#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAMTSL3	57188	hgsc.bcm.edu	37	15	84651877	84651877	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr15:84651877A>T	ENST00000286744.5	+	21	3721	c.3497A>T	c.(3496-3498)aAc>aTc	p.N1166I	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.N1166I	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1166						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.N1166I(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CATGCAAAAAACTCAGGCAAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	15											55.0	55.0	55.0					15																	84651877		2203	4300	6503	82442881	SO:0001583	missense	57188			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3497A>T	15.37:g.84651877A>T	ENSP00000286744:p.Asn1166Ile	Somatic		Capture	SOLID	Phase_III	82442881	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326602	0.41197	.	.	ENSG00000156218	ENST00000286744	T	0.65178	-0.14	5.23	-4.81	0.03180	.	1.563420	0.04093	N	0.311698	T	0.53997	0.1831	L	0.54323	1.7	0.09310	N	1	B;B	0.28128	0.008;0.201	B;B	0.26969	0.015;0.075	T	0.45116	-0.9283	10	0.38643	T	0.18	.	8.9239	0.35628	0.2653:0.4686:0.2662:0.0	.	1166;1166	P82987-2;P82987	.;ATL3_HUMAN	I	1166	ENSP00000286744:N1166I	ENSP00000286744:N1166I	N	+	2	0	ADAMTSL3	82442881	0.000000	0.05858	0.000000	0.03702	0.580000	0.36256	0.397000	0.20883	-1.021000	0.03350	-0.472000	0.04984	AAC		0.493	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		Missense_Mutation
ANGPT4	51378	hgsc.bcm.edu	37	20	896772	896772	+	Missense_Mutation	SNP	G	G	A	rs369053720		TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr20:896772G>A	ENST00000381922.3	-	1	188	c.86C>T	c.(85-87)gCg>gTg	p.A29V	ANGPT4_ENST00000546022.1_Missense_Mutation_p.A29V	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	29					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.A29V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						GCCCCTATCCGCCTCCTGCCT	0.602																																					Pancreas(181;481 2077 3259 31286 49856)											1	Substitution - Missense(1)	ovary(1)	20						G	VAL/ALA	1,4405		0,1,2202	74.0	71.0	72.0		86	0.0	0.0	20		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	ANGPT4	NM_015985.2	64	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	29/504	896772	2,13004	2203	4300	6503	844772	SO:0001583	missense	51378			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.86C>T	20.37:g.896772G>A	ENSP00000371347:p.Ala29Val	Somatic		Capture	SOLID	Phase_III	844772	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	CCDS13009.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.347	-0.133344	0.06711	2.27E-4	1.16E-4	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.52295	0.67;1.49	4.57	0.0345	0.14184	.	1.272720	0.05785	N	0.609337	T	0.33089	0.0851	L	0.44542	1.39	0.09310	N	1	B;B	0.34061	0.436;0.436	B;B	0.24701	0.03;0.055	T	0.18461	-1.0336	10	0.30854	T	0.27	.	3.9973	0.09564	0.3198:0.1937:0.4865:0.0	.	29;29	B4E3J9;Q9Y264	.;ANGP4_HUMAN	V	29	ENSP00000371347:A29V;ENSP00000439605:A29V	ENSP00000371347:A29V	A	-	2	0	ANGPT4	844772	0.000000	0.05858	0.027000	0.17364	0.013000	0.08279	0.348000	0.20031	0.176000	0.19873	0.305000	0.20034	GCG		0.602	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985		Missense_Mutation
ARHGAP25	9938	hgsc.bcm.edu	37	2	69053236	69053236	+	Silent	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr2:69053236C>T	ENST00000295381.3	+	11	2267	c.1848C>T	c.(1846-1848)tcC>tcT	p.S616S	ARHGAP25_ENST00000409030.3_Silent_p.S609S|ARHGAP25_ENST00000467265.1_Silent_p.S577S|ARHGAP25_ENST00000409202.3_Silent_p.S617S|ARHGAP25_ENST00000409220.1_Silent_p.S610S|ARHGAP25_ENST00000479844.1_Silent_p.S310S	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	616					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S610S(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						TGGAGCGCTCCCGGGAGGATG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	2											107.0	113.0	111.0					2																	69053236		2203	4300	6503	68906740	SO:0001819	synonymous_variant	9938			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1848C>T	2.37:g.69053236C>T		Somatic		Capture	SOLID	Phase_III	68906740	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Silent	SNP	ENST00000295381.3	37		SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.29	1.308325	0.23821	.	.	ENSG00000163219	ENST00000497259	.	.	.	5.95	3.99	0.46301	.	.	.	.	.	T	0.47875	0.1469	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44997	-0.9291	4	.	.	.	.	3.8139	0.08808	0.133:0.5794:0.1306:0.1571	.	.	.	.	L	476	.	.	P	+	2	0	ARHGAP25	68906740	0.935000	0.31712	1.000000	0.80357	0.999000	0.98932	0.433000	0.21477	1.527000	0.49086	0.655000	0.94253	CCC		0.507	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882		Silent
ATF7IP2	80063	hgsc.bcm.edu	37	16	10525013	10525013	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr16:10525013A>G	ENST00000396560.2	+	3	763	c.536A>G	c.(535-537)cAg>cGg	p.Q179R	ATF7IP2_ENST00000396559.1_Missense_Mutation_p.Q179R|ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000324570.5_Missense_Mutation_p.Q179R|ATF7IP2_ENST00000356427.2_Missense_Mutation_p.Q179R	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q179R(1)		large_intestine(3)	3						GGTGTTGTTCAGATGCCAGAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	16											112.0	105.0	107.0					16																	10525013		2197	4300	6497	10432514	SO:0001583	missense	80063			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.536A>G	16.37:g.10525013A>G	ENSP00000379808:p.Gln179Arg	Somatic		Capture	SOLID	Phase_III	10432514	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Missense_Mutation	SNP	ENST00000396560.2	37	CCDS10540.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.94	2.089500	0.36855	.	.	ENSG00000166669	ENST00000396559;ENST00000396560;ENST00000535850;ENST00000356427;ENST00000324570	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.35	3.1	0.35709	.	0.751704	0.11359	N	0.572150	T	0.29524	0.0736	L	0.44542	1.39	0.09310	N	1	B;B	0.33044	0.395;0.395	B;B	0.26310	0.068;0.068	T	0.16808	-1.0390	10	0.36615	T	0.2	-2.7129	4.9445	0.13982	0.7169:0.1888:0.0943:0.0	.	179;179	Q5U623-2;Q5U623	.;MCAF2_HUMAN	R	179	ENSP00000379807:Q179R;ENSP00000379808:Q179R;ENSP00000440791:Q179R;ENSP00000348799:Q179R;ENSP00000322811:Q179R	ENSP00000322811:Q179R	Q	+	2	0	ATF7IP2	10432514	0.030000	0.19436	0.182000	0.23118	0.349000	0.29174	2.178000	0.42519	0.855000	0.35359	0.260000	0.18958	CAG		0.428	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997		Missense_Mutation
FAM196A	642938	hgsc.bcm.edu	37	10	128974315	128974315	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr10:128974315G>T	ENST00000522781.1	-	4	900	c.345C>A	c.(343-345)taC>taA	p.Y115*	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Nonsense_Mutation_p.Y115*	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	115								p.Y115*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GGAACGTCTGGTAACACTTCT	0.537																																																1	Substitution - Nonsense(1)	ovary(1)	10											117.0	109.0	112.0					10																	128974315		2203	4300	6503	128864305	SO:0001587	stop_gained	642938				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.345C>A	10.37:g.128974315G>T	ENSP00000429763:p.Tyr115*	Somatic		Capture	SOLID	Phase_III	128864305	B2RNT4|B7ZME7	Nonsense_Mutation	SNP	ENST00000522781.1	37	CCDS31312.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	43	9.881951	0.99286	.	.	ENSG00000188916	ENST00000522781;ENST00000424811	.	.	.	4.84	3.92	0.45320	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2914	0.60272	0.0785:0.0:0.9215:0.0	.	.	.	.	X	115	.	ENSP00000428730:Y115X	Y	-	3	2	FAM196A	128864305	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.130000	0.42064	2.608000	0.88229	0.563000	0.77884	TAC		0.537	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762		Nonsense_Mutation
C1orf141	400757	hgsc.bcm.edu	37	1	67561090	67561090	+	Missense_Mutation	SNP	T	T	C	rs72933970	byFrequency	TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:67561090T>C	ENST00000371007.2	-	7	540	c.431A>G	c.(430-432)cAg>cGg	p.Q144R	C1orf141_ENST00000371006.1_Missense_Mutation_p.Q144R|C1orf141_ENST00000544837.1_Missense_Mutation_p.Q144R	NM_001276351.1	NP_001263280.1	Q5JVX7	CA141_HUMAN	chromosome 1 open reading frame 141	144										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18						ATCGTTCATCTGTGGAGATTT	0.363													C|||	582	0.116214	0.2617	0.085	5008	,	,		19959	0.0645		0.0507	False		,,,				2504	0.0624															0			1						C	ARG/GLN	926,3478		95,736,1371	43.0	41.0	42.0		431	-1.1	0.0	1	dbSNP_130	42	402,8194		10,382,3906	yes	missense	C1orf141	NM_001013674.1	43	105,1118,5277	CC,CT,TT		4.6766,21.0263,10.2154	possibly-damaging	144/401	67561090	1328,11672	2202	4298	6500	67333678	SO:0001583	missense	400757			BC090886	CCDS30745.1, CCDS72804.1	1p31.2	2012-07-23			ENSG00000203963	ENSG00000203963			32044	protein-coding gene	gene with protein product							Standard	NM_001276351		Approved		uc001ddm.2	Q5JVX7	OTTHUMG00000009406	ENST00000371007.2:c.431A>G	1.37:g.67561090T>C	ENSP00000360046:p.Gln144Arg	Somatic		Capture	SOLID	Phase_III	67333678	Q0P5P5|Q5JVX5	Missense_Mutation	SNP	ENST00000371007.2	37	CCDS30745.1	SNP	55	Baylor	223	0.1021062271062271	128	0.2601626016260163	19	0.052486187845303865	32	0.055944055944055944	44	0.05804749340369393	C	10.40	1.339284	0.24339	0.210263	0.046766	ENSG00000203963	ENST00000371007;ENST00000371006;ENST00000544837;ENST00000371005;ENST00000448166	T;T;T	0.28895	1.59;1.59;1.59	5.76	-1.07	0.09968	.	2.750990	0.01545	N	0.019435	T	0.05364	0.0142	N	0.24115	0.695	0.80722	P	0.0	P	0.38250	0.624	B	0.31337	0.128	T	0.10019	-1.0648	9	0.27082	T	0.32	2.7976	2.5553	0.04758	0.1112:0.1536:0.1509:0.5843	.	144	Q5JVX7	CA141_HUMAN	R	144;144;144;215;215	ENSP00000360046:Q144R;ENSP00000360045:Q144R;ENSP00000444018:Q144R	ENSP00000360044:Q215R	Q	-	2	0	C1orf141	67333678	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.005000	0.03674	-0.099000	0.12263	-1.286000	0.01371	CAG		0.363	C1orf141-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026096.2	NM_001013674		Missense_Mutation
BPIFA2	140683	hgsc.bcm.edu	37	20	31760767	31760767	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr20:31760767G>C	ENST00000253362.2	+	3	333	c.187G>C	c.(187-189)Gga>Cga	p.G63R	BPIFA2_ENST00000354932.5_Missense_Mutation_p.G63R			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	63						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)	p.G63R(1)									GGTCGACCTAGGAGTGCTTCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	20											93.0	85.0	88.0					20																	31760767		2203	4299	6502	31224428	SO:0001583	missense	140683			AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.187G>C	20.37:g.31760767G>C	ENSP00000253362:p.Gly63Arg	Somatic		Capture	SOLID	Phase_III	31224428	Q9BQQ0	Missense_Mutation	SNP	ENST00000253362.2	37	CCDS13214.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.176	-1.066660	0.01934	.	.	ENSG00000131050	ENST00000253362;ENST00000354932	T;T	0.05139	3.49;3.49	3.87	-7.74	0.01241	.	2.270050	0.01823	N	0.034193	T	0.02888	0.0086	N	0.19112	0.55	0.09310	N	1	P	0.35411	0.5	B	0.33121	0.158	T	0.38672	-0.9650	10	0.12430	T	0.62	-17.6039	0.949	0.01372	0.4244:0.2134:0.147:0.2152	.	63	Q96DR5	BPIA2_HUMAN	R	63	ENSP00000253362:G63R;ENSP00000347012:G63R	ENSP00000253362:G63R	G	+	1	0	BPIFA2	31224428	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.698000	0.01908	-2.323000	0.00639	-0.367000	0.07326	GGA		0.488	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574		Missense_Mutation
FAM193A	8603	hgsc.bcm.edu	37	4	2696853	2696853	+	Silent	SNP	C	C	A			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr4:2696853C>A	ENST00000324666.5	+	15	2751	c.2400C>A	c.(2398-2400)ggC>ggA	p.G800G	FAM193A_ENST00000505311.1_Silent_p.G800G|FAM193A_ENST00000382839.3_Silent_p.G800G|FAM193A_ENST00000502458.1_Silent_p.G822G|FAM193A_ENST00000545951.1_Silent_p.G800G	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	800								p.G800G(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						TTGGGCACGGCGGGGTGAGTG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	4											88.0	64.0	73.0					4																	2696853		2203	4300	6503	2666651	SO:0001819	synonymous_variant	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2400C>A	4.37:g.2696853C>A		Somatic		Capture	SOLID	Phase_III	2666651	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Silent	SNP	ENST00000324666.5	37	CCDS58875.1	SNP	27	Baylor																																																																																				0.547	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		Silent
NPR3	4883	hgsc.bcm.edu	37	5	32789821	32789821	+	3'UTR	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr5:32789821G>T	ENST00000265074.8	+	0	5339				AC026703.1_ENST00000326958.1_Missense_Mutation_p.G105V	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GCTGATTTTGGGTGTGTGTGT	0.423																																																0			5											141.0	111.0	121.0					5																	32789821		2203	4300	6503	32825578	SO:0001624	3_prime_UTR_variant	79614				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.*3370G>T	5.37:g.32789821G>T		Somatic		Capture	SOLID	Phase_III	32825578	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	CCDS56357.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495953	0.26774	.	.	ENSG00000181495	ENST00000326958	.	.	.	4.17	2.36	0.29203	.	.	.	.	.	T	0.42245	0.1194	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36065	-0.9763	5	0.87932	D	0	.	6.8722	0.24127	0.21:0.0:0.79:0.0	.	.	.	.	V	105	.	ENSP00000318340:G105V	G	+	2	0	AC026703.1	32825578	0.051000	0.20477	0.001000	0.08648	0.192000	0.23643	1.009000	0.29886	0.694000	0.31654	0.543000	0.68304	GGG		0.423	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908		Missense_Mutation
CREBRF	153222	hgsc.bcm.edu	37	5	172517730	172517730	+	Frame_Shift_Del	DEL	C	C	-			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr5:172517730delC	ENST00000296953.2	+	4	867	c.548delC	c.(547-549)gctfs	p.A183fs	CREBRF_ENST00000540014.1_Frame_Shift_Del_p.A183fs|CREBRF_ENST00000522692.1_Frame_Shift_Del_p.A183fs|CREBRF_ENST00000520420.1_Frame_Shift_Del_p.A183fs	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	183					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGAGCAGCTGCTCCTGTGTGT	0.443																																																0			5											50.0	48.0	49.0					5																	172517730		2203	4300	6503	172450336	SO:0001589	frameshift_variant	153222			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.548delC	5.37:g.172517730delC	ENSP00000296953:p.Ala183fs	Somatic		Capture	SOLID	Phase_III	172450336	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Frame_Shift_Del	DEL	ENST00000296953.2	37	CCDS34293.1	DEL	28	Baylor																																																																																				0.443	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607		Frame_Shift_Del
ATAT1	79969	hgsc.bcm.edu	37	6	30609969	30609969	+	Silent	SNP	G	G	A			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr6:30609969G>A	ENST00000376485.4	+	9	699	c.669G>A	c.(667-669)ctG>ctA	p.L223L	ATAT1_ENST00000376483.4_Silent_p.L223L|ATAT1_ENST00000330083.5_Silent_p.L211L|ATAT1_ENST00000468713.1_3'UTR|ATAT1_ENST00000329992.8_Silent_p.L223L|ATAT1_ENST00000376478.2_Silent_p.L200L|ATAT1_ENST00000318999.7_Silent_p.L200L|ATAT1_ENST00000319027.5_Silent_p.L200L					alpha tubulin acetyltransferase 1									p.L223L(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	9						CAAGGAAGCTGCCACCCAAGA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	6											97.0	85.0	89.0					6																	30609969		2203	4300	6503	30717948	SO:0001819	synonymous_variant	79969			AK023220	CCDS4683.2, CCDS54978.1, CCDS59002.1	6p21.32	2014-06-17	2010-10-11	2010-10-11	ENSG00000137343	ENSG00000137343	2.3.1.108		21186	protein-coding gene	gene with protein product	"""alpha-tubulin N-acetyltransferase"""	615556	"""chromosome 6 open reading frame 134"""	C6orf134		20829795	Standard	NM_024909		Approved	FLJ13158, Em:AB023049.7, MEC17	uc003nqv.3	Q5SQI0	OTTHUMG00000031219	ENST00000376485.4:c.669G>A	6.37:g.30609969G>A		Somatic		Capture	SOLID	Phase_III	30717948		Silent	SNP	ENST00000376485.4	37		SNP	46	Baylor																																																																																				0.577	ATAT1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076449.2	NM_024909		Silent
CEP89	84902	hgsc.bcm.edu	37	19	33450806	33450806	+	Splice_Site	SNP	C	C	A	rs73926195	byFrequency	TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr19:33450806C>A	ENST00000305768.5	-	3	393	c.305G>T	c.(304-306)cGg>cTg	p.R102L	CEP89_ENST00000590597.2_Splice_Site_p.R102L	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	102					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.R102L(1)|p.R102Q(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TGGTACCTACCGAGGCCTCAG	0.587																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	19											94.0	75.0	81.0					19																	33450806		2203	4300	6503	38142646	SO:0001630	splice_region_variant	84902			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.305+1G>T	19.37:g.33450806C>A		Somatic		Capture	SOLID	Phase_III	38142646	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849552	0.32699	.	.	ENSG00000121289	ENST00000305768	T	0.31769	1.48	5.48	2.01	0.26516	.	0.317619	0.28382	N	0.015556	T	0.25717	0.0626	L	0.46157	1.445	0.38568	D	0.949883	P;P	0.43973	0.586;0.823	B;B	0.40659	0.272;0.336	T	0.04855	-1.0922	9	.	.	.	-1.7133	10.2426	0.43321	0.0:0.7433:0.0:0.2567	.	102;102	Q96ST8-3;Q96ST8	.;CEP89_HUMAN	L	102	ENSP00000306105:R102L	.	R	-	2	0	CEP89	38142646	0.975000	0.34042	0.770000	0.31555	0.026000	0.11368	0.915000	0.28638	0.162000	0.19483	0.655000	0.94253	CGG		0.587	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	Missense_Mutation	Missense_Mutation
CHD6	84181	hgsc.bcm.edu	37	20	40042021	40042021	+	Silent	SNP	C	C	G			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr20:40042021C>G	ENST00000373233.3	-	35	7251	c.7074G>C	c.(7072-7074)ctG>ctC	p.L2358L	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2358					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.L2358L(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GCCAGTCAAGCAGACTCTTGC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	20											67.0	64.0	65.0					20																	40042021		2203	4300	6503	39475435	SO:0001819	synonymous_variant	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7074G>C	20.37:g.40042021C>G		Somatic		Capture	SOLID	Phase_III	39475435	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	CCDS13317.1	SNP	25	Baylor																																																																																				0.572	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			Silent
COL7A1	1294	hgsc.bcm.edu	37	3	48602596	48602597	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-24-1556-01	TCGA-24-1556-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:48602596_48602597insGG	ENST00000328333.8	-	116	8672_8673	c.8565_8566insCC	c.(8563-8568)tactccfs	p.S2856fs	COL7A1_ENST00000454817.1_Frame_Shift_Ins_p.S2824fs|UCN2_ENST00000273610.3_5'Flank|COL7A1_ENST00000470076.1_5'Flank	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2856	Nonhelical region (NC2).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S2856fs*43(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAATACTCGGAGTATTCAGAGT	0.634																																																1	Insertion - Frameshift(1)	ovary(1)	3																																								48577601	SO:0001589	frameshift_variant	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8565_8566insCC	3.37:g.48602596_48602597insGG	ENSP00000332371:p.Ser2856fs	Somatic		Capture	SOLID	Phase_III	48577600	Q14054|Q16507	Frame_Shift_Ins	INS	ENST00000328333.8	37	CCDS2773.1	INS	11	Baylor																																																																																				0.634	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		Frame_Shift_Ins
COMMD9	29099	hgsc.bcm.edu	37	11	36296247	36296247	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr11:36296247G>C	ENST00000263401.5	-	6	548	c.532C>G	c.(532-534)Ctg>Gtg	p.L178V	COMMD9_ENST00000452374.2_Missense_Mutation_p.L136V|LINC00610_ENST00000355500.1_lincRNA|COMMD9_ENST00000532705.1_Missense_Mutation_p.T166S|COMMD9_ENST00000533308.1_5'Flank	NM_014186.3	NP_054905.2	Q9P000	COMD9_HUMAN	COMM domain containing 9	178	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.							p.L178V(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	5	all_lung(20;0.211)	all_hematologic(20;0.107)				ATGGTGTCCAGTGTTTCTTTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	11											174.0	143.0	154.0					11																	36296247		2202	4298	6500	36252823	SO:0001583	missense	29099			AY542164	CCDS7900.1, CCDS44571.1	11p13	2008-02-05			ENSG00000110442	ENSG00000110442			25014	protein-coding gene	gene with protein product		612299				15799966	Standard	NM_014186		Approved	HSPC166, FLJ31106	uc001mwn.4	Q9P000	OTTHUMG00000166333	ENST00000263401.5:c.532C>G	11.37:g.36296247G>C	ENSP00000263401:p.Leu178Val	Somatic		Capture	SOLID	Phase_III	36252823	E9PAN2|Q96FI2|Q9H0R0	Missense_Mutation	SNP	ENST00000263401.5	37	CCDS7900.1	SNP	36	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.79|12.79	2.044965|2.044965	0.36085|0.36085	.|.	.|.	ENSG00000110442|ENSG00000110442	ENST00000263401;ENST00000452374|ENST00000532705	T;T|.	0.15834|.	2.39;2.39|.	5.66|5.66	4.74|4.74	0.60224|0.60224	COMM domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58935|0.58935	0.2157|0.2157	M|M	0.76574|0.76574	2.34|2.34	0.23063|0.23063	N|N	0.998355|0.998355	D;B|.	0.71674|.	0.998;0.117|.	D;B|.	0.65443|.	0.935;0.103|.	T|T	0.55283|0.55283	-0.8165|-0.8165	10|6	0.66056|0.87932	D|D	0.02|0	-15.346|-15.346	9.8588|9.8588	0.41101|0.41101	0.1477:0.0:0.8523:0.0|0.1477:0.0:0.8523:0.0	.|.	136;178|.	Q9P000-2;Q9P000|.	.;COMD9_HUMAN|.	V|S	178;136|166	ENSP00000263401:L178V;ENSP00000392510:L136V|.	ENSP00000263401:L178V|ENSP00000435599:T166S	L|T	-|-	1|2	2|0	COMMD9|COMMD9	36252823|36252823	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.967000|0.967000	0.64934|0.64934	3.026000|3.026000	0.49689|0.49689	2.656000|2.656000	0.90262|0.90262	0.655000|0.655000	0.94253|0.94253	CTG|ACT		0.562	COMMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389196.1	NM_014186		Missense_Mutation
CTSL3P	392360	hgsc.bcm.edu	37	9	90388462	90388462	+	RNA	SNP	A	A	G			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr9:90388462A>G	ENST00000354530.2	+	0	328					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)	p.M110V(1)									CTTCAAGGCAATGTTGGCTGC	0.453																																																1	Substitution - Missense(1)	ovary(1)	9											166.0	154.0	158.0					9																	90388462		2203	4300	6503	89578282			392360			AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90388462A>G		Somatic		Capture	SOLID	Phase_III	89578282		Missense_Mutation	SNP	ENST00000354530.2	37		SNP	4	Baylor																																																																																				0.453	CTSL3P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356542.1	NR_027917		Missense_Mutation
NSG1	27065	hgsc.bcm.edu	37	4	4393274	4393274	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr4:4393274G>C	ENST00000421177.2	+	7	2193	c.202G>C	c.(202-204)Gag>Cag	p.E68Q	NSG1_ENST00000433139.2_Missense_Mutation_p.E68Q|NSG1_ENST00000513555.1_Missense_Mutation_p.E68Q|NSG1_ENST00000506380.1_Missense_Mutation_p.E68Q|NSG1_ENST00000397958.1_Missense_Mutation_p.E68Q|NSG1_ENST00000504171.1_Intron|NSG1_ENST00000505246.1_Missense_Mutation_p.E68Q			P42857	NSG1_HUMAN		68					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.E68Q(1)|p.E68K(1)									CCAAATTGCTGAGTTCACCGT	0.522																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	4											132.0	112.0	119.0					4																	4393274		2203	4300	6503	4444175	SO:0001583	missense	27065																														ENST00000421177.2:c.202G>C	4.37:g.4393274G>C	ENSP00000388823:p.Glu68Gln	Somatic		Capture	SOLID	Phase_III	4444175	B4DXC5|Q49AQ1	Missense_Mutation	SNP	ENST00000421177.2	37	CCDS3376.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412542	0.83340	.	.	ENSG00000168824	ENST00000421177;ENST00000513555;ENST00000505246;ENST00000506380;ENST00000397958;ENST00000433139	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.75838	0.3904	L	0.58101	1.795	0.58432	D	0.999999	D	0.89917	1.0	D	0.70935	0.971	T	0.75969	-0.3130	9	0.44086	T	0.13	-22.2244	18.2363	0.89950	0.0:0.0:1.0:0.0	.	68	P42857	NSG1_HUMAN	Q	68	.	ENSP00000381049:E68Q	E	+	1	0	AC110814.1	4444175	1.000000	0.71417	0.971000	0.41717	0.917000	0.54804	8.283000	0.89909	2.372000	0.80975	0.563000	0.77884	GAG		0.522	NSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246799.1			Missense_Mutation
DDX55	57696	hgsc.bcm.edu	37	12	124090657	124090657	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr12:124090657C>G	ENST00000238146.4	+	3	247	c.197C>G	c.(196-198)cCc>cGc	p.P66R	DDX55_ENST00000538744.1_Missense_Mutation_p.P66R	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	66	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.P66L(1)|p.P66R(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		TTTGTCATCCCCATCCTGGAA	0.428																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	12											76.0	72.0	74.0					12																	124090657		2203	4300	6503	122656610	SO:0001583	missense	57696			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.197C>G	12.37:g.124090657C>G	ENSP00000238146:p.Pro66Arg	Somatic		Capture	SOLID	Phase_III	122656610	Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	ENST00000238146.4	37	CCDS9251.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.110539	0.94292	.	.	ENSG00000111364	ENST00000238146;ENST00000538449;ENST00000538744	T;T	0.56941	2.49;0.43	6.17	6.17	0.99709	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84991	0.5595	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89553	0.3801	10	0.87932	D	0	-16.7259	20.8794	0.99867	0.0:1.0:0.0:0.0	.	66	Q8NHQ9	DDX55_HUMAN	R	66	ENSP00000238146:P66R;ENSP00000443114:P66R	ENSP00000238146:P66R	P	+	2	0	DDX55	122656610	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CCC		0.428	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2			Missense_Mutation
EPB41L3	23136	hgsc.bcm.edu	37	18	5416037	5416037	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr18:5416037A>T	ENST00000341928.2	-	13	2187	c.1847T>A	c.(1846-1848)cTc>cAc	p.L616H	EPB41L3_ENST00000427684.2_Intron|EPB41L3_ENST00000342933.3_Missense_Mutation_p.L616H|EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000542146.1_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	616	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.L616H(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CTGGGGCAGGAGGTTGGTTTC	0.532																																																1	Substitution - Missense(1)	ovary(1)	18											174.0	133.0	147.0					18																	5416037		2203	4300	6503	5406037	SO:0001583	missense	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1847T>A	18.37:g.5416037A>T	ENSP00000343158:p.Leu616His	Somatic		Capture	SOLID	Phase_III	5406037	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	23.8	4.453896	0.84209	.	.	ENSG00000082397	ENST00000341928;ENST00000342933	D;D	0.84873	-1.91;-1.91	5.74	5.74	0.90152	.	0.207759	0.42294	D	0.000729	D	0.87309	0.6145	L	0.51422	1.61	0.80722	D	1	D	0.61697	0.99	P	0.52710	0.707	D	0.88598	0.3148	10	0.72032	D	0.01	.	16.0469	0.80725	1.0:0.0:0.0:0.0	.	616	Q9Y2J2	E41L3_HUMAN	H	616	ENSP00000343158:L616H;ENSP00000341138:L616H	ENSP00000343158:L616H	L	-	2	0	EPB41L3	5406037	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.169000	0.94788	2.194000	0.70268	0.460000	0.39030	CTC		0.532	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307		Missense_Mutation
EPHA3	2042	hgsc.bcm.edu	37	3	89499441	89499441	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:89499441T>G	ENST00000336596.2	+	15	2836	c.2611T>G	c.(2611-2613)Ttt>Gtt	p.F871V	EPHA3_ENST00000494014.1_Missense_Mutation_p.F871V	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	871	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.F871V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CAGACCCAAGTTTGAGCAGAT	0.512										TSP Lung(6;0.00050)																																						1	Substitution - Missense(1)	ovary(1)	3											94.0	83.0	87.0					3																	89499441		2203	4300	6503	89582131	SO:0001583	missense	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2611T>G	3.37:g.89499441T>G	ENSP00000337451:p.Phe871Val	Somatic		Capture	SOLID	Phase_III	89582131	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.2	4.712175	0.89112	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.88046	-2.33;-2.33	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95201	0.8444	M	0.93678	3.445	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.96343	0.9252	9	.	.	.	.	15.9043	0.79412	0.0:0.0:0.0:1.0	.	871	P29320	EPHA3_HUMAN	V	871	ENSP00000337451:F871V;ENSP00000419190:F871V	.	F	+	1	0	EPHA3	89582131	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.040000	0.89188	2.160000	0.67779	0.528000	0.53228	TTT		0.512	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		Missense_Mutation
FAT2	2196	hgsc.bcm.edu	37	5	150923090	150923090	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr5:150923090G>C	ENST00000261800.5	-	9	7610	c.7598C>G	c.(7597-7599)cCc>cGc	p.P2533R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2533	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2533R(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGCCATTGGGGTTTATGGA	0.428																																																1	Substitution - Missense(1)	ovary(1)	5											146.0	149.0	148.0					5																	150923090		2203	4300	6503	150903283	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.7598C>G	5.37:g.150923090G>C	ENSP00000261800:p.Pro2533Arg	Somatic		Capture	SOLID	Phase_III	150903283	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.752	-0.051317	0.07407	.	.	ENSG00000086570	ENST00000261800	T	0.53640	0.61	5.34	5.34	0.76211	Cadherin (4);Cadherin-like (1);	0.398004	0.24443	N	0.038491	T	0.36991	0.0987	L	0.39245	1.2	0.23003	N	0.998441	B	0.33198	0.401	B	0.30716	0.119	T	0.24190	-1.0167	10	0.25106	T	0.35	.	12.2297	0.54480	0.0:0.0:0.7116:0.2884	.	2533	Q9NYQ8	FAT2_HUMAN	R	2533	ENSP00000261800:P2533R	ENSP00000261800:P2533R	P	-	2	0	FAT2	150903283	0.876000	0.30132	0.984000	0.44739	0.960000	0.62799	2.692000	0.47018	2.498000	0.84270	0.462000	0.41574	CCC		0.428	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		Missense_Mutation
GREB1	9687	hgsc.bcm.edu	37	2	11716494	11716494	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr2:11716494G>T	ENST00000381486.2	+	5	770	c.470G>T	c.(469-471)tGt>tTt	p.C157F	GREB1_ENST00000381483.2_Missense_Mutation_p.C157F|GREB1_ENST00000389825.3_Missense_Mutation_p.C47F|GREB1_ENST00000263834.5_Missense_Mutation_p.C157F|GREB1_ENST00000234142.5_Missense_Mutation_p.C157F	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	157						integral component of membrane (GO:0016021)		p.C157F(2)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCTGGGAATTGTGTTGGCTGT	0.388																																					Ovarian(39;850 945 2785 23371 33093)											2	Substitution - Missense(2)	ovary(2)	2											144.0	149.0	147.0					2																	11716494		2203	4300	6503	11633945	SO:0001583	missense	9687				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.470G>T	2.37:g.11716494G>T	ENSP00000370896:p.Cys157Phe	Somatic		Capture	SOLID	Phase_III	11633945	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246215	0.80024	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;T;T;T;T	0.79033	1.34;0.31;-1.23;0.46;1.34	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.88051	0.6333	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.997	D	0.89421	0.3710	10	0.87932	D	0	-8.5931	18.2133	0.89877	0.0:0.0:1.0:0.0	.	157;47;157;157	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	F	157;157;47;157;157	ENSP00000370896:C157F;ENSP00000263834:C157F;ENSP00000374475:C47F;ENSP00000370892:C157F;ENSP00000234142:C157F	ENSP00000234142:C157F	C	+	2	0	GREB1	11633945	1.000000	0.71417	0.960000	0.40013	0.987000	0.75469	9.478000	0.97927	2.534000	0.85438	0.655000	0.94253	TGT		0.388	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		Missense_Mutation
GSS	2937	hgsc.bcm.edu	37	20	33524780	33524780	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr20:33524780C>G	ENST00000216951.2	-	7	753	c.655G>C	c.(655-657)Gac>Cac	p.D219H	GSS_ENST00000451957.2_Missense_Mutation_p.D108H|GSS_ENST00000541098.1_Missense_Mutation_p.D91H	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	219			D -> A (in GSS deficiency).|D -> G (in GSS deficiency; dbSNP:rs28938472). {ECO:0000269|PubMed:8896573}.		aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.D219H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	GCACGCTGGTCAAATATGTTT	0.498																																																1	Substitution - Missense(1)	ovary(1)	20											154.0	137.0	143.0					20																	33524780		2203	4300	6503	32988441	SO:0001583	missense	2937				CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.655G>C	20.37:g.33524780C>G	ENSP00000216951:p.Asp219His	Somatic		Capture	SOLID	Phase_III	32988441	B2R697|B6F210|E1P5P9|Q4TTD9	Missense_Mutation	SNP	ENST00000216951.2	37	CCDS13245.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.112932	0.94339	.	.	ENSG00000100983	ENST00000216951;ENST00000541098;ENST00000451957	D;D;D	0.94793	-3.52;-3.52;-3.52	5.9	5.9	0.94986	PreATP-grasp-like fold (1);Glutathione synthase, substrate-binding, eukaryotic (2);	0.168662	0.64402	D	0.000006	D	0.98372	0.9459	H	0.96015	3.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98962	1.0798	10	0.87932	D	0	-25.3403	19.8768	0.96875	0.0:1.0:0.0:0.0	.	108;219	B6F210;P48637	.;GSHB_HUMAN	H	219;91;108	ENSP00000216951:D219H;ENSP00000439744:D91H;ENSP00000407517:D108H	ENSP00000216951:D219H	D	-	1	0	GSS	32988441	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.110000	0.77069	2.786000	0.95864	0.561000	0.74099	GAC		0.498	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2			Missense_Mutation
HMG20A	10363	hgsc.bcm.edu	37	15	77763381	77763381	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr15:77763381C>T	ENST00000381714.3	+	6	1008	c.580C>T	c.(580-582)Caa>Taa	p.Q194*	HMG20A_ENST00000336216.4_Nonsense_Mutation_p.Q194*	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	194					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q194*(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATCTCATAGGCAAGGTATCAA	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	15											117.0	111.0	113.0					15																	77763381		2196	4294	6490	75550436	SO:0001587	stop_gained	10363			AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.580C>T	15.37:g.77763381C>T	ENSP00000371133:p.Gln194*	Somatic		Capture	SOLID	Phase_III	75550436	A6NHY3|D3DW78|Q53G31|Q9NSF6	Nonsense_Mutation	SNP	ENST00000381714.3	37	CCDS10295.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	38	6.958289	0.97964	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	.	.	.	5.97	5.97	0.96955	.	0.214716	0.49916	D	0.000138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-21.3402	20.4388	0.99107	0.0:1.0:0.0:0.0	.	.	.	.	X	194	.	ENSP00000336856:Q194X	Q	+	1	0	HMG20A	75550436	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.001000	0.63946	2.836000	0.97738	0.655000	0.94253	CAA		0.413	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200		Nonsense_Mutation
HRNR	388697	hgsc.bcm.edu	37	1	152195729	152195729	+	Start_Codon_Del	DEL	T	T	-	rs397824794|rs530205886|rs200372988|rs34061715|rs561299511	byFrequency	TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:152195729delT	ENST00000368801.2	-	0	76				FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin						establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.?(2)|p.M1L(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTTTAGGCATTTTTTTTTTT	0.378																																																3	Unknown(2)|Substitution - Missense(1)	ovary(2)|lung(1)	1											33.0	21.0	25.0					1																	152195729		2203	4300	6503	150462353	SO:0001582	initiator_codon_variant	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243		1.37:g.152195729delT		Somatic		Capture	SOLID	Phase_III	150462353	Q5DT20|Q5U1F4	Frame_Shift_Del	DEL	ENST00000368801.2	37	CCDS30859.1	DEL	52	Baylor																																																																																				0.378	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		Frame_Shift_Del
IKBKE	9641	hgsc.bcm.edu	37	1	206658352	206658352	+	Silent	SNP	A	A	G			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:206658352A>G	ENST00000367120.3	+	14	1819	c.1446A>G	c.(1444-1446)ggA>ggG	p.G482G	IKBKE_ENST00000537984.1_Silent_p.G397G	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	482	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.G482G(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					GCGTGGCTGGAACGCCTGAGA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	1											60.0	55.0	57.0					1																	206658352		2203	4300	6503	204724975	SO:0001819	synonymous_variant	9641			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1446A>G	1.37:g.206658352A>G		Somatic		Capture	SOLID	Phase_III	204724975	D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	ENST00000367120.3	37	CCDS30996.1	SNP	9	Baylor																																																																																				0.592	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1			Silent
IL17RC	84818	hgsc.bcm.edu	37	3	9974300	9974300	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:9974300A>G	ENST00000295981.3	+	17	1827	c.1609A>G	c.(1609-1611)Aag>Gag	p.K537E	CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000403601.3_Missense_Mutation_p.K466E|CRELD1_ENST00000383811.3_5'Flank|IL17RC_ENST00000383812.4_Missense_Mutation_p.K451E|IL17RC_ENST00000455057.1_Missense_Mutation_p.K434E|CRELD1_ENST00000397170.3_5'Flank|CRELD1_ENST00000326434.5_5'Flank|IL17RC_ENST00000416074.2_Missense_Mutation_p.K305E|IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000413608.1_Missense_Mutation_p.K466E	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	537					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)	p.K537E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AGACATCCACAAGCGCTGGGC	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											72.0	77.0	75.0					3																	9974300		2203	4300	6503	9949300	SO:0001583	missense	84818			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1609A>G	3.37:g.9974300A>G	ENSP00000295981:p.Lys537Glu	Somatic		Capture	SOLID	Phase_III	9949300	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	ENST00000295981.3	37	CCDS2590.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863208	0.51482	.	.	ENSG00000163702	ENST00000383812;ENST00000295981;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T	0.44083	1.9;1.89;1.9;0.93;1.88	4.71	-2.5	0.06384	.	1.021750	0.07821	N	0.959858	T	0.24314	0.0589	N	0.19112	0.55	0.20821	N	0.999845	B;B;B;B;B;B;B;B;B	0.26318	0.012;0.012;0.002;0.002;0.009;0.007;0.012;0.146;0.037	B;B;B;B;B;B;B;B;B	0.24974	0.009;0.009;0.004;0.004;0.003;0.004;0.009;0.057;0.013	T	0.28459	-1.0043	10	0.18276	T	0.48	-3.3982	9.2504	0.37551	0.1747:0.6939:0.1314:0.0	.	451;305;434;449;466;305;451;537;466	Q8NAC3-4;F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;B4E008;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;.;I17RC_HUMAN;.	E	451;537;466;305;434;466	ENSP00000373323:K451E;ENSP00000295981:K537E;ENSP00000384969:K466E;ENSP00000407894:K434E;ENSP00000396064:K466E	ENSP00000295981:K537E	K	+	1	0	IL17RC	9949300	0.022000	0.18835	0.990000	0.47175	0.975000	0.68041	-0.315000	0.08081	-0.028000	0.13850	0.379000	0.24179	AAG		0.542	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732		Missense_Mutation
IL2RA	3559	hgsc.bcm.edu	37	10	6104069	6104069	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr10:6104069C>G	ENST00000379959.3	-	1	219	c.46G>C	c.(46-48)Gtg>Ctg	p.V16L	IL2RA_ENST00000256876.6_Missense_Mutation_p.V16L|IL2RA_ENST00000379954.1_Missense_Mutation_p.V16L	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	16					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CAGCCAGGCACCATGATGAAC	0.612																																																0			10											75.0	70.0	72.0					10																	6104069		2203	4300	6503	6144075	SO:0001583	missense	3559			X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.46G>C	10.37:g.6104069C>G	ENSP00000369293:p.Val16Leu	Somatic		Capture	SOLID	Phase_III	6144075	Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	CCDS7076.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742935	0.30865	.	.	ENSG00000134460	ENST00000379959;ENST00000397240;ENST00000379954;ENST00000256876	T;T;T	0.53206	1.12;0.63;1.1	5.24	4.34	0.51931	.	0.580895	0.14484	N	0.316746	T	0.54695	0.1874	L	0.50333	1.59	0.09310	N	1	D;D	0.61080	0.989;0.989	P;P	0.57679	0.825;0.825	T	0.41574	-0.9501	10	0.38643	T	0.18	-11.7518	9.6733	0.40026	0.0:0.9044:0.0:0.0956	.	16;16	Q5W005;P01589	.;IL2RA_HUMAN	L	16;2;16;16	ENSP00000369293:V16L;ENSP00000369287:V16L;ENSP00000256876:V16L	ENSP00000256876:V16L	V	-	1	0	IL2RA	6144075	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	0.153000	0.16323	1.205000	0.43262	0.563000	0.77884	GTG		0.612	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417		Missense_Mutation
KHNYN	23351	hgsc.bcm.edu	37	14	24902054	24902054	+	Silent	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr14:24902054C>T	ENST00000251343.5	+	4	1615	c.1476C>T	c.(1474-1476)gtC>gtT	p.V492V	KHNYN_ENST00000556842.1_Silent_p.V492V|KHNYN_ENST00000554268.1_5'UTR|KHNYN_ENST00000553935.1_Silent_p.V492V|CBLN3_ENST00000555436.1_5'Flank			O15037	KHNYN_HUMAN	KH and NYN domain containing	492							RNA binding (GO:0003723)	p.V492V(1)		kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						ATGCCAAAGTCAGAGGTGAGT	0.507											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	14											175.0	152.0	160.0					14																	24902054		2203	4300	6503	23971894	SO:0001819	synonymous_variant	23351			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.1476C>T	14.37:g.24902054C>T		Somatic	774	Capture	SOLID	Phase_III	23971894	Q86TZ6|Q8IUQ2|Q96BA9	Silent	SNP	ENST00000251343.5	37	CCDS32058.1	SNP	29	Baylor																																																																																				0.507	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1			Silent
UNC79	57578	hgsc.bcm.edu	37	14	94060163	94060163	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr14:94060163G>A	ENST00000393151.2	+	23	3170	c.3170G>A	c.(3169-3171)tGg>tAg	p.W1057*	UNC79_ENST00000553484.1_Nonsense_Mutation_p.W1057*|UNC79_ENST00000555664.1_Nonsense_Mutation_p.W1057*|UNC79_ENST00000256339.4_Nonsense_Mutation_p.W880*			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1057					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.W880*(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGCAAAGACTGGAAGATGAGG	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	14											156.0	136.0	143.0					14																	94060163		2203	4300	6503	93129916	SO:0001587	stop_gained	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3170G>A	14.37:g.94060163G>A	ENSP00000376858:p.Trp1057*	Somatic		Capture	SOLID	Phase_III	93129916	B5MDL6|Q6ZUT7	Nonsense_Mutation	SNP	ENST00000393151.2	37		SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	42	9.368463	0.99150	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1738	19.978	0.97315	0.0:0.0:1.0:0.0	.	.	.	.	X	880;1057;1057;1057;1057	.	ENSP00000256339:W880X	W	+	2	0	KIAA1409	93129916	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.733000	0.93635	0.557000	0.71058	TGG		0.483	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		Nonsense_Mutation
MACF1	23499	hgsc.bcm.edu	37	1	39895648	39895648	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:39895648G>C	ENST00000372915.3	+	63	16813	c.16726G>C	c.(16726-16728)Ggg>Cgg	p.G5576R	MACF1_ENST00000317713.7_Missense_Mutation_p.G3618R|MACF1_ENST00000361689.2_Missense_Mutation_p.G3618R|MACF1_ENST00000545844.1_Missense_Mutation_p.G3618R|MACF1_ENST00000539005.1_Missense_Mutation_p.G3488R|MACF1_ENST00000567887.1_Missense_Mutation_p.G5717R|MACF1_ENST00000564288.1_Missense_Mutation_p.G5680R|MACF1_ENST00000289893.4_Missense_Mutation_p.G4120R			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5576					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.G4120R(1)|p.G3618R(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGAACTGACCGGGTGGCTGAG	0.562																																																2	Substitution - Missense(2)	ovary(2)	1											39.0	39.0	39.0					1																	39895648		2203	4300	6503	39668235	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16726G>C	1.37:g.39895648G>C	ENSP00000362006:p.Gly5576Arg	Somatic		Capture	SOLID	Phase_III	39668235	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		SNP	39	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.24|15.24	2.775049|2.775049	0.49786|0.49786	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.61274|.	0.12;1.36;0.12;1.36;0.24;1.29|.	6.08|6.08	2.91|2.91	0.33838|0.33838	.|.	0.103789|.	0.42821|.	D|.	0.000646|.	T|T	0.35008|0.35008	0.0917|0.0917	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	D;P;B|.	0.76494|.	0.999;0.595;0.043|.	D;B;B|.	0.71870|.	0.975;0.234;0.038|.	T|T	0.04708|0.04708	-1.0932|-1.0932	10|5	0.25751|.	T|.	0.34|.	.|.	7.457|7.457	0.27272|0.27272	0.1596:0.0:0.7109:0.1295|0.1596:0.0:0.7109:0.1295	.|.	5576;3618;3562|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	R|P	3618;5576;3618;3618;3488;4120|2621	ENSP00000439537:G3618R;ENSP00000362006:G5576R;ENSP00000354573:G3618R;ENSP00000313438:G3618R;ENSP00000444364:G3488R;ENSP00000289893:G4120R|.	ENSP00000289893:G4120R|.	G|R	+|+	1|2	0|0	MACF1|MACF1	39668235|39668235	0.741000|0.741000	0.28217|0.28217	0.902000|0.902000	0.35471|0.35471	0.959000|0.959000	0.62525|0.62525	1.082000|1.082000	0.30803|0.30803	0.319000|0.319000	0.23209|0.23209	0.591000|0.591000	0.81541|0.81541	GGG|CGG		0.562	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		Missense_Mutation
LMX1A	4009	hgsc.bcm.edu	37	1	165322351	165322351	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:165322351G>T	ENST00000342310.3	-	3	607	c.225C>A	c.(223-225)taC>taA	p.Y75*	LMX1A_ENST00000294816.2_Nonsense_Mutation_p.Y75*|LMX1A_ENST00000367893.4_Nonsense_Mutation_p.Y75*	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	75	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					TCTTGTCCCGGTAGAAGCAGG	0.597																																																0			1											90.0	92.0	91.0					1																	165322351		2203	4300	6503	163588975	SO:0001587	stop_gained	4009			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.225C>A	1.37:g.165322351G>T	ENSP00000340226:p.Tyr75*	Somatic		Capture	SOLID	Phase_III	163588975	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Nonsense_Mutation	SNP	ENST00000342310.3	37	CCDS1247.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	39	7.731186	0.98459	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	.	.	.	5.56	3.69	0.42338	.	0.431412	0.25625	N	0.029397	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3819	0.44117	0.159:0.0:0.841:0.0	.	.	.	.	X	75	.	ENSP00000294816:Y75X	Y	-	3	2	LMX1A	163588975	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.363000	0.44178	1.346000	0.45694	0.561000	0.74099	TAC		0.597	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398		Nonsense_Mutation
MED13L	23389	hgsc.bcm.edu	37	12	116422004	116422004	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr12:116422004T>G	ENST00000281928.3	-	20	4718	c.4512A>C	c.(4510-4512)caA>caC	p.Q1504H		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1504						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q1504H(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GGCGGCAAACTTGCGCATAAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	67.0	72.0					12																	116422004		2203	4300	6503	114906387	SO:0001583	missense	23389			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4512A>C	12.37:g.116422004T>G	ENSP00000281928:p.Gln1504His	Somatic		Capture	SOLID	Phase_III	114906387	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.00	2.403593	0.42613	.	.	ENSG00000123066	ENST00000281928	T	0.58506	0.33	5.43	4.08	0.47627	.	0.169619	0.53938	D	0.000050	T	0.52108	0.1714	L	0.58101	1.795	0.43852	D	0.996442	B	0.32693	0.38	B	0.34180	0.177	T	0.57665	-0.7772	10	0.59425	D	0.04	.	9.1969	0.37233	0.0:0.202:0.0:0.798	.	1504	Q71F56	MD13L_HUMAN	H	1504	ENSP00000281928:Q1504H	ENSP00000281928:Q1504H	Q	-	3	2	MED13L	114906387	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.075000	0.30716	2.052000	0.61016	0.533000	0.62120	CAA		0.438	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			Missense_Mutation
MPHOSPH8	54737	hgsc.bcm.edu	37	13	20224279	20224282	+	Frame_Shift_Del	DEL	AAAC	AAAC	-			TCGA-24-1556-01	TCGA-24-1556-10	AAAC	AAAC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr13:20224279_20224282delAAAC	ENST00000361479.5	+	5	1523_1526	c.1455_1458delAAAC	c.(1453-1458)gaaaacfs	p.EN485fs	MPHOSPH8_ENST00000414242.2_Frame_Shift_Del_p.EN485fs	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	485					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		AAACCAAGGAAAACAAACAGTCAC	0.392																																																0			13																																								19122282	SO:0001589	frameshift_variant	54737			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1455_1458delAAAC	13.37:g.20224283_20224286delAAAC	ENSP00000355388:p.Glu485fs	Somatic		Capture	SOLID	Phase_III	19122279	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Frame_Shift_Del	DEL	ENST00000361479.5	37	CCDS9287.1	DEL	1	Baylor																																																																																				0.392	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2	NM_017520		Frame_Shift_Del
MTOR	2475	hgsc.bcm.edu	37	1	11272933	11272933	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:11272933G>C	ENST00000361445.4	-	22	3394	c.3318C>G	c.(3316-3318)aaC>aaG	p.N1106K		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1106					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.N1106K(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGTCATCCAGGTTGGCGCCAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											108.0	93.0	98.0					1																	11272933		2203	4300	6503	11195520	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3318C>G	1.37:g.11272933G>C	ENSP00000354558:p.Asn1106Lys	Somatic		Capture	SOLID	Phase_III	11195520	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833110	0.50951	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.64618	-0.11	5.48	4.56	0.56223	Armadillo-like helical (1);Armadillo-type fold (1);	0.105630	0.64402	D	0.000006	T	0.66218	0.2767	M	0.91663	3.23	0.80722	D	1	P	0.37781	0.608	B	0.34180	0.177	T	0.71477	-0.4581	10	0.72032	D	0.01	-13.4007	9.0711	0.36493	0.223:0.0:0.777:0.0	.	1106	P42345	MTOR_HUMAN	K	1106	ENSP00000354558:N1106K	ENSP00000354558:N1106K	N	-	3	2	MTOR	11195520	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.613000	0.46351	1.289000	0.44618	0.655000	0.94253	AAC		0.507	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		Missense_Mutation
MTOR	2475	hgsc.bcm.edu	37	1	11272943	11272943	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:11272943A>T	ENST00000361445.4	-	22	3384	c.3308T>A	c.(3307-3309)tTt>tAt	p.F1103Y		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1103					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.F1103Y(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GTTGGCGCCAAACAGCTGGAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	82.0	87.0					1																	11272943		2203	4300	6503	11195530	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3308T>A	1.37:g.11272943A>T	ENSP00000354558:p.Phe1103Tyr	Somatic		Capture	SOLID	Phase_III	11195530	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	28.3	4.907797	0.92107	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.67345	-0.26	5.48	5.48	0.80851	Armadillo-like helical (1);Armadillo-type fold (1);	0.133205	0.53938	D	0.000049	T	0.79862	0.4519	H	0.94808	3.585	0.80722	D	1	D	0.57571	0.98	P	0.46885	0.53	D	0.86264	0.1657	10	0.66056	D	0.02	-15.3771	15.5783	0.76410	1.0:0.0:0.0:0.0	.	1103	P42345	MTOR_HUMAN	Y	1103	ENSP00000354558:F1103Y	ENSP00000354558:F1103Y	F	-	2	0	MTOR	11195530	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	8.739000	0.91574	2.081000	0.62600	0.533000	0.62120	TTT		0.507	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		Missense_Mutation
MYH1	4619	hgsc.bcm.edu	37	17	10411826	10411826	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr17:10411826T>A	ENST00000226207.5	-	16	1845	c.1751A>T	c.(1750-1752)cAc>cTc	p.H584L	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	584	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.H584L(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCCAGCATAGTGAATCAAAGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											111.0	110.0	110.0					17																	10411826		2203	4300	6503	10352551	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.1751A>T	17.37:g.10411826T>A	ENSP00000226207:p.His584Leu	Somatic		Capture	SOLID	Phase_III	10352551	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.86	3.491568	0.64074	.	.	ENSG00000109061	ENST00000226207	D	0.97089	-4.24	4.73	4.73	0.59995	Myosin head, motor domain (2);	0.000000	0.45606	U	0.000344	D	0.99193	0.9720	H	0.99764	4.76	0.80722	D	1	D	0.67145	0.996	D	0.68621	0.959	D	0.98465	1.0598	10	0.87932	D	0	.	14.6813	0.69020	0.0:0.0:0.0:1.0	.	584	P12882	MYH1_HUMAN	L	584	ENSP00000226207:H584L	ENSP00000226207:H584L	H	-	2	0	MYH1	10352551	1.000000	0.71417	0.993000	0.49108	0.234000	0.25298	5.848000	0.69458	2.125000	0.65367	0.528000	0.53228	CAC		0.498	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		Missense_Mutation
NCKIPSD	51517	hgsc.bcm.edu	37	3	48720358	48720358	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:48720358G>C	ENST00000294129.2	-	2	378	c.259C>G	c.(259-261)Ctg>Gtg	p.L87V	NCKIPSD_ENST00000341520.4_Missense_Mutation_p.L87V|NCKIPSD_ENST00000416649.2_Missense_Mutation_p.L87V	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	87					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGCTGTTCCAGGCTGTACTTG	0.622																																																0			3											135.0	72.0	94.0					3																	48720358		2186	4243	6429	48695362	SO:0001583	missense	51517			AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.259C>G	3.37:g.48720358G>C	ENSP00000294129:p.Leu87Val	Somatic		Capture	SOLID	Phase_III	48695362	B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Missense_Mutation	SNP	ENST00000294129.2	37	CCDS2776.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978328	0.74360	.	.	ENSG00000213672	ENST00000341520;ENST00000416649;ENST00000294129;ENST00000439518;ENST00000453349	T;T;T;T	0.51071	0.72;1.31;1.31;1.27	4.87	4.87	0.63330	.	0.000000	0.52532	U	0.000074	T	0.63815	0.2543	M	0.66939	2.045	0.58432	D	0.999994	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.994;0.991;0.996	T	0.61023	-0.7146	10	0.29301	T	0.29	.	12.4749	0.55807	0.081:0.0:0.919:0.0	.	87;87;87	C9JSC3;Q9NZQ3;Q9NZQ3-3	.;SPN90_HUMAN;.	V	87;87;87;87;9	ENSP00000342621:L87V;ENSP00000389059:L87V;ENSP00000294129:L87V;ENSP00000409675:L87V	ENSP00000294129:L87V	L	-	1	2	NCKIPSD	48695362	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.658000	0.61497	2.258000	0.74832	0.591000	0.81541	CTG		0.622	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257520.1	NM_016453		Missense_Mutation
NR1I2	8856	hgsc.bcm.edu	37	3	119531662	119531662	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:119531662G>T	ENST00000337940.4	+	5	814	c.766G>T	c.(766-768)Ggg>Tgg	p.G256W	NR1I2_ENST00000393716.2_Missense_Mutation_p.G217W|NR1I2_ENST00000466380.1_Missense_Mutation_p.G180W	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	217	Ligand-binding.				drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.G256W(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	GCAGCTGCGGGGGGAGGATGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											78.0	77.0	78.0					3																	119531662		2203	4300	6503	121014352	SO:0001583	missense	8856			AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.766G>T	3.37:g.119531662G>T	ENSP00000336528:p.Gly256Trp	Somatic		Capture	SOLID	Phase_III	121014352	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	ENST00000337940.4	37	CCDS2995.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805940	0.70682	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	D;D;D	0.95307	-3.67;-3.67;-3.67	4.27	4.27	0.50696	Nuclear hormone receptor, ligand-binding (1);	0.142332	0.32518	N	0.005987	D	0.96093	0.8727	M	0.70595	2.14	0.44073	D	0.996825	D;D;D	0.89917	0.998;1.0;0.999	P;D;P	0.68483	0.777;0.958;0.907	D	0.95094	0.8224	10	0.38643	T	0.18	.	12.0824	0.53677	0.0:0.0:1.0:0.0	.	217;256;203	O75469;F1D8P9;O75469-6	NR1I2_HUMAN;.;.	W	217;180;256	ENSP00000377319:G217W;ENSP00000420297:G180W;ENSP00000336528:G256W	ENSP00000336528:G256W	G	+	1	0	NR1I2	121014352	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	2.364000	0.44187	2.219000	0.72066	0.561000	0.74099	GGG		0.582	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355126.1			Missense_Mutation
NRAP	4892	hgsc.bcm.edu	37	10	115423591	115423591	+	Silent	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr10:115423591C>T	ENST00000359988.3	-	1	295	c.51G>A	c.(49-51)gaG>gaA	p.E17E	NRAP_ENST00000369360.3_Silent_p.E17E|NRAP_ENST00000369358.4_Silent_p.E17E|NRAP_ENST00000360478.3_Silent_p.E17E	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.E17E(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		AGCTGATCTTCTCGGCAGGAT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	10											113.0	105.0	108.0					10																	115423591		2203	4300	6503	115413581	SO:0001819	synonymous_variant	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.51G>A	10.37:g.115423591C>T		Somatic		Capture	SOLID	Phase_III	115413581		Silent	SNP	ENST00000359988.3	37	CCDS7579.1	SNP	32	Baylor																																																																																				0.433	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175		Silent
OTUD4	54726	hgsc.bcm.edu	37	4	146092822	146092822	+	Splice_Site	SNP	C	C	A	rs565618098		TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr4:146092822C>A	ENST00000447906.2	-	3	481	c.294G>T	c.(292-294)caG>caT	p.Q98H	OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000509620.2_Splice_Site_p.Q33H|OTUD4_ENST00000296579.6_Splice_Site_p.Q33H|OTUD4_ENST00000454497.2_Splice_Site_p.Q33H			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	98	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|Variable-loop. {ECO:0000250}.				protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.Q33H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					TGTGACATACCTGTGGATTTT	0.254																																																1	Substitution - Missense(1)	ovary(1)	4											39.0	44.0	42.0					4																	146092822		2197	4290	6487	146312272	SO:0001630	splice_region_variant	54726				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.294+1G>T	4.37:g.146092822C>A		Somatic		Capture	SOLID	Phase_III	146312272	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37		SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472500	0.84640	.	.	ENSG00000164164	ENST00000454497;ENST00000447906;ENST00000514973;ENST00000509620;ENST00000296579;ENST00000504501	T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58	5.67	5.67	0.87782	Ovarian tumour, otubain (2);	0.000000	0.47852	D	0.000204	T	0.46600	0.1401	L	0.38692	1.165	0.54753	D	0.999989	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.17077	-1.0381	9	.	.	.	-11.8801	17.2679	0.87093	0.0:1.0:0.0:0.0	.	98;98	G3V0I6;Q01804	.;OTUD4_HUMAN	H	33;98;33;33;33;33	ENSP00000409279:Q33H;ENSP00000395487:Q98H;ENSP00000425972:Q33H;ENSP00000424192:Q33H;ENSP00000296579:Q33H;ENSP00000423453:Q33H	.	Q	-	3	2	OTUD4	146312272	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.597000	0.67577	2.673000	0.90976	0.557000	0.71058	CAG		0.254	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	Missense_Mutation	Missense_Mutation
PDZRN4	29951	hgsc.bcm.edu	37	12	41966176	41966178	+	In_Frame_Del	DEL	AAG	AAG	-	rs199717682	byFrequency	TCGA-24-1556-01	TCGA-24-1556-10	AAG	AAG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr12:41966176_41966178delAAG	ENST00000402685.2	+	10	1603_1605	c.1595_1597delAAG	c.(1594-1599)caagaa>caa	p.E536del	PDZRN4_ENST00000298919.7_In_Frame_Del_p.E276del|PDZRN4_ENST00000539469.2_In_Frame_Del_p.E278del	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	536	Poly-Glu.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E278delE(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CCAAAAAAGCAAGAAGAAGAAGA	0.355														3	0.000599042	0.0015	0.0	5008	,	,		24414	0.0		0.001	False		,,,				2504	0.0															1	Deletion - In frame(1)	ovary(1)	12							,	29,4235		1,27,2104					,	5.1	1.0			55	64,8190		0,64,4063	no	coding,coding	PDZRN4	NM_013377.3,NM_001164595.1	,	1,91,6167	A1A1,A1R,RR		0.7754,0.6801,0.7429	,	,		93,12425				40252445	SO:0001651	inframe_deletion	29951			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1595_1597delAAG	12.37:g.41966185_41966187delAAG	ENSP00000384197:p.Glu536del	Somatic		Capture	SOLID	Phase_III	40252443	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	In_Frame_Del	DEL	ENST00000402685.2	37	CCDS53777.1	DEL	5	Baylor																																																																																				0.355	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377		In_Frame_Del
PHF19	26147	hgsc.bcm.edu	37	9	123632799	123632799	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr9:123632799C>T	ENST00000373896.3	-	4	538	c.286G>A	c.(286-288)Gag>Aag	p.E96K	PHF19_ENST00000312189.6_Missense_Mutation_p.E96K|PHF19_ENST00000487555.1_5'Flank|PHF19_ENST00000419155.1_5'Flank	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	96					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.E96K(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CACTTGGGCTCCTCTCCTGGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	9											108.0	96.0	100.0					9																	123632799		2203	4300	6503	122672620	SO:0001583	missense	26147			BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.286G>A	9.37:g.123632799C>T	ENSP00000363003:p.Glu96Lys	Somatic		Capture	SOLID	Phase_III	122672620	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Missense_Mutation	SNP	ENST00000373896.3	37	CCDS35116.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.143123	0.94560	.	.	ENSG00000119403	ENST00000544082;ENST00000373896;ENST00000436309;ENST00000312189;ENST00000456291	D;D;D;T	0.87887	-2.31;-2.31;-2.31;0.48	5.04	5.04	0.67666	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.056684	0.64402	D	0.000001	D	0.90195	0.6935	L	0.60455	1.87	0.80722	D	1	P;D;B	0.65815	0.916;0.995;0.354	P;P;B	0.59424	0.486;0.857;0.292	D	0.90438	0.4429	10	0.54805	T	0.06	-25.8929	13.1516	0.59492	0.0:0.8394:0.1606:0.0	.	96;96;96	B0QZ72;Q5T6S3-2;Q5T6S3	.;.;PHF19_HUMAN	K	96	ENSP00000363003:E96K;ENSP00000408479:E96K;ENSP00000310372:E96K;ENSP00000397935:E96K	ENSP00000310372:E96K	E	-	1	0	PHF19	122672620	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.927000	0.70080	2.328000	0.79073	0.313000	0.20887	GAG		0.577	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053838.3	XM_045308		Missense_Mutation
PIK3C2B	5287	hgsc.bcm.edu	37	1	204403700	204403700	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:204403700A>G	ENST00000367187.3	-	25	4109	c.3553T>C	c.(3553-3555)Tgc>Cgc	p.C1185R	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.C1157R	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1185	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GTGGCCACGCAGCAGCCAGCG	0.547																																																0			1											62.0	50.0	54.0					1																	204403700		2203	4300	6503	202670323	SO:0001583	missense	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3553T>C	1.37:g.204403700A>G	ENSP00000356155:p.Cys1185Arg	Somatic		Capture	SOLID	Phase_III	202670323	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.3	4.822542	0.90873	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.77750	-1.12;-1.12	5.69	5.69	0.88448	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.197854	0.53938	D	0.000043	D	0.91858	0.7423	H	0.96142	3.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94288	0.7526	10	0.87932	D	0	.	15.6005	0.76620	1.0:0.0:0.0:0.0	.	1157;1185	F5GWN5;O00750	.;P3C2B_HUMAN	R	1185;1157	ENSP00000356155:C1185R;ENSP00000400561:C1157R	ENSP00000356155:C1185R	C	-	1	0	PIK3C2B	202670323	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.218000	0.95166	2.174000	0.68829	0.460000	0.39030	TGC		0.547	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		Missense_Mutation
PMS1	5378	hgsc.bcm.edu	37	2	190708747	190708747	+	Silent	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr2:190708747C>T	ENST00000441310.2	+	6	873	c.640C>T	c.(640-642)Ctg>Ttg	p.L214L	PMS1_ENST00000432292.3_Silent_p.L38L|PMS1_ENST00000447232.2_Silent_p.L214L|PMS1_ENST00000409823.3_Intron|PMS1_ENST00000418224.3_Silent_p.L38L|PMS1_ENST00000421722.1_Intron	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	214					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)	p.L214L(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			CATGTCAGTTCTGGGGACTGC	0.358			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	1	Substitution - coding silent(1)	ovary(1)	2											113.0	105.0	108.0					2																	190708747		2203	4300	6503	190416992	SO:0001819	synonymous_variant	5378				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.640C>T	2.37:g.190708747C>T		Somatic		Capture	SOLID	Phase_III	190416992	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Silent	SNP	ENST00000441310.2	37	CCDS2302.1	SNP	32	Baylor																																																																																				0.358	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2			Silent
POU2F1	5451	hgsc.bcm.edu	37	1	167381426	167381426	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:167381426delG	ENST00000541643.3	+	15	1879	c.1717delG	c.(1717-1719)gcafs	p.A576fs	POU2F1_ENST00000367866.2_Frame_Shift_Del_p.A599fs|POU2F1_ENST00000420254.3_Frame_Shift_Del_p.A576fs|POU2F1_ENST00000367862.5_Frame_Shift_Del_p.A588fs|POU2F1_ENST00000429375.2_Frame_Shift_Del_p.A536fs|POU2F1_ENST00000367865.1_3'UTR			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	576					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A573fs*26(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GCAAACAGCAGCAGCTGCTGC	0.577																																																1	Deletion - Frameshift(1)	ovary(1)	1											74.0	51.0	59.0					1																	167381426		2203	4300	6503	165648050	SO:0001589	frameshift_variant	5451			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1717delG	1.37:g.167381426delG	ENSP00000441285:p.Ala576fs	Somatic		Capture	SOLID	Phase_III	165648050	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Frame_Shift_Del	DEL	ENST00000541643.3	37		DEL	34	Baylor																																																																																				0.577	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697		Frame_Shift_Del
PRMT5	10419	hgsc.bcm.edu	37	14	23396005	23396005	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr14:23396005A>T	ENST00000324366.8	-	5	692	c.469T>A	c.(469-471)Ttg>Atg	p.L157M	PRMT5-AS1_ENST00000587245.2_RNA|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5_ENST00000216350.8_Missense_Mutation_p.L96M|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.L51M|PRMT5_ENST00000397441.2_Missense_Mutation_p.L140M|PRMT5_ENST00000397440.4_Intron|PRMT5_ENST00000553641.1_5'UTR|RP11-298I3.1_ENST00000548322.1_RNA|RP11-298I3.1_ENST00000548819.1_RNA|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5_ENST00000553897.1_Missense_Mutation_p.L113M	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	157	TIM barrel. {ECO:0000269|PubMed:23071334}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		GGTGCCACCAAGGGTACCCGC	0.448																																																0			14											179.0	143.0	155.0					14																	23396005		2203	4300	6503	22465845	SO:0001583	missense	10419			AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.469T>A	14.37:g.23396005A>T	ENSP00000319169:p.Leu157Met	Somatic		Capture	SOLID	Phase_III	22465845	A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	ENST00000324366.8	37	CCDS9579.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.69	3.193980	0.58017	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000216350;ENST00000538452;ENST00000553897;ENST00000555530;ENST00000554867;ENST00000556616;ENST00000554910;ENST00000421938	.	.	.	5.39	3.1	0.35709	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	L	0.46741	1.465	0.51482	D	0.999926	P;B;B;P	0.44877	0.845;0.33;0.324;0.768	P;B;B;B	0.51582	0.674;0.135;0.123;0.325	T	0.49390	-0.8945	9	0.23302	T	0.38	-9.5143	9.3986	0.38417	0.8681:0.0:0.1319:0.0	.	113;96;157;140	G3V5W5;B4DX49;O14744;A8MZ91	.;.;ANM5_HUMAN;.	M	157;140;96;51;113;58;112;119;115;167	.	ENSP00000216350:L96M	L	-	1	2	PRMT5	22465845	0.975000	0.34042	0.990000	0.47175	0.990000	0.78478	2.043000	0.41231	2.054000	0.61138	0.533000	0.62120	TTG		0.448	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071674.3			Missense_Mutation
PRRG3	79057	hgsc.bcm.edu	37	X	150869329	150869329	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chrX:150869329A>T	ENST00000370353.3	+	4	910	c.520A>T	c.(520-522)Acc>Tcc	p.T174S	PRRG3_ENST00000538575.1_Missense_Mutation_p.T174S			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	174						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.T174S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GCTAGAGAGCACCCTCTACCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	X											48.0	37.0	41.0					X																	150869329		2202	4299	6501	150619985	SO:0001583	missense	79057			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.520A>T	X.37:g.150869329A>T	ENSP00000359378:p.Thr174Ser	Somatic		Capture	SOLID	Phase_III	150619985	A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	ENST00000370353.3	37	CCDS14699.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.864	0.947598	0.18356	.	.	ENSG00000130032	ENST00000538575;ENST00000370353	D;D	0.98135	-4.74;-4.74	4.31	3.04	0.35103	.	0.457400	0.19232	N	0.119391	D	0.89469	0.6724	N	0.02539	-0.55	0.27244	N	0.959071	B	0.11235	0.004	B	0.15052	0.012	T	0.81758	-0.0786	9	.	.	.	-25.4068	7.538	0.27721	0.8066:0.0:0.0:0.1934	.	174	Q9BZD7	TMG3_HUMAN	S	174	ENSP00000440217:T174S;ENSP00000359378:T174S	.	T	+	1	0	PRRG3	150619985	1.000000	0.71417	0.996000	0.52242	0.319000	0.28217	2.759000	0.47573	1.715000	0.51383	0.425000	0.28330	ACC		0.667	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1	NM_024082		Missense_Mutation
QSOX2	169714	hgsc.bcm.edu	37	9	139113725	139113726	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-24-1556-01	TCGA-24-1556-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr9:139113725_139113726delTT	ENST00000358701.5	-	6	774_775	c.737_738delAA	c.(736-738)aaafs	p.K246fs		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	246					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.K246fs*27(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		CCAGAAATGCTTTGTCCCCGTC	0.525																																																1	Deletion - Frameshift(1)	ovary(1)	9																																								138253547	SO:0001589	frameshift_variant	169714			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.737_738delAA	9.37:g.139113725_139113726delTT	ENSP00000351536:p.Lys246fs	Somatic		Capture	SOLID	Phase_III	138253546	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Frame_Shift_Del	DEL	ENST00000358701.5	37	CCDS35178.1	DEL	56	Baylor																																																																																				0.525	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701		Frame_Shift_Del
RNF220	55182	hgsc.bcm.edu	37	1	44878361	44878361	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr1:44878361G>T	ENST00000355387.2	+	2	1042	c.592G>T	c.(592-594)Gcc>Tcc	p.A198S	RNF220_ENST00000361799.2_Missense_Mutation_p.A198S|RNF220_ENST00000372247.2_Missense_Mutation_p.A198S			Q5VTB9	RN220_HUMAN	ring finger protein 220	198					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A198S(2)		endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TGATCGGGAAGCCTCATCTAG	0.522																																																2	Substitution - Missense(2)	ovary(2)	1											97.0	88.0	91.0					1																	44878361		2203	4300	6503	44650948	SO:0001583	missense	55182			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.592G>T	1.37:g.44878361G>T	ENSP00000347548:p.Ala198Ser	Somatic		Capture	SOLID	Phase_III	44650948	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	ENST00000355387.2	37	CCDS510.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.428	-0.331581	0.05314	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	5.69	3.46	0.39613	.	0.260806	0.38058	N	0.001826	T	0.27419	0.0673	N	0.14661	0.345	0.80722	D	1	B	0.13594	0.008	B	0.12156	0.007	T	0.07271	-1.0781	9	0.07813	T	0.8	.	6.258	0.20884	0.3927:0.0:0.6073:0.0	.	198	Q5VTB9	RN220_HUMAN	S	198	.	ENSP00000347548:A198S	A	+	1	0	RNF220	44650948	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.653000	0.54446	1.377000	0.46286	0.655000	0.94253	GCC		0.522	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150		Missense_Mutation
RNPS1	10921	hgsc.bcm.edu	37	16	2314218	2314218	+	Silent	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr16:2314218G>C	ENST00000565678.1	-	3	731	c.186C>G	c.(184-186)acC>acG	p.T62T	RNPS1_ENST00000301730.8_Silent_p.T62T|RNPS1_ENST00000566397.1_5'UTR|RNPS1_ENST00000569598.2_Intron|RNPS1_ENST00000320225.5_Silent_p.T62T|RNPS1_ENST00000397086.2_Silent_p.T62T|RNPS1_ENST00000567147.1_Silent_p.T39T|RNPS1_ENST00000561718.1_5'UTR|RNPS1_ENST00000566458.1_Silent_p.T39T|RNPS1_ENST00000568631.1_Silent_p.T62T			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	62	Lys-rich.|Necessary for interaction with SRP54, nuclear localization and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						GCCTCTTTCGGGTTTTGTCCC	0.607																																																0			16											72.0	75.0	74.0					16																	2314218		2198	4300	6498	2254219	SO:0001819	synonymous_variant	10921			AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.186C>G	16.37:g.2314218G>C		Somatic		Capture	SOLID	Phase_III	2254219	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Silent	SNP	ENST00000565678.1	37	CCDS10465.1	SNP	43	Baylor																																																																																				0.607	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435415.1	NM_080594		Silent
SF1	7536	hgsc.bcm.edu	37	11	64537765	64537765	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr11:64537765C>G	ENST00000377390.3	-	4	689	c.352G>C	c.(352-354)Gca>Cca	p.A118P	SF1_ENST00000422298.2_Missense_Mutation_p.A3P|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000227503.9_Missense_Mutation_p.A118P|SF1_ENST00000377387.1_Missense_Mutation_p.A243P|SF1_ENST00000433274.2_Missense_Mutation_p.A92P|SF1_ENST00000334944.5_Missense_Mutation_p.A118P|SF1_ENST00000377394.3_Missense_Mutation_p.A118P	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	118					Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A118P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GGATTGAGTGCAACCATCTCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											149.0	143.0	145.0					11																	64537765		2201	4297	6498	64294341	SO:0001583	missense	7536			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.352G>C	11.37:g.64537765C>G	ENSP00000366607:p.Ala118Pro	Somatic		Capture	SOLID	Phase_III	64294341	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	37	CCDS31599.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911443	0.72983	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000433274	T;T;T;T;T;T;T	0.45668	0.89;0.91;0.91;0.91;0.89;0.89;0.91	5.95	5.95	0.96441	.	0.053457	0.64402	D	0.000001	T	0.47691	0.1459	L	0.43923	1.385	0.41827	D	0.990057	D;P;P;D;D;D	0.56035	0.957;0.95;0.95;0.957;0.974;0.974	B;P;P;B;P;P	0.49999	0.402;0.475;0.475;0.424;0.628;0.628	T	0.34104	-0.9842	10	0.44086	T	0.13	.	17.8686	0.88804	0.0:1.0:0.0:0.0	.	3;118;118;118;118;243	B4DX42;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	P	243;118;118;118;118;3;92	ENSP00000366604:A243P;ENSP00000366607:A118P;ENSP00000227503:A118P;ENSP00000366611:A118P;ENSP00000334414:A118P;ENSP00000413084:A3P;ENSP00000396793:A92P	ENSP00000227503:A118P	A	-	1	0	SF1	64294341	1.000000	0.71417	0.966000	0.40874	0.313000	0.28021	5.566000	0.67372	2.817000	0.96982	0.563000	0.77884	GCA		0.552	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630		Missense_Mutation
SH3BP4	23677	hgsc.bcm.edu	37	2	235949685	235949685	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr2:235949685A>T	ENST00000409212.1	+	4	779	c.272A>T	c.(271-273)gAg>gTg	p.E91V	SH3BP4_ENST00000392011.2_Missense_Mutation_p.E91V|SH3BP4_ENST00000344528.4_Missense_Mutation_p.E91V			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	91	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.E91V(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TCTGGCGGTGAGTGGTGGTAC	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											159.0	134.0	142.0					2																	235949685		2203	4300	6503	235614424	SO:0001583	missense	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.272A>T	2.37:g.235949685A>T	ENSP00000386862:p.Glu91Val	Somatic		Capture	SOLID	Phase_III	235614424	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.8	4.867376	0.91511	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000416021;ENST00000409212;ENST00000344528;ENST00000446904	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.44	5.44	0.79542	Src homology-3 domain (4);	0.098091	0.64402	D	0.000002	T	0.69672	0.3137	M	0.87682	2.9	0.80722	D	1	D;D	0.53619	0.961;0.961	P;P	0.60068	0.868;0.868	T	0.76198	-0.3047	10	0.87932	D	0	-24.287	14.3275	0.66530	1.0:0.0:0.0:0.0	.	91;91	A8K594;Q9P0V3	.;SH3B4_HUMAN	V	91	ENSP00000375867:E91V;ENSP00000403251:E91V;ENSP00000386862:E91V;ENSP00000340237:E91V;ENSP00000415391:E91V	ENSP00000340237:E91V	E	+	2	0	SH3BP4	235614424	1.000000	0.71417	0.999000	0.59377	0.674000	0.39518	9.039000	0.93777	2.062000	0.61559	0.533000	0.62120	GAG		0.532	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1			Missense_Mutation
SIN3B	23309	hgsc.bcm.edu	37	19	16952586	16952586	+	Missense_Mutation	SNP	C	C	T	rs141227814		TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr19:16952586C>T	ENST00000248054.5	+	4	410	c.389C>T	c.(388-390)tCg>tTg	p.S130L	CTD-2538G9.5_ENST00000600987.1_RNA|SIN3B_ENST00000379803.1_Missense_Mutation_p.S130L|SIN3B_ENST00000596802.1_Missense_Mutation_p.S130L					SIN3 transcription regulator family member B									p.S130L(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						CAGGAGAATTCGCACAACCAC	0.547																																																1	Substitution - Missense(1)	ovary(1)	19						C	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	83.0	78.0	80.0		389	3.3	0.0	19	dbSNP_134	80	0,8600		0,0,4300	yes	missense	SIN3B	NM_015260.2	145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	130/1163	16952586	1,13005	2203	4300	6503	16813586	SO:0001583	missense	23309			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.389C>T	19.37:g.16952586C>T	ENSP00000248054:p.Ser130Leu	Somatic		Capture	SOLID	Phase_III	16813586		Missense_Mutation	SNP	ENST00000248054.5	37		SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785574	0.31593	2.27E-4	0.0	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.48836	0.8;0.83	5.41	3.29	0.37713	.	0.575072	0.18584	N	0.136946	T	0.37839	0.1018	L	0.58101	1.795	0.09310	N	0.999997	P;B;B	0.35982	0.531;0.027;0.281	B;B;B	0.24701	0.055;0.005;0.014	T	0.24584	-1.0156	10	0.51188	T	0.08	-33.228	9.0245	0.36220	0.0:0.8317:0.0:0.1683	.	130;130;130	O75182-2;O75182;O75182-3	.;SIN3B_HUMAN;.	L	130	ENSP00000369131:S130L;ENSP00000248054:S130L	ENSP00000248054:S130L	S	+	2	0	SIN3B	16813586	0.005000	0.15991	0.001000	0.08648	0.352000	0.29268	1.675000	0.37555	0.658000	0.30925	0.557000	0.71058	TCG		0.547	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260		Missense_Mutation
SLC17A6	57084	hgsc.bcm.edu	37	11	22391651	22391651	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr11:22391651T>G	ENST00000263160.3	+	8	1395	c.958T>G	c.(958-960)Ttc>Gtc	p.F320V		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	320					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TGTTGCAAACTTCTGCAGAAG	0.338																																																0			11											74.0	72.0	73.0					11																	22391651		2202	4296	6498	22348227	SO:0001583	missense	57084			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.958T>G	11.37:g.22391651T>G	ENSP00000263160:p.Phe320Val	Somatic		Capture	SOLID	Phase_III	22348227	A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	CCDS7856.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696633	0.88830	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.58940	0.3	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.044974	0.85682	D	0.000000	T	0.68540	0.3012	L	0.60957	1.885	0.80722	D	1	P	0.52061	0.95	P	0.57283	0.817	T	0.69007	-0.5259	10	0.45353	T	0.12	.	15.7332	0.77822	0.0:0.0:0.0:1.0	.	320	Q9P2U8	VGLU2_HUMAN	V	320;208	ENSP00000263160:F320V	ENSP00000263160:F320V	F	+	1	0	SLC17A6	22348227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.182000	0.69389	0.482000	0.46254	TTC		0.338	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		Missense_Mutation
SLC34A2	10568	hgsc.bcm.edu	37	4	25667856	25667856	+	Silent	SNP	C	C	A			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr4:25667856C>A	ENST00000382051.3	+	5	536	c.486C>A	c.(484-486)acC>acA	p.T162T	SLC34A2_ENST00000504570.1_Silent_p.T161T|SLC34A2_ENST00000510033.2_3'UTR|SLC34A2_ENST00000503434.1_Silent_p.T161T	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	162					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCTCCAGCACCTCAACGTCCA	0.562			T	ROS1	NSCLC																																		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0			4											128.0	114.0	118.0					4																	25667856		2203	4300	6503	25276954	SO:0001819	synonymous_variant	10568			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.486C>A	4.37:g.25667856C>A		Somatic		Capture	SOLID	Phase_III	25276954	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	ENST00000382051.3	37	CCDS3435.1	SNP	24	Baylor																																																																																				0.562	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424		Silent
SLC6A2	6530	hgsc.bcm.edu	37	16	55706077	55706077	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr16:55706077G>T	ENST00000379906.2	+	3	889	c.634G>T	c.(634-636)Gag>Tag	p.E212*	SLC6A2_ENST00000414754.3_Nonsense_Mutation_p.E212*|SLC6A2_ENST00000219833.8_Nonsense_Mutation_p.E212*|SLC6A2_ENST00000561820.1_Nonsense_Mutation_p.E212*|SLC6A2_ENST00000568943.1_Nonsense_Mutation_p.E212*|SLC6A2_ENST00000566163.1_Nonsense_Mutation_p.E212*|SLC6A2_ENST00000567238.1_Nonsense_Mutation_p.E107*	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	212					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)	p.E212*(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GCCGGCAGCCGAGTTTTATGA	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	16											67.0	64.0	65.0					16																	55706077		2198	4300	6498	54263578	SO:0001587	stop_gained	6530				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.634G>T	16.37:g.55706077G>T	ENSP00000369237:p.Glu212*	Somatic		Capture	SOLID	Phase_III	54263578	B2R707|B4DX48|Q96KH8	Nonsense_Mutation	SNP	ENST00000379906.2	37	CCDS10754.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	37	6.633143	0.97722	.	.	ENSG00000103546	ENST00000414754;ENST00000379906;ENST00000219833	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.063	0.97692	0.0:0.0:1.0:0.0	.	.	.	.	X	212	.	ENSP00000219833:E212X	E	+	1	0	SLC6A2	54263578	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.813000	0.99286	2.741000	0.93983	0.650000	0.86243	GAG		0.547	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			Nonsense_Mutation
SYNE1	23345	hgsc.bcm.edu	37	6	152697532	152697532	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr6:152697532C>A	ENST00000367255.5	-	58	9909	c.9308G>T	c.(9307-9309)aGt>aTt	p.S3103I	SYNE1_ENST00000341594.5_Missense_Mutation_p.S3142I|SYNE1_ENST00000448038.1_Missense_Mutation_p.S3110I|SYNE1_ENST00000265368.4_Missense_Mutation_p.S3103I|SYNE1_ENST00000423061.1_Missense_Mutation_p.S3110I	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3103					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S3103I(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTCTGAAGACTAGTTGAAAC	0.398										HNSCC(10;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	6											102.0	108.0	106.0					6																	152697532		2203	4300	6503	152739225	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9308G>T	6.37:g.152697532C>A	ENSP00000356224:p.Ser3103Ile	Somatic		Capture	SOLID	Phase_III	152739225	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	SNP	20	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.32|17.32	3.360379|3.360379	0.61403|0.61403	.|.	.|.	ENSG00000131018|ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594|ENST00000454018	T;T;T;T;T|.	0.53206|.	1.38;0.63;1.38;0.63;1.38|.	5.71|5.71	4.84|4.84	0.62591|0.62591	.|.	0.075155|.	0.56097|.	D|.	0.000024|.	T|T	0.50616|0.50616	0.1626|0.1626	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.47841|.	0.712;0.901;0.712;0.883|.	B;P;B;P|.	0.50231|.	0.312;0.447;0.312;0.635|.	T|T	0.54098|0.54098	-0.8344|-0.8344	10|5	0.40728|.	T|.	0.16|.	.|.	9.2317|9.2317	0.37441|0.37441	0.0:0.7833:0.0:0.2167|0.0:0.7833:0.0:0.2167	.|.	3103;220;3103;3110|.	Q8NF91;B7ZBC4;E7EQI5;Q8NF91-4|.	SYNE1_HUMAN;.;.;.|.	I|F	3103;3110;3103;3110;3142|220	ENSP00000356224:S3103I;ENSP00000396024:S3110I;ENSP00000265368:S3103I;ENSP00000390975:S3110I;ENSP00000341887:S3142I|.	ENSP00000265368:S3103I|.	S|V	-|-	2|1	0|0	SYNE1|SYNE1	152739225|152739225	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.987000|0.987000	0.75469|0.75469	2.427000|2.427000	0.44740|0.44740	1.426000|1.426000	0.47256|0.47256	0.655000|0.655000	0.94253|0.94253	AGT|GTC		0.398	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Missense_Mutation
SYNE2	23224	hgsc.bcm.edu	37	14	64596541	64596541	+	Silent	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr14:64596541C>T	ENST00000344113.4	+	75	14273	c.14061C>T	c.(14059-14061)agC>agT	p.S4687S	SYNE2_ENST00000358025.3_Silent_p.S4687S|SYNE2_ENST00000554584.1_Silent_p.S4604S|SYNE2_ENST00000357395.3_Silent_p.S1072S|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000394768.2_Silent_p.S1072S|SYNE2_ENST00000555002.1_Silent_p.S1321S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4687					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.S4687S(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACGCCGAGAGCCGAGTGGCCA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	14											117.0	119.0	119.0					14																	64596541		2203	4300	6503	63666294	SO:0001819	synonymous_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14061C>T	14.37:g.64596541C>T		Somatic		Capture	SOLID	Phase_III	63666294	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1	SNP	26	Baylor																																																																																				0.428	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		Silent
TGFBR2	7048	hgsc.bcm.edu	37	3	30713461	30713461	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:30713461G>C	ENST00000295754.5	+	4	1168	c.786G>C	c.(784-786)aaG>aaC	p.K262N	TGFBR2_ENST00000359013.4_Missense_Mutation_p.K287N	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.K262N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						ATAAGGCCAAGCTGAAGCAGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	3											154.0	138.0	143.0					3																	30713461		2203	4300	6503	30688465	SO:0001583	missense	7048				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.786G>C	3.37:g.30713461G>C	ENSP00000295754:p.Lys262Asn	Somatic		Capture	SOLID	Phase_III	30688465	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521058	0.64747	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.93811	-3.29;-3.29	5.44	2.66	0.31614	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045892	0.85682	D	0.000000	D	0.90841	0.7123	N	0.17379	0.485	0.58432	D	0.999998	P;P	0.47604	0.898;0.642	P;P	0.57548	0.823;0.673	D	0.88896	0.3349	10	0.87932	D	0	.	8.5377	0.33373	0.3764:0.0:0.6236:0.0	.	262;287	P37173;D2JYI1	TGFR2_HUMAN;.	N	262;287;128	ENSP00000295754:K262N;ENSP00000351905:K287N	ENSP00000295754:K262N	K	+	3	2	TGFBR2	30688465	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.789000	0.47813	0.259000	0.21709	0.591000	0.81541	AAG		0.512	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2			Missense_Mutation
TNFRSF10A	8797	hgsc.bcm.edu	37	8	23049492	23049492	+	Silent	SNP	G	G	T	rs145547481		TCGA-24-1556-01	TCGA-24-1556-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr8:23049492G>T	ENST00000221132.3	-	10	1186	c.1122C>A	c.(1120-1122)atC>atA	p.I374I	RP11-1149O23.2_ENST00000518308.1_RNA	NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	374	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)	p.I374I(1)		NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		CAAAGGGCACGATGTTTGCAA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	8											74.0	62.0	66.0					8																	23049492		2203	4300	6503	23105437	SO:0001819	synonymous_variant	8797			U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.1122C>A	8.37:g.23049492G>T		Somatic		Capture	SOLID	Phase_III	23105437	A8K5I4|Q53Y72|Q96E62	Silent	SNP	ENST00000221132.3	37	CCDS6039.1	SNP	37	Baylor																																																																																				0.542	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215133.2	NM_003844		Silent
TP53	7157	hgsc.bcm.edu	37	17	7576927	7576927	+	Splice_Site	SNP	C	C	T	rs587781702		TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr17:7576927C>T	ENST00000269305.4	-	9	1109		c.e9-1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(20)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGGGCAGTGCTAGGAAAGAG	0.493		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Unknown(20)|Whole gene deletion(8)|Deletion - Frameshift(2)	upper_aerodigestive_tract(7)|ovary(5)|bone(4)|central_nervous_system(3)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|liver(2)|stomach(1)|gastrointestinal_tract_(site_indeterminate)(1)	17											138.0	124.0	129.0					17																	7576927		2203	4300	6503	7517652	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.920-1G>A	17.37:g.7576927C>T		Somatic		Capture	SOLID	Phase_III	7517652	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.756	1.168861	0.21621	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0356	0.58870	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517652	0.043000	0.20138	0.996000	0.52242	0.305000	0.27757	0.852000	0.27764	2.462000	0.83206	0.561000	0.74099	.		0.493	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
SH2B1	25970	hgsc.bcm.edu	37	16	28856084	28856084	+	5'Flank	SNP	T	T	G	rs372069941		TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr16:28856084T>G	ENST00000322610.8	+	0	0				MIR4721_ENST00000577590.1_RNA|TUFM_ENST00000313511.3_Missense_Mutation_p.T207P			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.T207P(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CCAAACTCGGTGAGCAGCTCC	0.587																																																1	Substitution - Missense(1)	ovary(1)	16						T	PRO/THR	0,4394		0,0,2197	111.0	104.0	107.0		619	5.8	1.0	16		107	1,8599	1.2+/-3.3	0,1,4299	no	missense	TUFM	NM_003321.4	38	0,1,6496	GG,GT,TT		0.0116,0.0,0.0077	possibly-damaging	207/456	28856084	1,12993	2197	4300	6497	28763585	SO:0001631	upstream_gene_variant	7284			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28856084T>G	Exception_encountered	Somatic		Capture	SOLID	Phase_III	28763585	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	CCDS53996.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.11	3.030383	0.54790	0.0	1.16E-4	ENSG00000178952	ENST00000313511	T	0.71222	-0.55	5.81	5.81	0.92471	Protein synthesis factor, GTP-binding (1);	0.090601	0.85682	D	0.000000	T	0.81517	0.4839	M	0.87617	2.895	0.58432	D	0.999996	P	0.45283	0.855	P	0.50049	0.629	D	0.85001	0.0900	10	0.87932	D	0	-39.0183	15.1391	0.72595	0.0:0.0:0.0:1.0	.	204	P49411	EFTU_HUMAN	P	207	ENSP00000322439:T207P	ENSP00000322439:T207P	T	-	1	0	TUFM	28763585	1.000000	0.71417	0.991000	0.47740	0.869000	0.49853	4.069000	0.57541	2.214000	0.71695	0.459000	0.35465	ACC		0.587	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		Missense_Mutation
VAV1	7409	hgsc.bcm.edu	37	19	6828827	6828827	+	Splice_Site	SNP	A	A	G			TCGA-24-1556-01	TCGA-24-1556-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr19:6828827A>G	ENST00000602142.1	+	13	1263	c.1181A>G	c.(1180-1182)gAc>gGc	p.D394G	VAV1_ENST00000539284.1_Splice_Site_p.D297G|VAV1_ENST00000596764.1_Splice_Site_p.D362G|VAV1_ENST00000599806.1_Splice_Site_p.D339G|VAV1_ENST00000304076.2_Splice_Site_p.D394G	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	394					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D394G(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						ACTGCATAGGACCAGTCTCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											59.0	52.0	54.0					19																	6828827		2203	4300	6503	6779827	SO:0001630	splice_region_variant	7409				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1180-1A>G	19.37:g.6828827A>G		Somatic		Capture	SOLID	Phase_III	6779827	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.85	2.359677	0.41801	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D;D	0.87966	-2.32;-2.32	5.25	4.15	0.48705	Pleckstrin homology-type (1);	0.266705	0.34386	N	0.004007	T	0.72078	0.3416	N	0.14661	0.345	0.35904	D	0.830576	B;B;B;B	0.12013	0.005;0.0;0.002;0.002	B;B;B;B	0.18263	0.021;0.0;0.01;0.01	T	0.66638	-0.5873	10	0.05620	T	0.96	.	10.3116	0.43712	0.7484:0.2516:0.0:0.0	.	297;394;339;394	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	G	394;297	ENSP00000302269:D394G;ENSP00000443242:D297G	ENSP00000302269:D394G	D	+	2	0	VAV1	6779827	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	1.980000	0.40618	2.006000	0.58801	0.477000	0.44152	GAC		0.622	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		Missense_Mutation	Missense_Mutation
VCL	7414	hgsc.bcm.edu	37	10	75857067	75857067	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr10:75857067C>T	ENST00000211998.4	+	13	1943	c.1849C>T	c.(1849-1851)Cct>Tct	p.P617S	VCL_ENST00000478896.2_Intron|VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.P617S	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	617	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.P617S(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CACGGCGCCTCCTGATGCGCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											94.0	91.0	92.0					10																	75857067		2203	4300	6503	75527073	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1849C>T	10.37:g.75857067C>T	ENSP00000211998:p.Pro617Ser	Somatic		Capture	SOLID	Phase_III	75527073	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.925	0.171879	0.09391	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.36520	1.25;1.25;1.25	5.29	4.37	0.52481	.	0.175329	0.48286	D	0.000183	T	0.19087	0.0458	N	0.14661	0.345	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.07868	-1.0750	10	0.23302	T	0.38	.	8.091	0.30801	0.0:0.7788:0.0:0.2212	.	544;617;617	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	S	617;617;524;544;289	ENSP00000361841:P617S;ENSP00000211998:P617S;ENSP00000415489:P289S	ENSP00000211998:P617S	P	+	1	0	VCL	75527073	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	2.938000	0.48987	2.641000	0.89580	0.644000	0.83932	CCT		0.502	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000		Missense_Mutation
VPS33A	65082	hgsc.bcm.edu	37	12	122745828	122745828	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr12:122745828C>A	ENST00000267199.4	-	4	575	c.463G>T	c.(463-465)Gaa>Taa	p.E155*	RP11-512M8.5_ENST00000535844.1_Nonsense_Mutation_p.E155*|VPS33A_ENST00000451053.2_Nonsense_Mutation_p.E155*|VPS33A_ENST00000542310.1_5'UTR	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	155					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)		p.E155*(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		CCCTCTGATTCCATGGATAAG	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	12											115.0	99.0	105.0					12																	122745828		2203	4300	6503	121311781	SO:0001587	stop_gained	65082			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.463G>T	12.37:g.122745828C>A	ENSP00000267199:p.Glu155*	Somatic		Capture	SOLID	Phase_III	121311781	Q547V4|Q9H5Q0	Nonsense_Mutation	SNP	ENST00000267199.4	37	CCDS9231.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	36	5.927979	0.97110	.	.	ENSG00000139719	ENST00000267199;ENST00000451053	.	.	.	5.29	5.29	0.74685	.	0.050625	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.4154	19.2838	0.94063	0.0:1.0:0.0:0.0	.	.	.	.	X	155	.	ENSP00000446319:E155X	E	-	1	0	VPS33A	121311781	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.709000	0.84645	2.647000	0.89833	0.561000	0.74099	GAA		0.433	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2			Nonsense_Mutation
WDR49	151790	hgsc.bcm.edu	37	3	167250750	167250750	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1556-01	TCGA-24-1556-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr3:167250750T>G	ENST00000308378.3	-	8	1219	c.914A>C	c.(913-915)gAa>gCa	p.E305A	WDR49_ENST00000453925.2_Missense_Mutation_p.E369A|WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_Missense_Mutation_p.E130A	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	305								p.E305A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TAGAACAATTTCTCCATCATA	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											110.0	95.0	100.0					3																	167250750		2203	4299	6502	168733444	SO:0001583	missense	151790			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.914A>C	3.37:g.167250750T>G	ENSP00000311343:p.Glu305Ala	Somatic		Capture	SOLID	Phase_III	168733444	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	SNP	62	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.75|19.75	3.885506|3.885506	0.72410|0.72410	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925|ENST00000472600	T;T;T|.	0.59772|.	0.24;0.24;0.24|.	5.82|5.82	5.82|5.82	0.92795|0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);|.	0.103264|.	0.64402|.	D|.	0.000004|.	T|T	0.51041|0.51041	0.1651|0.1651	L|L	0.41961|0.41961	1.31|1.31	0.31488|0.31488	N|N	0.666302|0.666302	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.76071|.	0.987;0.987|.	T|T	0.56583|0.56583	-0.7955|-0.7955	10|5	0.36615|.	T|.	0.2|.	.|.	15.1777|15.1777	0.72927|0.72927	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	369;305|.	E7EQK3;Q8IV35|.	.;WDR49_HUMAN|.	A|Q	305;130;369|381	ENSP00000311343:E305A;ENSP00000420508:E130A;ENSP00000410863:E369A|.	ENSP00000311343:E305A|.	E|K	-|-	2|1	0|0	WDR49|WDR49	168733444|168733444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.877000|0.877000	0.50540|0.50540	5.036000|5.036000	0.64164|0.64164	2.228000|2.228000	0.72767|0.72767	0.460000|0.460000	0.39030|0.39030	GAA|AAA		0.373	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824		Missense_Mutation
ZFYVE26	23503	hgsc.bcm.edu	37	14	68251956	68251956	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1556-01	TCGA-24-1556-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1556-01	TCGA-24-1556-10	g.chr14:68251956C>A	ENST00000347230.4	-	19	3481	c.3343G>T	c.(3343-3345)Gca>Tca	p.A1115S	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.A1115S	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1115				A -> T (in Ref. 3; CAH18131). {ECO:0000305}.	cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.A1115S(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TTCTGGGCTGCCTGCTCCACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	14											42.0	38.0	40.0					14																	68251956		2203	4300	6503	67321709	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3343G>T	14.37:g.68251956C>A	ENSP00000251119:p.Ala1115Ser	Somatic		Capture	SOLID	Phase_III	67321709	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985862	0.53934	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.33865	1.55;1.39	5.54	0.479	0.16796	.	0.713238	0.13844	N	0.358821	T	0.28300	0.0699	L	0.46157	1.445	0.32576	N	0.52915	B;B	0.31548	0.328;0.1	B;B	0.34242	0.178;0.054	T	0.32561	-0.9902	10	0.51188	T	0.08	0.3236	4.6746	0.12706	0.139:0.5501:0.0:0.3109	.	1115;1115	G3V2D8;Q68DK2	.;ZFY26_HUMAN	S	1115;1094;1115	ENSP00000251119:A1115S;ENSP00000450603:A1115S	ENSP00000251119:A1115S	A	-	1	0	ZFYVE26	67321709	1.000000	0.71417	0.382000	0.26119	0.980000	0.70556	2.502000	0.45398	0.032000	0.15435	-0.140000	0.14226	GCA		0.597	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		Missense_Mutation
