#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PROKR2	128674	genome.wustl.edu	37	20	5282949	5282949	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr20:5282949G>A	ENST00000217270.3	-	2	891	c.892C>T	c.(892-894)Cgt>Tgt	p.R298C	PROKR2_ENST00000546004.1_Missense_Mutation_p.R298C	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	298					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.R298C(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						AAGAAGTCACGAACGATGGTG	0.562										HNSCC(71;0.22)																																						2	Substitution - Missense(2)	ovary(1)|skin(1)	20											153.0	114.0	127.0					20																	5282949		2203	4300	6503	5230949	SO:0001583	missense	128674			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.892C>T	20.37:g.5282949G>A	ENSP00000217270:p.Arg298Cys	Somatic		Capture	Illumina GAIIx	4	5230949	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	ENST00000217270.3	37	CCDS13089.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550422	0.86127	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.72942	-0.7;-0.7	5.05	5.05	0.67936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83552	0.5279	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83251	-0.0053	10	0.37606	T	0.19	.	15.9064	0.79433	0.0:0.0:1.0:0.0	.	298	Q8NFJ6	PKR2_HUMAN	C	298	ENSP00000440790:R298C;ENSP00000217270:R298C	ENSP00000217270:R298C	R	-	1	0	PROKR2	5230949	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.275000	0.72594	2.370000	0.80446	0.655000	0.94253	CGT		0.562	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7579592	7579592	+	Splice_Site	SNP	T	T	A			TCGA-24-1562-01	TCGA-24-1562-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr17:7579592T>A	ENST00000269305.4	-	4	286		c.e4-2		TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(15)|p.0?(8)|p.S33fs*10(1)|p.P13fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAGGGGGACTGTAGATGGGT	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	25	Unknown(15)|Whole gene deletion(8)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	lung(8)|liver(4)|bone(4)|central_nervous_system(3)|upper_aerodigestive_tract(2)|ovary(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)	17											139.0	135.0	137.0					17																	7579592		2203	4300	6503	7520317	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.97-2A>T	17.37:g.7579592T>A		Somatic		Capture	Illumina GAIIx	4	7520317	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	8.950	0.967875	0.18659	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	3.59	3.59	0.41128	.	.	.	.	.	.	.	.	.	.	.	0.45005	D	0.998021	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8383	0.35126	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520317	0.924000	0.31332	0.022000	0.16811	0.019000	0.09904	1.202000	0.32271	1.873000	0.54277	0.459000	0.35465	.		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
PLCB4	5332	genome.wustl.edu	37	20	9288464	9288464	+	Start_Codon_SNP	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr20:9288464G>A	ENST00000378493.1	+	1	18	c.3G>A	c.(1-3)atG>atA	p.M1I	PLCB4_ENST00000278655.4_Start_Codon_SNP_p.M1I|PLCB4_ENST00000334005.3_Start_Codon_SNP_p.M1I|PLCB4_ENST00000378501.2_Start_Codon_SNP_p.M1I|PLCB4_ENST00000414679.2_Start_Codon_SNP_p.M1I|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378473.3_Start_Codon_SNP_p.M1I			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.M1I(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ATATAATCATGGCCAAACCTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	20											62.0	57.0	59.0					20																	9288464		2203	4299	6502	9236464	SO:0001582	initiator_codon_variant	5332				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3G>A	20.37:g.9288464G>A	ENSP00000367754:p.Met1Ile	Somatic		Capture	Illumina GAIIx	4	9236464	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409762	0.83340	.	.	ENSG00000101333	ENST00000407043;ENST00000441846;ENST00000334005;ENST00000378473;ENST00000437503;ENST00000416836;ENST00000278655;ENST00000378493;ENST00000378501	T;T;T;T;T;T;T;T;T	0.60424	0.68;0.68;2.08;2.1;0.49;0.19;2.09;2.09;2.08	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.78457	0.4286	.	.	.	0.80722	D	1	D;P;D	0.69078	0.997;0.525;0.995	D;B;D	0.73380	0.98;0.38;0.944	T	0.80162	-0.1497	9	0.87932	D	0	.	18.9896	0.92786	0.0:0.0:1.0:0.0	.	1;1;1	E2QRH8;Q15147;Q15147-4	.;PLCB4_HUMAN;.	I	1	ENSP00000385805:M1I;ENSP00000412982:M1I;ENSP00000334105:M1I;ENSP00000367734:M1I;ENSP00000391614:M1I;ENSP00000395753:M1I;ENSP00000278655:M1I;ENSP00000367754:M1I;ENSP00000367762:M1I	ENSP00000278655:M1I	M	+	3	0	PLCB4	9236464	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.072000	0.76777	2.785000	0.95823	0.655000	0.94253	ATG		0.333	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		Missense_Mutation	Missense_Mutation
Unknown	0	genome.wustl.edu	37	12	9459809	9459809	+	IGR	SNP	G	G	C	rs200346295		TCGA-24-1562-01	TCGA-24-1562-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr12:9459809G>C								SNORA75 (20391 upstream) : RP13-735L24.1 (60250 downstream)																							CAGCCTCAGTGAGAGCACCCT	0.582																																																0			12																																								9351076	SO:0001628	intergenic_variant	0																															12.37:g.9459809G>C		Somatic		Capture	Illumina GAIIx	4	9351076		Missense_Mutation	SNP		37		SNP	45	WashU																																																																																			0	0.582									Missense_Mutation
LOC728715	728715	genome.wustl.edu	37	12	9713438	9713438	+	RNA	SNP	T	T	C	rs76076453		TCGA-24-1562-01	TCGA-24-1562-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr12:9713438T>C	ENST00000520314.1	+	0	633																											TTTTAAGACATTGGAGAGAAT	0.353																																																0			12																																								9604705			408186																															12.37:g.9713438T>C		Somatic		Capture	Illumina GAIIx	4	9604705		Silent	SNP	ENST00000520314.1	37		SNP	52	WashU																																																																																				0.353	RP11-726G1.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000381543.1			Silent
ESF1	51575	genome.wustl.edu	37	20	13753204	13753204	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr20:13753204C>T	ENST00000202816.1	-	5	1314	c.1207G>A	c.(1207-1209)Gta>Ata	p.V403I		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V403I(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						AATAGCTCTACTGGTCCTTGA	0.328																																																1	Substitution - Missense(1)	ovary(1)	20											187.0	179.0	182.0					20																	13753204		2203	4300	6503	13701204	SO:0001583	missense	51575				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1207G>A	20.37:g.13753204C>T	ENSP00000202816:p.Val403Ile	Somatic		Capture	Illumina GAIIx	4	13701204	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983104	0.34942	.	.	ENSG00000089048	ENST00000202816	T	0.78481	-1.18	5.53	4.57	0.56435	.	0.614883	0.17360	N	0.177041	T	0.56077	0.1961	N	0.11560	0.145	0.09310	N	0.999996	B	0.30406	0.278	B	0.24974	0.057	T	0.44483	-0.9325	10	0.33940	T	0.23	-4.6795	8.3937	0.32544	0.0:0.6231:0.2521:0.1248	.	403	Q9H501	ESF1_HUMAN	I	403	ENSP00000202816:V403I	ENSP00000202816:V403I	V	-	1	0	ESF1	13701204	0.635000	0.27199	1.000000	0.80357	0.998000	0.95712	0.458000	0.21892	2.755000	0.94549	0.650000	0.86243	GTA		0.328	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649		Missense_Mutation
ANKRD20A11P	391267	genome.wustl.edu	37	21	15306303	15306303	+	IGR	SNP	C	C	A			TCGA-24-1562-01	TCGA-24-1562-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr21:15306303C>A								CYP4F29P (85618 upstream) : ANKRD20A11P (9786 downstream)																							TAATTACTGTCTCTTTATGAT	0.343																																																0			21																																								14228174	SO:0001628	intergenic_variant	0																															21.37:g.15306303C>A		Somatic		Capture	Illumina GAIIx	4	14228174		Missense_Mutation	SNP		37		SNP	32	WashU																																																																																			0	0.343									Missense_Mutation
PTPRO	5800	genome.wustl.edu	37	12	15661551	15661551	+	Silent	SNP	C	C	T	rs140514339		TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr12:15661551C>T	ENST00000281171.4	+	7	1644	c.1314C>T	c.(1312-1314)caC>caT	p.H438H	PTPRO_ENST00000543886.1_Silent_p.H438H|PTPRO_ENST00000348962.2_Silent_p.H438H	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	438	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)	p.H438H(1)		NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AGCCGCAGCACGTGAGTGTCC	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		18975	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						C	,	1,4405	2.1+/-5.4	0,1,2202	92.0	85.0	87.0		1314,1314	-5.9	0.8	12	dbSNP_134	87	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PTPRO	NM_002848.3,NM_030667.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	438/1189,438/1217	15661551	1,13005	2203	4300	6503	15552818	SO:0001819	synonymous_variant	5800			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1314C>T	12.37:g.15661551C>T		Somatic		Capture	Illumina GAIIx	4	15552818	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	ENST00000281171.4	37	CCDS8675.1	SNP	19	WashU																																																																																				0.502	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			Silent
RSC1A1	6248	genome.wustl.edu	37	1	15986577	15986577	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr1:15986577C>G	ENST00000345034.1	+	1	214	c.214C>G	c.(214-216)Ctt>Gtt	p.L72V	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	72					intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)	p.L72V(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAAAGAACATCTTTCTTTACA	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	111.0	109.0					1																	15986577		2203	4300	6503	15859164	SO:0001583	missense	6248			BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.214C>G	1.37:g.15986577C>G	ENSP00000341963:p.Leu72Val	Somatic		Capture	Illumina GAIIx	4	15859164	B2RBP5	Missense_Mutation	SNP	ENST00000345034.1	37	CCDS161.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	9.872	1.199217	0.22121	.	.	ENSG00000215695	ENST00000345034	T	0.44482	0.92	5.68	2.77	0.32553	.	0.683196	0.13026	N	0.419704	T	0.28234	0.0697	L	0.27053	0.805	0.09310	N	1	B	0.20671	0.047	B	0.24541	0.054	T	0.20075	-1.0286	10	0.32370	T	0.25	.	7.0845	0.25249	0.0:0.705:0.1425:0.1525	.	72	Q92681	RSCA1_HUMAN	V	72	ENSP00000341963:L72V	ENSP00000341963:L72V	L	+	1	0	RSC1A1	15859164	0.000000	0.05858	0.307000	0.25127	0.364000	0.29643	0.115000	0.15540	0.740000	0.32651	0.561000	0.74099	CTT		0.438	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	NM_006511		Missense_Mutation
IGHV3OR15-7	28318	genome.wustl.edu	37	15	20192941	20192941	+	RNA	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr15:20192941G>A	ENST00000558565.2	-	0	326									immunoglobulin heavy variable 3/OR15-7 (pseudogene)																		CCAAGTCCTCGGTTTTCAGGT	0.537																																																0			15																																								18452955						Z29597		15q11.2	2012-06-12	2011-04-15		ENSG00000259490	ENSG00000259490		"""Immunoglobulins / IGH orphons"""	5633	pseudogene	immunoglobulin pseudogene			"""immunoglobulin heavy variable 3/OR15-7"", ""immunoglobulin heavy variable 3/OR15-7 pseudogene"""				Standard			Approved	IGHV3/OR15-7			OTTHUMG00000171835		15.37:g.20192941G>A		Somatic		Capture	Illumina GAIIx	4	18452955		Silent	SNP	ENST00000558565.2	37		SNP	39	WashU																																																																																				0.537	IGHV3OR15-7-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000415305.2			Silent
CHEK2	11200	genome.wustl.edu	37	22	29092947	29092947	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr22:29092947C>T	ENST00000405598.1	-	11	1228	c.1037G>A	c.(1036-1038)cGt>cAt	p.R346H	CHEK2_ENST00000382580.2_Missense_Mutation_p.R389H|CHEK2_ENST00000382578.1_Missense_Mutation_p.R255H|CHEK2_ENST00000404276.1_Missense_Mutation_p.R346H|CHEK2_ENST00000464581.1_5'UTR|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000544772.1_Missense_Mutation_p.R125H|CHEK2_ENST00000348295.3_Intron|CHEK2_ENST00000328354.6_Missense_Mutation_p.R346H|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000403642.1_Missense_Mutation_p.R255H|CHEK2_ENST00000402731.1_Intron			O96017	CHK2_HUMAN	checkpoint kinase 2	346	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.R346H(1)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CTTTAAGTCACGGTGTATAAT	0.388			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																														yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	1	Substitution - Missense(1)	ovary(1)	22											136.0	115.0	122.0					22																	29092947		2203	4300	6503	27422947	SO:0001583	missense	11200			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1037G>A	22.37:g.29092947C>T	ENSP00000386087:p.Arg346His	Somatic		Capture	Illumina GAIIx	4	27422947	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	SNP	19	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.330264|5.330264	0.95733|0.95733	.|.	.|.	ENSG00000183765|ENSG00000183765	ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000447421|ENST00000434810	T;T;T;T;T;T;T;T|.	0.66099|.	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90359|0.90359	0.6983|0.6983	H|H	0.97758|0.97758	4.07|4.07	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;1.0;0.999;1.0;1.0|.	D|D	0.93393|0.93393	0.6753|0.6753	10|5	0.87932|.	D|.	0|.	-1.4542|-1.4542	18.7264|18.7264	0.91716|0.91716	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	255;125;346;346;389|.	O96017-4;Q9HBS5;A8JZZ5;O96017;O96017-9|.	.;.;.;CHK2_HUMAN;.|.	H|M	255;125;346;346;346;389;255;279|90	ENSP00000372021:R255H;ENSP00000442458:R125H;ENSP00000329178:R346H;ENSP00000385747:R346H;ENSP00000386087:R346H;ENSP00000372023:R389H;ENSP00000384919:R255H;ENSP00000397478:R279H|.	ENSP00000329178:R346H|.	R|V	-|-	2|1	0|0	CHEK2|CHEK2	27422947|27422947	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.911000|0.911000	0.54048|0.54048	6.128000|6.128000	0.71650|0.71650	2.653000|2.653000	0.90120|0.90120	0.650000|0.650000	0.86243|0.86243	CGT|GTG		0.388	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735		Missense_Mutation
ZNF267	10308	genome.wustl.edu	37	16	31927249	31927249	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr16:31927249G>C	ENST00000300870.10	+	4	1888	c.1679G>C	c.(1678-1680)aGt>aCt	p.S560T		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	560					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S560T(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TTTCCTTATAGTTCACACCTT	0.353																																																1	Substitution - Missense(1)	ovary(1)	16											53.0	55.0	54.0					16																	31927249		2197	4300	6497	31834750	SO:0001583	missense	10308			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1679G>C	16.37:g.31927249G>C	ENSP00000300870:p.Ser560Thr	Somatic		Capture	Illumina GAIIx	4	31834750	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	37	CCDS32440.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	.	3.360	-0.130666	0.06753	.	.	ENSG00000185947	ENST00000300870	T	0.07567	3.18	0.458	0.458	0.16670	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07458	0.0188	L	0.48218	1.51	0.09310	N	0.999999	B	0.15141	0.012	B	0.06405	0.002	T	0.35724	-0.9777	9	0.29301	T	0.29	.	6.6931	0.23183	1.0E-4:0.0:0.9999:0.0	.	560	Q14586	ZN267_HUMAN	T	560	ENSP00000300870:S560T	ENSP00000300870:S560T	S	+	2	0	ZNF267	31834750	0.000000	0.05858	0.119000	0.21687	0.111000	0.19643	-1.547000	0.02186	0.482000	0.27582	0.484000	0.47621	AGT		0.353	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414		Missense_Mutation
FHOD3	80206	genome.wustl.edu	37	18	34191995	34191995	+	Silent	SNP	C	C	A			TCGA-24-1562-01	TCGA-24-1562-10	C	C	A	A	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr18:34191995C>A	ENST00000359247.4	+	9	894	c.894C>A	c.(892-894)tcC>tcA	p.S298S	FHOD3_ENST00000445677.1_Silent_p.S298S|FHOD3_ENST00000590592.1_Silent_p.S298S|FHOD3_ENST00000257209.4_Silent_p.S298S|FHOD3_ENST00000591635.1_5'UTR	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	298	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CTGCTGTGTCCCAGAGGCACT	0.502																																																0			18											189.0	150.0	163.0					18																	34191995		2203	4300	6503	32445993	SO:0001819	synonymous_variant	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.894C>A	18.37:g.34191995C>A		Germline		Capture	Illumina GAIIx	4	32445993	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37		SNP	22	WashU																																																																																				0.502	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		Silent
CUL7	9820	genome.wustl.edu	37	6	43019995	43019995	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr6:43019995G>A	ENST00000265348.3	-	2	617	c.532C>T	c.(532-534)Cgc>Tgc	p.R178C	CUL7_ENST00000535468.1_Missense_Mutation_p.R230C			Q14999	CUL7_HUMAN	cullin 7	178					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.R178C(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GCACTCCAGCGAATCTGATAA	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											69.0	63.0	65.0					6																	43019995		2203	4300	6503	43127973	SO:0001583	missense	9820			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.532C>T	6.37:g.43019995G>A	ENSP00000265348:p.Arg178Cys	Somatic		Capture	Illumina GAIIx	4	43127973	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434540	0.62955	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.72942	-0.7;-0.42	5.6	5.6	0.85130	Armadillo-like helical (1);	0.201800	0.43579	D	0.000558	T	0.68403	0.2997	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	0.987;1.0	P;D	0.83275	0.495;0.996	T	0.70927	-0.4739	10	0.44086	T	0.13	-15.9369	14.8367	0.70190	0.0712:0.0:0.9288:0.0	.	230;178	F5H0L1;Q14999	.;CUL7_HUMAN	C	178;230	ENSP00000265348:R178C;ENSP00000438788:R230C	ENSP00000265348:R178C	R	-	1	0	CUL7	43127973	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.237000	0.58681	2.632000	0.89209	0.561000	0.74099	CGC		0.577	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780		Missense_Mutation
PSMC3	5702	genome.wustl.edu	37	11	47441885	47441885	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr11:47441885C>A	ENST00000298852.3	-	10	1214	c.1057G>T	c.(1057-1059)Gag>Tag	p.E353*	PSMC3_ENST00000530912.1_Nonsense_Mutation_p.E311*|PSMC3_ENST00000602866.1_Nonsense_Mutation_p.E337*	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	353					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E353*(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ATCGGGAACTCTATCTTGCGG	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	11											51.0	53.0	52.0					11																	47441885		2201	4298	6499	47398461	SO:0001587	stop_gained	5702			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.1057G>T	11.37:g.47441885C>A	ENSP00000298852:p.Glu353*	Somatic		Capture	Illumina GAIIx	4	47398461	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Nonsense_Mutation	SNP	ENST00000298852.3	37	CCDS7935.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	32	5.151045	0.94645	.	.	ENSG00000165916	ENST00000298852;ENST00000530912	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-40.2369	19.315	0.94208	0.0:1.0:0.0:0.0	.	.	.	.	X	353;311	.	ENSP00000298852:E353X	E	-	1	0	PSMC3	47398461	1.000000	0.71417	0.995000	0.50966	0.902000	0.53008	7.811000	0.86092	2.559000	0.86315	0.561000	0.74099	GAG		0.592	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804		Nonsense_Mutation
VEZF1	7716	genome.wustl.edu	37	17	56056655	56056655	+	Silent	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr17:56056655G>A	ENST00000581208.1	-	5	1036	c.996C>T	c.(994-996)acC>acT	p.T332T	VEZF1_ENST00000584396.1_Silent_p.T323T	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	332					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T332T(1)		breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						TTTGGTTACTGGTCTCTTCAC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	17											95.0	100.0	98.0					17																	56056655		2203	4300	6503	53411654	SO:0001819	synonymous_variant	7716			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.996C>T	17.37:g.56056655G>A		Somatic		Capture	Illumina GAIIx	4	53411654		Silent	SNP	ENST00000581208.1	37	CCDS32687.1	SNP	47	WashU																																																																																				0.433	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1			Silent
ALPK2	115701	genome.wustl.edu	37	18	56204113	56204113	+	Silent	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr18:56204113C>T	ENST00000361673.3	-	5	3519	c.3306G>A	c.(3304-3306)caG>caA	p.Q1102Q	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1102						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q1102Q(1)|p.Q463Q(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GGTTATCAACCTGAAGAGGGG	0.502																																																2	Substitution - coding silent(2)	ovary(2)	18											169.0	186.0	181.0					18																	56204113		2203	4300	6503	54355093	SO:0001819	synonymous_variant	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3306G>A	18.37:g.56204113C>T		Somatic		Capture	Illumina GAIIx	4	54355093	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2	SNP	24	WashU																																																																																				0.502	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		Silent
ZNF716	441234	genome.wustl.edu	37	7	57528776	57528776	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1562-01	TCGA-24-1562-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr7:57528776T>G	ENST00000420713.1	+	4	721	c.609T>G	c.(607-609)caT>caG	p.H203Q		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H203Q(1)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						TAAATCAACATCAGATAATTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	7											56.0	49.0	51.0					7																	57528776		692	1591	2283	57532718	SO:0001583	missense	441234			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.609T>G	7.37:g.57528776T>G	ENSP00000394248:p.His203Gln	Somatic		Capture	Illumina GAIIx	4	57532718		Missense_Mutation	SNP	ENST00000420713.1	37	CCDS55112.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	t	5.718	0.316894	0.10845	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	D	0.86865	-2.18	0.195	0.195	0.15151	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85847	0.5792	M	0.86651	2.83	0.09310	N	0.999998	B	0.24132	0.098	B	0.20955	0.032	T	0.77778	-0.2460	9	0.62326	D	0.03	.	4.8229	0.13400	0.0:2.0E-4:0.0:0.9998	.	191	A6NP11	ZN716_HUMAN	Q	203;191	ENSP00000394248:H203Q	ENSP00000387687:H191Q	H	+	3	2	ZNF716	57532718	0.005000	0.15991	0.009000	0.14445	0.009000	0.06853	-0.676000	0.05221	0.257000	0.21650	0.254000	0.18369	CAT		0.343	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		Missense_Mutation
UBXN2B	137886	genome.wustl.edu	37	8	59352253	59352253	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr8:59352253G>A	ENST00000399598.2	+	6	717	c.595G>A	c.(595-597)Gat>Aat	p.D199N		NM_001077619.1	NP_001071087.1	Q14CS0	UBX2B_HUMAN	UBX domain protein 2B	199	SEP. {ECO:0000255|PROSITE- ProRule:PRU00732}.					endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.D199N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13						GGATATGGAGGATCATCAGGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	8											108.0	101.0	103.0					8																	59352253		1846	4079	5925	59514807	SO:0001583	missense	137886			AK054658	CCDS43741.1	8q12.1	2008-08-08			ENSG00000215114	ENSG00000215114		"""UBX domain containing"""	27035	protein-coding gene	gene with protein product		610686				8619474, 9110174	Standard	NM_001077619		Approved	p37	uc003xtl.3	Q14CS0	OTTHUMG00000164300	ENST00000399598.2:c.595G>A	8.37:g.59352253G>A	ENSP00000382507:p.Asp199Asn	Somatic		Capture	Illumina GAIIx	4	59514807	B3KWZ3	Missense_Mutation	SNP	ENST00000399598.2	37	CCDS43741.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.676832	0.96764	.	.	ENSG00000215114	ENST00000399598	T	0.51325	0.71	5.42	5.42	0.78866	SEP domain (4);	0.000000	0.46145	U	0.000310	T	0.72526	0.3471	M	0.84683	2.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.74945	-0.3491	10	0.48119	T	0.1	-13.7543	17.4072	0.87477	0.0:0.0:1.0:0.0	.	199	Q14CS0	UBX2B_HUMAN	N	199	ENSP00000382507:D199N	ENSP00000382507:D199N	D	+	1	0	UBXN2B	59514807	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.261000	0.95576	2.561000	0.86390	0.603000	0.83216	GAT		0.383	UBXN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378184.1	NM_001077619		Missense_Mutation
IPMK	253430	genome.wustl.edu	37	10	59986812	59986812	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr10:59986812G>A	ENST00000373935.3	-	3	687	c.365C>T	c.(364-366)gCa>gTa	p.A122V		NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	122					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)	p.A122V(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						ACCGTTTGGTGCAGTGGGAGG	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											94.0	96.0	95.0					10																	59986812		2203	4300	6503	59656818	SO:0001583	missense	253430			AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.365C>T	10.37:g.59986812G>A	ENSP00000363046:p.Ala122Val	Somatic		Capture	Illumina GAIIx	4	59656818		Missense_Mutation	SNP	ENST00000373935.3	37	CCDS7250.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309864	0.60414	.	.	ENSG00000151151	ENST00000373935	T	0.18657	2.2	5.88	5.88	0.94601	.	0.270973	0.42548	D	0.000696	T	0.23094	0.0558	L	0.50333	1.59	0.43959	D	0.996639	B	0.22604	0.072	B	0.20767	0.031	T	0.02339	-1.1174	9	.	.	.	-3.6826	17.7222	0.88355	0.0:0.0:1.0:0.0	.	122	Q8NFU5	IPMK_HUMAN	V	122	ENSP00000363046:A122V	.	A	-	2	0	IPMK	59656818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.740000	0.47418	2.785000	0.95823	0.650000	0.86243	GCA		0.343	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048142.1	NM_152230		Missense_Mutation
KIR2DL3	3804	genome.wustl.edu	37	19	55263912	55263912	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr19:55263912C>T	ENST00000342376.3	+	8	998	c.967C>T	c.(967-969)Ccc>Tcc	p.P323S	KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Intron	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	323					immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.P323S(1)		breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		TTCTCAGAGGCCCAAGACACC	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											171.0	190.0	184.0					19																	55263912		2043	4005	6048	59955724	SO:0001583	missense	3804			L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.967C>T	19.37:g.55263912C>T	ENSP00000342215:p.Pro323Ser	Somatic		Capture	Illumina GAIIx	4	59955724	O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	ENST00000342376.3	37	CCDS33107.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	1.896	-0.454278	0.04540	.	.	ENSG00000243772	ENST00000342376	T	0.00456	7.3	0.909	-1.54	0.08584	.	.	.	.	.	T	0.00210	0.0006	N	0.20328	0.56	0.09310	N	1	B;B;B	0.26876	0.012;0.162;0.162	B;B;B	0.23275	0.013;0.045;0.045	T	0.28808	-1.0032	9	0.45353	T	0.12	.	3.9292	0.09276	0.0:0.4636:0.0:0.5364	.	225;323;323	P43628-2;P43628;E3NZD8	.;KI2L3_HUMAN;.	S	323	ENSP00000342215:P323S	ENSP00000342215:P323S	P	+	1	0	KIR2DL3	59955724	0.000000	0.05858	0.003000	0.11579	0.052000	0.14988	0.031000	0.13710	-0.567000	0.06046	0.298000	0.19748	CCC		0.507	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141150.1			Missense_Mutation
NT5E	4907	genome.wustl.edu	37	6	86197130	86197130	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1562-01	TCGA-24-1562-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr6:86197130A>G	ENST00000257770.3	+	5	1076	c.1027A>G	c.(1027-1029)Att>Gtt	p.I343V	NT5E_ENST00000369651.3_Missense_Mutation_p.I343V	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	343					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.I343V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	AGGGAAAACAATTGTCTATCT	0.398																																					Melanoma(140;797 1765 2035 2752 18208)											1	Substitution - Missense(1)	ovary(1)	6											148.0	145.0	146.0					6																	86197130		2203	4300	6503	86253849	SO:0001583	missense	4907			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.1027A>G	6.37:g.86197130A>G	ENSP00000257770:p.Ile343Val	Somatic		Capture	Illumina GAIIx	4	86253849	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	ENST00000257770.3	37	CCDS5002.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	2.189	-0.385704	0.04966	.	.	ENSG00000135318	ENST00000369647;ENST00000257770;ENST00000369651	T;T	0.54279	0.58;0.58	5.38	-1.34	0.09143	5&apos (3);-Nucleotidase, C-terminal (3);	0.574073	0.19296	N	0.117770	T	0.06371	0.0164	N	0.04705	-0.18	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.30621	-0.9972	10	0.11485	T	0.65	-3.7314	1.2605	0.02000	0.4141:0.2553:0.2076:0.1231	.	343;343	B3KQI8;P21589	.;5NTD_HUMAN	V	119;343;343	ENSP00000257770:I343V;ENSP00000358665:I343V	ENSP00000257770:I343V	I	+	1	0	NT5E	86253849	0.000000	0.05858	0.059000	0.19551	0.469000	0.32828	-0.026000	0.12392	-0.205000	0.10219	0.455000	0.32223	ATT		0.398	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1			Missense_Mutation
DCN	1634	genome.wustl.edu	37	12	91558418	91558418	+	Silent	SNP	G	G	T			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr12:91558418G>T	ENST00000052754.5	-	3	789	c.288C>A	c.(286-288)atC>atA	p.I96I	DCN_ENST00000441303.2_Silent_p.I96I|DCN_ENST00000547568.2_Intron|DCN_ENST00000228329.5_Intron|DCN_ENST00000456569.2_Intron|DCN_ENST00000425043.1_Intron|DCN_ENST00000552962.1_Silent_p.I96I|DCN_ENST00000393155.1_Silent_p.I96I|DCN_ENST00000420120.2_Intron|DCN_ENST00000303320.3_Silent_p.I96I	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	96					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)	p.I96I(1)		central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						CTCCATCTTTGATTTCGGTTA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	12											156.0	139.0	145.0					12																	91558418		2203	4300	6503	90082549	SO:0001819	synonymous_variant	1634			AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.288C>A	12.37:g.91558418G>T		Somatic		Capture	Illumina GAIIx	4	90082549	Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Silent	SNP	ENST00000052754.5	37	CCDS9039.1	SNP	45	WashU																																																																																				0.373	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507		Silent
SERPINA5	5104	genome.wustl.edu	37	14	95058502	95058502	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr14:95058502G>A	ENST00000554866.1	+	5	1261	c.1147G>A	c.(1147-1149)Gtg>Atg	p.V383M	SERPINA5_ENST00000554276.1_Missense_Mutation_p.V383M|RP11-986E7.7_ENST00000553947.1_Intron|SERPINA5_ENST00000329597.7_Missense_Mutation_p.V383M|SERPINA5_ENST00000553780.1_Missense_Mutation_p.V383M			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	383					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V383M(1)		endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	TCAGAGGCTAGTGTTCAACAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	14											234.0	246.0	242.0					14																	95058502		2203	4300	6503	94128255	SO:0001583	missense	5104			M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.1147G>A	14.37:g.95058502G>A	ENSP00000451126:p.Val383Met	Somatic		Capture	Illumina GAIIx	4	94128255	Q07616|Q9UG30	Missense_Mutation	SNP	ENST00000554866.1	37	CCDS9928.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	10.77	1.444632	0.25987	.	.	ENSG00000188488	ENST00000553780;ENST00000554866;ENST00000329597;ENST00000537685;ENST00000438291;ENST00000554276	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	5.49	-1.01	0.10169	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	1.265590	0.05593	N	0.575048	T	0.77003	0.4067	L	0.41236	1.265	0.09310	N	1	B	0.24675	0.109	B	0.24006	0.05	T	0.59359	-0.7469	10	0.34782	T	0.22	.	4.8561	0.13561	0.5012:0.0:0.3496:0.1492	.	383	P05154	IPSP_HUMAN	M	383;383;383;235;307;383	ENSP00000450837:V383M;ENSP00000451126:V383M;ENSP00000333203:V383M;ENSP00000451610:V383M	ENSP00000333203:V383M	V	+	1	0	SERPINA5	94128255	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-1.132000	0.03235	-0.156000	0.11079	0.655000	0.94253	GTG		0.547	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410726.1	NM_000624		Missense_Mutation
DPY19L4	286148	genome.wustl.edu	37	8	95792594	95792594	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1562-01	TCGA-24-1562-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr8:95792594T>A	ENST00000414645.2	+	15	1682	c.1583T>A	c.(1582-1584)aTt>aAt	p.I528N		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	528						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.I528N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					TAGGCTCTTATTCTGAGCATG	0.299																																																1	Substitution - Missense(1)	ovary(1)	8											66.0	65.0	65.0					8																	95792594		2203	4296	6499	95861770	SO:0001583	missense	286148				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1583T>A	8.37:g.95792594T>A	ENSP00000389630:p.Ile528Asn	Somatic		Capture	Illumina GAIIx	4	95861770	Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	ENST00000414645.2	37	CCDS34924.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	17.99	3.522662	0.64747	.	.	ENSG00000156162	ENST00000414645	T	0.60171	0.21	5.25	2.85	0.33270	.	0.260251	0.43110	D	0.000612	T	0.55561	0.1928	L	0.47716	1.5	0.44316	D	0.997195	P	0.46142	0.873	P	0.49192	0.602	T	0.53528	-0.8426	10	0.59425	D	0.04	-1.4903	8.6114	0.33804	0.0:0.1524:0.0:0.8476	.	528	Q7Z388	D19L4_HUMAN	N	528	ENSP00000389630:I528N	ENSP00000389630:I528N	I	+	2	0	DPY19L4	95861770	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	3.613000	0.54152	0.394000	0.25230	-0.263000	0.10527	ATT		0.299	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379339.1	NM_181787		Missense_Mutation
MUM1L1	139221	genome.wustl.edu	37	X	105451021	105451021	+	Silent	SNP	C	C	G			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chrX:105451021C>G	ENST00000357175.2	+	4	2245	c.1596C>G	c.(1594-1596)acC>acG	p.T532T	MUM1L1_ENST00000372552.1_Silent_p.T532T|MUM1L1_ENST00000337685.2_Silent_p.T532T	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	532						extracellular vesicular exosome (GO:0070062)		p.T532T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTTCCCAGACCAAGAAAATGT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	X											61.0	53.0	56.0					X																	105451021		1857	4082	5939	105337677	SO:0001819	synonymous_variant	139221			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1596C>G	X.37:g.105451021C>G		Somatic		Capture	Illumina GAIIx	4	105337677	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Silent	SNP	ENST00000357175.2	37	CCDS55469.1	SNP	21	WashU																																																																																				0.458	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423		Silent
ABHD13	84945	genome.wustl.edu	37	13	108881820	108881820	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr13:108881820C>T	ENST00000375898.3	+	2	555	c.254C>T	c.(253-255)cCa>cTa	p.P85L		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	85						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.P85L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					ACTGGCATTCCACATGAAAAC	0.378																																					Pancreas(22;506 789 38166 45896 51596)											1	Substitution - Missense(1)	ovary(1)	13											95.0	94.0	94.0					13																	108881820		2203	4299	6502	107679821	SO:0001583	missense	84945			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.254C>T	13.37:g.108881820C>T	ENSP00000365063:p.Pro85Leu	Somatic		Capture	Illumina GAIIx	4	107679821	B3KWE7|Q8NBW1|Q96JX9	Missense_Mutation	SNP	ENST00000375898.3	37	CCDS32007.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275687	0.59649	.	.	ENSG00000139826	ENST00000375898	T	0.46451	0.87	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.49762	0.1576	M	0.80508	2.5	0.80722	D	1	P	0.42483	0.781	B	0.37387	0.248	T	0.58803	-0.7572	10	0.66056	D	0.02	-16.737	19.2409	0.93883	0.0:1.0:0.0:0.0	.	85	Q7L211	ABHDD_HUMAN	L	85	ENSP00000365063:P85L	ENSP00000365063:P85L	P	+	2	0	ABHD13	107679821	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.393000	0.79851	2.788000	0.95919	0.557000	0.71058	CCA		0.378	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859		Missense_Mutation
PKNOX2	63876	genome.wustl.edu	37	11	125237800	125237800	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr11:125237800C>T	ENST00000298282.9	+	5	417	c.146C>T	c.(145-147)tCa>tTa	p.S49L	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Intron	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	49					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.S49L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TCTGCCCCCTCAGCTGCTGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											55.0	65.0	62.0					11																	125237800		2086	4207	6293	124743010	SO:0001583	missense	63876			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.146C>T	11.37:g.125237800C>T	ENSP00000298282:p.Ser49Leu	Somatic		Capture	Illumina GAIIx	4	124743010	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	13.06	2.124762	0.37533	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000535518	T;T;T	0.55234	0.53;0.53;0.53	5.49	5.49	0.81192	.	0.274240	0.36555	N	0.002538	T	0.43433	0.1247	L	0.29908	0.895	0.80722	D	1	B	0.20261	0.043	B	0.17433	0.018	T	0.21518	-1.0243	10	0.24483	T	0.36	-1.2563	18.1483	0.89665	0.0:1.0:0.0:0.0	.	49	Q96KN3	PKNX2_HUMAN	L	20;20;49;37	ENSP00000434732:S20L;ENSP00000433971:S20L;ENSP00000298282:S49L	ENSP00000298282:S49L	S	+	2	0	PKNOX2	124743010	1.000000	0.71417	0.913000	0.36048	0.755000	0.42902	6.828000	0.75308	2.564000	0.86499	0.563000	0.77884	TCA		0.632	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3			Missense_Mutation
SYCE1	93426	genome.wustl.edu	37	10	135369534	135369534	+	Silent	SNP	T	T	A	rs199551948	byFrequency	TCGA-24-1562-01	TCGA-24-1562-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr10:135369534T>A	ENST00000343131.5	-	9	650	c.546A>T	c.(544-546)gcA>gcT	p.A182A	SYCE1_ENST00000432597.2_Silent_p.A146A|SYCE1_ENST00000368517.3_Silent_p.A146A|SPRN_ENST00000541506.1_Intron	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	182					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AAATCTCCTTTGCCAGCCGCT	0.552																																																0			10											94.0	83.0	87.0					10																	135369534		2203	4300	6503	135219524	SO:0001819	synonymous_variant	93426			AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.546A>T	10.37:g.135369534T>A		Somatic		Capture	Illumina GAIIx	4	135219524	B2RC80|Q9BWU3|Q9BWU4	Silent	SNP	ENST00000343131.5	37	CCDS44501.1	SNP	63	WashU																																																																																				0.552	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564		Silent
KLHL24	54800	genome.wustl.edu	37	3	183368847	183368847	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr3:183368847C>T	ENST00000454652.2	+	4	1089	c.703C>T	c.(703-705)Cgt>Tgt	p.R235C	KLHL24_ENST00000242810.6_Missense_Mutation_p.R235C|KLHL24_ENST00000476808.1_Missense_Mutation_p.R235C	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	235	BACK.					cell projection (GO:0042995)|cytoplasm (GO:0005737)		p.R235C(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			AGCCGTCATGCGTTGGGTCTA	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											152.0	146.0	148.0					3																	183368847		2203	4300	6503	184851541	SO:0001583	missense	54800				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.703C>T	3.37:g.183368847C>T	ENSP00000395012:p.Arg235Cys	Somatic		Capture	Illumina GAIIx	4	184851541	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	CCDS3246.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329530	0.60743	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.70516	-0.49;-0.49;-0.49	5.09	5.09	0.68999	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.85877	0.5799	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72625	0.965;0.978	D	0.87972	0.2737	10	0.62326	D	0.03	.	18.5002	0.90878	0.0:1.0:0.0:0.0	.	235;235	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	C	235	ENSP00000242810:R235C;ENSP00000395012:R235C;ENSP00000419010:R235C	ENSP00000242810:R235C	R	+	1	0	KLHL24	184851541	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.891000	0.48617	2.361000	0.80049	0.460000	0.39030	CGT		0.418	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644		Missense_Mutation
FAT1	2195	genome.wustl.edu	37	4	187540875	187540875	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr4:187540875C>T	ENST00000441802.2	-	10	7074	c.6865G>A	c.(6865-6867)Gcg>Acg	p.A2289T		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2289	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A2289T(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGGGTCACCGCATAAGACTGC	0.463										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											97.0	99.0	99.0					4																	187540875		1986	4169	6155	187777869	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6865G>A	4.37:g.187540875C>T	ENSP00000406229:p.Ala2289Thr	Somatic		Capture	Illumina GAIIx	4	187777869		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.417154	0.00188	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.02682	4.2	5.23	-1.36	0.09085	Cadherin (3);Cadherin-like (1);	0.598725	0.18384	N	0.142864	T	0.01124	0.0037	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.47774	-0.9091	10	0.06494	T	0.89	.	6.8433	0.23975	0.1301:0.4287:0.0:0.4412	.	2289	Q14517	FAT1_HUMAN	T	2289;2291	ENSP00000406229:A2289T	ENSP00000260147:A2291T	A	-	1	0	FAT1	187777869	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.091000	0.11146	-0.226000	0.09899	0.655000	0.94253	GCG		0.463	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
NF1	4763	genome.wustl.edu	37	17	29663789	29663790	+	Frame_Shift_Ins	INS	-	-	T			TCGA-24-1562-01	TCGA-24-1562-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr17:29663789_29663790insT	ENST00000358273.4	+	42	6667_6668	c.6284_6285insT	c.(6283-6288)gatgtgfs	p.V2096fs	NF1_ENST00000356175.3_Frame_Shift_Ins_p.V2075fs|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2096					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.V2096fs*24(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AATTCCCTTGATGTGGCAGCTC	0.441			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(3)|Insertion - Frameshift(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17																																								26687916	SO:0001589	frameshift_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6285dupT	17.37:g.29663790_29663790dupT	ENSP00000351015:p.Val2096fs	Somatic		Capture	Illumina GAIIx	4	26687915	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Ins	INS	ENST00000358273.4	37	CCDS42292.1	INS	12	WashU																																																																																				0.441	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Frame_Shift_Ins
N4BP2L1	90634	genome.wustl.edu	37	13	32972626	32972626	+	IGR	SNP	A	A	T	rs11571833	byFrequency	TCGA-24-1562-01	TCGA-24-1562-10	A	T	A	T	A	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA;Sanger_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr13:32972626A>T	ENST00000380130.2	-	0	3046				BRCA2_ENST00000544455.1_Nonsense_Mutation_p.K3326*|BRCA2_ENST00000380152.3_Nonsense_Mutation_p.K3326*	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		GACTCCATTTAAAAAATTCAA	0.383													A|||	22	0.00439297	0.0008	0.0029	5008	,	,		18509	0.0		0.0109	False		,,,				2504	0.0082															0			13	GRCh37	CM993644	BRCA2	M	rs11571833	A	stop/LYS	12,4394	16.8+/-37.8	0,12,2191	44.0	48.0	47.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	9976	0.2	0.0	13	dbSNP_120	47	72,8528	37.4+/-92.8	0,72,4228	yes	stop-gained	BRCA2	NM_000059.3		0,84,6419	TT,TA,AA		0.8372,0.2724,0.6459		3326/3419	32972626	84,12922	2203	4300	6503	31870626	SO:0001628	intergenic_variant	675			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		13.37:g.32972626A>T		Germline		Capture	Illumina GAIIx	Phase_III	31870626	A4QN21|Q5TBK0	Nonsense_Mutation	SNP	ENST00000380130.2	37	CCDS9345.2	SNP	13	WashU	12	0.005494505494505495	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	8	0.010554089709762533	A	51	17.476080	0.99887	0.002724	0.008372	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.47	0.163	0.14986	.	0.837103	0.11127	N	0.596829	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.1226	0.03730	0.4974:0.2613:0.1218:0.1195	rs11571833;rs52837913;rs11571833	.	.	.	X	3326	.	ENSP00000369497:K3326X	K	+	1	0	BRCA2	31870626	0.008000	0.16893	0.000000	0.03702	0.802000	0.45316	0.523000	0.22925	-0.178000	0.10672	0.383000	0.25322	AAA		0.383	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052818		Nonsense_Mutation
XPO6	23214	genome.wustl.edu	37	16	28123239	28123239	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr16:28123239C>T	ENST00000304658.5	-	17	2740	c.2240G>A	c.(2239-2241)cGc>cAc	p.R747H	XPO6_ENST00000565698.1_Missense_Mutation_p.R733H	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	747					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GTTGATGGAGCGCACGGGCCA	0.587																																																0			16											72.0	79.0	77.0					16																	28123239		2107	4229	6336	28030740	SO:0001583	missense	23214			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.2240G>A	16.37:g.28123239C>T	ENSP00000302790:p.Arg747His	Somatic		Capture	Illumina GAIIx	PhaseIII	28030740	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	32	5.136003	0.94517	.	.	ENSG00000169180	ENST00000304658	T	0.73152	-0.72	5.77	4.82	0.62117	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80819	0.4696	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	T	0.78663	-0.2116	10	0.27785	T	0.31	-12.3173	12.717	0.57121	0.0:0.9205:0.0:0.0795	.	747;747	B7ZM10;Q96QU8	.;XPO6_HUMAN	H	747	ENSP00000302790:R747H	ENSP00000302790:R747H	R	-	2	0	XPO6	28030740	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.607000	0.82883	1.462000	0.47948	0.650000	0.86243	CGC		0.587	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195		Missense_Mutation
TMEM43	79188	genome.wustl.edu	37	3	14183263	14183263	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1562-01	TCGA-24-1562-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr3:14183263C>T	ENST00000306077.4	+	12	1425	c.1171C>T	c.(1171-1173)Cgg>Tgg	p.R391W	AC093495.4_ENST00000428681.3_RNA|RP11-434D12.1_ENST00000608606.1_Intron|RP11-434D12.1_ENST00000601399.1_Intron	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	391					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.R391W(1)		breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						CCTTGTTGCTCGGACACGGGT	0.647																																																1	Substitution - Missense(1)	ovary(1)	3											44.0	44.0	44.0					3																	14183263		2203	4300	6503	14158264	SO:0001583	missense	79188			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.1171C>T	3.37:g.14183263C>T	ENSP00000303992:p.Arg391Trp	Somatic		Capture	Illumina GAIIx	4	14158264	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	37	CCDS2618.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	17.05	3.291095	0.59976	.	.	ENSG00000170876	ENST00000306077	T	0.38401	1.14	5.6	4.73	0.59995	.	0.128849	0.47093	N	0.000254	T	0.43545	0.1252	L	0.38175	1.15	0.42739	D	0.993731	D	0.76494	0.999	P	0.61722	0.893	T	0.42120	-0.9470	10	0.87932	D	0	-26.2125	8.7277	0.34480	0.2464:0.6796:0.0:0.074	.	391	Q9BTV4	TMM43_HUMAN	W	391	ENSP00000303992:R391W	ENSP00000303992:R391W	R	+	1	2	TMEM43	14158264	0.990000	0.36364	0.998000	0.56505	0.331000	0.28603	2.163000	0.42377	1.361000	0.45981	0.585000	0.79938	CGG		0.647	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334		Missense_Mutation
TNPO2	30000	genome.wustl.edu	37	19	12814323	12814323	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1562-01	TCGA-24-1562-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-24-1562-01	TCGA-24-1562-10	g.chr19:12814323G>C	ENST00000592287.1	-	19	2236	c.2128C>G	c.(2128-2130)Ctg>Gtg	p.L710V	TNPO2_ENST00000441499.1_Missense_Mutation_p.L710V|TNPO2_ENST00000450764.2_Missense_Mutation_p.L710V|TNPO2_ENST00000356861.5_Missense_Mutation_p.L710V|SNORD41_ENST00000386967.1_RNA|TNPO2_ENST00000425528.1_Missense_Mutation_p.L710V|TNPO2_ENST00000588216.1_Missense_Mutation_p.L710V	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	710					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)	p.L710V(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTGGTGCCCAGAATGGGCATG	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											108.0	117.0	114.0					19																	12814323		2013	4182	6195	12675323	SO:0001583	missense	30000			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.2128C>G	19.37:g.12814323G>C	ENSP00000468434:p.Leu710Val	Somatic		Capture	Illumina GAIIx	PhaseIII	12675323	O14655|Q6IN77	Missense_Mutation	SNP	ENST00000592287.1	37	CCDS45991.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546781	0.45383	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000546320	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.5	1.77	0.24775	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.88640	2.97	0.58432	D	0.999999	P;P	0.43392	0.73;0.805	B;P	0.44732	0.303;0.459	T	0.61978	-0.6951	10	0.54805	T	0.06	-11.3565	9.7922	0.40713	0.3117:0.0:0.6883:0.0	.	874;710	Q4LE60;O14787	.;TNPO2_HUMAN	V	874;710;710;710;710;710	ENSP00000407182:L710V;ENSP00000389648:L710V;ENSP00000397379:L710V;ENSP00000349321:L710V	ENSP00000349321:L710V	L	-	1	2	TNPO2	12675323	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.050000	0.30404	0.699000	0.31761	-0.137000	0.14449	CTG		0.592	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433		Missense_Mutation
