	0.655000	0.94253	CGC		0.711	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			Missense_Mutation
ZNF536	9745	broad.mit.edu	37	19	30934886	30934886	+	Silent	SNP	C	C	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr19:30934886C>T	ENST00000355537.3	+	2	564	c.417C>T	c.(415-417)ttC>ttT	p.F139F		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	139					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.F139F(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCAAGCGCTTCCGCTTCAACA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19											66.0	54.0	58.0					19																	30934886		2203	4300	6503	35626726	SO:0001819	synonymous_variant	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.417C>T	19.37:g.30934886C>T		Unknown		x	x	x	35626726	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1	SNP	30	Broad																																																																																				0.637	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		Silent
ZSWIM3	140831	broad.mit.edu	37	20	44507214	44507214	+	Missense_Mutation	SNP	C	C	T	rs141779185	byFrequency	TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr20:44507214C>T	ENST00000255152.2	+	2	2226	c.2017C>T	c.(2017-2019)Cgc>Tgc	p.R673C	ZSWIM1_ENST00000372520.1_5'Flank|ZSWIM3_ENST00000454862.2_Missense_Mutation_p.R667C|ZSWIM1_ENST00000372523.1_5'Flank	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	673							zinc ion binding (GO:0008270)	p.R673C(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				GGACGTGGGCCGCCTCCCTTT	0.552													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20339	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20						C	CYS/ARG	7,4399	14.3+/-33.2	0,7,2196	81.0	87.0	85.0		2017	-0.9	0.0	20	dbSNP_134	85	0,8600		0,0,4300	yes	missense	ZSWIM3	NM_080752.3	180	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	benign	673/697	44507214	7,12999	2203	4300	6503	43940621	SO:0001583	missense	140831			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.2017C>T	20.37:g.44507214C>T	ENSP00000255152:p.Arg673Cys	Unknown		x	x	x	43940621	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	1.131	-0.652470	0.03480	0.001589	0.0	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.23950	1.91;1.88	5.27	-0.947	0.10382	.	0.945136	0.08900	N	0.877321	T	0.11495	0.0280	N	0.11560	0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27191	-1.0081	10	0.49607	T	0.09	0.0243	2.7082	0.05167	0.1174:0.435:0.1141:0.3335	.	667;673	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	C	673;667	ENSP00000255152:R673C;ENSP00000406313:R667C	ENSP00000255152:R673C	R	+	1	0	ZSWIM3	43940621	0.000000	0.05858	0.001000	0.08648	0.303000	0.27691	-0.147000	0.10234	-0.624000	0.05611	-2.600000	0.00162	CGC		0.552	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752		Missense_Mutation
KRTAP10-9	386676	broad.mit.edu	37	21	46047807	46047807	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr21:46047807G>A	ENST00000397911.3	+	1	768	c.719G>A	c.(718-720)aGg>aAg	p.R240K	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	240	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCTGTGTGCAGGCCCGCCTGC	0.687																																																0			21											86.0	104.0	98.0					21																	46047807		2203	4300	6503	44872235	SO:0001583	missense	386676			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.719G>A	21.37:g.46047807G>A	ENSP00000381009:p.Arg240Lys	Unknown		x	x	x	44872235	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	CCDS42961.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	g	10.02	1.237432	0.22711	.	.	ENSG00000221837	ENST00000397911	T	0.01347	4.99	3.5	0.524	0.17066	.	.	.	.	.	T	0.01695	0.0054	L	0.28504	0.86	0.09310	N	0.999993	P	0.48407	0.91	P	0.47744	0.556	T	0.52238	-0.8602	8	.	.	.	.	5.388	0.16227	0.4068:0.0:0.5932:0.0	.	240	P60411	KR109_HUMAN	K	240	ENSP00000381009:R240K	.	R	+	2	0	KRTAP10-9	44872235	0.005000	0.15991	0.261000	0.24466	0.080000	0.17528	0.365000	0.20348	0.127000	0.18452	-0.251000	0.11542	AGG		0.687	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1			Missense_Mutation
IQSEC1	9922	broad.mit.edu	37	3	12957152	12957152	+	Missense_Mutation	SNP	T	T	C	rs145903276		TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr3:12957152T>C	ENST00000273221.4	-	7	2360	c.2144A>G	c.(2143-2145)aAt>aGt	p.N715S		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	715					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.N715S(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATGGTCCTCATTGGTCTTTAG	0.572																																																1	Substitution - Missense(1)	ovary(1)	3						T	SER/ASN,SER/ASN	0,4406		0,0,2203	214.0	169.0	184.0		2102,2144	2.1	0.8	3	dbSNP_134	184	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IQSEC1	NM_001134382.1,NM_014869.4	46,46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	701/1115,715/964	12957152	1,13005	2203	4300	6503	12932152	SO:0001583	missense	9922			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2144A>G	3.37:g.12957152T>C	ENSP00000273221:p.Asn715Ser	Unknown		x	x	x	12932152	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	37	CCDS33703.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522258	0.44866	0.0	1.16E-4	ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247	T;T	0.12774	2.69;2.65	4.54	2.12	0.27331	SEC7-like, alpha orthogonal bundle (1);SEC7-like (1);	0.091794	0.64402	N	0.000001	T	0.10380	0.0254	.	.	.	0.53688	D	0.999972	B;B;B	0.19706	0.005;0.038;0.001	B;B;B	0.17979	0.015;0.02;0.006	T	0.13764	-1.0497	9	0.41790	T	0.15	.	8.3098	0.32064	0.0:0.1705:0.0:0.8295	.	701;701;715	E9PG60;C9JMG9;Q6DN90	.;.;IQEC1_HUMAN	S	715;701;701	ENSP00000273221:N715S;ENSP00000402299:N701S	ENSP00000273221:N715S	N	-	2	0	IQSEC1	12932152	1.000000	0.71417	0.804000	0.32291	0.987000	0.75469	3.519000	0.53458	0.221000	0.20879	0.533000	0.62120	AAT		0.572	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869		Missense_Mutation
SEMA3G	56920	broad.mit.edu	37	3	52472055	52472055	+	Missense_Mutation	SNP	C	C	T	rs142528178	byFrequency	TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr3:52472055C>T	ENST00000231721.2	-	14	1669	c.1670G>A	c.(1669-1671)cGc>cAc	p.R557H		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	557					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R557H(1)		kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GCGGAACCGGCGCTTGCCAAG	0.682													C|||	9	0.00179712	0.0045	0.0	5008	,	,		16566	0.0		0.0	False		,,,				2504	0.0031															1	Substitution - Missense(1)	ovary(1)	3						C	HIS/ARG	23,4377		0,23,2177	33.0	32.0	32.0		1670	5.1	1.0	3	dbSNP_134	32	0,8568		0,0,4284	yes	missense	SEMA3G	NM_020163.1	29	0,23,6461	TT,TC,CC		0.0,0.5227,0.1774	possibly-damaging	557/783	52472055	23,12945	2200	4284	6484	52447095	SO:0001583	missense	56920				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1670G>A	3.37:g.52472055C>T	ENSP00000231721:p.Arg557His	Unknown		x	x	x	52447095	Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	37	CCDS2856.1	SNP	27	Broad	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	22.5	4.299248	0.81025	0.005227	0.0	ENSG00000010319	ENST00000231721	T	0.23348	1.91	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.33294	0.0858	M	0.89353	3.025	0.58432	D	0.999997	P	0.35507	0.506	B	0.37780	0.258	T	0.46596	-0.9180	10	0.56958	D	0.05	.	16.8509	0.85993	0.0:1.0:0.0:0.0	.	557	Q9NS98	SEM3G_HUMAN	H	557	ENSP00000231721:R557H	ENSP00000231721:R557H	R	-	2	0	SEMA3G	52447095	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.343000	0.59348	2.662000	0.90505	0.655000	0.94253	CGC		0.682	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163		Missense_Mutation
SI	6476	broad.mit.edu	37	3	164785131	164785131	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr3:164785131G>A	ENST00000264382.3	-	6	694	c.632C>T	c.(631-633)aCt>aTt	p.T211I		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	211	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.T211I(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CACTTACAAAGTTTTACCGTT	0.299										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											64.0	63.0	63.0					3																	164785131		2202	4298	6500	166267825	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.632C>T	3.37:g.164785131G>A	ENSP00000264382:p.Thr211Ile	Somatic		x	x	x	166267825	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	0.651	-0.809576	0.02798	.	.	ENSG00000090402	ENST00000264382	T	0.27890	1.64	5.25	-3.05	0.05396	Glycoside hydrolase-type carbohydrate-binding (1);	1.050670	0.07297	N	0.873500	T	0.13372	0.0324	N	0.02854	-0.475	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29852	-0.9998	10	0.39692	T	0.17	.	11.1529	0.48469	0.613:0.0:0.387:0.0	.	211	P14410	SUIS_HUMAN	I	211	ENSP00000264382:T211I	ENSP00000264382:T211I	T	-	2	0	SI	166267825	0.012000	0.17670	0.005000	0.12908	0.003000	0.03518	0.258000	0.18387	-0.734000	0.04843	-2.051000	0.00406	ACT		0.299	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
PIGG	54872	broad.mit.edu	37	4	515043	515043	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr4:515043G>A	ENST00000453061.2	+	7	1419	c.1313G>A	c.(1312-1314)gGg>gAg	p.G438E	PIGG_ENST00000296306.7_Intron|PIGG_ENST00000383028.4_Missense_Mutation_p.G305E|PIGG_ENST00000310340.5_Intron|PIGG_ENST00000509768.1_Missense_Mutation_p.G349E|PIGG_ENST00000503111.1_Intron|PIGG_ENST00000536264.1_Intron|PIGG_ENST00000504346.1_Missense_Mutation_p.G349E	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	438					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)	p.?(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						ATGATGGTGGGGACTGTCGTG	0.463																																																1	Unknown(1)	ovary(1)	4											107.0	80.0	89.0					4																	515043		2203	4300	6503	505043	SO:0001583	missense	54872				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1313G>A	4.37:g.515043G>A	ENSP00000415203:p.Gly438Glu	Unknown		x	x	x	505043	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	ENST00000453061.2	37	CCDS46992.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481637	0.84747	.	.	ENSG00000174227	ENST00000453061;ENST00000504346;ENST00000383028;ENST00000509768	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.82	5.82	0.92795	.	.	.	.	.	T	0.68201	0.2975	M	0.72118	2.19	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.982;0.941;0.941	T	0.66532	-0.5900	8	.	.	.	.	17.5831	0.87973	0.0:0.0:1.0:0.0	.	305;349;438	Q5H8A4-3;D6RFE8;Q5H8A4	.;.;PIGG_HUMAN	E	438;349;305;349	ENSP00000415203:G438E;ENSP00000424800:G349E;ENSP00000372494:G305E;ENSP00000421550:G349E	.	G	+	2	0	PIGG	505043	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	7.317000	0.79018	2.761000	0.94854	0.655000	0.94253	GGG		0.463	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733		Missense_Mutation
MARCH1	55016	broad.mit.edu	37	4	165118166	165118166	+	Intron	SNP	C	C	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr4:165118166C>T	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R233Q(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ttctcattttcgcttctgacc	0.423																																																1	Substitution - Missense(1)	ovary(1)	4											138.0	123.0	128.0					4																	165118166		2203	4300	6503	165337616	SO:0001627	intron_variant	23520			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85352G>A	4.37:g.165118166C>T		Unknown		x	x	x	165337616	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1	SNP	31	Broad																																																																																				0.423	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		Missense_Mutation
CDH18	1016	broad.mit.edu	37	5	19483573	19483573	+	Silent	SNP	A	A	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr5:19483573A>T	ENST00000507958.1	-	14	2709	c.1719T>A	c.(1717-1719)ggT>ggA	p.G573G	CDH18_ENST00000382275.1_Silent_p.G573G|CDH18_ENST00000506372.1_Intron|CDH18_ENST00000502796.1_Intron|CDH18_ENST00000274170.4_Silent_p.G573G			Q13634	CAD18_HUMAN	cadherin 18, type 2	573	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G573G(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGGGGATTCCACCATCAGAGA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	5											91.0	77.0	81.0					5																	19483573		2203	4300	6503	19519330	SO:0001819	synonymous_variant	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1719T>A	5.37:g.19483573A>T		Unknown		x	x	x	19519330	A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	ENST00000507958.1	37	CCDS3889.1	SNP	6	Broad																																																																																				0.512	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		Silent
EPB41L4A	64097	broad.mit.edu	37	5	111504701	111504701	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr5:111504701G>A	ENST00000261486.5	-	21	2117	c.1841C>T	c.(1840-1842)tCg>tTg	p.S614L	EPB41L4A_ENST00000507810.1_5'UTR	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	614						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)		p.S614L(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CTTCACTTCCGAGAGAACTGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	5											137.0	137.0	137.0					5																	111504701		2082	4209	6291	111532600	SO:0001583	missense	64097			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1841C>T	5.37:g.111504701G>A	ENSP00000261486:p.Ser614Leu	Unknown		x	x	x	111532600	A4FUI6	Missense_Mutation	SNP	ENST00000261486.5	37	CCDS43350.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.230828	0.95207	.	.	ENSG00000129595	ENST00000261486	D	0.83673	-1.75	5.86	5.86	0.93980	.	0.248877	0.28448	U	0.015305	D	0.87321	0.6148	L	0.29908	0.895	0.46356	D	0.999003	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	D	0.88248	0.2914	10	0.87932	D	0	.	18.9573	0.92664	0.0:0.0:1.0:0.0	.	614;241	Q9HCS5;Q8N8X1	E41LA_HUMAN;.	L	614	ENSP00000261486:S614L	ENSP00000261486:S614L	S	-	2	0	EPB41L4A	111532600	1.000000	0.71417	0.965000	0.40720	0.957000	0.61999	7.300000	0.78841	2.777000	0.95525	0.591000	0.81541	TCG		0.488	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1			Missense_Mutation
AFF4	27125	broad.mit.edu	37	5	132270224	132270224	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1466-01	TCGA-24-1466-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr5:132270224G>C	ENST00000265343.5	-	3	912	c.533C>G	c.(532-534)tCt>tGt	p.S178C	AFF4_ENST00000378595.3_Missense_Mutation_p.S178C|AFF4_ENST00000491831.1_5'UTR	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	178	Ser-rich.				spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S178C(1)	SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGGCTGGAAGAACGTGATTT	0.473																																					Ovarian(126;889 1733 2942 10745 11605)											1	Substitution - Missense(1)	ovary(1)	5											144.0	143.0	143.0					5																	132270224		2203	4300	6503	132298123	SO:0001583	missense	27125			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.533C>G	5.37:g.132270224G>C	ENSP00000265343:p.Ser178Cys	Somatic		x	x	x	132298123	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	CCDS4164.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043714	0.75732	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.64991	-0.13;-0.13	5.86	5.86	0.93980	.	0.102855	0.64402	D	0.000002	T	0.78007	0.4216	L	0.56769	1.78	0.54753	D	0.999986	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.954	T	0.77563	-0.2541	10	0.62326	D	0.03	-9.7935	20.1802	0.98196	0.0:0.0:1.0:0.0	.	178;178;178	Q9UHB7-3;Q9UHB7-2;Q9UHB7	.;.;AFF4_HUMAN	C	178	ENSP00000265343:S178C;ENSP00000367858:S178C	ENSP00000265343:S178C	S	-	2	0	AFF4	132298123	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.539000	0.67199	2.777000	0.95525	0.655000	0.94253	TCT		0.473	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423		Missense_Mutation
FLT4	2324	broad.mit.edu	37	5	180048851	180048851	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr5:180048851C>T	ENST00000261937.6	-	13	1789	c.1711G>A	c.(1711-1713)Ggc>Agc	p.G571S	FLT4_ENST00000393347.3_Missense_Mutation_p.G571S|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.G571S	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	571	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.G571S(2)|p.G381S(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACCGGCTGGCCCTCTAGTAGC	0.622																																					Colon(97;1075 1466 27033 27547 35871)											3	Substitution - Missense(3)	ovary(3)	5											78.0	87.0	84.0					5																	180048851		2203	4300	6503	179981457	SO:0001583	missense	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1711G>A	5.37:g.180048851C>T	ENSP00000261937:p.Gly571Ser	Unknown		x	x	x	179981457	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783196	0.70222	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.21932	1.98;1.98;1.98	4.64	4.64	0.57946	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45895	0.1365	M	0.65975	2.015	0.42002	D	0.990898	D;D;D;D	0.67145	0.996;0.996;0.996;0.996	D;D;D;D	0.74348	0.956;0.983;0.983;0.983	T	0.48151	-0.9060	9	0.59425	D	0.04	.	17.887	0.88858	0.0:1.0:0.0:0.0	.	571;381;571;571	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	S	571;571;571;381	ENSP00000261937:G571S;ENSP00000377016:G571S;ENSP00000426057:G571S	ENSP00000261937:G571S	G	-	1	0	FLT4	179981457	1.000000	0.71417	0.999000	0.59377	0.476000	0.33039	3.217000	0.51184	2.300000	0.77407	0.561000	0.74099	GGC		0.622	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			Missense_Mutation
GCNT2	2651	broad.mit.edu	37	6	10556700	10556700	+	Intron	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr6:10556700G>A	ENST00000379597.3	+	1	1481				GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000316170.3_Missense_Mutation_p.S15N			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.S15N(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		TCTGTCTCTAGTGTAATTATT	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											114.0	109.0	111.0					6																	10556700		2203	4300	6503	10664686	SO:0001627	intron_variant	2651			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.925+26631G>A	6.37:g.10556700G>A		Somatic		x	x	x	10664686		Missense_Mutation	SNP	ENST00000379597.3	37	CCDS34338.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	6.142	0.394426	0.11638	.	.	ENSG00000111846	ENST00000316170	T	0.10860	2.83	5.05	1.91	0.25777	.	.	.	.	.	T	0.03477	0.0100	L	0.41492	1.28	0.09310	N	0.999999	B	0.19583	0.037	B	0.19391	0.025	T	0.42481	-0.9449	9	0.15499	T	0.54	.	16.4739	0.84127	0.0:0.5431:0.4569:0.0	.	15	Q06430	GNT2B_HUMAN	N	15	ENSP00000314844:S15N	ENSP00000314844:S15N	S	+	2	0	GCNT2	10664686	0.001000	0.12720	0.001000	0.08648	0.091000	0.18340	0.503000	0.22610	0.602000	0.29896	0.655000	0.94253	AGT		0.393	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649		Missense_Mutation
HIST1H3B	8358	broad.mit.edu	37	6	26031939	26031939	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr6:26031939C>T	ENST00000244661.2	-	1	349	c.350G>A	c.(349-351)cGa>cAa	p.R117Q		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	117					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.R117P(1)|p.R117Q(1)		breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						AATAGTCACTCGCTTAGCATG	0.517																																																2	Substitution - Missense(2)	cervix(1)|ovary(1)	6											76.0	77.0	77.0					6																	26031939		2203	4300	6503	26139918	SO:0001583	missense	8358			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.350G>A	6.37:g.26031939C>T	ENSP00000244661:p.Arg117Gln	Unknown		x	x	x	26139918	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	CCDS4573.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	c	16.10	3.026253	0.54683	.	.	ENSG00000124693	ENST00000244661	T	0.68331	-0.32	5.17	5.17	0.71159	.	.	.	.	.	T	0.75961	0.3921	.	.	.	0.37251	D	0.906557	.	.	.	.	.	.	T	0.79895	-0.1610	6	0.87932	D	0	.	18.0207	0.89253	0.0:1.0:0.0:0.0	.	.	.	.	Q	117	ENSP00000244661:R117Q	ENSP00000244661:R117Q	R	-	2	0	HIST1H3B	26139918	1.000000	0.71417	0.990000	0.47175	0.007000	0.05969	7.492000	0.81482	2.545000	0.85829	0.561000	0.74099	CGA		0.517	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537		Missense_Mutation
HLA-E	3133	broad.mit.edu	37	6	30457687	30457687	+	Silent	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr6:30457687G>A	ENST00000376630.4	+	2	314	c.249G>A	c.(247-249)cgG>cgA	p.R83R		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	83	Alpha-1.				antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)	p.R83R(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						ATTGGGACCGGGAGACACGGA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	6											77.0	92.0	87.0					6																	30457687		1509	2708	4217	30565666	SO:0001819	synonymous_variant	3133			M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.249G>A	6.37:g.30457687G>A		Unknown		x	x	x	30565666	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Silent	SNP	ENST00000376630.4	37	CCDS34379.1	SNP	43	Broad																																																																																				0.657	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516		Silent
GPR115	221393	broad.mit.edu	37	6	47680169	47680169	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr6:47680169A>G	ENST00000283303.2	+	5	635	c.377A>G	c.(376-378)gAg>gGg	p.E126G	GPR115_ENST00000371220.1_Missense_Mutation_p.E183G|GPR115_ENST00000327753.3_Missense_Mutation_p.E126G|RN7SKP116_ENST00000516902.1_RNA	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	126					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E126G(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						CGAGCTCCAGAGACCATTGAG	0.428																																					GBM(22;431 510 9010 26644 32828)											1	Substitution - Missense(1)	ovary(1)	6											153.0	142.0	146.0					6																	47680169		2203	4300	6503	47788128	SO:0001583	missense	221393			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.377A>G	6.37:g.47680169A>G	ENSP00000283303:p.Glu126Gly	Unknown		x	x	x	47788128	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	10.94	1.494227	0.26774	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.35605	1.51;1.3;1.3	5.78	3.27	0.37495	.	0.729150	0.12830	N	0.435713	T	0.09335	0.0230	L	0.38838	1.175	0.18873	N	0.999989	B	0.10296	0.003	B	0.04013	0.001	T	0.35624	-0.9781	10	0.20046	T	0.44	-4.0661	6.1364	0.20235	0.6708:0.1624:0.0:0.1668	.	126	Q8IZF3	GP115_HUMAN	G	183;126;126	ENSP00000360264:E183G;ENSP00000328319:E126G;ENSP00000283303:E126G	ENSP00000283303:E126G	E	+	2	0	GPR115	47788128	0.236000	0.23804	0.111000	0.21465	0.007000	0.05969	2.364000	0.44187	0.397000	0.25310	0.533000	0.62120	GAG		0.428	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		Missense_Mutation
FAM83B	222584	broad.mit.edu	37	6	54804566	54804566	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr6:54804566T>C	ENST00000306858.7	+	5	913	c.797T>C	c.(796-798)gTt>gCt	p.V266A		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	266								p.V266A(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GGACAACTTGTTGAGTCCTTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	92.0	92.0					6																	54804566		2203	4300	6503	54912525	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.797T>C	6.37:g.54804566T>C	ENSP00000304078:p.Val266Ala	Unknown		x	x	x	54912525	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	19.39	3.818248	0.71028	.	.	ENSG00000168143	ENST00000306858	T	0.16324	2.35	5.42	5.42	0.78866	.	0.063510	0.64402	D	0.000007	T	0.30792	0.0776	M	0.63169	1.94	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.03413	-1.1039	10	0.56958	D	0.05	-25.3038	15.767	0.78135	0.0:0.0:0.0:1.0	.	266	Q5T0W9	FA83B_HUMAN	A	266	ENSP00000304078:V266A	ENSP00000304078:V266A	V	+	2	0	FAM83B	54912525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.184000	0.69523	0.482000	0.46254	GTT		0.383	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		Missense_Mutation
KCNQ5	56479	broad.mit.edu	37	6	73787150	73787150	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr6:73787150G>A	ENST00000370398.1	+	4	831	c.722G>A	c.(721-723)cGc>cAc	p.R241H	KCNQ5_ENST00000342056.2_Missense_Mutation_p.R241H|KCNQ5_ENST00000403813.2_Missense_Mutation_p.R241H|KCNQ5_ENST00000402622.2_Missense_Mutation_p.R241H|KCNQ5_ENST00000370392.1_Missense_Mutation_p.R241H|KCNQ5_ENST00000355635.3_Missense_Mutation_p.R241H|KCNQ5_ENST00000355194.4_Missense_Mutation_p.R241H|KCNQ5_ENST00000414165.2_Missense_Mutation_p.R241H	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	241					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.R241H(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CAGATCCTCCGCATGGTGCGC	0.443																																					GBM(142;1375 1859 14391 23261 44706)											1	Substitution - Missense(1)	ovary(1)	6											85.0	80.0	82.0					6																	73787150		2203	4300	6503	73843871	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.722G>A	6.37:g.73787150G>A	ENSP00000359425:p.Arg241His	Somatic		x	x	x	73843871	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.487480	0.96323	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15;-5.15;-5.15;-5.15	5.84	5.84	0.93424	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	H	0.95187	3.635	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.992;0.996;0.987;0.995;0.997;0.99	D	0.98492	1.0610	10	0.87932	D	0	.	20.1438	0.98071	0.0:0.0:1.0:0.0	.	241;241;241;241;241;241	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	H	241	ENSP00000345055:R241H;ENSP00000347326:R241H;ENSP00000359425:R241H;ENSP00000359419:R241H;ENSP00000385501:R241H;ENSP00000347853:R241H;ENSP00000384453:R241H;ENSP00000409861:R241H	ENSP00000345055:R241H	R	+	2	0	KCNQ5	73843871	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	9.869000	0.99810	2.768000	0.95171	0.650000	0.86243	CGC		0.443	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842		Missense_Mutation
FIGNL1	63979	broad.mit.edu	37	7	50514933	50514933	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr7:50514933T>A	ENST00000419119.1	-	2	1606	c.53A>T	c.(52-54)tAc>tTc	p.Y18F	FIGNL1_ENST00000433017.1_Missense_Mutation_p.Y18F|FIGNL1_ENST00000395556.2_Missense_Mutation_p.Y18F|FIGNL1_ENST00000435566.1_Missense_Mutation_p.Y18F|FIGNL1_ENST00000356889.4_Missense_Mutation_p.Y18F			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	18					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)	p.Y18F(2)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				AATTGCGAAGTAATTCTTCTG	0.418																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	7											53.0	44.0	47.0					7																	50514933		2203	4300	6503	50482427	SO:0001583	missense	63979			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.53A>T	7.37:g.50514933T>A	ENSP00000410811:p.Tyr18Phe	Unknown		x	x	x	50482427	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	37	CCDS5510.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	14.87	2.665195	0.47677	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119;ENST00000435566;ENST00000436590;ENST00000422854;ENST00000440350;ENST00000420829;ENST00000448788	T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01	5.36	4.2	0.49525	.	0.142095	0.47852	D	0.000219	T	0.22551	0.0544	M	0.64997	1.995	0.27919	N	0.938319	D	0.53619	0.961	B	0.43413	0.419	T	0.18147	-1.0346	10	0.56958	D	0.05	-10.9752	7.4524	0.27246	0.0:0.0727:0.1427:0.7847	.	18	Q6PIW4	FIGL1_HUMAN	F	18	ENSP00000349356:Y18F;ENSP00000378924:Y18F;ENSP00000399997:Y18F;ENSP00000410811:Y18F;ENSP00000394070:Y18F;ENSP00000403012:Y18F;ENSP00000388471:Y18F	ENSP00000349356:Y18F	Y	-	2	0	FIGNL1	50482427	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	3.381000	0.52455	0.969000	0.38237	0.460000	0.39030	TAC		0.418	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762		Missense_Mutation
COBL	23242	broad.mit.edu	37	7	51096337	51096337	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr7:51096337T>G	ENST00000265136.7	-	10	2621	c.2456A>C	c.(2455-2457)aAg>aCg	p.K819T	COBL_ENST00000395542.2_Missense_Mutation_p.K901T	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	819					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.K819T(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GTGGGCAGACTTCTGCTGGGG	0.652																																					NSCLC(189;2119 2138 12223 30818 34679)											1	Substitution - Missense(1)	ovary(1)	7											53.0	56.0	55.0					7																	51096337		2203	4300	6503	51063831	SO:0001583	missense	23242			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2456A>C	7.37:g.51096337T>G	ENSP00000265136:p.Lys819Thr	Unknown		x	x	x	51063831	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	SNP	56	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.996|0.996	-0.692306|-0.692306	0.03303|0.03303	.|.	.|.	ENSG00000106078|ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542|ENST00000457306	T;T;T;T|.	0.12879|.	2.66;2.66;2.65;2.64|.	3.83|3.83	-0.242|-0.242	0.13039|0.13039	.|.	0.702099|.	0.11916|.	N|.	0.517125|.	T|T	0.16128|0.16128	0.0388|0.0388	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.22211|.	0.004;0.004;0.0;0.003;0.066|.	B;B;B;B;B|.	0.24006|.	0.008;0.005;0.0;0.001;0.05|.	T|T	0.23226|0.23226	-1.0194|-1.0194	10|6	0.15066|0.87932	T|D	0.55|0	.|.	5.688|5.688	0.17813|0.17813	0.0:0.0944:0.3224:0.5832|0.0:0.0944:0.3224:0.5832	.|.	819;876;819;901;361|.	O75128-3;O75128-7;O75128;O75128-2;O75128-6|.	.;.;COBL_HUMAN;.;.|.	T|R	819;711;704;901|265	ENSP00000265136:K819T;ENSP00000401204:K711T;ENSP00000413498:K704T;ENSP00000378912:K901T|.	ENSP00000265136:K819T|ENSP00000397300:S265R	K|S	-|-	2|1	0|0	COBL|COBL	51063831|51063831	0.000000|0.000000	0.05858|0.05858	0.013000|0.013000	0.15412|0.15412	0.007000|0.007000	0.05969|0.05969	-0.145000|-0.145000	0.10265|0.10265	-0.031000|-0.031000	0.13781|0.13781	0.460000|0.460000	0.39030|0.39030	AAG|AGT		0.652	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		Missense_Mutation
AKAP9	10142	broad.mit.edu	37	7	91712529	91712529	+	Missense_Mutation	SNP	G	G	T	rs371753464		TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr7:91712529G>T	ENST00000359028.2	+	34	8467	c.8242G>T	c.(8242-8244)Gtt>Ttt	p.V2748F	AKAP9_ENST00000356239.3_Missense_Mutation_p.V2736F|AKAP9_ENST00000358100.2_Missense_Mutation_p.V2748F			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2748	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.V2736F(1)|p.V2748F(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CTTAAGCCAAGTTAGGGATCA	0.368			T	BRAF	papillary thyroid																																		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Missense(2)	ovary(2)	7											60.0	59.0	59.0					7																	91712529		2203	4300	6503	91550465	SO:0001583	missense	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8242G>T	7.37:g.91712529G>T	ENSP00000351922:p.Val2748Phe	Unknown		x	x	x	91550465	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733421	0.30684	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	4.8	2.82	0.32997	.	0.220262	0.23103	N	0.051891	T	0.64789	0.2630	M	0.73598	2.24	0.09310	N	0.999999	D;P;P;P;P	0.61080	0.989;0.879;0.883;0.928;0.928	P;P;B;P;P	0.58873	0.847;0.715;0.445;0.648;0.648	T	0.56323	-0.7998	10	0.66056	D	0.02	.	10.0102	0.41981	0.239:0.0:0.761:0.0	.	2740;2740;2748;2736;2728	F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	F	2736;2748;2748;2740;582	ENSP00000348573:V2736F;ENSP00000351922:V2748F;ENSP00000350813:V2748F;ENSP00000378042:V582F	ENSP00000348573:V2736F	V	+	1	0	AKAP9	91550465	1.000000	0.71417	0.474000	0.27266	0.799000	0.45148	3.151000	0.50670	1.245000	0.43885	0.591000	0.81541	GTT		0.368	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		Missense_Mutation
SGCE	8910	broad.mit.edu	37	7	94248262	94248262	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr7:94248262G>A	ENST00000265735.7	-	5	580	c.470C>T	c.(469-471)cCg>cTg	p.P157L	SGCE_ENST00000447873.1_Missense_Mutation_p.P157L|SGCE_ENST00000437425.2_Missense_Mutation_p.P116L|SGCE_ENST00000415788.2_Missense_Mutation_p.P193L|SGCE_ENST00000445866.2_Missense_Mutation_p.P157L|SGCE_ENST00000428696.2_Missense_Mutation_p.P157L	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	157					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)	p.P157L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATATGGCAACGGGAAGTCTAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	7											82.0	75.0	77.0					7																	94248262		2203	4300	6503	94086198	SO:0001583	missense	8910			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.470C>T	7.37:g.94248262G>A	ENSP00000265735:p.Pro157Leu	Unknown		x	x	x	94086198	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Missense_Mutation	SNP	ENST00000265735.7	37	CCDS5637.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	13.44	2.237442	0.39498	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000437425;ENST00000447873;ENST00000428696;ENST00000415788	D;D;D;D;D;D	0.98345	-4.5;-4.5;-4.88;-4.51;-4.51;-4.5	5.54	4.64	0.57946	Dystroglycan-type cadherin-like (1);	0.047393	0.85682	N	0.000000	D	0.97576	0.9206	L	0.27053	0.805	0.80722	D	1	D;B;B;B;D	0.89917	1.0;0.075;0.219;0.296;1.0	D;B;B;B;D	0.97110	1.0;0.016;0.183;0.034;0.998	D	0.96761	0.9561	10	0.27785	T	0.31	-9.3439	13.8781	0.63665	0.0767:0.0:0.9233:0.0	.	193;116;157;157;157	B7Z2R4;E9PEH6;E9PF60;G5E9K6;O43556	.;.;.;.;SGCE_HUMAN	L	157;157;116;157;157;193	ENSP00000265735:P157L;ENSP00000398930:P157L;ENSP00000394061:P116L;ENSP00000388734:P157L;ENSP00000397536:P157L;ENSP00000405313:P193L	ENSP00000265735:P157L	P	-	2	0	SGCE	94086198	1.000000	0.71417	0.974000	0.42286	0.977000	0.68977	5.770000	0.68873	1.418000	0.47098	0.655000	0.94253	CCG		0.358	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2			Missense_Mutation
KMT2E	55904	broad.mit.edu	37	7	104749603	104749603	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr7:104749603C>G	ENST00000311117.3	+	23	4228	c.3683C>G	c.(3682-3684)tCt>tGt	p.S1228C	KMT2E_ENST00000334877.4_Missense_Mutation_p.S1228C|KMT2E_ENST00000257745.4_Missense_Mutation_p.S1228C|SRPK2_ENST00000493638.1_5'Flank|KMT2E_ENST00000334914.7_Missense_Mutation_p.S283C	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1228					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.S1228C(1)									AATGCCACTTCTGAAGAAACT	0.453																																																1	Substitution - Missense(1)	ovary(1)	7											92.0	79.0	83.0					7																	104749603		2203	4300	6503	104536839	SO:0001583	missense	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3683C>G	7.37:g.104749603C>G	ENSP00000312379:p.Ser1228Cys	Unknown		x	x	x	104536839	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.00|19.00	3.742105|3.742105	0.69418|0.69418	.|.	.|.	ENSG00000005483|ENSG00000005483	ENST00000473063|ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	.|D;D;D;T	.|0.92446	.|-3.04;-2.66;-3.04;0.73	5.07|5.07	0.984|0.984	0.19773|0.19773	.|.	.|0.903820	.|0.09498	.|N	.|0.794056	D|D	0.83866|0.83866	0.5347|0.5347	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.68988|0.68988	-0.5264|-0.5264	5|10	.|0.35671	.|T	.|0.21	.|.	5.5993|5.5993	0.17345|0.17345	0.0:0.6114:0.1395:0.2491|0.0:0.6114:0.1395:0.2491	.|.	.|1228	.|Q8IZD2	.|MLL5_HUMAN	L|C	39|1228;1228;1228;1148;1228;283	.|ENSP00000312379:S1228C;ENSP00000335599:S1228C;ENSP00000257745:S1228C;ENSP00000333986:S283C	.|ENSP00000257745:S1228C	F|S	+|+	3|2	2|0	MLL5|MLL5	104536839|104536839	0.068000|0.068000	0.21057|0.21057	0.003000|0.003000	0.11579|0.11579	0.799000|0.799000	0.45148|0.45148	0.665000|0.665000	0.25083|0.25083	-0.112000|-0.112000	0.11979|0.11979	0.467000|0.467000	0.42956|0.42956	TTC|TCT		0.453	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			Missense_Mutation
KIAA1549	57670	broad.mit.edu	37	7	138602549	138602549	+	Missense_Mutation	SNP	C	C	T	rs370628698		TCGA-24-1466-01	TCGA-24-1466-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr7:138602549C>T	ENST00000422774.1	-	2	1871	c.1823G>A	c.(1822-1824)cGt>cAt	p.R608H	KIAA1549_ENST00000242365.4_Missense_Mutation_p.R558H|KIAA1549_ENST00000440172.1_Missense_Mutation_p.R608H			Q9HCM3	K1549_HUMAN	KIAA1549	608	Ser-rich.					integral component of membrane (GO:0016021)		p.R608H(1)	KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AAAACTGGAACGTTCTTGGTC	0.488			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)		Dom	yes		7	7q34	57670	KIAA1549		O	1	Substitution - Missense(1)	ovary(1)	7											45.0	48.0	47.0					7																	138602549		1888	4115	6003	138253089	SO:0001583	missense	57670				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1823G>A	7.37:g.138602549C>T	ENSP00000416040:p.Arg608His	Somatic		x	x	x	138253089	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	11.18	1.564110	0.27915	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.23348	1.91;1.91;1.91	3.97	3.09	0.35607	.	0.525126	0.15805	N	0.243783	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	P;P	0.37781	0.474;0.608	B;B	0.31751	0.064;0.135	T	0.10451	-1.0629	10	0.52906	T	0.07	.	11.1008	0.48172	0.0:0.19:0.81:0.0	.	608;608	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	H	608;558;608	ENSP00000406661:R608H;ENSP00000242365:R558H;ENSP00000416040:R608H	ENSP00000242365:R558H	R	-	2	0	KIAA1549	138253089	0.060000	0.20803	0.001000	0.08648	0.003000	0.03518	2.034000	0.41145	0.904000	0.36572	-0.203000	0.12734	CGT		0.488	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			Missense_Mutation
PCM1	5108	broad.mit.edu	37	8	17812987	17812987	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr8:17812987C>G	ENST00000519253.1	+	10	1548	c.1297C>G	c.(1297-1299)Caa>Gaa	p.Q433E	PCM1_ENST00000524226.1_Missense_Mutation_p.Q433E|PCM1_ENST00000325083.8_Missense_Mutation_p.Q433E|PCM1_ENST00000518537.1_Missense_Mutation_p.Q472E			Q15154	PCM1_HUMAN	pericentriolar material 1	433					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)	p.Q433E(1)	PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AGCCTCTCCACAAAGGAGTGT	0.413			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	1	Substitution - Missense(1)	ovary(1)	8											64.0	57.0	59.0					8																	17812987		1896	4114	6010	17857267	SO:0001583	missense	5108				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.1297C>G	8.37:g.17812987C>G	ENSP00000431099:p.Gln433Glu	Unknown		x	x	x	17857267	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	37		SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674288	0.67928	.	.	ENSG00000078674	ENST00000325083;ENST00000325126;ENST00000517730;ENST00000518537;ENST00000519253;ENST00000524226	T;T;T;T;T	0.24350	3.63;2.73;1.86;3.63;3.39	5.04	5.04	0.67666	.	0.242522	0.36628	N	0.002485	T	0.26231	0.0640	L	0.51422	1.61	0.80722	D	1	B;B;B;B	0.23185	0.064;0.081;0.027;0.064	B;B;B;B	0.25884	0.047;0.064;0.037;0.047	T	0.08994	-1.0695	10	0.09843	T	0.71	-4.1022	19.2661	0.93985	0.0:1.0:0.0:0.0	.	433;472;433;433	E7ETA6;E7EV93;E7EV56;Q15154	.;.;.;PCM1_HUMAN	E	433;472;472;472;433;433	ENSP00000327077:Q433E;ENSP00000428131:Q472E;ENSP00000428123:Q472E;ENSP00000431099:Q433E;ENSP00000430521:Q433E	ENSP00000327077:Q433E	Q	+	1	0	PCM1	17857267	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.584000	0.67490	2.721000	0.93114	0.655000	0.94253	CAA		0.413	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197		Missense_Mutation
ZFHX4	79776	broad.mit.edu	37	8	77761834	77761834	+	Silent	SNP	G	G	T	rs79691445	byFrequency	TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr8:77761834G>T	ENST00000521891.2	+	8	4180	c.3732G>T	c.(3730-3732)ccG>ccT	p.P1244P	ZFHX4_ENST00000455469.2_Silent_p.P1199P|ZFHX4_ENST00000518282.1_Silent_p.P1218P|ZFHX4_ENST00000050961.6_Silent_p.P1199P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P1244P(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CGGTGCAGCCGGTCATCTGCT	0.473										HNSCC(33;0.089)																																						1	Substitution - coding silent(1)	ovary(1)	8											126.0	121.0	122.0					8																	77761834		2047	4214	6261	77924389	SO:0001819	synonymous_variant	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3732G>T	8.37:g.77761834G>T		Unknown		x	x	x	77924389	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	39	Broad																																																																																				0.473	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Silent
NDRG1	10397	broad.mit.edu	37	8	134296538	134296538	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr8:134296538T>C	ENST00000414097.2	-	2	884	c.17A>G	c.(16-18)cAg>cGg	p.Q6R	NDRG1_ENST00000518066.1_Missense_Mutation_p.Q6R|NDRG1_ENST00000522476.1_Intron|NDRG1_ENST00000537882.1_5'UTR|NDRG1_ENST00000354944.5_Missense_Mutation_p.Q6R|NDRG1_ENST00000518176.1_Missense_Mutation_p.Q6R|NDRG1_ENST00000323851.7_Missense_Mutation_p.Q6R	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	6					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)	p.Q6R(1)	NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GTCTACATCCTGCATCTCCCG	0.532			T	ERG	prostate																																		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	1	Substitution - Missense(1)	ovary(1)	8											217.0	158.0	178.0					8																	134296538		2203	4300	6503	134365720	SO:0001583	missense	10397			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.17A>G	8.37:g.134296538T>C	ENSP00000404854:p.Gln6Arg	Unknown		x	x	x	134365720	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	ENST00000414097.2	37	CCDS34945.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	15.99	2.994383	0.54041	.	.	ENSG00000104419	ENST00000323851;ENST00000537144;ENST00000354944;ENST00000414097;ENST00000518176;ENST00000518066;ENST00000520230;ENST00000519228;ENST00000519580;ENST00000522890;ENST00000520943;ENST00000521544;ENST00000522738	T;T;T;T;T;T;T;T;T;T	0.20738	2.1;2.05;2.1;2.09;2.14;2.16;2.16;2.12;2.16;2.05	5.03	5.03	0.67393	.	0.239665	0.43579	D	0.000549	T	0.22551	0.0544	L	0.59436	1.845	0.80722	D	1	B;B	0.18741	0.01;0.03	B;B	0.15484	0.007;0.013	T	0.03887	-1.0995	10	0.66056	D	0.02	-12.3457	11.0644	0.47966	0.0:0.0:0.0:1.0	.	6;6	E7ESM1;Q92597	.;NDRG1_HUMAN	R	6;6;6;6;6;6;23;6;6;6;17;6;60	ENSP00000319977:Q6R;ENSP00000347028:Q6R;ENSP00000404854:Q6R;ENSP00000428345:Q23R;ENSP00000429994:Q6R;ENSP00000429272:Q6R;ENSP00000428384:Q6R;ENSP00000429840:Q17R;ENSP00000429524:Q6R;ENSP00000428991:Q60R	ENSP00000319977:Q6R	Q	-	2	0	NDRG1	134365720	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	3.796000	0.55507	2.108000	0.64289	0.528000	0.53228	CAG		0.532	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378805.1			Missense_Mutation
MPDZ	8777	broad.mit.edu	37	9	13224504	13224504	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1466-01	TCGA-24-1466-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr9:13224504G>C	ENST00000319217.7	-	4	509	c.262C>G	c.(262-264)Ctg>Gtg	p.L88V	MPDZ_ENST00000546205.1_Missense_Mutation_p.L88V|MPDZ_ENST00000447879.1_Missense_Mutation_p.L88V|MPDZ_ENST00000536827.1_Missense_Mutation_p.L88V|MPDZ_ENST00000381015.4_Missense_Mutation_p.L88V|MPDZ_ENST00000381022.2_Missense_Mutation_p.L88V|MPDZ_ENST00000541718.1_Missense_Mutation_p.L88V	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	88					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.L88V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TCATTTTGCAGAGTAGGAATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	9											111.0	106.0	107.0					9																	13224504		1860	4096	5956	13214504	SO:0001583	missense	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.262C>G	9.37:g.13224504G>C	ENSP00000320006:p.Leu88Val	Somatic		x	x	x	13214504	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632675	0.29068	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.11277	2.84;2.79;2.79;2.8;2.84;2.84;2.84	5.34	3.34	0.38264	.	0.494435	0.15415	N	0.263554	T	0.05593	0.0147	N	0.19112	0.55	0.09310	N	1	B;P;B	0.38395	0.304;0.629;0.43	B;B;B	0.33960	0.084;0.115;0.173	T	0.27054	-1.0085	10	0.09843	T	0.71	.	9.1716	0.37086	0.1231:0.143:0.7339:0.0	.	88;88;88	B7ZMI4;O75970-3;O75970-2	.;.;.	V	88	ENSP00000320006:L88V;ENSP00000439807:L88V;ENSP00000370410:L88V;ENSP00000444151:L88V;ENSP00000415208:L88V;ENSP00000370403:L88V;ENSP00000446358:L88V	ENSP00000320006:L88V	L	-	1	2	MPDZ	13214504	0.001000	0.12720	0.097000	0.21041	0.966000	0.64601	0.918000	0.28678	1.461000	0.47929	0.655000	0.94253	CTG		0.403	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		Missense_Mutation
SPATA31E1	286234	broad.mit.edu	37	9	90502005	90502005	+	Missense_Mutation	SNP	C	C	T	rs147060985	byFrequency	TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr9:90502005C>T	ENST00000325643.5	+	4	2669	c.2603C>T	c.(2602-2604)cCg>cTg	p.P868L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	868					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P868L(1)									GCTCAGGCCCCGCCCTTCCCA	0.552													.|||	5	0.000998403	0.0038	0.0	5008	,	,		18788	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9						C	LEU/PRO	9,4397	15.5+/-35.6	0,9,2194	45.0	42.0	43.0		2603	-4.8	0.0	9	dbSNP_134	43	1,8599	1.2+/-3.3	0,1,4299	yes	missense	C9orf79	NM_178828.4	98	0,10,6493	TT,TC,CC		0.0116,0.2043,0.0769	benign	868/1446	90502005	10,12996	2203	4300	6503	89691825	SO:0001583	missense	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2603C>T	9.37:g.90502005C>T	ENSP00000322640:p.Pro868Leu	Unknown		x	x	x	89691825	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	SNP	23	Broad	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	c	0.006	-2.099055	0.00360	0.002043	1.16E-4	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.02944	4.1	2.46	-4.76	0.03229	.	2.239400	0.02564	N	0.097051	T	0.01222	0.0040	N	0.01505	-0.83	0.09310	N	1	B;B	0.21381	0.055;0.033	B;B	0.13407	0.003;0.009	T	0.46582	-0.9181	10	0.11182	T	0.66	.	9.4954	0.38984	0.0:0.2604:0.0:0.7396	.	868;520	Q6ZUB1;Q8NA33	CI079_HUMAN;.	L	868;520	ENSP00000322640:P868L	ENSP00000322640:P868L	P	+	2	0	C9orf79	89691825	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.428000	0.06991	-1.449000	0.01938	-0.259000	0.10710	CCG		0.552	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		Missense_Mutation
SPTAN1	6709	broad.mit.edu	37	9	131388958	131388958	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr9:131388958A>G	ENST00000372731.4	+	48	6663	c.6553A>G	c.(6553-6555)Atc>Gtc	p.I2185V	SPTAN1_ENST00000372739.3_Missense_Mutation_p.I2190V|SPTAN1_ENST00000358161.5_Missense_Mutation_p.I2190V	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	2185					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I2185V(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CCTACAGAAAATCATCAAGGT	0.602																																					NSCLC(120;833 1744 2558 35612 37579)											1	Substitution - Missense(1)	ovary(1)	9											29.0	33.0	32.0					9																	131388958		2203	4300	6503	130428779	SO:0001583	missense	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.6553A>G	9.37:g.131388958A>G	ENSP00000361816:p.Ile2185Val	Unknown		x	x	x	130428779	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	13.96	2.393323	0.42410	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.48836	0.8;0.8;0.8	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.64670	0.2619	L	0.54965	1.715	0.80722	D	1	B;D;P;B	0.65815	0.333;0.995;0.65;0.379	B;D;P;P	0.77557	0.267;0.99;0.658;0.549	T	0.66716	-0.5853	10	0.62326	D	0.03	.	15.6721	0.77286	1.0:0.0:0.0:0.0	.	1174;2165;2190;2185	Q9UG16;Q13813-3;Q13813-2;Q13813	.;.;.;SPTA2_HUMAN	V	2190;2185;2190;2165;434	ENSP00000350882:I2190V;ENSP00000361816:I2185V;ENSP00000361824:I2190V	ENSP00000350882:I2190V	I	+	1	0	SPTAN1	130428779	1.000000	0.71417	0.998000	0.56505	0.605000	0.37080	8.947000	0.93000	2.099000	0.63709	0.460000	0.39030	ATC		0.602	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		Missense_Mutation
FRMPD4	9758	broad.mit.edu	37	X	12712557	12712557	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1466-01	TCGA-24-1466-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chrX:12712557A>G	ENST00000380682.1	+	9	1423	c.917A>G	c.(916-918)gAg>gGg	p.E306G		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	306	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E306G(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GTTGCTTTCGAGTATCTCTAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	X											114.0	96.0	102.0					X																	12712557		2203	4300	6503	12622478	SO:0001583	missense	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.917A>G	X.37:g.12712557A>G	ENSP00000370057:p.Glu306Gly	Somatic		x	x	x	12622478	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349630	0.82132	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.79554	-1.28	5.02	5.02	0.67125	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.88503	0.6454	M	0.73217	2.22	0.49915	D	0.999839	D;D	0.76494	0.999;0.971	D;P	0.83275	0.996;0.727	D	0.89711	0.3912	10	0.72032	D	0.01	.	14.1021	0.65062	1.0:0.0:0.0:0.0	.	298;306	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	G	306;297;295	ENSP00000370057:E306G	ENSP00000304583:E295G	E	+	2	0	FRMPD4	12622478	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	8.818000	0.91991	1.775000	0.52247	0.417000	0.27973	GAG		0.383	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		Missense_Mutation
LAS1L	81887	broad.mit.edu	37	X	64743484	64743484	+	Silent	SNP	G	G	A			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chrX:64743484G>A	ENST00000374811.3	-	11	1444	c.1404C>T	c.(1402-1404)tcC>tcT	p.S468S	LAS1L_ENST00000374804.5_Silent_p.S409S|LAS1L_ENST00000374807.5_Silent_p.S451S|LAS1L_ENST00000312391.8_3'UTR	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	468					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S468S(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						AGCCCAAGCAGGACTCAACCA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	X											39.0	30.0	33.0					X																	64743484		2200	4300	6500	64660209	SO:0001819	synonymous_variant	81887			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1404C>T	X.37:g.64743484G>A		Unknown		x	x	x	64660209	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Silent	SNP	ENST00000374811.3	37	CCDS14381.1	SNP	35	Broad																																																																																				0.602	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206		Silent
PHKA1	5255	broad.mit.edu	37	X	71864275	71864275	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1466-01	TCGA-24-1466-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chrX:71864275C>A	ENST00000373542.4	-	14	1555	c.1396G>T	c.(1396-1398)Gct>Tct	p.A466S	PHKA1_ENST00000339490.3_Missense_Mutation_p.A466S|PHKA1_ENST00000373545.3_Missense_Mutation_p.A466S|PHKA1_ENST00000541944.1_Missense_Mutation_p.A466S|PHKA1_ENST00000373539.3_Missense_Mutation_p.A466S	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	466					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.A466S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TATACCTCAGCAATGGTCTCC	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											186.0	129.0	148.0					X																	71864275		2203	4300	6503	71781000	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1396G>T	X.37:g.71864275C>A	ENSP00000362643:p.Ala466Ser	Somatic		x	x	x	71781000	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	15.94	2.979814	0.53827	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.90844	-2.72;-2.74;-2.71;-2.72;-2.72	5.62	5.62	0.85841	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.88742	0.6519	L	0.37630	1.12	0.58432	D	0.999999	P;B;B	0.44521	0.837;0.014;0.08	P;B;B	0.49799	0.622;0.036;0.088	D	0.85559	0.1226	10	0.09338	T	0.73	-16.8414	15.9105	0.79470	0.0:1.0:0.0:0.0	.	466;466;466	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	S	466	ENSP00000362646:A466S;ENSP00000362643:A466S;ENSP00000441251:A466S;ENSP00000342469:A466S;ENSP00000362640:A466S	ENSP00000342469:A466S	A	-	1	0	PHKA1	71781000	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.886000	0.56190	2.356000	0.79943	0.523000	0.50628	GCT		0.438	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1			Missense_Mutation
NAV1	89796	broad.mit.edu	37	1	201749593	201749596	+	Frame_Shift_Del	DEL	CAGA	CAGA	-			TCGA-24-1466-01	TCGA-24-1466-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1466-01	TCGA-24-1466-10	g.chr1:201749593_201749596delCAGA	ENST00000367296.4	+	4	1691_1694	c.1271_1274delCAGA	c.(1270-1275)tcagacfs	p.SD424fs	NAV1_ENST00000367295.1_Frame_Shift_Del_p.SD33fs|NAV1_ENST00000367300.3_Frame_Shift_Del_p.SD424fs|NAV1_ENST00000295624.6_Frame_Shift_Del_p.SD424fs|NAV1_ENST00000367297.4_Frame_Shift_Del_p.SD424fs|NAV1_ENST00000367302.1_Frame_Shift_Del_p.SD437fs|IPO9-AS1_ENST00000413035.1_RNA	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	424					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.D425fs*29(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						AGCGATGCCTCAGACAATCTCAGT	0.485																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								200016219	SO:0001589	frameshift_variant	89796			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1271_1274delCAGA	1.37:g.201749593_201749596delCAGA	ENSP00000356265:p.Ser424fs	Unknown		Capture	Illumina GAIIx	Phase_I	200016216	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Frame_Shift_Del	DEL	ENST00000367296.4	37	CCDS1414.2	DEL	29	Broad																																																																																				0.485	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		Frame_Shift_Del
