#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ARHGAP17	55114	hgsc.bcm.edu	37	16	24958825	24958827	+	In_Frame_Del	DEL	AGT	AGT	-			TCGA-24-1548-01	TCGA-24-1548-10	AGT	AGT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr16:24958825_24958827delAGT	ENST00000289968.6	-	14	1286_1288	c.1217_1219delACT	c.(1216-1221)aacttg>atg	p.406_407NL>M	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_In_Frame_Del_p.406_407NL>M	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	406	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)	p.N406_L407>M(1)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		GCCCATAACAAGTTAGGGCCTAA	0.414																																																1	Complex - deletion inframe(1)	ovary(1)	16																																								24866328	SO:0001651	inframe_deletion	55114			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1217_1219delACT	16.37:g.24958825_24958827delAGT	ENSP00000289968:p.Asn406_Leu407delinsMet	Somatic		Capture	SOLID	Phase_III	24866326	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	In_Frame_Del	DEL	ENST00000289968.6	37	CCDS32409.1	DEL	3	Baylor																																																																																				0.414	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		In_Frame_Del
ARHGAP6	395	hgsc.bcm.edu	37	X	11187694	11187694	+	Silent	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chrX:11187694C>T	ENST00000337414.4	-	9	2612	c.1740G>A	c.(1738-1740)cgG>cgA	p.R580R	ARHGAP6_ENST00000413512.3_Silent_p.R389R|ARHGAP6_ENST00000380736.1_Silent_p.R377R|ARHGAP6_ENST00000380732.3_Silent_p.R612R|ARHGAP6_ENST00000380718.1_Silent_p.R580R|ARHGAP6_ENST00000303025.6_Silent_p.R377R|ARHGAP6_ENST00000534860.1_Silent_p.R405R|ARHGAP6_ENST00000491514.1_5'UTR	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	580	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCTCCTCAGCCCGGGCTGAAC	0.468																																																0			X											159.0	126.0	137.0					X																	11187694		2203	4300	6503	11097615	SO:0001819	synonymous_variant	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1740G>A	X.37:g.11187694C>T		Somatic		Capture	SOLID	Phase_III	11097615	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Silent	SNP	ENST00000337414.4	37	CCDS14140.1	SNP	22	Baylor																																																																																				0.468	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427		Silent
C19orf57	79173	hgsc.bcm.edu	37	19	14001101	14001101	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr19:14001101G>T	ENST00000586783.1	-	5	567	c.568C>A	c.(568-570)Cag>Aag	p.Q190K	C19orf57_ENST00000591586.1_Intron|C19orf57_ENST00000454313.1_Missense_Mutation_p.Q190K|C19orf57_ENST00000346736.2_Missense_Mutation_p.Q190K			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	190					multicellular organismal development (GO:0007275)			p.Q190K(1)		breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TCATCAGGCTGAGAATCCCCA	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	63.0	64.0					19																	14001101		2203	4300	6503	13862101	SO:0001583	missense	79173			BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.568C>A	19.37:g.14001101G>T	ENSP00000465822:p.Gln190Lys	Somatic		Capture	SOLID	Phase_III	13862101	Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	37		SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732448	0.48939	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.28666	1.6;1.6	3.34	3.34	0.38264	.	2.079320	0.02703	N	0.111993	T	0.34164	0.0888	L	0.29908	0.895	0.09310	N	1	P;P	0.50528	0.936;0.936	P;P	0.47744	0.556;0.556	T	0.37478	-0.9704	10	0.62326	D	0.03	2.8472	10.4194	0.44341	0.0:0.0:1.0:0.0	.	190;190	Q0VDD7-2;Q0VDD7	.;CS057_HUMAN	K	190	ENSP00000404382:Q190K;ENSP00000254336:Q190K	ENSP00000254336:Q190K	Q	-	1	0	C19orf57	13862101	0.000000	0.05858	0.024000	0.17045	0.189000	0.23516	-0.091000	0.11146	2.155000	0.67459	0.491000	0.48974	CAG		0.672	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323		Missense_Mutation
ERICH3	127254	hgsc.bcm.edu	37	1	75038387	75038387	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr1:75038387C>A	ENST00000326665.5	-	14	3225	c.3007G>T	c.(3007-3009)Gca>Tca	p.A1003S	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1003	Glu-rich.							p.A1003S(1)|p.A1003T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						ATCCGGCTTGCCTCTGCCTCT	0.532																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	1											103.0	93.0	96.0					1																	75038387		2203	4300	6503	74810975	SO:0001583	missense	127254																														ENST00000326665.5:c.3007G>T	1.37:g.75038387C>A	ENSP00000322609:p.Ala1003Ser	Somatic		Capture	SOLID	Phase_III	74810975	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858791	0.51376	.	.	ENSG00000178965	ENST00000326665	T	0.25749	1.78	4.33	2.38	0.29361	.	.	.	.	.	T	0.05640	0.0148	L	0.40543	1.245	0.09310	N	1	B	0.29432	0.244	B	0.28638	0.092	T	0.38499	-0.9658	9	0.09590	T	0.72	-0.4034	6.0902	0.19991	0.155:0.6594:0.0:0.1856	.	1003	Q5RHP9	CA173_HUMAN	S	1003	ENSP00000322609:A1003S	ENSP00000322609:A1003S	A	-	1	0	C1orf173	74810975	0.000000	0.05858	0.032000	0.17829	0.025000	0.11179	0.062000	0.14389	0.947000	0.37659	0.462000	0.41574	GCA		0.532	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			Missense_Mutation
CHST15	51363	hgsc.bcm.edu	37	10	125780792	125780794	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-24-1548-01	TCGA-24-1548-10	TGT	TGT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr10:125780792_125780794delTGT	ENST00000346248.5	-	6	1967_1969	c.1325_1327delACA	c.(1324-1329)aacacc>acc	p.N442del	CHST15_ENST00000421115.1_In_Frame_Del_p.N442del|CHST15_ENST00000435907.1_In_Frame_Del_p.N442del	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	442					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)	p.N442delN(1)		endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						TTGTTGAGGGTGTTGTTGTAGAC	0.537																																																1	Deletion - In frame(1)	ovary(1)	10																																								125770784	SO:0001651	inframe_deletion	51363			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1325_1327delACA	10.37:g.125780798_125780800delTGT	ENSP00000333947:p.Asn442del	Somatic		Capture	SOLID	Phase_III	125770782	O60338|O60474|Q86VM4	In_Frame_Del	DEL	ENST00000346248.5	37	CCDS7638.1	DEL	59	Baylor																																																																																				0.537	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892		In_Frame_Del
CUBN	8029	hgsc.bcm.edu	37	10	16992051	16992051	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr10:16992051G>C	ENST00000377833.4	-	34	5094	c.5029C>G	c.(5029-5031)Cgt>Ggt	p.R1677G		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1677	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.R1677G(1)|p.R1677C(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAAAGTCACGTGCACACGTT	0.463																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	10											82.0	74.0	77.0					10																	16992051		2203	4300	6503	17032057	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5029C>G	10.37:g.16992051G>C	ENSP00000367064:p.Arg1677Gly	Somatic		Capture	SOLID	Phase_III	17032057	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.109	1.005988	0.19199	.	.	ENSG00000107611	ENST00000377833	T	0.17854	2.25	6.08	1.95	0.26073	CUB (5);	2.072390	0.03210	N	0.176109	T	0.13970	0.0338	L	0.33668	1.02	0.09310	N	1	P	0.41624	0.757	B	0.39419	0.299	T	0.17198	-1.0377	10	0.27082	T	0.32	.	4.2995	0.10918	0.0676:0.2297:0.314:0.3888	.	1677	O60494	CUBN_HUMAN	G	1677	ENSP00000367064:R1677G	ENSP00000367064:R1677G	R	-	1	0	CUBN	17032057	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.866000	0.27954	0.097000	0.17492	-0.175000	0.13238	CGT		0.463	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		Missense_Mutation
DUOX1	53905	hgsc.bcm.edu	37	15	45436386	45436386	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr15:45436386C>G	ENST00000321429.4	+	18	2496	c.2089C>G	c.(2089-2091)Cgt>Ggt	p.R697G	DUOX1_ENST00000561166.1_Missense_Mutation_p.R343G|DUOX1_ENST00000389037.3_Missense_Mutation_p.R697G	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	697					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.R697G(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GTCCAGCAACCGTGGACGCCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	15											89.0	73.0	78.0					15																	45436386		2198	4298	6496	43223678	SO:0001583	missense	53905			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2089C>G	15.37:g.45436386C>G	ENSP00000317997:p.Arg697Gly	Somatic		Capture	SOLID	Phase_III	43223678	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025756	0.35701	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.85955	-2.05;-2.05	4.78	4.78	0.61160	.	0.631546	0.17728	N	0.163990	D	0.82857	0.5128	L	0.58101	1.795	0.45621	D	0.998551	B	0.27068	0.167	B	0.30495	0.116	T	0.77621	-0.2519	10	0.17832	T	0.49	-0.7754	15.688	0.77426	0.0:1.0:0.0:0.0	.	697	Q9NRD9	DUOX1_HUMAN	G	697	ENSP00000317997:R697G;ENSP00000373689:R697G	ENSP00000317997:R697G	R	+	1	0	DUOX1	43223678	0.866000	0.29940	0.992000	0.48379	0.678000	0.39670	1.656000	0.37355	2.631000	0.89168	0.655000	0.94253	CGT		0.622	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434		Missense_Mutation
F8	2157	hgsc.bcm.edu	37	X	154185254	154185254	+	Missense_Mutation	SNP	G	G	T	rs28937282		TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chrX:154185254G>T	ENST00000360256.4	-	11	1930	c.1730C>A	c.(1729-1731)tCt>tAt	p.S577Y		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	577	F5/8 type A 2.		S -> F (in HEMA; mild). {ECO:0000269|PubMed:8449505}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.S577Y(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TTGATCTACAGATTCTTTGTA	0.438																																																2	Substitution - Missense(2)	ovary(2)	X	GRCh37	CM930220	F8	M	rs28937282						174.0	159.0	164.0					X																	154185254		2203	4300	6503	153838448	SO:0001583	missense	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.1730C>A	X.37:g.154185254G>T	ENSP00000353393:p.Ser577Tyr	Somatic		Capture	SOLID	Phase_III	153838448	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170969	0.78452	.	.	ENSG00000185010	ENST00000360256	D	0.99080	-5.4	5.19	5.19	0.71726	Cupredoxin (2);	0.310852	0.35555	N	0.003128	D	0.99296	0.9754	M	0.85630	2.765	0.40864	D	0.983851	D	0.89917	1.0	D	0.81914	0.995	D	0.99671	1.0996	10	0.87932	D	0	-15.4012	16.3181	0.82935	0.0:0.0:1.0:0.0	.	577	P00451	FA8_HUMAN	Y	577	ENSP00000353393:S577Y	ENSP00000353393:S577Y	S	-	2	0	F8	153838448	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.847000	0.75404	2.155000	0.67459	0.600000	0.82982	TCT		0.438	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			Missense_Mutation
FBXO24	26261	hgsc.bcm.edu	37	7	100190453	100190453	+	Silent	SNP	C	C	T	rs374971411		TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr7:100190453C>T	ENST00000241071.6	+	5	928	c.606C>T	c.(604-606)taC>taT	p.Y202Y	FBXO24_ENST00000465843.1_Silent_p.Y188Y|FBXO24_ENST00000468962.1_Silent_p.Y190Y|FBXO24_ENST00000427939.2_Silent_p.Y240Y|PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000360609.2_Silent_p.Y188Y|PCOLCE-AS1_ENST00000442166.2_RNA	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	202					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.Y202Y(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					AATACCTCTACGTCTTGGCCA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	7						T	,,	1,4405	826.1+/-416.6	0,1,2202	63.0	59.0	61.0		570,720,606	-6.9	0.7	7		61	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	FBXO24	NM_001163499.1,NM_012172.4,NM_033506.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	190/569,240/619,202/581	100190453	1,13005	2203	4300	6503	100028389	SO:0001819	synonymous_variant	26261			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.606C>T	7.37:g.100190453C>T		Somatic		Capture	SOLID	Phase_III	100028389	A4D2D4|B4DX91|B4DY42|Q9H0G1	Silent	SNP	ENST00000241071.6	37	CCDS5698.1	SNP	19	Baylor																																																																																				0.567	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1			Silent
FCRL6	343413	hgsc.bcm.edu	37	1	159779317	159779317	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr1:159779317G>A	ENST00000368106.3	+	5	731	c.730G>A	c.(730-732)Gat>Aat	p.D244N	FCRL6_ENST00000321935.6_Missense_Mutation_p.D251N|FCRL6_ENST00000392235.3_Missense_Mutation_p.D149N|FCRL6_ENST00000339348.5_Missense_Mutation_p.D244N	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	244	Ig-like C2-type 3.					external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D244N(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					CTTCTACCTTGATGAGAAGAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	71.0	72.0					1																	159779317		2203	4300	6503	158045941	SO:0001583	missense	343413			AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.730G>A	1.37:g.159779317G>A	ENSP00000357086:p.Asp244Asn	Somatic		Capture	SOLID	Phase_III	158045941	A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	ENST00000368106.3	37	CCDS30912.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	g	8.977	0.974361	0.18736	.	.	ENSG00000181036	ENST00000321935;ENST00000339348;ENST00000392235;ENST00000368106	T;T;T;T	0.15017	2.46;2.46;2.46;2.46	3.91	-6.2	0.02072	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.142910	0.06898	N	0.805548	T	0.02533	0.0077	N	0.16307	0.4	0.09310	N	1	B;B;B;B	0.32573	0.001;0.376;0.058;0.081	B;B;B;B	0.35607	0.02;0.206;0.047;0.046	T	0.38436	-0.9661	9	.	.	.	.	6.3187	0.21204	0.6714:0.0:0.1878:0.1408	.	244;149;244;251	Q6DN72-3;Q6DN72-4;Q6DN72;Q6DN72-2	.;.;FCRL6_HUMAN;.	N	251;244;149;244	ENSP00000320625:D251N;ENSP00000340949:D244N;ENSP00000376068:D149N;ENSP00000357086:D244N	.	D	+	1	0	FCRL6	158045941	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.737000	0.04877	-1.251000	0.02494	-0.958000	0.02645	GAT		0.587	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276853.1	NM_001004310		Missense_Mutation
GABRG1	2565	hgsc.bcm.edu	37	4	46053582	46053582	+	Silent	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr4:46053582C>T	ENST00000295452.4	-	8	1157	c.990G>A	c.(988-990)gtG>gtA	p.V330V		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	330					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V330V(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCATCGCAGTCACATAAGAAA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	4											104.0	96.0	98.0					4																	46053582		2203	4300	6503	45748339	SO:0001819	synonymous_variant	2565			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.990G>A	4.37:g.46053582C>T		Somatic		Capture	SOLID	Phase_III	45748339	Q5H9T8	Silent	SNP	ENST00000295452.4	37	CCDS3470.1	SNP	29	Baylor																																																																																				0.378	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		Silent
GUCY1A3	2982	hgsc.bcm.edu	37	4	156631727	156631727	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr4:156631727G>A	ENST00000296518.7	+	6	619	c.410G>A	c.(409-411)gGt>gAt	p.G137D	GUCY1A3_ENST00000511507.1_Missense_Mutation_p.G137D|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.G137D|GUCY1A3_ENST00000515602.1_3'UTR|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.G137D|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.G137D|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.G137D|GUCY1A3_ENST00000393832.3_5'UTR			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	137					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.G137D(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GAATCTCTTGGTGAAGAGGTT	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											70.0	76.0	74.0					4																	156631727		2202	4300	6502	156851177	SO:0001583	missense	2982				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.410G>A	4.37:g.156631727G>A	ENSP00000296518:p.Gly137Asp	Somatic		Capture	SOLID	Phase_III	156851177	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888389	0.91814	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000296518;ENST00000513574	D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	5.55	5.55	0.83447	Heme-NO binding (1);	0.000000	0.64402	D	0.000005	D	0.93785	0.8013	M	0.78456	2.415	0.80722	D	1	D;D;D	0.65815	0.995;0.995;0.995	D;D;D	0.79108	0.987;0.987;0.992	D	0.93900	0.7187	10	0.87932	D	0	.	19.8522	0.96745	0.0:0.0:1.0:0.0	.	137;137;137	B3KU69;Q02108;D6RDW3	.;GCYA3_HUMAN;.	D	137	ENSP00000424361:G137D;ENSP00000421493:G137D;ENSP00000426968:G137D;ENSP00000412201:G137D;ENSP00000296518:G137D;ENSP00000426040:G137D	ENSP00000296518:G137D	G	+	2	0	GUCY1A3	156851177	1.000000	0.71417	0.880000	0.34516	0.980000	0.70556	9.062000	0.93920	2.769000	0.95229	0.637000	0.83480	GGT		0.393	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			Missense_Mutation
HTATSF1	27336	hgsc.bcm.edu	37	X	135592337	135592337	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chrX:135592337C>T	ENST00000218364.4	+	8	1195	c.1021C>T	c.(1021-1023)Caa>Taa	p.Q341*	HTATSF1_ENST00000535601.1_Nonsense_Mutation_p.Q341*	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	341	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q341*(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					TGGTGGCCGTCAAATCACTGC	0.473																																																1	Substitution - Nonsense(1)	ovary(1)	X											208.0	189.0	195.0					X																	135592337		2203	4300	6503	135420003	SO:0001587	stop_gained	27336			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1021C>T	X.37:g.135592337C>T	ENSP00000218364:p.Gln341*	Somatic		Capture	SOLID	Phase_III	135420003	D3DWG9|Q59G06|Q99730	Nonsense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	41	9.060350	0.99051	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	.	.	.	5.63	4.75	0.60458	.	0.052094	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-15.097	14.9324	0.70926	0.1439:0.8561:0.0:0.0	.	.	.	.	X	341	.	ENSP00000218364:Q341X	Q	+	1	0	HTATSF1	135420003	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	3.498000	0.53302	1.097000	0.41459	0.538000	0.68166	CAA		0.473	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		Nonsense_Mutation
ITIH5	80760	hgsc.bcm.edu	37	10	7618969	7618969	+	Nonsense_Mutation	SNP	G	G	C	rs148515073		TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr10:7618969G>C	ENST00000256861.6	-	10	1503	c.1425C>G	c.(1423-1425)taC>taG	p.Y475*	ITIH5_ENST00000298441.6_Nonsense_Mutation_p.Y261*|ITIH5_ENST00000397145.2_Nonsense_Mutation_p.Y475*|ITIH5_ENST00000397146.2_Nonsense_Mutation_p.Y475*|ITIH5_ENST00000446830.2_Nonsense_Mutation_p.Y257*|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	475	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Y475*(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGATTTCATCGTAGAACCTGC	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	10											47.0	47.0	47.0					10																	7618969		2203	4300	6503	7658975	SO:0001587	stop_gained	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1425C>G	10.37:g.7618969G>C	ENSP00000256861:p.Tyr475*	Somatic		Capture	SOLID	Phase_III	7658975	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Nonsense_Mutation	SNP	ENST00000256861.6	37		SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757129	0.69648	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	.	.	.	5.57	-3.72	0.04411	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.0563	14.8167	0.70039	0.6925:0.0:0.3075:0.0	.	.	.	.	X	475;475;261;257;475	.	ENSP00000256861:Y475X	Y	-	3	2	ITIH5	7658975	0.003000	0.15002	0.757000	0.31301	0.112000	0.19704	-1.135000	0.03225	-1.214000	0.02614	-0.448000	0.05591	TAC		0.577	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		Nonsense_Mutation
KHK	3795	hgsc.bcm.edu	37	2	27319663	27319663	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr2:27319663C>G	ENST00000260599.6	+	4	924	c.411C>G	c.(409-411)caC>caG	p.H137Q	KHK_ENST00000490823.1_3'UTR|KHK_ENST00000260598.5_Missense_Mutation_p.H137Q	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	137					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTGGATCCACATTGAGGTAA	0.498																																																0			2											148.0	124.0	132.0					2																	27319663		2203	4300	6503	27173167	SO:0001583	missense	3795				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.411C>G	2.37:g.27319663C>G	ENSP00000260599:p.His137Gln	Somatic		Capture	SOLID	Phase_III	27173167	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	ENST00000260599.6	37	CCDS1734.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335004	0.81801	.	.	ENSG00000138030	ENST00000260599;ENST00000260598;ENST00000429697	T;T;T	0.66995	-0.24;-0.24;-0.24	5.94	5.06	0.68205	Carbohydrate/purine kinase (1);	0.046798	0.85682	D	0.000000	D	0.83635	0.5297	M	0.90019	3.08	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.996;1.0	D	0.85990	0.1488	10	0.87932	D	0	-9.0987	12.156	0.54077	0.0:0.9185:0.0:0.0815	.	137;137;137;137	Q53G56;Q6IBK2;P50053-2;P50053	.;.;.;KHK_HUMAN	Q	137;137;182	ENSP00000260599:H137Q;ENSP00000260598:H137Q;ENSP00000404741:H182Q	ENSP00000260598:H137Q	H	+	3	2	KHK	27173167	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.859000	0.48364	2.826000	0.97356	0.561000	0.74099	CAC		0.498	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1			Missense_Mutation
KIAA2022	340533	hgsc.bcm.edu	37	X	73963172	73963172	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chrX:73963172G>T	ENST00000055682.6	-	3	1831	c.1220C>A	c.(1219-1221)cCt>cAt	p.P407H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	407					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.P407H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						ATTTAAGGCAGGCTTTTCTCC	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											254.0	215.0	228.0					X																	73963172		2203	4300	6503	73879897	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1220C>A	X.37:g.73963172G>T	ENSP00000055682:p.Pro407His	Somatic		Capture	SOLID	Phase_III	73879897	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.521	1.108340	0.20714	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29917	1.55;1.55	6.03	3.29	0.37713	.	1.722310	0.02434	N	0.083888	T	0.23054	0.0557	N	0.22421	0.69	0.09310	N	1	P	0.36315	0.547	B	0.37047	0.24	T	0.23297	-1.0192	10	0.15499	T	0.54	1.799	6.4722	0.22015	0.209:0.0:0.6616:0.1294	.	407	Q5QGS0	K2022_HUMAN	H	407	ENSP00000362567:P407H;ENSP00000055682:P407H	ENSP00000055682:P407H	P	-	2	0	KIAA2022	73879897	1.000000	0.71417	0.938000	0.37757	0.868000	0.49771	3.486000	0.53215	0.264000	0.21851	0.600000	0.82982	CCT		0.438	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Missense_Mutation
LAMA1	284217	hgsc.bcm.edu	37	18	6999480	6999480	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr18:6999480C>A	ENST00000389658.3	-	32	4720	c.4627G>T	c.(4627-4629)Gaa>Taa	p.E1543*		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1543	Laminin EGF-like 17. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.E1543*(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TGCCTCGGTTCACACTCATCG	0.532																																																1	Substitution - Nonsense(1)	ovary(1)	18											47.0	41.0	43.0					18																	6999480		2203	4300	6503	6989480	SO:0001587	stop_gained	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4627G>T	18.37:g.6999480C>A	ENSP00000374309:p.Glu1543*	Somatic		Capture	SOLID	Phase_III	6989480		Nonsense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	42	9.399418	0.99159	.	.	ENSG00000101680	ENST00000389658	.	.	.	5.87	0.605	0.17553	.	0.319872	0.31484	N	0.007567	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	9.3014	0.37847	0.0:0.4823:0.3847:0.133	.	.	.	.	X	1543	.	ENSP00000374309:E1543X	E	-	1	0	LAMA1	6989480	1.000000	0.71417	0.660000	0.29694	0.077000	0.17291	0.933000	0.28897	0.375000	0.24679	0.655000	0.94253	GAA		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		Nonsense_Mutation
LRP1B	53353	hgsc.bcm.edu	37	2	141777630	141777630	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1548-01	TCGA-24-1548-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr2:141777630T>G	ENST00000389484.3	-	12	2802	c.1831A>C	c.(1831-1833)Aat>Cat	p.N611H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	611					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.N611H(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAAAGATTATTTCCAATCCAG	0.368										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											108.0	107.0	107.0					2																	141777630		2203	4300	6503	141494100	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1831A>C	2.37:g.141777630T>G	ENSP00000374135:p.Asn611His	Somatic		Capture	SOLID	Phase_III	141494100	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.88	1.474181	0.26423	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.96554	-4.05	5.14	2.69	0.31865	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.065576	0.64402	U	0.000016	D	0.92338	0.7569	L	0.41124	1.26	0.42572	D	0.993183	B	0.14438	0.01	B	0.19391	0.025	D	0.85962	0.1471	10	0.39692	T	0.17	.	8.184	0.31328	0.0:0.0705:0.1344:0.7951	.	611	Q9NZR2	LRP1B_HUMAN	H	611;549	ENSP00000374135:N611H	ENSP00000374135:N611H	N	-	1	0	LRP1B	141494100	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.209000	0.42806	0.334000	0.23590	-0.388000	0.06559	AAT		0.368	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
MAP2K4	6416	hgsc.bcm.edu	37	17	11984782	11984782	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr17:11984782C>T	ENST00000353533.5	+	3	391	c.328C>T	c.(328-330)Cga>Tga	p.R110*	MIR744_ENST00000578242.1_RNA|MAP2K4_ENST00000415385.3_Nonsense_Mutation_p.R121*|MAP2K4_ENST00000581941.1_3'UTR	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.R110*(2)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		AGAAATTGGACGAGGAGCTTA	0.418			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	13	Whole gene deletion(10)|Substitution - Nonsense(2)|Unknown(1)	ovary(5)|breast(4)|biliary_tract(1)|stomach(1)|large_intestine(1)|pancreas(1)	17											90.0	82.0	84.0					17																	11984782		2203	4300	6503	11925507	SO:0001587	stop_gained	6416			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.328C>T	17.37:g.11984782C>T	ENSP00000262445:p.Arg110*	Somatic		Capture	SOLID	Phase_III	11925507	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Nonsense_Mutation	SNP	ENST00000353533.5	37	CCDS11162.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	36	5.628544	0.96671	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0133	0.89231	0.0:1.0:0.0:0.0	.	.	.	.	X	110;121;87	.	ENSP00000262445:R110X	R	+	1	2	MAP2K4	11925507	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.910000	0.69931	2.628000	0.89032	0.561000	0.74099	CGA		0.418	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1			Nonsense_Mutation
MSH6	2956	hgsc.bcm.edu	37	2	48033695	48033695	+	Silent	SNP	A	A	G			TCGA-24-1548-01	TCGA-24-1548-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr2:48033695A>G	ENST00000234420.5	+	9	4058	c.3906A>G	c.(3904-3906)gcA>gcG	p.A1302A	MSH6_ENST00000540021.1_Silent_p.A1172A|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_Silent_p.A1000A	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1302					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCTTTAATGCAGCAAGGCTTG	0.398			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	2											52.0	54.0	53.0					2																	48033695		2203	4300	6503	47887199	SO:0001819	synonymous_variant	2956	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3906A>G	2.37:g.48033695A>G		Somatic		Capture	SOLID	Phase_III	47887199	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Silent	SNP	ENST00000234420.5	37	CCDS1836.1	SNP	7	Baylor																																																																																				0.398	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179		Silent
NPAS4	266743	hgsc.bcm.edu	37	11	66191485	66191487	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-24-1548-01	TCGA-24-1548-10	TCC	TCC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr11:66191485_66191487delTCC	ENST00000311034.2	+	7	1300_1302	c.1124_1126delTCC	c.(1123-1128)ttcccc>tcc	p.375_376FP>S		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	375					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.F375_P376>S(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						AGCACCAGCTTCCCCAGTGCTCC	0.547																																																1	Complex - deletion inframe(1)	ovary(1)	11																																								65948063	SO:0001651	inframe_deletion	266743			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1124_1126delTCC	11.37:g.66191485_66191487delTCC	ENSP00000311196:p.Phe375_Pro376delinsSer	Somatic		Capture	SOLID	Phase_III	65948061	B7ZL81|Q8N8S5|Q8N9Q9	In_Frame_Del	DEL	ENST00000311034.2	37	CCDS8138.1	DEL	62	Baylor																																																																																				0.547	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864		In_Frame_Del
OR10H1	26539	hgsc.bcm.edu	37	19	15918177	15918177	+	Missense_Mutation	SNP	G	G	T	rs62619246	byFrequency	TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr19:15918177G>T	ENST00000334920.2	-	1	759	c.671C>A	c.(670-672)gCc>gAc	p.A224D		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A224D(3)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						CAAGATGGCGGCCACGATGAA	0.582																																																3	Substitution - Missense(3)	kidney(3)	19											79.0	66.0	70.0					19																	15918177		2202	4279	6481	15779177	SO:0001583	missense	26539			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.671C>A	19.37:g.15918177G>T	ENSP00000335596:p.Ala224Asp	Somatic		Capture	SOLID	Phase_III	15779177	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	SNP	42	Baylor	121	0.0554029304029304	40	0.08130081300813008	15	0.04143646408839779	47	0.08216783216783216	19	0.025065963060686015	.	9.676	1.148119	0.21288	.	.	ENSG00000186723	ENST00000334920	T	0.38077	1.16	4.96	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000141	T	0.05273	0.0140	M	0.82433	2.59	0.09310	N	1	D	0.53885	0.963	P	0.62649	0.905	T	0.04440	-1.0951	10	0.66056	D	0.02	.	5.0438	0.14473	0.1886:0.1747:0.6367:0.0	rs62619246	224	Q9Y4A9	O10H1_HUMAN	D	224	ENSP00000335596:A224D	ENSP00000335596:A224D	A	-	2	0	OR10H1	15779177	0.000000	0.05858	0.293000	0.24932	0.082000	0.17680	0.466000	0.22019	0.463000	0.27118	0.643000	0.83706	GCC		0.582	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1			Missense_Mutation
OR10H1	26539	hgsc.bcm.edu	37	19	15918201	15918201	+	Missense_Mutation	SNP	A	A	G	rs201868341	byFrequency	TCGA-24-1548-01	TCGA-24-1548-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr19:15918201A>G	ENST00000334920.2	-	1	735	c.647T>C	c.(646-648)cTc>cCc	p.L216P		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L216P(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						ATAGGAGAGGAGGATGAGGAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											97.0	79.0	85.0					19																	15918201		2203	4294	6497	15779201	SO:0001583	missense	26539			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.647T>C	19.37:g.15918201A>G	ENSP00000335596:p.Leu216Pro	Somatic		Capture	SOLID	Phase_III	15779201	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	SNP	11	Baylor	19	0.0086996336996337	2	0.0040650406504065045	4	0.011049723756906077	3	0.005244755244755245	10	0.013192612137203167	.	13.80	2.346237	0.41599	.	.	ENSG00000186723	ENST00000334920	T	0.00277	8.34	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.158488	0.29660	N	0.011531	T	0.00580	0.0019	M	0.90814	3.15	0.38102	D	0.937307	D	0.69078	0.997	D	0.72075	0.976	T	0.62397	-0.6863	10	0.72032	D	0.01	.	12.5636	0.56297	1.0:0.0:0.0:0.0	.	216	Q9Y4A9	O10H1_HUMAN	P	216	ENSP00000335596:L216P	ENSP00000335596:L216P	L	-	2	0	OR10H1	15779201	0.049000	0.20398	0.996000	0.52242	0.682000	0.39822	3.435000	0.52849	1.853000	0.53794	0.523000	0.50628	CTC		0.577	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1			Missense_Mutation
OR13A1	79290	hgsc.bcm.edu	37	10	45799065	45799065	+	Missense_Mutation	SNP	T	T	A	rs35302355|rs376671137	byFrequency	TCGA-24-1548-01	TCGA-24-1548-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr10:45799065T>A	ENST00000553795.1	-	4	1114	c.806A>T	c.(805-807)tAt>tTt	p.Y269F	OR13A1_ENST00000374401.2_Missense_Mutation_p.Y269F|OR13A1_ENST00000536058.1_Missense_Mutation_p.Y269F	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						AGCGGTGTAATACATGCACAC	0.567																																																0			10											93.0	87.0	89.0					10																	45799065		2203	4300	6503	45119071	SO:0001583	missense	79290			AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.806A>T	10.37:g.45799065T>A	ENSP00000451950:p.Tyr269Phe	Somatic		Capture	SOLID	Phase_III	45119071	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	37	CCDS31188.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	t	12.39	1.924314	0.34002	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.00014	9.18;9.18;9.18	5.78	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	0.176929	0.27331	N	0.019850	T	0.00073	0.0002	N	0.03294	-0.36	0.27900	N	0.938997	P	0.40681	0.727	P	0.50825	0.651	T	0.28073	-1.0055	10	0.02654	T	1	-35.2569	6.5244	0.22293	0.1383:0.0763:0.0:0.7854	.	269	Q8NGR1	O13A1_HUMAN	F	269	ENSP00000451950:Y269F;ENSP00000438657:Y269F;ENSP00000363522:Y269F	ENSP00000311379:Y269F	Y	-	2	0	OR13A1	45119071	0.028000	0.19301	0.719000	0.30619	0.943000	0.58893	0.119000	0.15626	0.437000	0.26423	0.529000	0.55759	TAT		0.567	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297		Missense_Mutation
PABPC3	5042	hgsc.bcm.edu	37	13	25671333	25671333	+	Frame_Shift_Del	DEL	A	A	-	rs371570689		TCGA-24-1548-01	TCGA-24-1548-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr13:25671333delA	ENST00000281589.3	+	1	1034	c.997delA	c.(997-999)aaafs	p.K333fs		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	333	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.F335fs*19(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGGTCGCAGCAAAGGGTTTGG	0.428																																																1	Deletion - Frameshift(1)	ovary(1)	13											162.0	159.0	160.0					13																	25671333		2203	4300	6503	24569333	SO:0001589	frameshift_variant	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.997delA	13.37:g.25671333delA	ENSP00000281589:p.Lys333fs	Somatic		Capture	SOLID	Phase_III	24569333	Q8NHV0|Q9H086	Frame_Shift_Del	DEL	ENST00000281589.3	37	CCDS9311.1	DEL	5	Baylor																																																																																				0.428	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		Frame_Shift_Del
PAH	5053	hgsc.bcm.edu	37	12	103237492	103237492	+	Silent	SNP	G	G	A			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr12:103237492G>A	ENST00000553106.1	-	11	1603	c.1131C>T	c.(1129-1131)taC>taT	p.Y377Y	PAH_ENST00000307000.2_Silent_p.Y372Y	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	377			Y -> C (in PKU; haplotype 4).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)	p.Y377Y(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	CCGTGACAGTGTAATTTTGGA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	12											107.0	103.0	104.0					12																	103237492		2203	4300	6503	101761622	SO:0001819	synonymous_variant	5053			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1131C>T	12.37:g.103237492G>A		Somatic		Capture	SOLID	Phase_III	101761622	Q16717|Q8TC14	Silent	SNP	ENST00000553106.1	37	CCDS9092.1	SNP	48	Baylor																																																																																				0.478	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1			Silent
PPP2R1A	5518	hgsc.bcm.edu	37	19	52716334	52716334	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr19:52716334C>T	ENST00000322088.6	+	6	836	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.R81C|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.R205C	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	260	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.R260C(1)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CTGGCGCGTCCGCTACATGGT	0.597			Mis		clear cell ovarian carcinoma																																		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	1	Substitution - Missense(1)	ovary(1)	19											47.0	42.0	44.0					19																	52716334		2203	4300	6503	57408146	SO:0001583	missense	5518				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.778C>T	19.37:g.52716334C>T	ENSP00000324804:p.Arg260Cys	Somatic		Capture	SOLID	Phase_III	57408146	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290760	0.80914	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.34859	1.34;1.34	4.59	4.59	0.56863	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.53938	D	0.000044	T	0.67439	0.2893	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.74973	-0.3481	10	0.87932	D	0	-18.7024	10.3858	0.44138	0.1951:0.8049:0.0:0.0	.	205;260;260	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	C	250;180;260;205	ENSP00000324804:R260C;ENSP00000415067:R205C	ENSP00000324804:R260C	R	+	1	0	PPP2R1A	57408146	1.000000	0.71417	0.934000	0.37439	0.980000	0.70556	4.860000	0.62961	2.550000	0.86006	0.655000	0.94253	CGC		0.597	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225		Missense_Mutation
RGS7	6000	hgsc.bcm.edu	37	1	241262044	241262044	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr1:241262044G>A	ENST00000407727.1	-	2	96	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W	RGS7_ENST00000446183.2_De_novo_Start_InFrame|RGS7_ENST00000401882.1_Missense_Mutation_p.R33W|RGS7_ENST00000366563.1_Missense_Mutation_p.R33W|RGS7_ENST00000348120.2_Missense_Mutation_p.R33W|RGS7_ENST00000331110.7_Missense_Mutation_p.R7W|RGS7_ENST00000366564.1_Missense_Mutation_p.R33W|RGS7_ENST00000366562.4_Missense_Mutation_p.R33W|RGS7_ENST00000366565.1_Missense_Mutation_p.R33W			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	33					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.R33W(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCTTGCATCCGTGCTATGACG	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											158.0	139.0	146.0					1																	241262044		2203	4300	6503	239328667	SO:0001583	missense	6000			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.97C>T	1.37:g.241262044G>A	ENSP00000384428:p.Arg33Trp	Somatic		Capture	SOLID	Phase_III	239328667	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715590	0.68844	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000348120;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T	0.34072	1.45;1.39;1.4;1.4;1.38;1.4;1.39;1.38	5.18	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.47691	0.1459	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.998	P;D;D;D;P	0.64042	0.836;0.921;0.921;0.921;0.827	T	0.48410	-0.9038	10	0.87932	D	0	-10.6163	11.3547	0.49609	0.0:0.0:0.8186:0.1814	.	7;33;33;33;33	B7Z257;P49802-4;P49802-2;P49802-5;P49802-3	.;.;.;.;.	W	7;33;33;33;33;33;33;33	ENSP00000331485:R7W;ENSP00000355523:R33W;ENSP00000355522:R33W;ENSP00000355521:R33W;ENSP00000341242:R33W;ENSP00000355520:R33W;ENSP00000384428:R33W;ENSP00000385508:R33W	ENSP00000331485:R7W	R	-	1	2	RGS7	239328667	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.378000	0.73150	1.289000	0.44618	0.655000	0.94253	CGG		0.333	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		Missense_Mutation
RTP1	132112	hgsc.bcm.edu	37	3	186917434	186917434	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1548-01	TCGA-24-1548-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr3:186917434T>C	ENST00000312295.4	+	2	398	c.368T>C	c.(367-369)gTg>gCg	p.V123A	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	123					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.V123A(1)		breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		GCGGGCTCGGTGCGCATGCGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											41.0	41.0	41.0					3																	186917434		2203	4297	6500	188400128	SO:0001583	missense	132112			BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.368T>C	3.37:g.186917434T>C	ENSP00000311712:p.Val123Ala	Somatic		Capture	SOLID	Phase_III	188400128		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002656	0.74932	.	.	ENSG00000175077	ENST00000312295	T	0.24350	1.86	5.7	4.54	0.55810	.	0.054864	0.64402	D	0.000001	T	0.45577	0.1349	M	0.71581	2.175	0.24665	N	0.993442	D	0.71674	0.998	D	0.71870	0.975	T	0.36089	-0.9762	10	0.62326	D	0.03	.	8.4502	0.32866	0.0:0.0879:0.0:0.9121	.	123	P59025	RTP1_HUMAN	A	123	ENSP00000311712:V123A	ENSP00000311712:V123A	V	+	2	0	RTP1	188400128	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.235000	0.51328	1.005000	0.39183	0.459000	0.35465	GTG		0.657	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708		Missense_Mutation
SPHKAP	80309	hgsc.bcm.edu	37	2	228886428	228886428	+	Splice_Site	SNP	G	G	A			TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr2:228886428G>A	ENST00000392056.3	-	6	742	c.696C>T	c.(694-696)aaC>aaT	p.N232N	SPHKAP_ENST00000344657.5_Splice_Site_p.N232N	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	232						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.N232N(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGTTCTCACCGTTCCTAGATT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	2											85.0	89.0	88.0					2																	228886428		2203	4300	6503	228594672	SO:0001630	splice_region_variant	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.697+1C>T	2.37:g.228886428G>A		Somatic		Capture	SOLID	Phase_III	228594672	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1	SNP	40	Baylor																																																																																				0.458	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	Silent	Silent
TP53	7157	hgsc.bcm.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-24-1548-01	TCGA-24-1548-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	17	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	7518915	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys	Somatic		Capture	SOLID	Phase_III	7518915	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
UBR4	23352	hgsc.bcm.edu	37	1	19454183	19454183	+	Silent	SNP	T	T	G			TCGA-24-1548-01	TCGA-24-1548-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr1:19454183T>G	ENST00000375254.3	-	63	9189	c.9162A>C	c.(9160-9162)gtA>gtC	p.V3054V	UBR4_ENST00000375217.2_Silent_p.V3047V|UBR4_ENST00000375226.2_Silent_p.V3030V|UBR4_ENST00000375267.2_Silent_p.V3054V	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3054					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V3054V(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GTCTCATTACTACCAGATGGA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	1											174.0	167.0	170.0					1																	19454183		2203	4300	6503	19326770	SO:0001819	synonymous_variant	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.9162A>C	1.37:g.19454183T>G		Somatic		Capture	SOLID	Phase_III	19326770	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1	SNP	53	Baylor																																																																																				0.478	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		Silent
USH2A	7399	hgsc.bcm.edu	37	1	215901473	215901473	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr1:215901473C>T	ENST00000307340.3	-	61	12351	c.11965G>A	c.(11965-11967)Gaa>Aaa	p.E3989K	USH2A_ENST00000366943.2_Missense_Mutation_p.E3989K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3989	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.E3989K(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTGGGAGATTCTGGCTTTGTC	0.483										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											127.0	122.0	124.0					1																	215901473		2203	4300	6503	213968096	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11965G>A	1.37:g.215901473C>T	ENSP00000305941:p.Glu3989Lys	Somatic		Capture	SOLID	Phase_III	213968096	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	5.968	0.362510	0.11296	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56611	0.45;0.45	5.25	3.37	0.38596	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.005240	0.08018	N	0.991569	T	0.44138	0.1279	L	0.52823	1.66	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.40478	-0.9561	10	0.06625	T	0.88	.	8.1213	0.30974	0.0:0.7256:0.1313:0.1431	.	3989	O75445	USH2A_HUMAN	K	3989	ENSP00000305941:E3989K;ENSP00000355910:E3989K	ENSP00000305941:E3989K	E	-	1	0	USH2A	213968096	0.000000	0.05858	0.522000	0.27862	0.983000	0.72400	0.079000	0.14782	0.590000	0.29694	0.591000	0.81541	GAA		0.483	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
XYLT1	64131	hgsc.bcm.edu	37	16	17252696	17252696	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr16:17252696C>T	ENST00000261381.6	-	6	1444	c.1360G>A	c.(1360-1362)Gac>Aac	p.D454N		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	454					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.D454N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTTGCATTGTCCCGGCCGTGT	0.478																																																1	Substitution - Missense(1)	ovary(1)	16											112.0	110.0	110.0					16																	17252696		2197	4300	6497	17160197	SO:0001583	missense	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1360G>A	16.37:g.17252696C>T	ENSP00000261381:p.Asp454Asn	Somatic		Capture	SOLID	Phase_III	17160197	Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	CCDS10569.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794398	0.90453	.	.	ENSG00000103489	ENST00000261381	T	0.13420	2.59	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.31765	0.0807	L	0.46741	1.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01298	-1.1392	10	0.45353	T	0.12	-47.6287	17.4172	0.87504	0.0:1.0:0.0:0.0	.	454	Q86Y38	XYLT1_HUMAN	N	454	ENSP00000261381:D454N	ENSP00000261381:D454N	D	-	1	0	XYLT1	17160197	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.905000	0.75714	2.398000	0.81561	0.563000	0.77884	GAC		0.478	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		Missense_Mutation
ZNF45	7596	hgsc.bcm.edu	37	19	44417975	44417975	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr19:44417975C>A	ENST00000269973.5	-	10	2703	c.1613G>T	c.(1612-1614)aGt>aTt	p.S538I	ZNF45_ENST00000589703.1_Missense_Mutation_p.S538I|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	538					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S538I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						TGAACCTACACTGAAGCCCTT	0.517																																																1	Substitution - Missense(1)	ovary(1)	19											99.0	88.0	91.0					19																	44417975		2203	4300	6503	49109815	SO:0001583	missense	7596			M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1613G>T	19.37:g.44417975C>A	ENSP00000269973:p.Ser538Ile	Somatic		Capture	SOLID	Phase_III	49109815	P17016|P78472|Q9P1U9	Missense_Mutation	SNP	ENST00000269973.5	37	CCDS12632.1	SNP	20	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.60|13.60	2.286274|2.286274	0.40494|0.40494	.|.	.|.	ENSG00000124459|ENSG00000124459	ENST00000269973|ENST00000328762	T|.	0.37058|.	1.22|.	3.61|3.61	2.54|2.54	0.30619|0.30619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.171467|.	0.28062|.	N|.	0.016745|.	T|T	0.51295|0.51295	0.1666|0.1666	L|L	0.54863|0.54863	1.705|1.705	0.09310|0.09310	N|N	0.999998|0.999998	P|.	0.36683|.	0.565|.	B|.	0.30782|.	0.12|.	T|T	0.44513|0.44513	-0.9323|-0.9323	10|6	0.36615|0.52906	T|T	0.2|0.07	-8.8305|-8.8305	11.4961|11.4961	0.50408|0.50408	0.0:0.4981:0.5019:0.0|0.0:0.4981:0.5019:0.0	.|.	538|.	Q02386|.	ZNF45_HUMAN|.	I|L	538|538	ENSP00000269973:S538I|.	ENSP00000269973:S538I|ENSP00000367176:V538L	S|V	-|-	2|1	0|0	ZNF45|ZNF45	49109815|49109815	0.000000|0.000000	0.05858|0.05858	0.920000|0.920000	0.36463|0.36463	0.988000|0.988000	0.76386|0.76386	-0.247000|-0.247000	0.08866|0.08866	0.831000|0.831000	0.34780|0.34780	0.455000|0.455000	0.32223|0.32223	AGT|GTG		0.517	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425		Missense_Mutation
ZNF518B	85460	hgsc.bcm.edu	37	4	10446084	10446084	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1548-01	TCGA-24-1548-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr4:10446084C>G	ENST00000326756.3	-	3	2307	c.1869G>C	c.(1867-1869)agG>agC	p.R623S		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	623					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R623S(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TGTTGTTAGTCCTTTCAGAAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											137.0	137.0	137.0					4																	10446084		2203	4300	6503	10055182	SO:0001583	missense	85460			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1869G>C	4.37:g.10446084C>G	ENSP00000317614:p.Arg623Ser	Somatic		Capture	SOLID	Phase_III	10055182	Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	CCDS33960.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318912	0.23994	.	.	ENSG00000178163	ENST00000326756	T	0.01438	4.89	6.06	0.46	0.16684	.	0.964866	0.08541	N	0.930553	T	0.00784	0.0026	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.48670	-0.9015	10	0.06625	T	0.88	-8.0171	0.8048	0.01082	0.255:0.3419:0.2154:0.1878	.	623	Q9C0D4	Z518B_HUMAN	S	623	ENSP00000317614:R623S	ENSP00000317614:R623S	R	-	3	2	ZNF518B	10055182	0.900000	0.30661	0.000000	0.03702	0.243000	0.25628	1.267000	0.33050	0.324000	0.23333	0.655000	0.94253	AGG		0.403	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		Missense_Mutation
ZSCAN29	146050	hgsc.bcm.edu	37	15	43653322	43653322	+	Silent	SNP	G	G	A	rs35278805	byFrequency	TCGA-24-1548-01	TCGA-24-1548-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1548-01	TCGA-24-1548-10	g.chr15:43653322G>A	ENST00000396976.2	-	5	2642	c.2508C>T	c.(2506-2508)caC>caT	p.H836H	ZSCAN29_ENST00000562072.1_3'UTR|ZSCAN29_ENST00000396972.1_Silent_p.H447H|ZSCAN29_ENST00000568898.1_Silent_p.H446H	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	836					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		GGATTTCTCCGTGCTTATTAA	0.453													G|||	685	0.136781	0.1891	0.1037	5008	,	,		21579	0.001		0.1958	False		,,,				2504	0.1687															0			15						G		845,3557	332.5+/-302.5	81,683,1437	89.0	90.0	90.0		2508	5.1	1.0	15	dbSNP_126	90	1622,6976	301.3+/-305.4	144,1334,2821	no	coding-synonymous	ZSCAN29	NM_152455.3		225,2017,4258	AA,AG,GG		18.8649,19.1958,18.9769		836/853	43653322	2467,10533	2201	4299	6500	41440614	SO:0001819	synonymous_variant	146050			AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.2508C>T	15.37:g.43653322G>A		Somatic		Capture	SOLID	Phase_III	41440614	B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	ENST00000396976.2	37	CCDS10095.2	SNP	40	Baylor																																																																																				0.453	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455		Silent
