#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCC12	94160	hgsc.bcm.edu	37	16	48174701	48174701	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr16:48174701G>A	ENST00000311303.3	-	4	899	c.554C>T	c.(553-555)gCc>gTc	p.A185V	ABCC12_ENST00000416054.1_Missense_Mutation_p.A185V|ABCC12_ENST00000448542.1_Missense_Mutation_p.A185V	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	185	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A185V(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GTAGTTGATGGCCCAGGCAAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	16											99.0	102.0	101.0					16																	48174701		2201	4300	6501	46732202	SO:0001583	missense	94160			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.554C>T	16.37:g.48174701G>A	ENSP00000311030:p.Ala185Val	Somatic		Capture	SOLID	Phase_IV	46732202	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551979	0.45487	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.91407	-2.84;-2.84;-2.84	6.07	5.1	0.69264	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.108901	0.64402	D	0.000008	D	0.89577	0.6755	L	0.45352	1.415	0.58432	D	0.999999	P;B	0.40083	0.702;0.443	P;B	0.47573	0.55;0.223	D	0.86594	0.1862	10	0.17369	T	0.5	.	15.4468	0.75238	0.0:0.0:0.8599:0.1401	.	185;185	Q96J65-2;Q96J65	.;MRP9_HUMAN	V	185	ENSP00000311030:A185V;ENSP00000401855:A185V;ENSP00000413046:A185V	ENSP00000311030:A185V	A	-	2	0	ABCC12	46732202	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	6.621000	0.74228	1.513000	0.48852	0.655000	0.94253	GCC		0.527	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226		Missense_Mutation
ACTN2	88	hgsc.bcm.edu	37	1	236900457	236900457	+	Silent	SNP	T	T	G			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:236900457T>G	ENST00000366578.4	+	9	985	c.819T>G	c.(817-819)ctT>ctG	p.L273L	ACTN2_ENST00000542672.1_Silent_p.L273L|ACTN2_ENST00000546208.1_5'UTR|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	273					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.L273L(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GTAAGGTTCTTGCTGTGAATC	0.498																																																1	Substitution - coding silent(1)	ovary(1)	1											124.0	114.0	117.0					1																	236900457		2203	4300	6503	234967080	SO:0001819	synonymous_variant	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.819T>G	1.37:g.236900457T>G		Somatic		Capture	SOLID	Phase_IV	234967080	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	CCDS1613.1	SNP	63	Baylor																																																																																				0.498	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		Silent
ADAM33	80332	hgsc.bcm.edu	37	20	3655433	3655433	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr20:3655433A>G	ENST00000356518.2	-	5	638	c.397T>C	c.(397-399)Tgc>Cgc	p.C133R	ADAM33_ENST00000379861.4_Missense_Mutation_p.C133R|ADAM33_ENST00000466620.1_5'Flank|ADAM33_ENST00000350009.2_Missense_Mutation_p.C133R	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	133					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C133R(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						ATCCCAGAGCAGGTGCAGAGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	20											42.0	46.0	44.0					20																	3655433		2203	4300	6503	3603433	SO:0001583	missense	80332			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.397T>C	20.37:g.3655433A>G	ENSP00000348912:p.Cys133Arg	Somatic		Capture	SOLID	Phase_IV	3603433	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	CCDS13058.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.2	3.952855	0.73787	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000444535;ENST00000439201	T;T;T	0.11277	2.79;2.79;2.79	4.74	4.74	0.60224	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.45756	0.1358	H	0.95982	3.75	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.62656	-0.6808	9	0.87932	D	0	.	13.4883	0.61379	1.0:0.0:0.0:0.0	.	133;145;133;133;133	B4DTZ3;B4E1Y6;Q9BZ11-2;Q9BZ11;A2A2L3	.;.;.;ADA33_HUMAN;.	R	133;133;133;146;133	ENSP00000348912:C133R;ENSP00000369190:C133R;ENSP00000322550:C133R	ENSP00000322550:C133R	C	-	1	0	ADAM33	3603433	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	5.909000	0.69923	2.133000	0.65898	0.533000	0.62120	TGC		0.632	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		Missense_Mutation
ADAMTS9	56999	hgsc.bcm.edu	37	3	64587734	64587734	+	Silent	SNP	G	G	A			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr3:64587734G>A	ENST00000498707.1	-	26	4245	c.3903C>T	c.(3901-3903)gaC>gaT	p.D1301D	ADAMTS9_ENST00000295903.4_Silent_p.D1273D	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1301					glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D1301D(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTAAGCCACTGTCTGGGGTCC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	3											167.0	156.0	160.0					3																	64587734		2203	4300	6503	64562774	SO:0001819	synonymous_variant	56999			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3903C>T	3.37:g.64587734G>A		Somatic		Capture	SOLID	Phase_IV	64562774	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	CCDS2903.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.077	0.771564	0.16051	.	.	ENSG00000163638	ENST00000481060	.	.	.	5.18	4.31	0.51392	.	.	.	.	.	T	0.40145	0.1105	.	.	.	0.29095	N	0.881854	.	.	.	.	.	.	T	0.30650	-0.9971	4	.	.	.	.	10.3552	0.43960	0.206:0.0:0.794:0.0	.	.	.	.	I	357	.	.	T	-	2	0	ADAMTS9	64562774	0.981000	0.34729	0.582000	0.28627	0.995000	0.86356	2.520000	0.45554	1.408000	0.46895	0.591000	0.81541	ACA		0.567	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			Silent
ADCK1	57143	hgsc.bcm.edu	37	14	78397970	78397970	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1555-01	TCGA-24-1555-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr14:78397970G>A	ENST00000238561.5	+	10	1415	c.1316G>A	c.(1315-1317)cGt>cAt	p.R439H	ADCK1_ENST00000556560.1_3'UTR|ADCK1_ENST00000341211.5_Missense_Mutation_p.R371H	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	446	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R371H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GACCTGCTGCGTGGCATTGAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	14											87.0	71.0	76.0					14																	78397970		2203	4300	6503	77467723	SO:0001583	missense	57143			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1316G>A	14.37:g.78397970G>A	ENSP00000238561:p.Arg439His	Somatic		Capture	SOLID	Phase_IV	77467723	B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	ENST00000238561.5	37	CCDS9869.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	34	5.338467	0.95783	.	.	ENSG00000063761	ENST00000238561;ENST00000341211	T;T	0.76709	-1.04;0.39	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.89497	0.6732	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	P;D;D	0.83275	0.889;0.996;0.948	D	0.90990	0.4834	10	0.66056	D	0.02	-16.094	18.5888	0.91200	0.0:0.0:1.0:0.0	.	446;371;439	Q86TW2;Q9UIE6;Q86TW2-2	ADCK1_HUMAN;.;.	H	439;371	ENSP00000238561:R439H;ENSP00000339663:R371H	ENSP00000238561:R439H	R	+	2	0	ADCK1	77467723	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	9.647000	0.98478	2.454000	0.82982	0.549000	0.68633	CGT		0.612	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1	NM_020421		Missense_Mutation
AK7	122481	hgsc.bcm.edu	37	14	96922785	96922785	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr14:96922785T>G	ENST00000267584.4	+	11	1244	c.1200T>G	c.(1198-1200)gaT>gaG	p.D400E		NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	400	Adenylate kinase.|NMPbind. {ECO:0000250}.				axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)	p.D400E(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		AACTGAAGGATGTCATTTCTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	14											156.0	139.0	145.0					14																	96922785		2203	4300	6503	95992538	SO:0001583	missense	122481			AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.1200T>G	14.37:g.96922785T>G	ENSP00000267584:p.Asp400Glu	Somatic		Capture	SOLID	Phase_IV	95992538	Q8IYP6	Missense_Mutation	SNP	ENST00000267584.4	37	CCDS9945.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	1.884	-0.457037	0.04540	.	.	ENSG00000140057	ENST00000267584	T	0.59224	0.28	5.26	-2.99	0.05497	.	0.097325	0.64402	D	0.000001	T	0.39759	0.1090	L	0.46741	1.465	0.80722	D	1	B	0.11235	0.004	B	0.22601	0.04	T	0.07158	-1.0787	10	0.19147	T	0.46	-31.1218	4.8262	0.13417	0.2368:0.3633:0.0:0.4	.	400	Q96M32	KAD7_HUMAN	E	400	ENSP00000267584:D400E	ENSP00000267584:D400E	D	+	3	2	AK7	95992538	0.041000	0.20044	0.026000	0.17262	0.280000	0.26924	-1.304000	0.02741	-0.881000	0.03992	0.379000	0.24179	GAT		0.368	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1			Missense_Mutation
ARHGAP20	57569	hgsc.bcm.edu	37	11	110454331	110454331	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr11:110454331T>G	ENST00000260283.4	-	14	1830	c.1546A>C	c.(1546-1548)Agt>Cgt	p.S516R	ARHGAP20_ENST00000357139.3_Missense_Mutation_p.S490R|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.S480R|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.S490R|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.S59R|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.S493R|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.S480R	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	516	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S516R(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CAAAGAATACTTGGAGCGACA	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											129.0	115.0	119.0					11																	110454331		2201	4298	6499	109959541	SO:0001583	missense	57569			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.1546A>C	11.37:g.110454331T>G	ENSP00000260283:p.Ser516Arg	Somatic		Capture	SOLID	Phase_IV	109959541	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779787	0.90195	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.46451	0.87;0.87;1.87;0.87;0.87;0.87;0.87	5.78	5.78	0.91487	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.045466	0.85682	D	0.000000	T	0.74473	0.3721	H	0.94771	3.58	0.52099	D	0.99994	D;D;D	0.71674	0.998;0.993;0.991	D;D;D	0.76575	0.987;0.988;0.979	T	0.82424	-0.0464	10	0.87932	D	0	.	16.4053	0.83662	0.0:0.0:0.0:1.0	.	490;516;493	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	R	516;490;59;493;480;490;480	ENSP00000260283:S516R;ENSP00000349660:S490R;ENSP00000437905:S59R;ENSP00000432076:S493R;ENSP00000436319:S480R;ENSP00000436522:S490R;ENSP00000431399:S480R	ENSP00000260283:S516R	S	-	1	0	ARHGAP20	109959541	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.196000	0.77805	2.333000	0.79357	0.482000	0.46254	AGT		0.408	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809		Missense_Mutation
BACH1	571	hgsc.bcm.edu	37	21	30715062	30715062	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1555-01	TCGA-24-1555-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr21:30715062G>T	ENST00000399921.1	+	5	2362	c.2119G>T	c.(2119-2121)Gag>Tag	p.E707*	BACH1_ENST00000286800.3_Nonsense_Mutation_p.E707*	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0			R -> C (in FANCJ; associated with C-647). {ECO:0000269|PubMed:16116423}.		DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E707*(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						AGCCACCTCTGAGCAAGCTGG	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	21											49.0	50.0	50.0					21																	30715062		2202	4300	6502	29636933	SO:0001587	stop_gained	571			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.2119G>T	21.37:g.30715062G>T	ENSP00000382805:p.Glu707*	Somatic		Capture	SOLID	Phase_IV	29636933	Q3MJE2|Q8NCI5	Nonsense_Mutation	SNP	ENST00000399921.1	37	CCDS13585.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	39	7.748695	0.98468	.	.	ENSG00000156273	ENST00000286800;ENST00000399921	.	.	.	5.75	5.75	0.90469	.	0.514651	0.18144	N	0.150302	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-10.7059	19.94	0.97155	0.0:0.0:1.0:0.0	.	.	.	.	X	707	.	ENSP00000286800:E707X	E	+	1	0	BACH1	29636933	0.945000	0.32115	0.146000	0.22360	0.337000	0.28794	4.225000	0.58600	2.721000	0.93114	0.650000	0.86243	GAG		0.562	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866		Nonsense_Mutation
BDKRB1	623	hgsc.bcm.edu	37	14	96730695	96730695	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr14:96730695C>A	ENST00000216629.6	+	3	1282	c.676C>A	c.(676-678)Ctg>Atg	p.L226M	RP11-404P21.3_ENST00000553638.1_RNA|BDKRB1_ENST00000553356.1_Missense_Mutation_p.L226M	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	226					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)	p.L226M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		CTACCACATCCTGGCCTCCCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	14											76.0	70.0	72.0					14																	96730695		2203	4300	6503	95800448	SO:0001583	missense	623			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.676C>A	14.37:g.96730695C>A	ENSP00000216629:p.Leu226Met	Somatic		Capture	SOLID	Phase_IV	95800448	A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	ENST00000216629.6	37	CCDS9943.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005450	0.35415	.	.	ENSG00000100739	ENST00000216629;ENST00000553356	T;T	0.42513	0.97;0.97	4.92	2.89	0.33648	GPCR, rhodopsin-like superfamily (1);	0.262004	0.29616	U	0.011645	T	0.41949	0.1181	L	0.55213	1.73	0.09310	N	0.99999	B;P	0.46859	0.364;0.885	B;P	0.48334	0.139;0.574	T	0.19976	-1.0289	10	0.42905	T	0.14	-10.6816	8.029	0.30454	0.2099:0.6957:0.0:0.0944	.	226;226	G3V4Y2;P46663	.;BKRB1_HUMAN	M	226	ENSP00000216629:L226M;ENSP00000452064:L226M	ENSP00000216629:L226M	L	+	1	2	BDKRB1	95800448	0.001000	0.12720	1.000000	0.80357	0.478000	0.33099	0.104000	0.15313	1.043000	0.40175	-0.703000	0.03666	CTG		0.582	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413300.1			Missense_Mutation
BRCA2	675	hgsc.bcm.edu	37	13	32936675	32936675	+	Frame_Shift_Del	DEL	T	T	-			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr13:32936675delT	ENST00000380152.3	+	17	8054	c.7821delT	c.(7819-7821)actfs	p.T2607fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.T2607fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2607					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.P2608fs*40(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGTGTGACACTCCAGGTGTGG	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Deletion - Frameshift(1)	ovary(1)	13											104.0	103.0	103.0					13																	32936675		2203	4300	6503	31834675	SO:0001589	frameshift_variant	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7821delT	13.37:g.32936675delT	ENSP00000369497:p.Thr2607fs	Somatic		Capture	SOLID	Phase_IV	31834675	O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	ENST00000380152.3	37	CCDS9344.1	DEL	54	Baylor																																																																																				0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		Frame_Shift_Del
SCAI	286205	hgsc.bcm.edu	37	9	127818182	127818182	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr9:127818182T>A	ENST00000336505.6	-	3	261	c.203A>T	c.(202-204)aAa>aTa	p.K68I	SCAI_ENST00000373549.4_Missense_Mutation_p.K91I	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	68	Necessary to inhibit MKL1-induced SRF transcriptional activity. {ECO:0000250}.				negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.K91I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						TTGCTTAGATTTATCCAGAAG	0.378																																																1	Substitution - Missense(1)	ovary(1)	9											110.0	101.0	104.0					9																	127818182		1830	4082	5912	126858003	SO:0001583	missense	286205			AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.203A>T	9.37:g.127818182T>A	ENSP00000336756:p.Lys68Ile	Somatic		Capture	SOLID	Phase_IV	126858003	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	ENST00000336505.6	37	CCDS48017.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	27.1	4.796418	0.90453	.	.	ENSG00000173611	ENST00000336505;ENST00000373549	T;T	0.53423	0.62;0.62	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.72803	0.3506	M	0.86864	2.845	0.58432	D	0.999998	D;D	0.76494	0.997;0.999	D;D	0.83275	0.996;0.996	T	0.78478	-0.2188	10	0.87932	D	0	-18.4064	14.9534	0.71091	0.0:0.0:0.0:1.0	.	68;91	Q8N9R8;Q8N9R8-2	SCAI_HUMAN;.	I	68;91	ENSP00000336756:K68I;ENSP00000362650:K91I	ENSP00000336756:K68I	K	-	2	0	SCAI	126858003	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.638000	0.83328	2.132000	0.65825	0.533000	0.62120	AAA		0.378	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054055.3	NM_173690		Missense_Mutation
CLPTM1L	81037	hgsc.bcm.edu	37	5	1341926	1341926	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr5:1341926A>G	ENST00000320895.5	-	3	570	c.313T>C	c.(313-315)Tat>Cat	p.Y105H	CLPTM1L_ENST00000320927.6_Missense_Mutation_p.Y105H|CLPTM1L_ENST00000507807.1_5'Flank	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	105					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.Y105H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		ATGTAGGCATACAGCGTCCCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	5											146.0	113.0	124.0					5																	1341926		2203	4300	6503	1394926	SO:0001583	missense	81037			AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.313T>C	5.37:g.1341926A>G	ENSP00000313854:p.Tyr105His	Somatic		Capture	SOLID	Phase_IV	1394926	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	CCDS3862.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967840	0.74131	.	.	ENSG00000049656	ENST00000320895;ENST00000320927	T;T	0.60424	0.27;0.19	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.66356	0.2781	L	0.56124	1.755	0.80722	D	1	D	0.54207	0.965	P	0.55345	0.774	T	0.68469	-0.5400	10	0.52906	T	0.07	-19.778	15.4022	0.74849	1.0:0.0:0.0:0.0	.	105	Q96KA5	CLP1L_HUMAN	H	105	ENSP00000313854:Y105H;ENSP00000315196:Y105H	ENSP00000313854:Y105H	Y	-	1	0	CLPTM1L	1394926	1.000000	0.71417	0.856000	0.33681	0.759000	0.43091	8.588000	0.90813	2.092000	0.63282	0.533000	0.62120	TAT		0.493	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782		Missense_Mutation
COL17A1	1308	hgsc.bcm.edu	37	10	105821222	105821222	+	Frame_Shift_Del	DEL	A	A	-			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr10:105821222delA	ENST00000353479.5	-	13	1210	c.920delT	c.(919-921)gtgfs	p.V307fs	COL17A1_ENST00000369733.3_Frame_Shift_Del_p.V307fs|COL17A1_ENST00000393211.3_Frame_Shift_Del_p.V307fs	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	307	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.V307fs*12(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GTTTTTCTTCACCCCATATGC	0.607																																																1	Deletion - Frameshift(1)	ovary(1)	10											61.0	49.0	53.0					10																	105821222		2203	4300	6503	105811212	SO:0001589	frameshift_variant	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.920delT	10.37:g.105821222delA	ENSP00000340937:p.Val307fs	Somatic		Capture	SOLID	Phase_IV	105811212	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Frame_Shift_Del	DEL	ENST00000353479.5	37	CCDS7554.1	DEL	6	Baylor																																																																																				0.607	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		Frame_Shift_Del
CTSE	1510	hgsc.bcm.edu	37	1	206320307	206320307	+	Silent	SNP	C	C	T	rs74145077	byFrequency	TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:206320307C>T	ENST00000358184.2	+	4	568	c.450C>T	c.(448-450)gcC>gcT	p.A150A	CTSE_ENST00000468617.1_3'UTR|CTSE_ENST00000432969.2_Silent_p.A75A|CTSE_ENST00000360218.2_Silent_p.A150A|CTSE_ENST00000361052.3_Silent_p.A150A	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	150					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.A150A(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TCATTGGAGCCGACCAAGTCT	0.488													C|||	148	0.0295527	0.1067	0.0101	5008	,	,		19631	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						C	,	386,4020	195.3+/-220.0	27,332,1844	92.0	91.0	91.0		450,450	-8.9	0.1	1	dbSNP_130	91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CTSE	NM_001910.3,NM_148964.2	,	27,333,6143	TT,TC,CC		0.0116,8.7608,2.9755	,	150/397,150/364	206320307	387,12619	2203	4300	6503	204486930	SO:0001819	synonymous_variant	1510			BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.450C>T	1.37:g.206320307C>T		Somatic		Capture	SOLID	Phase_IV	204486930	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Silent	SNP	ENST00000358184.2	37	CCDS1462.1	SNP	23	Baylor																																																																																				0.488	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910		Silent
DGKB	1607	hgsc.bcm.edu	37	7	14613881	14613881	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1555-01	TCGA-24-1555-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr7:14613881G>A	ENST00000403951.2	-	20	2148	c.1729C>T	c.(1729-1731)Cca>Tca	p.P577S	DGKB_ENST00000258767.5_Missense_Mutation_p.P577S|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000399322.3_Missense_Mutation_p.P577S|DGKB_ENST00000407950.1_Missense_Mutation_p.P569S|DGKB_ENST00000444700.2_Missense_Mutation_p.P558S|DGKB_ENST00000402815.1_Missense_Mutation_p.P576S|DGKB_ENST00000406247.3_Missense_Mutation_p.P577S			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	577					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.P577S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TAAGGCACTGGGTCTCCTTTC	0.363																																																1	Substitution - Missense(1)	ovary(1)	7											242.0	225.0	231.0					7																	14613881		1895	4110	6005	14580406	SO:0001583	missense	1607			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1729C>T	7.37:g.14613881G>A	ENSP00000385780:p.Pro577Ser	Somatic		Capture	SOLID	Phase_IV	14580406	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438312	0.83885	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.79653	-1.21;-1.21;-1.21;-1.21;-1.2;-1.2;-1.29	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	L	0.45422	1.42	0.80722	D	1	B;B;B;P	0.44478	0.361;0.168;0.086;0.836	B;B;B;P	0.44561	0.222;0.106;0.131;0.453	T	0.77378	-0.2610	10	0.33940	T	0.23	.	19.9574	0.97228	0.0:0.0:1.0:0.0	.	576;558;577;577	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	S	577;577;577;576;569;558;577	ENSP00000385780:P577S;ENSP00000382260:P577S;ENSP00000258767:P577S;ENSP00000384909:P576S;ENSP00000385031:P569S;ENSP00000388451:P558S;ENSP00000386066:P577S	ENSP00000258767:P577S	P	-	1	0	DGKB	14580406	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.750000	0.98875	2.715000	0.92844	0.561000	0.74099	CCA		0.363	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		Missense_Mutation
DOC2B	8447	hgsc.bcm.edu	37	17	11294	11295	+	In_Frame_Ins	INS	-	-	CAGTCC			TCGA-24-1555-01	TCGA-24-1555-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr17:11294_11295insCAGTCC	ENST00000343572.7	-	5	832_833	c.676_677insGGACTG	c.(676-678)gag>gGGACTGag	p.225_226insGT	DOC2B_ENST00000609727.1_5'Flank	NM_003585.3	NP_003576	Q14184	DOC2B_HUMAN	double C2-like domains, beta	225	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion (GO:0032024)|positive regulation of vesicle fusion (GO:0031340)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.N225_E226insGT(1)		endometrium(2)|ovary(1)	3						CCCGATGAACTCATTGTGCCGG	0.589																																																1	Insertion - In frame(1)	ovary(1)	17																																								11295	SO:0001652	inframe_insertion	653051			D70830	CCDS73934.1	17p13.3	2014-07-16			ENSG00000272636	ENSG00000272636		"""Synaptotagmins"""	2986	protein-coding gene	gene with protein product		604568	"""double C2-like domains, beta-like"""	DOC2BL		7826360	Standard	NM_003585		Approved		uc010vpx.1	Q14184	OTTHUMG00000154415	ENST00000343572.7:c.676_677insGGACTG	17.37:g.11294_11295insCAGTCC	ENSP00000343665:p.Asn225_Glu226insGlyThr	Somatic		Capture	SOLID	Phase_IV	11294		In_Frame_Ins	INS	ENST00000343572.7	37		INS	54	Baylor																																																																																				0.589	DOC2B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335122.3	NM_003585		In_Frame_Ins
DONSON	29980	hgsc.bcm.edu	37	21	34954294	34954294	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr21:34954294C>A	ENST00000303071.5	-	7	1180	c.1114G>T	c.(1114-1116)Gat>Tat	p.D372Y	DONSON_ENST00000303113.6_Missense_Mutation_p.D358Y|DONSON_ENST00000432378.1_Missense_Mutation_p.D372Y|DONSON_ENST00000453626.1_Missense_Mutation_p.D372Y	NM_017613.3	NP_060083.1	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	372					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)		p.D372Y(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|ovary(1)	11						TTAATTTTATCTTGCACACCC	0.373																																																1	Substitution - Missense(1)	ovary(1)	21											105.0	105.0	105.0					21																	34954294		2203	4300	6503	33876164	SO:0001583	missense	29980			AF000002	CCDS13632.1	21q22.1	2008-07-31			ENSG00000159147	ENSG00000159147			2993	protein-coding gene	gene with protein product		611428		C21orf60		10773462, 10950926	Standard	NM_017613		Approved	B17, C2TA, DKFZP434M035	uc002ysk.4	Q9NYP3	OTTHUMG00000065904	ENST00000303071.5:c.1114G>T	21.37:g.34954294C>A	ENSP00000307143:p.Asp372Tyr	Somatic		Capture	SOLID	Phase_IV	33876164	Q8NC53|Q9NSR9|Q9NVZ5|Q9NYP1|Q9NYP2	Missense_Mutation	SNP	ENST00000303071.5	37	CCDS13632.1	SNP	32	Baylor	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	27.0|27.0|27.0	4.793348|4.793348|4.793348	0.90453|0.90453|0.90453	.|.|.	.|.|.	ENSG00000159147|ENSG00000159147|ENSG00000159147	ENST00000303113;ENST00000453626;ENST00000303071;ENST00000432378|ENST00000437395|ENST00000440810	.|.|.	.|.|.	.|.|.	5.82|5.82|5.82	5.82|5.82|5.82	0.92795|0.92795|0.92795	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.81922|0.81922|0.81922	0.4925|0.4925|0.4925	M|M|M	0.80616|0.80616|0.80616	2.505|2.505|2.505	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D|.|.	0.89917|.|.	1.0;1.0|.|.	D;D|.|.	0.91635|.|.	0.994;0.999|.|.	T|T|T	0.81393|0.81393|0.81393	-0.0953|-0.0953|-0.0953	9|5|5	0.30854|.|.	T|.|.	0.27|.|.	-8.6645|-8.6645|-8.6645	19.6901|19.6901|19.6901	0.95998|0.95998|0.95998	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	358;372|.|.	F8W8A5;Q9NYP3|.|.	.;DONS_HUMAN|.|.	Y|N|I	358;372;372;372|342|143	.|.|.	ENSP00000307143:D372Y|.|.	D|K|R	-|-|-	1|3|2	0|2|0	DONSON|DONSON|DONSON	33876164|33876164|33876164	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.985000|0.985000|0.985000	0.73830|0.73830|0.73830	7.304000|7.304000|7.304000	0.78882|0.78882|0.78882	2.753000|2.753000|2.753000	0.94483|0.94483|0.94483	0.467000|0.467000|0.467000	0.42956|0.42956|0.42956	GAT|AAG|AGA		0.373	DONSON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141184.1	NM_017613		Missense_Mutation
DRP2	1821	hgsc.bcm.edu	37	X	100510224	100510224	+	Silent	SNP	C	C	T			TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chrX:100510224C>T	ENST00000395209.3	+	20	2759	c.2232C>T	c.(2230-2232)tcC>tcT	p.S744S	DRP2_ENST00000402866.1_Silent_p.S744S|DRP2_ENST00000538510.1_Silent_p.S744S|DRP2_ENST00000541709.1_Silent_p.S666S	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	744					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.S741S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						ACAGCTTGTCCCCAGATGACA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	X											162.0	137.0	146.0					X																	100510224		2203	4300	6503	100396880	SO:0001819	synonymous_variant	1821			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2232C>T	X.37:g.100510224C>T		Somatic		Capture	SOLID	Phase_IV	100396880	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	ENST00000395209.3	37	CCDS14480.2	SNP	22	Baylor																																																																																				0.473	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939		Silent
COL26A1	136227	hgsc.bcm.edu	37	7	101200669	101200669	+	RNA	SNP	A	A	G	rs200075468|rs398095266|rs36008849		TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr7:101200669A>G	ENST00000397927.3	+	0	1397				COL26A1_ENST00000313669.7_RNA|COL26A1_ENST00000528707.1_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											GCCTCCCCAGAGGAGGTTCTG	0.612																																																0			7											27.0	29.0	28.0					7																	101200669		1975	4139	6114	100987389			136227			AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101200669A>G		Somatic		Capture	SOLID	Phase_IV	100987389	Q32M90	Missense_Mutation	SNP	ENST00000397927.3	37		SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.15	1.554532	0.27739	.	.	ENSG00000160963	ENST00000313669	T	0.53206	0.63	3.34	2.17	0.27698	.	0.000000	0.49305	D	0.000142	T	0.39036	0.1063	L	0.54323	1.7	0.21933	N	0.999461	P	0.46395	0.877	B	0.43360	0.417	T	0.17319	-1.0373	10	0.30854	T	0.27	.	5.495	0.16797	0.8716:0.0:0.1284:0.0	.	395	C9JPW4	.	G	395	ENSP00000318234:E395G	ENSP00000318234:E395G	E	+	2	0	EMID2	100987389	1.000000	0.71417	0.831000	0.32960	0.002000	0.02628	3.909000	0.56363	0.671000	0.31185	-0.461000	0.05368	GAG		0.612	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2	NM_133457		Missense_Mutation
Unknown	0	hgsc.bcm.edu	37	8	0	0	+	IGR	DNP	-A	-A	AC			TCGA-24-1555-01	TCGA-24-1555-10	-	-	.	.	.	.	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr8:0_0-A>AC								None (None upstream) : AC144568.2 (22600 downstream)																							NNNNNNNNNN	0.0																																																0			8																																								22011998	SO:0001628	intergenic_variant	64760																															8.37:g.0_0delinsAC		Somatic		Capture	SOLID	Phase_IV	22011997		Indel	Indel		37		Indel	25	Baylor																																																																																			0	0.000									Indel
GOLGA4	2803	hgsc.bcm.edu	37	3	37365328	37365328	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr3:37365328C>G	ENST00000361924.2	+	14	2325	c.1951C>G	c.(1951-1953)Caa>Gaa	p.Q651E	GOLGA4_ENST00000356847.4_Missense_Mutation_p.Q673E|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	651	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.Q651E(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AAAGTGTGAACAAGAAAAAGA	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											53.0	55.0	54.0					3																	37365328		2203	4300	6503	37340332	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1951C>G	3.37:g.37365328C>G	ENSP00000354486:p.Gln651Glu	Somatic		Capture	SOLID	Phase_IV	37340332	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.225	0.409651	0.11812	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000429018;ENST00000437131	T;T;T	0.23754	1.9;1.89;1.93	4.96	4.07	0.47477	.	0.000000	0.34986	N	0.003522	T	0.18800	0.0451	L	0.52266	1.64	0.25536	N	0.987224	P;P;P;B	0.40794	0.729;0.729;0.729;0.031	B;B;B;B	0.32805	0.153;0.153;0.153;0.007	T	0.19582	-1.0301	10	0.06891	T	0.86	.	14.6734	0.68961	0.0:0.724:0.276:0.0	.	651;651;673;651	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	E	651;673;212;522	ENSP00000354486:Q651E;ENSP00000349305:Q673E;ENSP00000405842:Q522E	ENSP00000349305:Q673E	Q	+	1	0	GOLGA4	37340332	0.004000	0.15560	0.473000	0.27253	0.638000	0.38207	0.778000	0.26732	1.196000	0.43129	0.655000	0.94253	CAA		0.363	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078		Missense_Mutation
HECW1	23072	hgsc.bcm.edu	37	7	43590042	43590042	+	Splice_Site	SNP	A	A	T			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr7:43590042A>T	ENST00000395891.2	+	27	4853		c.e27-1		HECW1_ENST00000453890.1_Splice_Site	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TTTTCCTACAAGGTCACGGAA	0.493																																																1	Unknown(1)	ovary(1)	7											73.0	81.0	78.0					7																	43590042		2131	4259	6390	43556567	SO:0001630	splice_region_variant	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4249-1A>T	7.37:g.43590042A>T		Somatic		Capture	SOLID	Phase_IV	43556567	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Splice_Site_SNP	SNP	ENST00000395891.2	37	CCDS5469.2	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.0	4.486941	0.84854	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8276	0.78727	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HECW1	43556567	1.000000	0.71417	0.966000	0.40874	0.822000	0.46500	8.864000	0.92294	2.122000	0.65172	0.533000	0.62120	.		0.493	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	Intron	Splice_Site_SNP
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32551948	32551948	+	Frame_Shift_Del	DEL	G	G	-	rs67476479|rs17886882		TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr6:32551948delG	ENST00000360004.5	-	2	413	c.308delC	c.(307-309)gcgfs	p.A103fs		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	103	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)		p.A103fs*26(2)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GGTGTCCACCGCGGCCCGCGC	0.682										Multiple Myeloma(14;0.17)																																						2	Deletion - Frameshift(2)	ovary(1)|large_intestine(1)	6	GRCh37	CX045849	HLA-DRB1	X	rs17886882			272,799,3127		41,41,149,90,578,1200	26.0	27.0	26.0			-1.8	0.0	6	dbSNP_130	27	98,1359,6727		5,19,69,124,1092,2783	no	codingComplex	HLA-DRB1	NM_002124.3		46,60,218,214,1670,3983	A1A1,A1A2,A1R,A2A2,A2R,RR		17.803,25.5121,20.4167			32551948	370,2158,9854	2106	4192	6298	32659926	SO:0001589	frameshift_variant	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.308delC	6.37:g.32551948delG	ENSP00000353099:p.Ala103fs	Somatic		Capture	SOLID	Phase_IV	32659926	P01914|Q9MYF5	Frame_Shift_Del	DEL	ENST00000360004.5	37	CCDS47409.1	DEL	38	Baylor																																																																																				0.682	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124		Frame_Shift_Del
IGSF9B	22997	hgsc.bcm.edu	37	11	133801003	133801003	+	Silent	SNP	G	G	A	rs368414739		TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr11:133801003G>A	ENST00000321016.8	-	11	1625	c.1395C>T	c.(1393-1395)caC>caT	p.H465H	IGSF9B_ENST00000533871.2_Silent_p.H465H			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	465	Ig-like 5.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.H465H(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GCAGGGCACTGTGCTTGCTTC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	11						G		0,4356		0,0,2178	79.0	89.0	86.0		1395	4.0	1.0	11		86	1,8543		0,1,4271	no	coding-synonymous	IGSF9B	NM_014987.1		0,1,6449	AA,AG,GG		0.0117,0.0,0.0078		465/1350	133801003	1,12899	2178	4272	6450	133306213	SO:0001819	synonymous_variant	22997			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.1395C>T	11.37:g.133801003G>A		Somatic		Capture	SOLID	Phase_IV	133306213	G5EA26	Silent	SNP	ENST00000321016.8	37		SNP	48	Baylor																																																																																				0.607	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		Silent
KCNMA1	3778	hgsc.bcm.edu	37	10	78729786	78729786	+	Frame_Shift_Del	DEL	T	T	-			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr10:78729786delT	ENST00000286628.8	-	20	2305	c.2306delA	c.(2305-2307)aagfs	p.K769fs	RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000404771.3_Frame_Shift_Del_p.K769fs|KCNMA1_ENST00000406533.3_Frame_Shift_Del_p.K773fs|KCNMA1_ENST00000286627.5_Frame_Shift_Del_p.K711fs|KCNMA1_ENST00000354353.5_Frame_Shift_Del_p.K772fs|KCNMA1_ENST00000372440.1_Frame_Shift_Del_p.K711fs|KCNMA1_ENST00000372443.1_Frame_Shift_Del_p.K711fs|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000404857.1_Frame_Shift_Del_p.K711fs|RP11-443A13.5_ENST00000458661.2_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	769					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.K711fs*17(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ATTCCGTTGCTTTTTTTTTGG	0.502																																																1	Deletion - Frameshift(1)	ovary(1)	10											249.0	212.0	225.0					10																	78729786		2203	4300	6503	78399792	SO:0001589	frameshift_variant	3778			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2306delA	10.37:g.78729786delT	ENSP00000286628:p.Lys769fs	Somatic		Capture	SOLID	Phase_IV	78399792	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Frame_Shift_Del	DEL	ENST00000286628.8	37		DEL	56	Baylor																																																																																				0.502	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247		Frame_Shift_Del
AREL1	9870	hgsc.bcm.edu	37	14	75131548	75131548	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1555-01	TCGA-24-1555-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr14:75131548G>C	ENST00000356357.4	-	18	2699	c.2184C>G	c.(2182-2184)ttC>ttG	p.F728L	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	728	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.F728L(1)									CCTTTTCTCTGAAATGCCATG	0.448																																																1	Substitution - Missense(1)	ovary(1)	14											91.0	86.0	88.0					14																	75131548		1941	4148	6089	74201301	SO:0001583	missense	9870			AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.2184C>G	14.37:g.75131548G>C	ENSP00000348714:p.Phe728Leu	Somatic		Capture	SOLID	Phase_IV	74201301	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	CCDS41971.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075324	0.76415	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.56103	0.48;0.48	5.22	4.33	0.51752	HECT (4);	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.64630	1.985	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	T	0.62291	-0.6885	10	0.28530	T	0.3	.	10.3437	0.43893	0.1506:0.0:0.8494:0.0	.	728	O15033	K0317_HUMAN	L	728;567;567	ENSP00000348714:F728L;ENSP00000452101:F567L	ENSP00000348714:F728L	F	-	3	2	KIAA0317	74201301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.660000	0.61511	1.336000	0.45506	0.650000	0.86243	TTC		0.448	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821		Missense_Mutation
KIAA0556	23247	hgsc.bcm.edu	37	16	27629814	27629814	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1555-01	TCGA-24-1555-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr16:27629814G>C	ENST00000261588.4	+	3	151	c.132G>C	c.(130-132)caG>caC	p.Q44H		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	44						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Q44H(1)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						TGCTTCAGCAGAGGAACCGGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	16											74.0	73.0	73.0					16																	27629814		2197	4300	6497	27537315	SO:0001583	missense	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.132G>C	16.37:g.27629814G>C	ENSP00000261588:p.Gln44His	Somatic		Capture	SOLID	Phase_IV	27537315	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.21	2.466400	0.43839	.	.	ENSG00000047578	ENST00000261588	T	0.46063	0.88	4.76	3.79	0.43588	.	0.239442	0.33854	N	0.004497	T	0.47040	0.1424	L	0.29908	0.895	0.36480	D	0.867818	D	0.89917	1.0	D	0.83275	0.996	T	0.46693	-0.9173	10	0.27785	T	0.31	-2.9926	9.8685	0.41160	0.0983:0.0:0.9017:0.0	.	44	O60303	K0556_HUMAN	H	44	ENSP00000261588:Q44H	ENSP00000261588:Q44H	Q	+	3	2	KIAA0556	27537315	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.735000	0.47377	2.337000	0.79520	0.484000	0.47621	CAG		0.428	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		Missense_Mutation
LAMB1	3912	hgsc.bcm.edu	37	7	107599755	107599755	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1555-01	TCGA-24-1555-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr7:107599755C>T	ENST00000222399.6	-	20	2859	c.2629G>A	c.(2629-2631)Gac>Aac	p.D877N	LAMB1_ENST00000393561.1_Missense_Mutation_p.D901N	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	877	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.D877N(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GTCACTGGGTCGCAGTCATCG	0.552																																																1	Substitution - Missense(1)	ovary(1)	7											143.0	131.0	135.0					7																	107599755		2203	4300	6503	107386991	SO:0001583	missense	3912			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2629G>A	7.37:g.107599755C>T	ENSP00000222399:p.Asp877Asn	Somatic		Capture	SOLID	Phase_IV	107386991	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821952	0.50633	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.62941	-0.01;-0.01	5.55	4.67	0.58626	EGF-like, laminin (3);	.	.	.	.	T	0.49695	0.1572	L	0.39514	1.22	0.80722	D	1	P;B	0.40970	0.734;0.136	B;B	0.37888	0.26;0.023	T	0.49041	-0.8980	9	0.38643	T	0.18	.	8.7556	0.34643	0.0:0.7661:0.0:0.2339	.	877;901	P07942;G3XAI2	LAMB1_HUMAN;.	N	901;877	ENSP00000377191:D901N;ENSP00000222399:D877N	ENSP00000222399:D877N	D	-	1	0	LAMB1	107386991	0.977000	0.34250	0.938000	0.37757	0.683000	0.39861	2.365000	0.44196	1.578000	0.49821	0.655000	0.94253	GAC		0.552	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		Missense_Mutation
LIMD1	8994	hgsc.bcm.edu	37	3	45636879	45636879	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr3:45636879G>T	ENST00000273317.4	+	1	529	c.508G>T	c.(508-510)Gat>Tat	p.D170Y	LIMD1_ENST00000440097.1_Missense_Mutation_p.D170Y|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	170					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.D170Y(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		CCCCTGTGAGGATCCTTCCTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	83.0	83.0					3																	45636879		2203	4300	6503	45611883	SO:0001583	missense	8994			AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.508G>T	3.37:g.45636879G>T	ENSP00000273317:p.Asp170Tyr	Somatic		Capture	SOLID	Phase_IV	45611883	Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	37	CCDS2729.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261854	0.59431	.	.	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.59502	0.26;0.45	4.7	3.79	0.43588	.	0.635376	0.15119	N	0.279520	T	0.54351	0.1853	L	0.27053	0.805	0.28481	N	0.914943	D	0.56968	0.978	P	0.52267	0.694	T	0.52117	-0.8618	10	0.66056	D	0.02	.	12.1725	0.54167	0.0:0.1713:0.8287:0.0	.	170	Q9UGP4	LIMD1_HUMAN	Y	170	ENSP00000394537:D170Y;ENSP00000273317:D170Y	ENSP00000273317:D170Y	D	+	1	0	LIMD1	45611883	0.997000	0.39634	0.995000	0.50966	0.856000	0.48823	4.435000	0.59941	2.158000	0.67659	0.462000	0.41574	GAT		0.582	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240		Missense_Mutation
MAP7D3	79649	hgsc.bcm.edu	37	X	135326817	135326817	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chrX:135326817T>A	ENST00000316077.9	-	4	611	c.391A>T	c.(391-393)Aga>Tga	p.R131*	MAP7D3_ENST00000370661.1_Nonsense_Mutation_p.R131*|MAP7D3_ENST00000370663.5_Nonsense_Mutation_p.R113*	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	131					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.R428*(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TTCTGGTGTCTTTTTTCTTCT	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	X											318.0	296.0	303.0					X																	135326817		1912	4118	6030	135154483	SO:0001587	stop_gained	79649			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.391A>T	X.37:g.135326817T>A	ENSP00000318086:p.Arg131*	Somatic		Capture	SOLID	Phase_IV	135154483	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Nonsense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	35	5.534514	0.96460	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	.	.	.	5.02	2.51	0.30379	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.6377	11.1162	0.48262	0.0:0.0:0.2901:0.7099	.	.	.	.	X	131;131;113;131	.	ENSP00000318086:R131X	R	-	1	2	MAP7D3	135154483	1.000000	0.71417	0.006000	0.13384	0.043000	0.13939	3.259000	0.51515	0.180000	0.19960	-0.545000	0.04230	AGA		0.418	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2			Nonsense_Mutation
OR8U1	219417	hgsc.bcm.edu	37	11	56143126	56143126	+	Silent	SNP	G	G	A			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr11:56143126G>A	ENST00000302270.1	+	1	27	c.27G>A	c.(25-27)gcG>gcA	p.A9A		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A9A(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					GCACCCAGGCGACAGAGTTTA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	11											111.0	101.0	104.0					11																	56143126		1864	4097	5961	55899702	SO:0001819	synonymous_variant	219417			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.27G>A	11.37:g.56143126G>A		Somatic		Capture	SOLID	Phase_IV	55899702		Silent	SNP	ENST00000302270.1	37	CCDS41647.1	SNP	37	Baylor																																																																																				0.418	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204		Silent
OR5B17	219965	hgsc.bcm.edu	37	11	58126355	58126355	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr11:58126355T>C	ENST00000357377.3	-	1	187	c.188A>G	c.(187-189)aAc>aGc	p.N63S		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N63S(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AAGAGACAGGTTACTGAGAAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											76.0	73.0	74.0					11																	58126355		2201	4295	6496	57882931	SO:0001583	missense	219965			AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.188A>G	11.37:g.58126355T>C	ENSP00000349945:p.Asn63Ser	Somatic		Capture	SOLID	Phase_IV	57882931	Q6IEX1	Missense_Mutation	SNP	ENST00000357377.3	37	CCDS31548.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	t	11.36	1.617106	0.28801	.	.	ENSG00000197786	ENST00000357377	T	0.12774	2.65	3.41	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.24275	0.0588	L	0.50333	1.59	0.21861	N	0.999506	D	0.62365	0.991	P	0.58721	0.844	T	0.05194	-1.0900	9	0.33141	T	0.24	-9.3293	10.8511	0.46771	0.0:0.0:0.0:1.0	.	63	Q8NGF7	OR5BH_HUMAN	S	63	ENSP00000349945:N63S	ENSP00000349945:N63S	N	-	2	0	OR5B17	57882931	0.891000	0.30450	0.083000	0.20561	0.214000	0.24535	3.995000	0.57001	1.421000	0.47157	0.378000	0.23410	AAC		0.468	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489		Missense_Mutation
PARP10	84875	hgsc.bcm.edu	37	8	145059425	145059425	+	Missense_Mutation	SNP	T	T	C	rs11136344	byFrequency	TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr8:145059425T>C	ENST00000313028.7	-	5	839	c.745A>G	c.(745-747)Atc>Gtc	p.I249V	PARP10_ENST00000533665.1_5'UTR|PARP10_ENST00000525773.1_Missense_Mutation_p.I261V|PARP10_ENST00000524918.1_Missense_Mutation_p.I249V	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	249			I -> V (in dbSNP:rs11136344).		negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCTCCAGgatgtcgtagtgg	0.627													C|||	1959	0.391174	0.6165	0.2795	5008	,	,		18107	0.1458		0.4314	False		,,,				2504	0.3773															0			8							VAL/ILE	2628,1778	516.2+/-369.1	781,1066,356	40.0	42.0	41.0		745	-0.6	0.0	8	dbSNP_120	41	3640,4960	614.2+/-396.2	796,2048,1456	yes	missense	PARP10	NM_032789.3	29	1577,3114,1812	CC,CT,TT		42.3256,40.3541,48.1931	benign	249/1026	145059425	6268,6738	2203	4300	6503	145131413	SO:0001583	missense	84875			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.745A>G	8.37:g.145059425T>C	ENSP00000325618:p.Ile249Val	Somatic		Capture	SOLID	Phase_IV	145131413	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	SNP	51	Baylor	832	0.38095238095238093	308	0.6260162601626016	116	0.32044198895027626	88	0.15384615384615385	320	0.42216358839050133	C	0.003	-2.464539	0.00171	0.596459	0.423256	ENSG00000178685	ENST00000524918;ENST00000313028;ENST00000525773;ENST00000313059	T;T;T;T	0.24908	3.14;3.15;3.15;1.83	3.8	-0.575	0.11734	.	0.572735	0.14302	N	0.328229	T	0.00012	0.0000	N	0.00483	-1.445	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.36407	-0.9749	9	0.02654	T	1	.	3.4917	0.07639	0.179:0.3745:0.0:0.4465	rs11136344;rs57845841;rs11136344	261;249;249	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	V	249;249;261;164	ENSP00000431620:I249V;ENSP00000325618:I249V;ENSP00000434776:I261V;ENSP00000314320:I164V	ENSP00000325618:I249V	I	-	1	0	PARP10	145131413	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.973000	0.01500	-0.436000	0.07254	-1.016000	0.02456	ATC		0.627	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789		Missense_Mutation
PARP3	10039	hgsc.bcm.edu	37	3	51981825	51981825	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr3:51981825A>T	ENST00000417220.2	+	11	1834	c.1346A>T	c.(1345-1347)gAg>gTg	p.E449V	PARP3_ENST00000486510.1_3'UTR|PARP3_ENST00000431474.1_Missense_Mutation_p.E449V|PARP3_ENST00000398755.3_Missense_Mutation_p.E456V			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	449	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.G23G(1)		ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTGGGCAGAGAGCACCATATC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											163.0	162.0	162.0					3																	51981825		2082	4212	6294	51956865	SO:0001583	missense	10039			AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.1346A>T	3.37:g.51981825A>T	ENSP00000395951:p.Glu449Val	Somatic		Capture	SOLID	Phase_IV	51956865	Q8NER9|Q96CG2|Q9UG81	Missense_Mutation	SNP	ENST00000417220.2	37	CCDS43097.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.91	2.376601	0.42105	.	.	ENSG00000041880	ENST00000417220;ENST00000431474;ENST00000398755	T;T;T	0.12774	2.65;2.65;2.65	5.2	2.63	0.31362	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.102946	0.64402	N	0.000004	T	0.08802	0.0218	L	0.31926	0.97	0.52099	D	0.999943	B;B	0.25272	0.104;0.122	B;B	0.32762	0.052;0.152	T	0.13442	-1.0509	10	0.02654	T	1	-27.6096	7.1071	0.25370	0.6185:0.1304:0.0:0.2511	.	456;449	Q9Y6F1-2;Q9Y6F1	.;PARP3_HUMAN	V	449;449;456	ENSP00000395951:E449V;ENSP00000401511:E449V;ENSP00000381740:E456V	ENSP00000381740:E456V	E	+	2	0	PARP3	51956865	1.000000	0.71417	0.997000	0.53966	0.687000	0.40016	4.977000	0.63792	0.792000	0.33850	0.459000	0.35465	GAG		0.602	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348612.2	NM_005485.4		Missense_Mutation
PRAMEF12	390999	hgsc.bcm.edu	37	1	12837322	12837322	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:12837322G>T	ENST00000357726.4	+	3	1059	c.1032G>T	c.(1030-1032)gaG>gaT	p.E344D		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	344					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.E344D(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTGCTGGAGCAAGCTGAGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	85.0	85.0					1																	12837322		2203	4300	6503	12759909	SO:0001583	missense	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1032G>T	1.37:g.12837322G>T	ENSP00000350358:p.Glu344Asp	Somatic		Capture	SOLID	Phase_IV	12759909		Missense_Mutation	SNP	ENST00000357726.4	37	CCDS41254.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	.	14.54	2.565123	0.45694	.	.	ENSG00000116726	ENST00000357726	T	0.03889	3.77	2.83	0.918	0.19386	.	0.451826	0.22443	N	0.059998	T	0.19846	0.0477	M	0.93197	3.39	0.09310	N	1	D	0.58970	0.984	P	0.58928	0.848	T	0.04017	-1.0984	10	0.66056	D	0.02	.	6.7937	0.23713	0.2454:0.0:0.7546:0.0	.	344	O95522	PRA12_HUMAN	D	344	ENSP00000350358:E344D	ENSP00000350358:E344D	E	+	3	2	PRAMEF12	12759909	0.000000	0.05858	0.003000	0.11579	0.037000	0.13140	0.106000	0.15354	0.248000	0.21435	0.205000	0.17691	GAG		0.597	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		Missense_Mutation
RHBG	57127	hgsc.bcm.edu	37	1	156354348	156354348	+	Frame_Shift_Del	DEL	C	C	-	rs11303415	byFrequency	TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:156354348delC	ENST00000368249.1	+	9	1303	c.1265delC	c.(1264-1266)tccfs	p.S422fs	RHBG_ENST00000494874.1_Intron|RHBG_ENST00000400992.2_Frame_Shift_Del_p.S390fs|RHBG_ENST00000368246.2_Splice_Site|RHBG_ENST00000255013.3_Frame_Shift_Del_p.S353fs	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	422	Interaction with ANK3.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.R425fs*>17(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TTTCTGGACTCCCCCCCCAGA	0.632											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		2118	0.422923	0.6059	0.2925	5008	,	,		18146	0.5446		0.2396	False		,,,				2504	0.3313															1	Deletion - Frameshift(1)	ovary(1)	1											38.0	63.0	55.0					1																	156354348		1930	4140	6070	154620972	SO:0001589	frameshift_variant	57127			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1265delC	1.37:g.156354348delC	ENSP00000357232:p.Ser422fs	Somatic	1777	Capture	SOLID	Phase_IV	154620972	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Frame_Shift_Del	DEL	ENST00000368249.1	37		DEL	30	Baylor																																																																																				0.632	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395		Frame_Shift_Del
SLAMF6	114836	hgsc.bcm.edu	37	1	160461154	160461154	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:160461154G>T	ENST00000368057.3	-	3	467	c.407C>A	c.(406-408)aCc>aAc	p.T136N	SLAMF6_ENST00000368059.3_Missense_Mutation_p.T136N|SLAMF6_ENST00000368055.1_Missense_Mutation_p.T25N			Q96DU3	SLAF6_HUMAN	SLAM family member 6	136	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.T136N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			ACTGTGATTGGTAACTTGTAT	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	97.0	98.0					1																	160461154		2203	4300	6503	158727778	SO:0001583	missense	114836			AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.407C>A	1.37:g.160461154G>T	ENSP00000357036:p.Thr136Asn	Somatic		Capture	SOLID	Phase_IV	158727778	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Missense_Mutation	SNP	ENST00000368057.3	37	CCDS53394.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	4.296	0.054120	0.08291	.	.	ENSG00000162739	ENST00000368059;ENST00000368057;ENST00000368055	T;T;T	0.38240	1.15;1.15;1.15	4.37	0.223	0.15292	Immunoglobulin-like fold (1);	1.155870	0.06227	N	0.687987	T	0.13200	0.0320	L	0.52823	1.66	0.09310	N	1	B;B;B;B;B;B	0.18461	0.028;0.015;0.004;0.004;0.005;0.005	B;B;B;B;B;B	0.15052	0.012;0.012;0.004;0.004;0.006;0.006	T	0.32214	-0.9915	10	0.38643	T	0.18	-0.1063	5.1169	0.14838	0.1769:0.0:0.5205:0.3026	.	25;25;87;136;136;136	B7Z6A7;Q5TAS6;B4E1U5;Q96DU3-2;Q96DU3;B2R8X8	.;.;.;.;SLAF6_HUMAN;.	N	136;136;25	ENSP00000357038:T136N;ENSP00000357036:T136N;ENSP00000357034:T25N	ENSP00000357034:T25N	T	-	2	0	SLAMF6	158727778	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.009000	0.13219	-0.040000	0.13580	-0.808000	0.03180	ACC		0.428	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931		Missense_Mutation
PPFIA4	8497	hgsc.bcm.edu	37	1	203030110	203030110	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1555-01	TCGA-24-1555-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:203030110G>A	ENST00000447715.2	+	28	3172	c.2731G>A	c.(2731-2733)Gtc>Atc	p.V911I	PPFIA4_ENST00000414050.2_Missense_Mutation_p.V640I|PPFIA4_ENST00000599966.1_Missense_Mutation_p.V427I|PPFIA4_ENST00000367240.2_Missense_Mutation_p.V912I|PPFIA4_ENST00000295706.4_Missense_Mutation_p.V427I|PPFIA4_ENST00000272198.6_Missense_Mutation_p.V427I			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	911					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)		p.V1066I(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						TTCTGGGAATGTCTGGGTCAC	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											153.0	155.0	154.0					1																	203030110		1900	4114	6014	201296733	SO:0001583	missense	8497			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2731G>A	1.37:g.203030110G>A	ENSP00000402576:p.Val911Ile	Somatic		Capture	SOLID	Phase_IV	201296733	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37		SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.218702	0.95104	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.28255	2.03;1.72;1.62;1.7;1.65	5.11	5.11	0.69529	.	0.000000	0.40818	N	0.001001	T	0.54581	0.1867	M	0.64997	1.995	0.80722	D	1	P;B;P;D;D	0.64830	0.947;0.347;0.483;0.994;0.99	P;B;B;D;D	0.81914	0.667;0.261;0.317;0.995;0.989	T	0.52786	-0.8529	10	0.51188	T	0.08	-34.0796	18.7385	0.91765	0.0:0.0:1.0:0.0	.	640;911;122;427;427	B4DIS5;B1N949;B3KN22;O75335-2;O75335	.;.;.;.;LIPA4_HUMAN	I	912;911;427;640;427	ENSP00000356209:V912I;ENSP00000402576:V911I;ENSP00000295706:V427I;ENSP00000400379:V640I;ENSP00000272198:V427I	ENSP00000272198:V427I	V	+	1	0	PPFIA4	201296733	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	9.657000	0.98554	2.655000	0.90218	0.655000	0.94253	GTC		0.557	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053		Missense_Mutation
SLC7A14	57709	hgsc.bcm.edu	37	3	170198580	170198580	+	Silent	SNP	C	C	T	rs145787666	byFrequency	TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr3:170198580C>T	ENST00000231706.5	-	7	1806	c.1491G>A	c.(1489-1491)ggG>ggA	p.G497G	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	497					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.G497G(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TGTCTGATTTCCCTATGAGCA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	3											222.0	224.0	223.0					3																	170198580		2203	4300	6503	171681274	SO:0001819	synonymous_variant	57709			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1491G>A	3.37:g.170198580C>T		Somatic		Capture	SOLID	Phase_IV	171681274	B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	CCDS33892.1	SNP	30	Baylor																																																																																				0.488	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949		Silent
SRRM2	23524	hgsc.bcm.edu	37	16	2815496	2815496	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr16:2815496A>T	ENST00000301740.8	+	11	5516	c.4967A>T	c.(4966-4968)gAg>gTg	p.E1656V		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1656	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.E1656V(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGCAGTACCGAGTCCTCTCCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											79.0	71.0	74.0					16																	2815496		2198	4300	6498	2755497	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4967A>T	16.37:g.2815496A>T	ENSP00000301740:p.Glu1656Val	Somatic		Capture	SOLID	Phase_IV	2755497	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.240	0.806517	0.16467	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.37411	1.2	5.47	4.35	0.52113	.	0.097227	0.45361	D	0.000373	T	0.27594	0.0678	L	0.44542	1.39	0.29714	N	0.839204	B	0.24186	0.099	B	0.24155	0.051	T	0.21109	-1.0255	10	0.44086	T	0.13	-2.548	5.5484	0.17078	0.7364:0.1759:0.0877:0.0	.	1656	Q9UQ35	SRRM2_HUMAN	V	1656;1656;908	ENSP00000301740:E1656V	ENSP00000301740:E1656V	E	+	2	0	SRRM2	2755497	1.000000	0.71417	0.993000	0.49108	0.870000	0.49936	1.698000	0.37794	0.874000	0.35823	0.533000	0.62120	GAG		0.577	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			Missense_Mutation
SYTL2	54843	hgsc.bcm.edu	37	11	85435367	85435367	+	Intron	SNP	A	A	T			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr11:85435367A>T	ENST00000528231.1	-	8	1737				SYTL2_ENST00000354566.3_Silent_p.T711T|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000525423.1_Silent_p.T711T|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000359152.5_Silent_p.T1235T	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.T711T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GGGGGGTTACAGTTTTAATGG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	11											84.0	83.0	83.0					11																	85435367		2203	4299	6502	85113015	SO:0001627	intron_variant	54843			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1460-3365T>A	11.37:g.85435367A>T		Somatic		Capture	SOLID	Phase_IV	85113015	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	ENST00000528231.1	37	CCDS53688.1	SNP	7	Baylor																																																																																				0.478	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927		Silent
TKT	7086	hgsc.bcm.edu	37	3	53260781	53260781	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1555-01	TCGA-24-1555-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr3:53260781A>C	ENST00000462138.1	-	13	1775	c.1687T>G	c.(1687-1689)Tat>Gat	p.Y563D	TKT_ENST00000423525.2_Missense_Mutation_p.Y563D|TKT_ENST00000461139.1_5'UTR|TKT_ENST00000423516.1_Missense_Mutation_p.Y571D|TKT_ENST00000296289.6_Missense_Mutation_p.Y516D			P29401	TKT_HUMAN	transketolase	563					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)	p.Y563D(1)		endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		CCTTCATAATAATGGTCCTCC	0.617																																					Colon(133;1506 2347 35238 42177)											1	Substitution - Missense(1)	ovary(1)	3											112.0	102.0	106.0					3																	53260781		2203	4300	6503	53235821	SO:0001583	missense	7086				CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.1687T>G	3.37:g.53260781A>C	ENSP00000417773:p.Tyr563Asp	Somatic		Capture	SOLID	Phase_IV	53235821	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	37	CCDS2871.1	SNP	13	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.99	3.522870	0.64747	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75	5.14	5.14	0.70334	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95529	0.8547	M	0.86097	2.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.994	D	0.96076	0.9050	10	0.66056	D	0.02	-17.4573	14.9669	0.71201	1.0:0.0:0.0:0.0	.	571;480;563	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	D	563;563;571;516;397	ENSP00000417773:Y563D;ENSP00000405455:Y563D;ENSP00000391481:Y571D;ENSP00000296289:Y516D	ENSP00000296289:Y516D	Y	-	1	0	TKT	53235821	1.000000	0.71417	0.936000	0.37596	0.298000	0.27526	9.253000	0.95501	1.953000	0.56701	0.533000	0.62120	TAT		0.617	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1			Missense_Mutation
TMPRSS5	80975	hgsc.bcm.edu	37	11	113560533	113560533	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr11:113560533T>C	ENST00000299882.5	-	12	1461	c.1313A>G	c.(1312-1314)tAc>tGc	p.Y438C	TMPRSS5_ENST00000545579.1_Missense_Mutation_p.Y429C|TMPRSS5_ENST00000540540.1_Missense_Mutation_p.Y179C|TMPRSS5_ENST00000536856.1_Intron|TMPRSS5_ENST00000538955.1_Missense_Mutation_p.Y394C|TMPRSS5_ENST00000544634.1_Missense_Mutation_p.Y369C|TMPRSS5_ENST00000545265.1_5'Flank|TMPRSS5_ENST00000544476.1_Missense_Mutation_p.Y325C	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	438	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.Y438C(1)		endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		TACCTTGGCGTAGACACCTGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											31.0	34.0	33.0					11																	113560533		2032	4166	6198	113065743	SO:0001583	missense	80975			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.1313A>G	11.37:g.113560533T>C	ENSP00000299882:p.Tyr438Cys	Somatic		Capture	SOLID	Phase_IV	113065743		Missense_Mutation	SNP	ENST00000299882.5	37	CCDS44735.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	t	15.16	2.750521	0.49257	.	.	ENSG00000166682	ENST00000540540;ENST00000299882;ENST00000545579;ENST00000538955;ENST00000544634;ENST00000544476	T;T;T;T;T;T	0.69561	-0.33;-0.41;-0.41;-0.41;-0.33;-0.33	4.22	4.22	0.49857	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.56097	U	0.000022	D	0.85084	0.5616	M	0.94063	3.49	0.48571	D	0.99967	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88739	0.3242	10	0.87932	D	0	.	12.7196	0.57134	0.0:0.0:0.0:1.0	.	369;429;438	F5GYA3;F5GX83;Q9H3S3	.;.;TMPS5_HUMAN	C	179;438;429;394;369;325	ENSP00000437761:Y179C;ENSP00000299882:Y438C;ENSP00000441104:Y429C;ENSP00000445528:Y394C;ENSP00000440783:Y369C;ENSP00000445930:Y325C	ENSP00000299882:Y438C	Y	-	2	0	TMPRSS5	113065743	1.000000	0.71417	0.846000	0.33378	0.132000	0.20833	7.628000	0.83189	1.908000	0.55244	0.392000	0.25879	TAC		0.627	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398652.1	NM_030770		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578393	7578393	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1555-01	TCGA-24-1555-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr17:7578393A>C	ENST00000269305.4	-	5	726	c.537T>G	c.(535-537)caT>caG	p.H179Q	TP53_ENST00000359597.4_Missense_Mutation_p.H179Q|TP53_ENST00000413465.2_Missense_Mutation_p.H179Q|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.H179Q|TP53_ENST00000455263.2_Missense_Mutation_p.H179Q|TP53_ENST00000445888.2_Missense_Mutation_p.H179Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179Q(23)|p.P177_C182delPHHERC(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.H86Q(2)|p.H47Q(2)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.R174fs*3(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGCAGCGCTCATGGTGGGGGC	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	76	Substitution - Missense(27)|Deletion - In frame(24)|Deletion - Frameshift(14)|Whole gene deletion(8)|Substitution - coding silent(2)|Complex - deletion inframe(1)	large_intestine(18)|breast(10)|upper_aerodigestive_tract(8)|lung(7)|liver(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|bone(5)|central_nervous_system(4)|stomach(2)|oesophagus(2)|pancreas(2)|endometrium(1)	17											47.0	47.0	47.0					17																	7578393		2203	4300	6503	7519118	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.537T>G	17.37:g.7578393A>C	ENSP00000269305:p.His179Gln	Somatic		Capture	SOLID	Phase_IV	7519118	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252337	0.80135	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.47	-9.19	0.00685	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	N	0.000000	D	0.99878	0.9942	M	0.92507	3.315	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	0.989;1.0;0.995;1.0;0.996;1.0;0.999	D;D;D;D;D;D;D	0.97110	0.952;0.997;0.939;1.0;0.985;0.995;0.971	D	0.99861	1.1083	10	0.87932	D	0	-15.4889	14.291	0.66278	0.2679:0.1015:0.6306:0.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Q	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179Q;ENSP00000352610:H179Q;ENSP00000269305:H179Q;ENSP00000398846:H179Q;ENSP00000391127:H179Q;ENSP00000391478:H179Q;ENSP00000425104:H47Q;ENSP00000423862:H86Q	ENSP00000269305:H179Q	H	-	3	2	TP53	7519118	0.081000	0.21417	0.351000	0.25721	0.844000	0.47949	-0.635000	0.05471	-2.028000	0.00931	-0.376000	0.06991	CAT		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TRPV4	59341	hgsc.bcm.edu	37	12	110222186	110222186	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1555-01	TCGA-24-1555-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr12:110222186T>C	ENST00000418703.2	-	14	2487	c.2393A>G	c.(2392-2394)gAc>gGc	p.D798G	TRPV4_ENST00000261740.2_Missense_Mutation_p.D798G|TRPV4_ENST00000544971.1_Missense_Mutation_p.D691G|TRPV4_ENST00000392719.2_Missense_Mutation_p.D751G|TRPV4_ENST00000541794.1_Missense_Mutation_p.D751G|TRPV4_ENST00000346520.2_Missense_Mutation_p.D738G|TRPV4_ENST00000536838.1_Missense_Mutation_p.D764G|TRPV4_ENST00000537083.1_Missense_Mutation_p.D738G	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	798					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)	p.D798G(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CTTGCCCGGGTCCTCGTTGAT	0.627																																																1	Substitution - Missense(1)	ovary(1)	12											167.0	142.0	151.0					12																	110222186		2203	4300	6503	108706569	SO:0001583	missense	59341			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.2393A>G	12.37:g.110222186T>C	ENSP00000406191:p.Asp798Gly	Somatic		Capture	SOLID	Phase_IV	108706569	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382159	0.82792	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.92149	-2.98;-2.98;-2.63;-2.86;-2.65;-2.86;-2.63;-2.97	4.82	4.82	0.62117	.	0.047914	0.85682	D	0.000000	D	0.95629	0.8579	M	0.80183	2.485	0.80722	D	1	D;D;D;B;P	0.76494	0.999;0.981;0.998;0.4;0.794	D;P;D;B;B	0.73708	0.981;0.706;0.972;0.331;0.351	D	0.96017	0.9006	10	0.72032	D	0.01	-2.0635	13.3275	0.60467	0.0:0.0:0.0:1.0	.	738;798;691;751;764	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	G	798;798;751;738;691;738;751;764	ENSP00000406191:D798G;ENSP00000261740:D798G;ENSP00000376480:D751G;ENSP00000319003:D738G;ENSP00000443611:D691G;ENSP00000442738:D738G;ENSP00000442167:D751G;ENSP00000444336:D764G	ENSP00000261740:D798G	D	-	2	0	TRPV4	108706569	1.000000	0.71417	0.999000	0.59377	0.703000	0.40648	7.143000	0.77348	2.028000	0.59812	0.454000	0.30748	GAC		0.627	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		Missense_Mutation
TXLNA	200081	hgsc.bcm.edu	37	1	32657974	32657974	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr1:32657974G>T	ENST00000373609.1	+	6	1307	c.1026G>T	c.(1024-1026)caG>caT	p.Q342H	TXLNA_ENST00000373610.3_Missense_Mutation_p.Q342H			P40222	TXLNA_HUMAN	taxilin alpha	342					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)	p.Q342H(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCAAGCTCCAGCAGGCCCAGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											72.0	70.0	71.0					1																	32657974		2203	4300	6503	32430561	SO:0001583	missense	200081			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.1026G>T	1.37:g.32657974G>T	ENSP00000362711:p.Gln342His	Somatic		Capture	SOLID	Phase_IV	32430561	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Missense_Mutation	SNP	ENST00000373609.1	37	CCDS353.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340480	0.41498	.	.	ENSG00000084652	ENST00000373610;ENST00000373609	T;T	0.79454	-1.27;-1.27	5.55	4.63	0.57726	.	0.149749	0.64402	D	0.000009	T	0.68705	0.3030	L	0.38953	1.18	0.52099	D	0.999944	B	0.14012	0.009	B	0.23852	0.049	T	0.65376	-0.6183	10	0.48119	T	0.1	-30.2009	10.3041	0.43670	0.0706:0.0:0.7941:0.1353	.	342	P40222	TXLNA_HUMAN	H	342	ENSP00000362712:Q342H;ENSP00000362711:Q342H	ENSP00000362711:Q342H	Q	+	3	2	TXLNA	32430561	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.094000	0.30951	1.482000	0.48325	0.585000	0.79938	CAG		0.582	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1	NM_175852		Missense_Mutation
ZDHHC9	51114	hgsc.bcm.edu	37	X	128957688	128957688	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1555-01	TCGA-24-1555-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chrX:128957688C>T	ENST00000357166.6	-	5	845	c.454G>A	c.(454-456)Gcc>Acc	p.A152T	AL359542.1_ENST00000582964.1_RNA|ZDHHC9_ENST00000371064.3_Missense_Mutation_p.A152T|ZDHHC9_ENST00000491039.1_5'UTR	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	152					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)	p.A152T(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						CAATGGGAGGCCCGGGGAGGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	X											114.0	107.0	110.0					X																	128957688		2203	4300	6503	128785369	SO:0001583	missense	51114			AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.454G>A	X.37:g.128957688C>T	ENSP00000349689:p.Ala152Thr	Somatic		Capture	SOLID	Phase_IV	128785369	B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	ENST00000357166.6	37	CCDS35395.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	c	21.7	4.187655	0.78789	.	.	ENSG00000188706	ENST00000357166;ENST00000371064;ENST00000406492	T;T;T	0.24350	1.86;1.86;1.86	5.66	5.66	0.87406	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.046534	0.85682	D	0.000000	T	0.35248	0.0925	L	0.33753	1.03	0.80722	D	1	P	0.40638	0.725	P	0.51777	0.679	T	0.02232	-1.1191	10	0.35671	T	0.21	-11.368	18.3341	0.90282	0.0:1.0:0.0:0.0	.	152	Q9Y397	ZDHC9_HUMAN	T	152	ENSP00000349689:A152T;ENSP00000360103:A152T;ENSP00000383991:A152T	ENSP00000349689:A152T	A	-	1	0	ZDHHC9	128785369	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.662000	0.61525	2.369000	0.80426	0.597000	0.82753	GCC		0.498	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1	NM_016032		Missense_Mutation
ZNF451	26036	hgsc.bcm.edu	37	6	57012439	57012439	+	Missense_Mutation	SNP	G	G	T	rs140160169		TCGA-24-1555-01	TCGA-24-1555-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1555-01	TCGA-24-1555-10	g.chr6:57012439G>T	ENST00000370706.4	+	10	1800	c.1556G>T	c.(1555-1557)cGg>cTg	p.R519L	RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.R519L|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.R519L|RP11-203B9.4_ENST00000589549.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R519L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CACATGAGCCGGATTCACGGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											189.0	180.0	183.0					6																	57012439		2203	4300	6503	57120398	SO:0001583	missense	26036			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1556G>T	6.37:g.57012439G>T	ENSP00000359740:p.Arg519Leu	Somatic		Capture	SOLID	Phase_IV	57120398	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604388	0.87157	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.10960	2.82;2.82;2.82	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	M	0.85945	2.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.999;0.997	T	0.22695	-1.0209	10	0.72032	D	0.01	-12.1449	19.216	0.93778	0.0:0.0:1.0:0.0	.	519;519;519;519	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	L	519	ENSP00000359740:R519L;ENSP00000350083:R519L;ENSP00000421645:R519L	ENSP00000350083:R519L	R	+	2	0	ZNF451	57120398	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.035000	0.93752	2.529000	0.85273	0.650000	0.86243	CGG		0.408	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		Missense_Mutation
