#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
EPHB2	2048	broad.mit.edu	37	1	23208913	23208913	+	Silent	SNP	G	G	A	rs200120268		TCGA-24-1564-01	TCGA-24-1564-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr1:23208913G>A	ENST00000400191.3	+	6	1383	c.1365G>A	c.(1363-1365)tcG>tcA	p.S455S	EPHB2_ENST00000374627.1_Silent_p.S449S|EPHB2_ENST00000465676.1_3'UTR|EPHB2_ENST00000374632.3_Silent_p.S455S|EPHB2_ENST00000544305.1_Silent_p.S455S|EPHB2_ENST00000374630.3_Silent_p.S455S	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	455	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.S455S(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TTACCCTGTCGTGGTCCCAGC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		22349	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											151.0	135.0	140.0					1																	23208913		2203	4300	6503	23081500	SO:0001819	synonymous_variant	2048			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1365G>A	1.37:g.23208913G>A		Somatic		x	x	x	23081500	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	ENST00000400191.3	37		SNP	40	Broad																																																																																				0.592	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449		Silent
CSMD2	114784	broad.mit.edu	37	1	34076684	34076684	+	Silent	SNP	G	G	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr1:34076684G>A	ENST00000373380.1	-	20	3139	c.2919C>T	c.(2917-2919)agC>agT	p.S973S	CSMD2_ENST00000373388.2_Silent_p.S199S|CSMD2_ENST00000373381.4_Silent_p.S2100S|CSMD2_ENST00000373377.1_Silent_p.S199S			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2060	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S2060S(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGGAGTGGTCGCTGTGGAAAT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	1											119.0	100.0	107.0					1																	34076684		2203	4300	6503	33849271	SO:0001819	synonymous_variant	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2919C>T	1.37:g.34076684G>A		Unknown		x	x	x	33849271	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37		SNP	38	Broad																																																																																				0.567	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		Silent
PLEKHA6	22874	broad.mit.edu	37	1	204214794	204214794	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr1:204214794C>T	ENST00000272203.3	-	14	2297	c.1981G>A	c.(1981-1983)Ggg>Agg	p.G661R	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.G681R	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	661								p.G661R(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TTCCTCAGCCCCTCCATCACG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											138.0	117.0	124.0					1																	204214794		2203	4300	6503	202481417	SO:0001583	missense	22874			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1981G>A	1.37:g.204214794C>T	ENSP00000272203:p.Gly661Arg	Unknown		x	x	x	202481417	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	28.7	4.947300	0.92593	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.78595	-1.19;-1.19	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.82508	0.5052	M	0.75777	2.31	0.80722	D	1	P	0.47191	0.891	P	0.47206	0.541	D	0.85680	0.1300	10	0.87932	D	0	-27.1693	18.1807	0.89777	0.0:1.0:0.0:0.0	.	661	Q9Y2H5	PKHA6_HUMAN	R	661;681	ENSP00000272203:G661R;ENSP00000402046:G681R	ENSP00000272203:G661R	G	-	1	0	PLEKHA6	202481417	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.158000	0.77470	2.406000	0.81754	0.563000	0.77884	GGG		0.592	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935		Missense_Mutation
ACTN2	88	broad.mit.edu	37	1	236920879	236920879	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1564-01	TCGA-24-1564-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr1:236920879A>G	ENST00000366578.4	+	18	2414	c.2248A>G	c.(2248-2250)Atc>Gtc	p.I750V	ACTN2_ENST00000546208.1_Missense_Mutation_p.I244V|ACTN2_ENST00000542672.1_Missense_Mutation_p.I750V	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	750					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.I750V(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGCGAAGGGCATCACCCAGGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	123.0	130.0					1																	236920879		2203	4300	6503	234987502	SO:0001583	missense	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2248A>G	1.37:g.236920879A>G	ENSP00000355537:p.Ile750Val	Somatic		x	x	x	234987502	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587027	0.46110	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.63096	-0.02;-0.02;-0.02	5.73	5.73	0.89815	EF-hand-like domain (1);	0.171345	0.52532	D	0.000065	T	0.68384	0.2995	L	0.42008	1.315	0.80722	D	1	B;B;B;B	0.23058	0.044;0.004;0.044;0.079	B;B;B;P	0.45506	0.14;0.014;0.14;0.483	T	0.65001	-0.6274	10	0.32370	T	0.25	.	16.0225	0.80509	1.0:0.0:0.0:0.0	.	535;750;520;750	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	V	750;750;244;519	ENSP00000443495:I750V;ENSP00000355537:I750V;ENSP00000438384:I244V	ENSP00000355537:I750V	I	+	1	0	ACTN2	234987502	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.307000	0.96226	2.198000	0.70561	0.533000	0.62120	ATC		0.493	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		Missense_Mutation
NEBL	10529	broad.mit.edu	37	10	21101810	21101810	+	Silent	SNP	G	G	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr10:21101810G>A	ENST00000377122.4	-	24	2802	c.2406C>T	c.(2404-2406)gaC>gaT	p.D802D	NEBL_ENST00000377159.4_Silent_p.D105D|NEBL_ENST00000417816.2_Silent_p.D139D	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	802					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.D802D(2)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCACAGGATCGTCCACGACGG	0.468																																																2	Substitution - coding silent(2)	ovary(1)|prostate(1)	10											120.0	96.0	104.0					10																	21101810		2203	4300	6503	21141816	SO:0001819	synonymous_variant	10529			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2406C>T	10.37:g.21101810G>A		Unknown		x	x	x	21141816	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	37	CCDS7134.1	SNP	40	Broad																																																																																				0.468	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393		Silent
ZSWIM8	23053	broad.mit.edu	37	10	75560185	75560185	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr10:75560185G>A	ENST00000605216.1	+	23	5183	c.4966G>A	c.(4966-4968)Gtc>Atc	p.V1656I	RP11-574K11.31_ENST00000603027.1_Intron|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.V1653I|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.V1615I|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.V1661I|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.V1474I	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1656	Pro-rich.						zinc ion binding (GO:0008270)										CAGTCAGCCAGTCAATCCCCA	0.612																																																0			10											54.0	61.0	59.0					10																	75560185		2194	4288	6482	75230191	SO:0001583	missense	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.4966G>A	10.37:g.75560185G>A	ENSP00000474748:p.Val1656Ile	Unknown		x	x	x	75230191	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	2.325	-0.354772	0.05138	.	.	ENSG00000214655	ENST00000398706	T	0.43294	0.95	6.06	6.06	0.98353	.	.	.	.	.	T	0.27313	0.0670	N	0.10972	0.075	0.34801	D	0.73673	B;B;B;B;B	0.09022	0.002;0.002;0.002;0.002;0.001	B;B;B;B;B	0.14578	0.007;0.006;0.011;0.006;0.004	T	0.21177	-1.0253	9	0.08179	T	0.78	-6.5139	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1648;1656;1660;1648;1661	A7E2V4-2;A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4	.;K0913_HUMAN;.;.;.	I	1661	ENSP00000381693:V1661I	ENSP00000381693:V1661I	V	+	1	0	KIAA0913	75230191	1.000000	0.71417	0.921000	0.36526	0.186000	0.23388	7.208000	0.77907	2.882000	0.98803	0.655000	0.94253	GTC		0.612	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487		Missense_Mutation
ZDHHC16	84287	broad.mit.edu	37	10	99212186	99212186	+	Silent	SNP	C	C	T	rs199585228	byFrequency	TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr10:99212186C>T	ENST00000370854.3	+	4	642	c.453C>T	c.(451-453)atC>atT	p.I151I	ZDHHC16_ENST00000393760.1_Silent_p.I151I|ZDHHC16_ENST00000353979.3_Silent_p.I151I|ZDHHC16_ENST00000370846.4_Silent_p.I151I|ZDHHC16_ENST00000352634.4_Silent_p.I151I|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000345745.5_Silent_p.I86I|ZDHHC16_ENST00000370842.2_Silent_p.I151I	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	151					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.I151I(1)		kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		GGAATGATATCGCCACCGTCT	0.537													C|||	2	0.000399361	0.0	0.0029	5008	,	,		22062	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	10											133.0	121.0	125.0					10																	99212186		2203	4300	6503	99202176	SO:0001819	synonymous_variant	84287			AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.453C>T	10.37:g.99212186C>T		Unknown		x	x	x	99202176	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Silent	SNP	ENST00000370854.3	37	CCDS7460.1	SNP	31	Broad	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	4.879	0.163320	0.09287	.	.	ENSG00000171307	ENST00000420089;ENST00000417044	.	.	.	5.95	-6.11	0.02131	.	.	.	.	.	T	0.53465	0.1798	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57318	-0.7832	4	.	.	.	-23.6247	11.3629	0.49655	0.0:0.2902:0.0873:0.6225	.	.	.	.	L	127;93	.	.	S	+	2	0	ZDHHC16	99202176	0.107000	0.21998	0.502000	0.27614	0.891000	0.51852	-0.541000	0.06099	-1.039000	0.03275	-0.254000	0.11334	TCG		0.537	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327		Silent
OR52E2	119678	broad.mit.edu	37	11	5079964	5079964	+	Silent	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr11:5079964C>T	ENST00000321522.2	-	1	893	c.894G>A	c.(892-894)aaG>aaA	p.K298K		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K298K(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		TATAGATCTGCTTGGTTCTGA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	11											69.0	69.0	69.0					11																	5079964		2201	4298	6499	5036540	SO:0001819	synonymous_variant	119678			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.894G>A	11.37:g.5079964C>T		Unknown		x	x	x	5036540		Silent	SNP	ENST00000321522.2	37	CCDS31371.1	SNP	28	Broad																																																																																				0.393	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164		Silent
OR5L1	219437	broad.mit.edu	37	11	55579056	55579056	+	Silent	SNP	G	G	A	rs147224918		TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr11:55579056G>A	ENST00000333973.2	+	1	203	c.114G>A	c.(112-114)acG>acA	p.T38T		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T38T(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				ATGGAGTCACGTTGTTAGCCA	0.502													N|||	1	0.000199681	0.0008	0.0	5008	,	,		18448	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	11						G		1,4399	2.1+/-5.4	0,1,2199	304.0	268.0	280.0		114	-8.6	0.0	11	dbSNP_134	280	4,8588	3.7+/-12.6	0,4,4292	no	coding-synonymous	OR5L1	NM_001004738.1		0,5,6491	AA,AG,GG		0.0466,0.0227,0.0385		38/312	55579056	5,12987	2200	4296	6496	55335632	SO:0001819	synonymous_variant	219437			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.114G>A	11.37:g.55579056G>A		Unknown		x	x	x	55335632	B2RNK6|Q6IFD0	Silent	SNP	ENST00000333973.2	37	CCDS31509.1	SNP	40	Broad																																																																																				0.502	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		Silent
FTH1	2495	broad.mit.edu	37	11	61732321	61732321	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1564-01	TCGA-24-1564-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr11:61732321T>C	ENST00000273550.7	-	4	664	c.430A>G	c.(430-432)Aaa>Gaa	p.K144E	FTH1_ENST00000532601.1_Missense_Mutation_p.K74E|FTH1_ENST00000529191.1_Intron|FTH1_ENST00000526640.1_Missense_Mutation_p.K114E|FTH1_ENST00000529631.1_Intron|BEST1_ENST00000449131.2_3'UTR	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	144	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)	p.K144E(1)		NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	TTGATGGCTTTCACCTGCTCA	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											73.0	68.0	69.0					11																	61732321		1903	4121	6024	61488897	SO:0001583	missense	2495				CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.430A>G	11.37:g.61732321T>C	ENSP00000273550:p.Lys144Glu	Somatic		x	x	x	61488897	B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	ENST00000273550.7	37	CCDS41655.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	.	13.24	2.177406	0.38413	.	.	ENSG00000167996	ENST00000273550;ENST00000406545;ENST00000526640;ENST00000532601	T;T;T	0.60797	0.16;0.16;0.16	5.13	4.0	0.46444	Ferritin/ribonucleotide reductase-like (1);Ferritin, conserved site (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.141711	0.64402	N	0.000005	T	0.28599	0.0708	N	0.02142	-0.665	0.54753	D	0.999984	B	0.09022	0.002	B	0.13407	0.009	T	0.04976	-1.0914	10	0.21014	T	0.42	.	10.7964	0.46464	0.0:0.0758:0.0:0.9242	.	144	P02794	FRIH_HUMAN	E	144;193;114;74	ENSP00000273550:K144E;ENSP00000433321:K114E;ENSP00000435111:K74E	ENSP00000273550:K144E	K	-	1	0	FTH1	61488897	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	4.197000	0.58413	0.913000	0.36797	0.456000	0.33151	AAA		0.498	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388444.1	NM_002032		Missense_Mutation
NCAPD3	23310	broad.mit.edu	37	11	134062769	134062769	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr11:134062769C>T	ENST00000534548.2	-	16	1924	c.1860G>A	c.(1858-1860)tgG>tgA	p.W620*		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	620					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.W620*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CCCCCCGCAACCAGGCTTTCT	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	11											71.0	70.0	70.0					11																	134062769		2201	4297	6498	133567979	SO:0001587	stop_gained	23310			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1860G>A	11.37:g.134062769C>T	ENSP00000433681:p.Trp620*	Unknown		x	x	x	133567979	A6NFS2|Q4KMQ9	Nonsense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.600543	0.96614	.	.	ENSG00000151503	ENST00000534548	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.1764	20.2166	0.98299	0.0:1.0:0.0:0.0	.	.	.	.	X	620	.	ENSP00000431612:W620X	W	-	3	0	NCAPD3	133567979	1.000000	0.71417	0.997000	0.53966	0.019000	0.09904	7.466000	0.80914	2.781000	0.95711	0.591000	0.81541	TGG		0.542	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		Nonsense_Mutation
SLC4A8	9498	broad.mit.edu	37	12	51857482	51857482	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr12:51857482C>G	ENST00000453097.2	+	11	1550	c.1333C>G	c.(1333-1335)Ctt>Gtt	p.L445V	SLC4A8_ENST00000514353.3_Missense_Mutation_p.L392V|SLC4A8_ENST00000535225.2_Missense_Mutation_p.L392V|SLC4A8_ENST00000394856.1_Missense_Mutation_p.L392V|SLC4A8_ENST00000358657.3_Missense_Mutation_p.L472V	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.L445V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TGGGCCAGAACTTCAGCGCAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											98.0	99.0	99.0					12																	51857482		2203	4300	6503	50143749	SO:0001583	missense	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1333C>G	12.37:g.51857482C>G	ENSP00000405812:p.Leu445Val	Unknown		x	x	x	50143749		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827279	0.90955	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	D;D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12;-2.12	5.42	5.42	0.78866	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95837	0.8645	H	0.95950	3.745	0.80722	D	1	D;P;D;D;P;D	0.76494	0.999;0.917;0.982;0.994;0.817;0.957	D;P;P;D;P;D	0.80764	0.994;0.668;0.839;0.955;0.879;0.926	D	0.96875	0.9642	10	0.87932	D	0	.	18.3904	0.90481	0.0:1.0:0.0:0.0	.	392;472;392;445;445;445	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	V	392;472;445;392;445;392;392	ENSP00000441520:L392V;ENSP00000351483:L472V;ENSP00000405812:L445V;ENSP00000378325:L392V;ENSP00000442561:L392V	ENSP00000315789:L445V	L	+	1	0	SLC4A8	50143749	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	4.880000	0.63107	2.725000	0.93324	0.655000	0.94253	CTT		0.478	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858		Missense_Mutation
LRP1	4035	broad.mit.edu	37	12	57598286	57598286	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr12:57598286A>G	ENST00000243077.3	+	71	11511	c.11045A>G	c.(11044-11046)aAc>aGc	p.N3682S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3682	LDL-receptor class A 29. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.N3682S(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGTGGGGACAACTCAGATGAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	83.0	83.0					12																	57598286		2203	4300	6503	55884553	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11045A>G	12.37:g.57598286A>G	ENSP00000243077:p.Asn3682Ser	Unknown		x	x	x	55884553	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	16.46	3.128408	0.56721	.	.	ENSG00000123384	ENST00000243077	D	0.95342	-3.68	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000001	D	0.95185	0.8439	L	0.37850	1.14	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.94900	0.8055	10	0.44086	T	0.13	.	14.308	0.66397	1.0:0.0:0.0:0.0	.	3682	Q07954	LRP1_HUMAN	S	3682	ENSP00000243077:N3682S	ENSP00000243077:N3682S	N	+	2	0	LRP1	55884553	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	9.131000	0.94446	2.207000	0.71202	0.456000	0.33151	AAC		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		Missense_Mutation
NBEA	26960	broad.mit.edu	37	13	35685048	35685048	+	Silent	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr13:35685048C>T	ENST00000400445.3	+	13	2469	c.1935C>T	c.(1933-1935)caC>caT	p.H645H	NBEA_ENST00000379939.2_Silent_p.H645H|NBEA_ENST00000540320.1_Silent_p.H645H|NBEA_ENST00000310336.4_Silent_p.H645H	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	645					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.H645H(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AGCTAATGCACACCTTAAAAT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	13											81.0	78.0	79.0					13																	35685048		1880	4103	5983	34583048	SO:0001819	synonymous_variant	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1935C>T	13.37:g.35685048C>T		Somatic		x	x	x	34583048	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1	SNP	17	Broad																																																																																				0.378	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		Silent
USP8	9101	broad.mit.edu	37	15	50757280	50757280	+	Missense_Mutation	SNP	C	C	T	rs368365577		TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr15:50757280C>T	ENST00000396444.3	+	7	916	c.578C>T	c.(577-579)aCg>aTg	p.T193M	USP8_ENST00000433963.1_Missense_Mutation_p.T193M|USP8_ENST00000425032.3_Missense_Mutation_p.T116M|RNA5SP395_ENST00000516567.1_RNA|USP8_ENST00000307179.4_Missense_Mutation_p.T193M	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	193					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.T193M(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		ACAATGATGACGGATAAAAAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	15											120.0	97.0	105.0					15																	50757280		2196	4294	6490	48544572	SO:0001583	missense	9101			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.578C>T	15.37:g.50757280C>T	ENSP00000379721:p.Thr193Met	Unknown		x	x	x	48544572	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	37	CCDS10137.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	12.05	1.820786	0.32145	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.06	2.4	0.29515	Rhodanese-like (4);	0.431104	0.28409	N	0.015459	T	0.18341	0.0440	N	0.08118	0	0.25813	N	0.984371	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.09596	-1.0667	10	0.31617	T	0.26	-7.7224	4.2773	0.10815	0.1551:0.25:0.0:0.5949	.	116;193	B4DKA8;P40818	.;UBP8_HUMAN	M	193;193;193;116	ENSP00000379721:T193M;ENSP00000405537:T193M;ENSP00000302239:T193M;ENSP00000412682:T116M	ENSP00000302239:T193M	T	+	2	0	USP8	48544572	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.669000	0.37492	0.772000	0.33382	-0.312000	0.09012	ACG		0.393	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		Missense_Mutation
MYH11	4629	broad.mit.edu	37	16	15844038	15844038	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr16:15844038G>A	ENST00000300036.5	-	16	2124	c.2015C>T	c.(2014-2016)aCg>aTg	p.T672M	MYH11_ENST00000396324.3_Missense_Mutation_p.T679M|MYH11_ENST00000576790.2_Missense_Mutation_p.T672M|MYH11_ENST00000452625.2_Missense_Mutation_p.T679M	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	672	Actin-binding. {ECO:0000250}.|Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.T672M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GAAGTTGGGCGTGGTGTTGCG	0.647			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	1	Substitution - Missense(1)	ovary(1)	16											176.0	139.0	152.0					16																	15844038		2197	4300	6497	15751539	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2015C>T	16.37:g.15844038G>A	ENSP00000300036:p.Thr672Met	Unknown		x	x	x	15751539	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368450	0.82463	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.195959	0.45126	D	0.000385	T	0.71247	0.3317	M	0.66378	2.025	0.37733	D	0.92533	P;B;B;B;P;B	0.52316	0.952;0.397;0.397;0.397;0.792;0.397	P;P;P;P;P;P	0.46940	0.532;0.532;0.532;0.532;0.532;0.532	T	0.77983	-0.2382	10	0.87932	D	0	.	9.5298	0.39187	0.0:0.1426:0.6899:0.1675	.	679;672;672;679;672;679	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	M	672;672;679;679;679	ENSP00000300036:T672M;ENSP00000345136:T672M;ENSP00000379616:T679M;ENSP00000407821:T679M	ENSP00000300036:T672M	T	-	2	0	MYH11	15751539	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.864000	0.62990	2.571000	0.86741	0.561000	0.74099	ACG		0.647	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		Missense_Mutation
ANKS4B	257629	broad.mit.edu	37	16	21261206	21261206	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr16:21261206A>T	ENST00000311620.5	+	2	392	c.319A>T	c.(319-321)Agc>Tgc	p.S107C		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	107					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)		p.S107C(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TGCTGCTGCCAGCAGGGAGCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											73.0	72.0	72.0					16																	21261206		2082	4224	6306	21168707	SO:0001583	missense	257629			AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.319A>T	16.37:g.21261206A>T	ENSP00000308772:p.Ser107Cys	Unknown		x	x	x	21168707		Missense_Mutation	SNP	ENST00000311620.5	37	CCDS42130.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731612	0.69189	.	.	ENSG00000175311	ENST00000311620	T	0.66280	-0.2	5.81	5.81	0.92471	Ankyrin repeat-containing domain (4);	0.097774	0.64402	D	0.000001	T	0.71500	0.3347	L	0.39467	1.215	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.70182	-0.4942	10	0.37606	T	0.19	-19.2859	15.3251	0.74154	1.0:0.0:0.0:0.0	.	107	Q8N8V4	ANS4B_HUMAN	C	107	ENSP00000308772:S107C	ENSP00000308772:S107C	S	+	1	0	ANKS4B	21168707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.594000	0.61041	2.212000	0.71576	0.482000	0.46254	AGC		0.537	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865		Missense_Mutation
ZNF267	10308	broad.mit.edu	37	16	31927489	31927489	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr16:31927489C>T	ENST00000300870.10	+	4	2128	c.1919C>T	c.(1918-1920)gCc>gTc	p.A640V		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	640					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A640V(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TGTGGCAAAGCCTTCAACTAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	16											75.0	76.0	76.0					16																	31927489		2197	4300	6497	31834990	SO:0001583	missense	10308			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1919C>T	16.37:g.31927489C>T	ENSP00000300870:p.Ala640Val	Unknown		x	x	x	31834990	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	37	CCDS32440.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	.	12.24	1.880046	0.33162	.	.	ENSG00000185947	ENST00000300870	T	0.36340	1.26	0.468	-0.935	0.10423	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18718	0.0449	L	0.37750	1.13	0.18873	N	0.999985	P	0.41008	0.735	B	0.29862	0.108	T	0.11179	-1.0598	9	0.49607	T	0.09	.	2.3985	0.04395	0.3218:0.3555:0.3226:0.0	.	640	Q14586	ZN267_HUMAN	V	640	ENSP00000300870:A640V	ENSP00000300870:A640V	A	+	2	0	ZNF267	31834990	0.000000	0.05858	0.468000	0.27192	0.445000	0.32107	-0.706000	0.05047	-0.489000	0.06716	-0.500000	0.04577	GCC		0.418	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr17:7578370C>A	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)	17											48.0	46.0	47.0					17																	7578370		2203	4300	6503	7519095	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>T	17.37:g.7578370C>A		Unknown		x	x	x	7519095	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713974	0.30413	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
AP2B1	163	broad.mit.edu	37	17	33977562	33977562	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr17:33977562C>G	ENST00000262325.7	+	13	2103	c.1550C>G	c.(1549-1551)cCt>cGt	p.P517R	AP2B1_ENST00000592545.1_Missense_Mutation_p.P479R|AP2B1_ENST00000538556.1_Missense_Mutation_p.P460R|AP2B1_ENST00000312678.8_Missense_Mutation_p.P517R|AP2B1_ENST00000537622.2_Missense_Mutation_p.P517R|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000589344.1_Missense_Mutation_p.P517R	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	517					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)	p.P517R(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TCTGATAATCCTGACCTTCGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	17											133.0	131.0	132.0					17																	33977562		2203	4300	6503	31001675	SO:0001583	missense	163			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1550C>G	17.37:g.33977562C>G	ENSP00000262325:p.Pro517Arg	Unknown		x	x	x	31001675	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702463	0.88924	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	5.73	5.73	0.89815	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	H	0.97103	3.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.73616	-0.3926	10	0.87932	D	0	-10.3645	18.8762	0.92337	0.0:1.0:0.0:0.0	.	254;479;517;517	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	R	517;517;460;517;254	ENSP00000262325:P517R;ENSP00000314414:P517R;ENSP00000440563:P460R;ENSP00000437413:P517R	ENSP00000262325:P517R	P	+	2	0	AP2B1	31001675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.809000	0.86057	2.720000	0.93068	0.591000	0.81541	CCT		0.443	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1			Missense_Mutation
SDK2	54549	broad.mit.edu	37	17	71387631	71387631	+	Silent	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr17:71387631C>T	ENST00000392650.3	-	28	3945	c.3945G>A	c.(3943-3945)acG>acA	p.T1315T	SDK2_ENST00000388726.3_Silent_p.T1315T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1315	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T1315T(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCCGCACAGACGTGGTCCGCA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	17											28.0	25.0	26.0					17																	71387631		2202	4299	6501	68899226	SO:0001819	synonymous_variant	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.3945G>A	17.37:g.71387631C>T		Unknown		x	x	x	68899226	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1	SNP	19	Broad																																																																																				0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		Silent
INSR	3643	broad.mit.edu	37	19	7152753	7152753	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1564-01	TCGA-24-1564-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr19:7152753C>G	ENST00000302850.5	-	10	2357	c.2215G>C	c.(2215-2217)Gtg>Ctg	p.V739L	INSR_ENST00000341500.5_Missense_Mutation_p.V739L	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	739	Insulin-binding.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.V739L(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	ACGAAAACCACGTTGTGCAGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											193.0	172.0	179.0					19																	7152753		2203	4300	6503	7103753	SO:0001583	missense	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2215G>C	19.37:g.7152753C>G	ENSP00000303830:p.Val739Leu	Somatic		x	x	x	7103753	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	13.94	2.388181	0.42308	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.70631	-0.5;-0.5	5.57	5.57	0.84162	Fibronectin, type III (2);	0.168108	0.26907	N	0.021893	T	0.64011	0.2560	L	0.38175	1.15	0.33959	D	0.645338	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.17098	0.002;0.017;0.002	T	0.66999	-0.5781	10	0.40728	T	0.16	.	17.0456	0.86501	0.0:1.0:0.0:0.0	.	730;739;739	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	L	739	ENSP00000303830:V739L;ENSP00000342838:V739L	ENSP00000303830:V739L	V	-	1	0	INSR	7103753	1.000000	0.71417	0.963000	0.40424	0.775000	0.43874	5.576000	0.67437	2.629000	0.89072	0.603000	0.83216	GTG		0.547	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			Missense_Mutation
CD97	976	broad.mit.edu	37	19	14513441	14513441	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr19:14513441A>G	ENST00000242786.5	+	12	1296	c.1216A>G	c.(1216-1218)Aac>Gac	p.N406D	CD97_ENST00000357355.3_Missense_Mutation_p.N357D|CD97_ENST00000358600.3_Missense_Mutation_p.N313D|CTC-548K16.5_ENST00000590626.1_RNA	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	406					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.N406D(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTCCATCCAGAACATGACGAC	0.572																																																1	Substitution - Missense(1)	ovary(1)	19											112.0	104.0	106.0					19																	14513441		2203	4300	6503	14374441	SO:0001583	missense	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1216A>G	19.37:g.14513441A>G	ENSP00000242786:p.Asn406Asp	Unknown		x	x	x	14374441	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	14.28	2.489215	0.44249	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70986	-0.53;-0.46;-0.08	5.12	-2.84	0.05751	.	.	.	.	.	T	0.69637	0.3133	M	0.72118	2.19	0.09310	N	1	P;P;B	0.50443	0.935;0.935;0.024	P;P;B	0.54889	0.763;0.763;0.024	T	0.58885	-0.7557	9	0.25751	T	0.34	.	1.095	0.01671	0.2945:0.2948:0.2671:0.1436	.	313;357;406	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	D	406;357;313;356	ENSP00000242786:N406D;ENSP00000349918:N357D;ENSP00000351413:N313D	ENSP00000242786:N406D	N	+	1	0	CD97	14374441	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.112000	0.15479	-0.301000	0.08882	0.374000	0.22700	AAC		0.572	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		Missense_Mutation
NLRP2	55655	broad.mit.edu	37	19	55512226	55512226	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr19:55512226C>A	ENST00000543010.1	+	13	3292	c.3149C>A	c.(3148-3150)cCc>cAc	p.P1050H	NLRP2_ENST00000427260.2_Missense_Mutation_p.P1027H|NLRP2_ENST00000339757.7_Missense_Mutation_p.P1028H|NLRP2_ENST00000391721.4_Missense_Mutation_p.P1026H|NLRP2_ENST00000263437.6_Missense_Mutation_p.P1047H|NLRP2_ENST00000448584.2_Missense_Mutation_p.P1050H|NLRP2_ENST00000538819.1_Missense_Mutation_p.P1026H|NLRP2_ENST00000537859.1_Missense_Mutation_p.P1028H	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	1050					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.P1050H(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AAACATCATCCCTGGGCAGAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	19											116.0	107.0	110.0					19																	55512226		2203	4300	6503	60204038	SO:0001583	missense	55655			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.3149C>A	19.37:g.55512226C>A	ENSP00000445135:p.Pro1050His	Unknown		x	x	x	60204038	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	CCDS12913.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750595	0.31046	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.75589	-0.91;-0.83;-0.83;-0.91;-0.83;-0.95;-0.83;-0.94	2.98	1.93	0.25924	.	.	.	.	.	T	0.77857	0.4193	L	0.46157	1.445	0.09310	N	1	D;D;D;D;D	0.76494	0.998;0.999;0.999;0.999;0.998	P;D;D;D;P	0.66979	0.888;0.948;0.936;0.948;0.888	T	0.63646	-0.6590	9	0.66056	D	0.02	.	6.0452	0.19755	0.0:0.8548:0.0:0.1452	.	1027;1028;1047;1026;1050	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	H	1050;1026;1028;1050;1028;1027;1026;1047	ENSP00000445135:P1050H;ENSP00000375601:P1026H;ENSP00000344074:P1028H;ENSP00000409370:P1050H;ENSP00000440601:P1028H;ENSP00000402474:P1027H;ENSP00000441133:P1026H;ENSP00000263437:P1047H	ENSP00000263437:P1047H	P	+	2	0	NLRP2	60204038	0.006000	0.16342	0.002000	0.10522	0.007000	0.05969	1.862000	0.39448	0.819000	0.34492	0.556000	0.70494	CCC		0.408	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		Missense_Mutation
COLEC11	78989	broad.mit.edu	37	2	3691501	3691501	+	Silent	SNP	C	C	T	rs572396920		TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr2:3691501C>T	ENST00000349077.4	+	7	712	c.609C>T	c.(607-609)atC>atT	p.I203I	COLEC11_ENST00000404205.1_Silent_p.I129I|COLEC11_ENST00000487365.1_3'UTR|COLEC11_ENST00000403096.3_Silent_p.I177I|COLEC11_ENST00000236693.7_Silent_p.I200I|COLEC11_ENST00000402794.1_Silent_p.I153I|COLEC11_ENST00000382062.2_Silent_p.I179I|COLEC11_ENST00000418971.2_Silent_p.I217I|COLEC11_ENST00000402922.1_Silent_p.I153I	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	203	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)	p.I200I(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		GTGTCTTCATCGGCATCAACG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		17493	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	2											48.0	54.0	52.0					2																	3691501		2203	4300	6503	3669376	SO:0001819	synonymous_variant	78989			BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.609C>T	2.37:g.3691501C>T		Unknown		x	x	x	3669376	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Silent	SNP	ENST00000349077.4	37	CCDS1649.1	SNP	31	Broad																																																																																				0.657	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1	NM_024027		Silent
VRK2	7444	broad.mit.edu	37	2	58275998	58275998	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr2:58275998T>A	ENST00000435505.2	+	5	777	c.32T>A	c.(31-33)cTt>cAt	p.L11H	VRK2_ENST00000440705.2_Intron|VRK2_ENST00000340157.4_Missense_Mutation_p.L11H|VRK2_ENST00000417641.2_Missense_Mutation_p.L11H|VRK2_ENST00000412104.2_Missense_Mutation_p.L11H			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	11					cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L11H(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						AAATACAAACTTCCTATTCCA	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	85.0	84.0					2																	58275998		2203	4300	6503	58129502	SO:0001583	missense	7444			AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.32T>A	2.37:g.58275998T>A	ENSP00000408002:p.Leu11His	Unknown		x	x	x	58129502	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	37	CCDS1859.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246800	0.80024	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000423109;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000428021	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.72003	0.3407	M	0.86028	2.79	0.51012	D	0.999901	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.987;0.984	T	0.76992	-0.2753	10	0.87932	D	0	-15.3956	14.9988	0.71455	0.0:0.0:0.0:1.0	.	11;11;11	Q86Y07-2;Q86Y07-5;Q86Y07	.;.;VRK2_HUMAN	H	11;11;11;11;11;11;16	ENSP00000408002:L11H;ENSP00000402375:L11H;ENSP00000404156:L11H;ENSP00000342381:L11H;ENSP00000404961:L16H	ENSP00000342381:L11H	L	+	2	0	VRK2	58129502	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	5.124000	0.64709	2.279000	0.76181	0.533000	0.62120	CTT		0.378	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296		Missense_Mutation
PSD4	23550	broad.mit.edu	37	2	113955156	113955156	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr2:113955156G>A	ENST00000245796.6	+	13	2597	c.2402G>A	c.(2401-2403)cGt>cAt	p.R801H	PSD4_ENST00000441564.3_Missense_Mutation_p.R773H	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	801	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.R801H(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGGGCAAGCGTGGCTGGAAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	84.0	89.0					2																	113955156		2203	4300	6503	113671627	SO:0001583	missense	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2402G>A	2.37:g.113955156G>A	ENSP00000245796:p.Arg801His	Unknown		x	x	x	113671627	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676617	0.88445	.	.	ENSG00000125637	ENST00000245796;ENST00000441564;ENST00000409378	T;T;T	0.80653	-1.4;-1.4;1.36	4.29	4.29	0.51040	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.90532	0.7033	M	0.90252	3.1	0.48696	D	0.999697	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.92146	0.5724	10	0.87932	D	0	.	12.2513	0.54599	0.0:0.0:1.0:0.0	.	32;459;773;801	B4DFU9;Q59HG0;Q8NDX1-2;Q8NDX1	.;.;.;PSD4_HUMAN	H	801;773;15	ENSP00000245796:R801H;ENSP00000413997:R773H;ENSP00000386606:R15H	ENSP00000245796:R801H	R	+	2	0	PSD4	113671627	1.000000	0.71417	0.990000	0.47175	0.988000	0.76386	6.527000	0.73803	1.947000	0.56498	0.561000	0.74099	CGT		0.542	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455		Missense_Mutation
BBS5	129880	broad.mit.edu	37	2	170336097	170336097	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr2:170336097G>T	ENST00000295240.3	+	1	410	c.34G>T	c.(34-36)Gat>Tat	p.D12Y	BBS5_ENST00000554017.1_Missense_Mutation_p.D12Y|RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.D12Y|BBS5_ENST00000392663.2_Missense_Mutation_p.D12Y	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	12					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.D12Y(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GGAGGATCGGGATGTCCGTTT	0.637									Bardet-Biedl syndrome																																							1	Substitution - Missense(1)	ovary(1)	2											137.0	123.0	128.0					2																	170336097		2203	4300	6503	170044343	SO:0001583	missense	129880	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.34G>T	2.37:g.170336097G>T	ENSP00000295240:p.Asp12Tyr	Unknown		x	x	x	170044343	D3DPC3|Q6PKN0	Missense_Mutation	SNP	ENST00000295240.3	37	CCDS2233.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.466847	0.96257	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	6.01	6.01	0.97437	.	0.043806	0.85682	D	0.000000	D	0.86003	0.5829	M	0.72894	2.215	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.982;0.96;0.976	D	0.86343	0.1706	10	0.87932	D	0	-19.2408	18.6988	0.91613	0.0:0.0:1.0:0.0	.	12;12;12	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	Y	12	ENSP00000295240:D12Y;ENSP00000452313:D12Y;ENSP00000376431:D12Y;ENSP00000424363:D12Y	ENSP00000295240:D12Y	D	+	1	0	BBS5;RP11-724O16.1	170044343	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	8.529000	0.90602	2.860000	0.98153	0.655000	0.94253	GAT		0.637	BBS5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255265.2	NM_152384		Missense_Mutation
LPIN3	64900	broad.mit.edu	37	20	39977404	39977404	+	Missense_Mutation	SNP	G	G	C	rs201236014	byFrequency	TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr20:39977404G>C	ENST00000373257.3	+	4	525	c.434G>C	c.(433-435)cGt>cCt	p.R145P		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	145					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.R145P(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				AGGAAGAGGCGTCGCAGGAGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	20											41.0	40.0	40.0					20																	39977404		2203	4300	6503	39410818	SO:0001583	missense	64900			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.434G>C	20.37:g.39977404G>C	ENSP00000362354:p.Arg145Pro	Unknown		x	x	x	39410818	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	ENST00000373257.3	37	CCDS33469.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246574	0.22796	.	.	ENSG00000132793	ENST00000373257	D	0.82526	-1.62	4.35	3.38	0.38709	.	0.221515	0.37393	N	0.002104	T	0.73481	0.3592	N	0.08118	0	0.18873	N	0.999985	D;D	0.63046	0.957;0.992	P;P	0.57502	0.822;0.769	T	0.62572	-0.6826	9	.	.	.	-6.7448	5.465	0.16637	0.1019:0.0:0.6971:0.2009	.	145;145	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	P	145	ENSP00000362354:R145P	.	R	+	2	0	LPIN3	39410818	0.215000	0.23574	0.251000	0.24312	0.290000	0.27261	0.833000	0.27504	1.135000	0.42183	0.650000	0.86243	CGT		0.627	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896		Missense_Mutation
TMPRSS15	5651	broad.mit.edu	37	21	19685263	19685263	+	Splice_Site	SNP	C	C	A			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr21:19685263C>A	ENST00000284885.3	-	18	2197	c.2164G>T	c.(2164-2166)Ggg>Tgg	p.G722W		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	722	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.G722W(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						ATTACTTACCCTAGTCCCAGC	0.353																																																1	Substitution - Missense(1)	ovary(1)	21											98.0	96.0	97.0					21																	19685263		2203	4300	6503	18607134	SO:0001630	splice_region_variant	5651				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2165+1G>T	21.37:g.19685263C>A		Unknown		x	x	x	18607134	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845140	0.71603	.	.	ENSG00000154646	ENST00000284885	T	0.38887	1.11	5.53	5.53	0.82687	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.128900	0.52532	D	0.000061	T	0.64483	0.2602	M	0.69823	2.125	0.50313	D	0.999862	D	0.89917	1.0	D	0.97110	1.0	T	0.63528	-0.6617	9	.	.	.	.	16.9598	0.86269	0.0:1.0:0.0:0.0	.	722	P98073	ENTK_HUMAN	W	722	ENSP00000284885:G722W	.	G	-	1	0	TMPRSS15	18607134	1.000000	0.71417	0.996000	0.52242	0.934000	0.57294	4.524000	0.60552	2.607000	0.88179	0.655000	0.94253	GGG		0.353	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	Missense_Mutation	Missense_Mutation
SYNJ1	8867	broad.mit.edu	37	21	34072358	34072358	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1564-01	TCGA-24-1564-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr21:34072358A>G	ENST00000322229.7	-	3	268	c.269T>C	c.(268-270)aTt>aCt	p.I90T	SYNJ1_ENST00000382491.3_Missense_Mutation_p.I90T|SYNJ1_ENST00000382499.2_Missense_Mutation_p.I129T|SYNJ1_ENST00000433931.2_Missense_Mutation_p.I129T|SYNJ1_ENST00000357345.3_Missense_Mutation_p.I90T			O43426	SYNJ1_HUMAN	synaptojanin 1	90					cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.I90T(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						AGATTCTTGAATTTTTCCAAC	0.378																																																1	Substitution - Missense(1)	ovary(1)	21											66.0	69.0	68.0					21																	34072358		2203	4300	6503	32994229	SO:0001583	missense	8867			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.269T>C	21.37:g.34072358A>G	ENSP00000322234:p.Ile90Thr	Somatic		x	x	x	32994229	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	26.6	4.749266	0.89753	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236;ENST00000456084	T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12	5.6	5.6	0.85130	Synaptojanin, N-terminal (1);	0.047266	0.85682	D	0.000000	T	0.78426	0.4281	M	0.87180	2.865	0.80722	D	1	D;D;P;D;P	0.63880	0.963;0.98;0.915;0.993;0.902	P;P;P;D;B	0.66497	0.87;0.876;0.702;0.944;0.311	T	0.82833	-0.0262	10	0.87932	D	0	.	15.7902	0.78350	1.0:0.0:0.0:0.0	.	90;129;90;90;90	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	T	90;90;129;129;90;90;90	ENSP00000371931:I90T;ENSP00000349903:I90T;ENSP00000371939:I129T;ENSP00000409667:I129T;ENSP00000322234:I90T;ENSP00000413649:I90T;ENSP00000412707:I90T	ENSP00000322234:I90T	I	-	2	0	SYNJ1	32994229	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.823000	0.92018	2.138000	0.66242	0.477000	0.44152	ATT		0.378	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				Missense_Mutation
BACE2	25825	broad.mit.edu	37	21	42609500	42609500	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr21:42609500G>T	ENST00000330333.6	+	3	925	c.462G>T	c.(460-462)tgG>tgT	p.W154C	BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Missense_Mutation_p.W154C|BACE2_ENST00000347667.5_Missense_Mutation_p.W154C	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	154					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)	p.W154C(1)		endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				AAGGAAGCTGGACGGGCTTCG	0.418																																																1	Substitution - Missense(1)	ovary(1)	21											85.0	68.0	74.0					21																	42609500		2203	4300	6503	41531370	SO:0001583	missense	25825			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.462G>T	21.37:g.42609500G>T	ENSP00000332979:p.Trp154Cys	Unknown		x	x	x	41531370	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	37	CCDS13668.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610276	0.87258	.	.	ENSG00000182240	ENST00000330333;ENST00000347667;ENST00000328735;ENST00000544566	T;T;T	0.56941	0.43;0.43;0.43	5.85	5.85	0.93711	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.85682	D	0.000000	T	0.75049	0.3797	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.97110	0.931;0.999;1.0	T	0.76561	-0.2914	10	0.72032	D	0.01	.	19.1545	0.93504	0.0:0.0:1.0:0.0	.	154;154;154	Q9Y5Z0-3;Q9Y5Z0-2;Q9Y5Z0	.;.;BACE2_HUMAN	C	154;154;154;59	ENSP00000332979:W154C;ENSP00000327528:W154C;ENSP00000333854:W154C	ENSP00000333854:W154C	W	+	3	0	BACE2	41531370	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.866000	0.92307	2.773000	0.95371	0.585000	0.79938	TGG		0.418	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1			Missense_Mutation
MCTP1	79772	broad.mit.edu	37	5	94046533	94046533	+	Silent	SNP	G	G	C			TCGA-24-1564-01	TCGA-24-1564-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr5:94046533G>C	ENST00000515393.1	-	21	2819	c.2820C>G	c.(2818-2820)gtC>gtG	p.V940V	MCTP1_ENST00000505078.1_Silent_p.V456V|MCTP1_ENST00000312216.8_Silent_p.V719V|ANKRD32_ENST00000493934.1_Intron|MCTP1_ENST00000429576.2_Silent_p.V633V|MCTP1_ENST00000514040.1_5'UTR	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	940					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.V940V(1)		breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CCCAGACAAGGACAATGTATC	0.483																																																1	Substitution - coding silent(1)	ovary(1)	5											99.0	84.0	90.0					5																	94046533		2203	4300	6503	94072289	SO:0001819	synonymous_variant	79772				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.2820C>G	5.37:g.94046533G>C		Somatic		x	x	x	94072289	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Silent	SNP	ENST00000515393.1	37	CCDS34203.1	SNP	41	Broad																																																																																				0.483	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717		Silent
PRR3	80742	broad.mit.edu	37	6	30530243	30530243	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1564-01	TCGA-24-1564-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr6:30530243C>G	ENST00000376560.3	+	4	997	c.538C>G	c.(538-540)Cat>Gat	p.H180D	PRR3_ENST00000498336.1_3'UTR|PRR3_ENST00000376557.3_Missense_Mutation_p.H159D	NM_025263.3	NP_079539.2	P79522	PRR3_HUMAN	proline rich 3	180							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.H180D(1)		lung(1)|ovary(1)	2						TGCCTTCTACCATCCAGGCGT	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											166.0	167.0	167.0					6																	30530243		2037	4219	6256	30638222	SO:0001583	missense	80742			AK074531	CCDS43440.1, CCDS43441.1	6p21.32	2013-01-18	2004-05-27		ENSG00000204576	ENSG00000204576		"""Zinc fingers, CCCH-type domain containing"""	21149	protein-coding gene	gene with protein product			"""proline-rich polpeptide 3"""				Standard	NM_025263		Approved	CAT56, Em:AB014077.1, Em:AB023052.2	uc003nqi.2	P79522	OTTHUMG00000031037	ENST00000376560.3:c.538C>G	6.37:g.30530243C>G	ENSP00000365744:p.His180Asp	Somatic		x	x	x	30638222	A1A4H4|Q5RJB5|Q5STN6	Missense_Mutation	SNP	ENST00000376560.3	37	CCDS43440.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359450	0.61403	.	.	ENSG00000204576	ENST00000376560;ENST00000376555;ENST00000376557	D;D	0.99952	-8.75;-8.75	5.26	4.4	0.53042	Zinc finger, CCCH-type (3);	0.000000	0.50627	D	0.000106	D	0.99906	0.9955	L	0.56199	1.76	0.43191	D	0.995029	D;D	0.71674	0.997;0.998	D;D	0.67382	0.918;0.951	D	0.94737	0.7915	10	0.87932	D	0	-20.4019	13.0162	0.58759	0.0:0.9213:0.0:0.0787	.	159;180	P79522-2;P79522	.;PRR3_HUMAN	D	180;245;159	ENSP00000365744:H180D;ENSP00000365740:H159D	ENSP00000365738:H245D	H	+	1	0	PRR3	30638222	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	5.108000	0.64609	1.453000	0.47775	0.655000	0.94253	CAT		0.527	PRR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076033.2	NM_025263		Missense_Mutation
DEFB110	245913	broad.mit.edu	37	6	49989593	49989593	+	Splice_Site	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr6:49989593C>T	ENST00000371148.2	-	1	101		c.e1+1		DEFB110_ENST00000393660.2_Splice_Site	NM_001037497.1	NP_001032586.1	Q30KQ9	DB110_HUMAN	defensin, beta 110 locus						defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.?(2)		endometrium(1)|lung(1)|ovary(1)	3	Lung NSC(77;0.042)					TTGCATATTACCTGGTAAAAT	0.303																																																2	Unknown(2)	ovary(2)	6											32.0	37.0	35.0					6																	49989593		2201	4297	6498	50097552	SO:0001630	splice_region_variant	245913			DQ012014, BC148541	CCDS43473.1, CCDS34475.1	6p12.3	2010-11-26	2010-11-26		ENSG00000203970	ENSG00000203970		"""Defensins, beta"""	18091	protein-coding gene	gene with protein product			"""defensin, beta 110"""			11854508, 16033865	Standard	NM_001037728		Approved	DEFB-10, DEFB-11, DEFB111	uc003pac.3	Q30KQ9	OTTHUMG00000160208	ENST00000371148.2:c.55+1G>A	6.37:g.49989593C>T		Unknown		x	x	x	50097552	Q30KR0	Splice_Site_SNP	SNP	ENST00000371148.2	37	CCDS34475.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	8.817	0.936656	0.18206	.	.	ENSG00000203970	ENST00000393660;ENST00000371148	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2057	0.59795	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DEFB110	50097552	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	3.083000	0.50136	2.569000	0.86673	0.467000	0.42956	.		0.303	DEFB110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359664.1	NM_001037728	Intron	Splice_Site_SNP
GSTA5	221357	broad.mit.edu	37	6	52696672	52696672	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr6:52696672C>T	ENST00000370989.2	-	6	672	c.643G>A	c.(643-645)Gaa>Aaa	p.E215K	GSTA5_ENST00000475052.1_5'UTR|GSTA5_ENST00000284562.2_Missense_Mutation_p.E215K			Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	215					glutathione metabolic process (GO:0006749)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.E215K(1)		endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Lung NSC(77;0.0912)				Glutathione(DB00143)	TTCCTTGCTTCTTCTAAAGAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	6											142.0	137.0	138.0					6																	52696672		2203	4300	6503	52804631	SO:0001583	missense	221357			BK000212	CCDS4946.1	6p12.2	2012-06-21	2008-11-26		ENSG00000182793	ENSG00000182793	2.5.1.18	"""Glutathione S-transferases / Soluble"""	19662	protein-coding gene	gene with protein product		607605	"""glutathione S-transferase A5"""			12042665	Standard	NM_153699		Approved		uc003pba.1	Q7RTV2	OTTHUMG00000014857	ENST00000370989.2:c.643G>A	6.37:g.52696672C>T	ENSP00000360028:p.Glu215Lys	Unknown		x	x	x	52804631	Q5SZC2	Missense_Mutation	SNP	ENST00000370989.2	37	CCDS4946.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	1.041	-0.678871	0.03378	.	.	ENSG00000182793	ENST00000370989;ENST00000284562	T;T	0.01516	4.81;4.81	2.37	-4.75	0.03239	Glutathione S-transferase, C-terminal-like (1);	0.889303	0.09686	N	0.769158	T	0.00328	0.0010	N	0.17723	0.515	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44050	-0.9353	10	0.12103	T	0.63	.	5.9242	0.19099	0.0:0.409:0.1309:0.4601	.	215	Q7RTV2	GSTA5_HUMAN	K	215	ENSP00000360028:E215K;ENSP00000284562:E215K	ENSP00000284562:E215K	E	-	1	0	GSTA5	52804631	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-3.082000	0.00613	-2.048000	0.00907	-1.206000	0.01644	GAA		0.448	GSTA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040917.1	NM_153699		Missense_Mutation
KHDRBS2	202559	broad.mit.edu	37	6	62390875	62390875	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1564-01	TCGA-24-1564-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr6:62390875C>A	ENST00000281156.4	-	9	1321	c.1043G>T	c.(1042-1044)aGa>aTa	p.R348I	RP1-240B8.3_ENST00000511849.2_RNA	NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)	p.R348I(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		CCTTCAATATCTACCATAGGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	6											188.0	131.0	150.0					6																	62390875		2203	4300	6503	62448834	SO:0001583	missense	202559			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.1043G>T	6.37:g.62390875C>A	ENSP00000281156:p.Arg348Ile	Somatic		x	x	x	62448834	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	37	CCDS4963.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081469	0.55753	.	.	ENSG00000112232	ENST00000281156	T	0.59224	0.28	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.64843	0.2635	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68595	-0.5367	10	0.87932	D	0	.	18.9222	0.92529	0.0:1.0:0.0:0.0	.	348	Q5VWX1	KHDR2_HUMAN	I	348	ENSP00000281156:R348I	ENSP00000281156:R348I	R	-	2	0	KHDRBS2	62448834	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.395000	0.73228	2.541000	0.85698	0.650000	0.86243	AGA		0.483	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688		Missense_Mutation
CACNA2D1	781	broad.mit.edu	37	7	81714151	81714151	+	Missense_Mutation	SNP	C	C	T	rs370389203		TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr7:81714151C>T	ENST00000356253.5	-	7	847	c.592G>A	c.(592-594)Gag>Aag	p.E198K	CACNA2D1_ENST00000423588.1_Missense_Mutation_p.E198K|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.E198K			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	198					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.E198K(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGGTCTTCCTCGCGATTCTTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	7						C	LYS/GLU	0,4406		0,0,2203	112.0	110.0	111.0		592	5.1	1.0	7		111	1,8599	1.2+/-3.3	0,1,4299	no	missense	CACNA2D1	NM_000722.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	198/1092	81714151	1,13005	2203	4300	6503	81552087	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.592G>A	7.37:g.81714151C>T	ENSP00000348589:p.Glu198Lys	Unknown		x	x	x	81552087	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202063	0.58234	0.0	1.16E-4	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.24538	3.2;3.19;1.85	5.96	5.06	0.68205	.	0.406926	0.28606	N	0.014760	T	0.23210	0.0561	L	0.43598	1.365	0.80722	D	1	B	0.14012	0.009	B	0.13407	0.009	T	0.05354	-1.0890	10	0.11794	T	0.64	-4.5946	16.6309	0.85032	0.0:0.8698:0.1302:0.0	.	198	P54289-2	.	K	198	ENSP00000349320:E198K;ENSP00000348589:E198K;ENSP00000405395:E198K	ENSP00000284088:E198K	E	-	1	0	CACNA2D1	81552087	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	4.776000	0.62354	1.471000	0.48121	0.650000	0.86243	GAG		0.383	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
SLC26A3	1811	broad.mit.edu	37	7	107427810	107427810	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr7:107427810A>C	ENST00000340010.5	-	7	1064	c.880T>G	c.(880-882)Ttc>Gtc	p.F294V	SLC26A3_ENST00000422236.2_Missense_Mutation_p.F259V	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	294					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.F294V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						ACCATAATGAATTCGATTGGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	7											170.0	162.0	165.0					7																	107427810		2203	4300	6503	107215046	SO:0001583	missense	1811			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.880T>G	7.37:g.107427810A>C	ENSP00000345873:p.Phe294Val	Unknown		x	x	x	107215046		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	0.033	-1.324077	0.01309	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.92348	-3.02;-3.02	5.4	2.0	0.26442	Sulphate transporter (1);	0.177387	0.49305	D	0.000143	T	0.71779	0.3380	N	0.00729	-1.24	0.25938	N	0.982901	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.65516	-0.6149	10	0.40728	T	0.16	.	5.378	0.16176	0.0898:0.1301:0.6468:0.1334	.	259;294	G5E9U3;P40879	.;S26A3_HUMAN	V	259;294	ENSP00000415817:F259V;ENSP00000345873:F294V	ENSP00000345873:F294V	F	-	1	0	SLC26A3	107215046	1.000000	0.71417	0.915000	0.36163	0.227000	0.25037	1.210000	0.32370	0.146000	0.19002	-0.250000	0.11733	TTC		0.383	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		Missense_Mutation
REPIN1	29803	broad.mit.edu	37	7	150068781	150068781	+	Missense_Mutation	SNP	G	G	A	rs551779231	byFrequency	TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr7:150068781G>A	ENST00000425389.2	+	1	529	c.451G>A	c.(451-453)Gag>Aag	p.E151K	RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000482680.1_3'UTR|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000489432.2_Missense_Mutation_p.E208K|REPIN1_ENST00000444957.1_Missense_Mutation_p.E151K|REPIN1_ENST00000397281.2_Missense_Mutation_p.E151K|REPIN1_ENST00000540729.1_Missense_Mutation_p.E151K	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	151					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E151K(1)		cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCCCAAATGCGAGAGACGCTT	0.662													G|||	2	0.000399361	0.0	0.0	5008	,	,		16767	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	7											19.0	22.0	21.0					7																	150068781		2051	4187	6238	149699714	SO:0001583	missense	29803			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.451G>A	7.37:g.150068781G>A	ENSP00000388287:p.Glu151Lys	Unknown		x	x	x	149699714	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	ENST00000425389.2	37	CCDS43677.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087877	0.55968	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000425389	T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	4.73	3.84	0.44239	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63058	0.2479	N	0.16903	0.455	0.80722	D	1	P;P	0.49447	0.924;0.88	B;B	0.41374	0.284;0.355	T	0.67154	-0.5742	9	0.72032	D	0.01	-7.4782	11.0633	0.47961	0.0914:0.0:0.9086:0.0	.	208;151	C9J3L7;Q9BWE0	.;REPI1_HUMAN	K	151;151;151;208;210;211;151	ENSP00000445016:E151K;ENSP00000380451:E151K;ENSP00000407714:E151K;ENSP00000417291:E208K;ENSP00000419789:E210K;ENSP00000419872:E211K;ENSP00000388287:E151K	ENSP00000380451:E151K	E	+	1	0	REPIN1	149699714	1.000000	0.71417	0.920000	0.36463	0.966000	0.64601	4.132000	0.57977	1.188000	0.43014	0.462000	0.41574	GAG		0.662	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374		Missense_Mutation
MYOM2	9172	broad.mit.edu	37	8	2005774	2005774	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr8:2005774T>G	ENST00000262113.4	+	5	577	c.436T>G	c.(436-438)Ttt>Gtt	p.F146V	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	146					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.F146V(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GAGACACACATTTGAAGAGCG	0.602																																																1	Substitution - Missense(1)	ovary(1)	8											83.0	74.0	77.0					8																	2005774		2203	4300	6503	1993181	SO:0001583	missense	9172				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.436T>G	8.37:g.2005774T>G	ENSP00000262113:p.Phe146Val	Unknown		x	x	x	1993181	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	0.224	-1.026237	0.02045	.	.	ENSG00000036448	ENST00000262113	T	0.49720	0.77	4.86	0.188	0.15114	.	0.753102	0.12288	N	0.482225	T	0.31702	0.0805	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.23084	-1.0198	10	0.17369	T	0.5	.	2.4586	0.04536	0.1282:0.3818:0.1312:0.3587	.	146	P54296	MYOM2_HUMAN	V	146	ENSP00000262113:F146V	ENSP00000262113:F146V	F	+	1	0	MYOM2	1993181	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.032000	0.13732	-0.065000	0.13021	0.459000	0.35465	TTT		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		Missense_Mutation
CNBD1	168975	broad.mit.edu	37	8	87899829	87899829	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr8:87899829G>C	ENST00000518476.1	+	2	199	c.148G>C	c.(148-150)Gga>Cga	p.G50R		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	50								p.G50R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						CCACATTAGAGGACAACACAG	0.289																																																1	Substitution - Missense(1)	ovary(1)	8											65.0	61.0	62.0					8																	87899829		1844	4087	5931	87968945	SO:0001583	missense	168975			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.148G>C	8.37:g.87899829G>C	ENSP00000430073:p.Gly50Arg	Unknown		x	x	x	87968945		Missense_Mutation	SNP	ENST00000518476.1	37	CCDS55259.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011782	0.35511	.	.	ENSG00000176571	ENST00000518476	T	0.58210	0.35	4.57	3.69	0.42338	.	0.390475	0.19758	N	0.106730	T	0.61627	0.2362	L	0.56769	1.78	0.22581	N	0.998969	D	0.63880	0.993	P	0.59546	0.859	T	0.53158	-0.8478	10	0.72032	D	0.01	.	9.0479	0.36358	0.1057:0.0:0.8943:0.0	.	50	Q8NA66	CNBD1_HUMAN	R	50	ENSP00000430073:G50R	ENSP00000430073:G50R	G	+	1	0	CNBD1	87968945	0.126000	0.22350	0.867000	0.34043	0.921000	0.55340	1.223000	0.32527	1.214000	0.43395	0.563000	0.77884	GGA		0.289	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538		Missense_Mutation
TLE1	7088	broad.mit.edu	37	9	84200491	84200491	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chr9:84200491A>T	ENST00000376499.3	-	18	3121	c.2057T>A	c.(2056-2058)gTg>gAg	p.V686E		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	686					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)	p.V686E(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						AGGCTTGTTCACGTGCAGCAC	0.572																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)											1	Substitution - Missense(1)	ovary(1)	9											103.0	76.0	85.0					9																	84200491		2203	4300	6503	83390311	SO:0001583	missense	7088				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.2057T>A	9.37:g.84200491A>T	ENSP00000365682:p.Val686Glu	Unknown		x	x	x	83390311	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	a	15.39	2.818798	0.50633	.	.	ENSG00000196781	ENST00000376499	T	0.12465	2.68	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.11495	0.0280	N	0.22421	0.69	0.80722	D	1	B;B	0.14012	0.009;0.007	B;B	0.13407	0.004;0.009	T	0.08046	-1.0741	10	0.39692	T	0.17	-16.7534	15.6027	0.76636	1.0:0.0:0.0:0.0	.	671;686	B4DEF9;Q04724	.;TLE1_HUMAN	E	686	ENSP00000365682:V686E	ENSP00000365682:V686E	V	-	2	0	TLE1	83390311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.073000	0.57570	2.085000	0.62840	0.533000	0.62120	GTG		0.572	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077		Missense_Mutation
ACE2	59272	broad.mit.edu	37	X	15593882	15593882	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1564-01	TCGA-24-1564-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chrX:15593882A>G	ENST00000252519.3	-	10	1451	c.1349T>C	c.(1348-1350)cTg>cCg	p.L450P	ACE2_ENST00000427411.1_Missense_Mutation_p.L450P			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	450					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.L450P(1)		endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	AGTAAATGGCAGAGTCCCAAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	X											166.0	138.0	148.0					X																	15593882		2203	4300	6503	15503803	SO:0001583	missense	59272			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.1349T>C	X.37:g.15593882A>G	ENSP00000252519:p.Leu450Pro	Unknown		x	x	x	15503803	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	37	CCDS14169.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	21.1	4.098694	0.76870	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	T;T	0.41400	1.0;1.0	5.83	5.83	0.93111	.	0.158989	0.45606	D	0.000342	T	0.77164	0.4090	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85714	0.1321	10	0.87932	D	0	-12.7199	15.1031	0.72299	1.0:0.0:0.0:0.0	.	450	Q9BYF1	ACE2_HUMAN	P	450	ENSP00000252519:L450P;ENSP00000389326:L450P	ENSP00000252519:L450P	L	-	2	0	ACE2	15503803	1.000000	0.71417	0.530000	0.27963	0.886000	0.51366	9.339000	0.96797	1.949000	0.56562	0.486000	0.48141	CTG		0.393	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			Missense_Mutation
HEPH	9843	broad.mit.edu	37	X	65390482	65390482	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1564-01	TCGA-24-1564-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chrX:65390482G>T	ENST00000343002.2	+	1	734	c.70G>T	c.(70-72)Gcc>Tcc	p.A24S	HEPH_ENST00000419594.1_Missense_Mutation_p.A27S|HEPH_ENST00000336279.5_Intron|HEPH_ENST00000519389.1_Missense_Mutation_p.A78S|HEPH_ENST00000374727.3_Missense_Mutation_p.A27S|HEPH_ENST00000441993.2_Missense_Mutation_p.A27S			Q9BQS7	HEPH_HUMAN	hephaestin	24	Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.A24S(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GACTGATGGAGCCACTCGAGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											84.0	60.0	68.0					X																	65390482		2203	4300	6503	65307207	SO:0001583	missense	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.70G>T	X.37:g.65390482G>T	ENSP00000343939:p.Ala24Ser	Somatic		x	x	x	65307207	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	7.726	0.698137	0.15106	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000458621;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.98926	-5.24;-5.24;-5.24;-5.24;-5.24;-5.24;-5.24	5.01	3.25	0.37280	Cupredoxin (2);	0.402799	0.24258	N	0.040115	D	0.95341	0.8488	L	0.38838	1.175	0.09310	N	0.999997	B;B;B	0.26935	0.003;0.164;0.003	B;B;B	0.19946	0.007;0.027;0.007	D	0.88022	0.2769	10	0.19590	T	0.45	.	8.3703	0.32410	0.1723:0.0:0.8277:0.0	.	78;27;24	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	S	78;27;24;27;27;24;24	ENSP00000430620:A78S;ENSP00000363859:A27S;ENSP00000396907:A24S;ENSP00000411687:A27S;ENSP00000413211:A27S;ENSP00000343939:A24S;ENSP00000398078:A24S	ENSP00000343939:A24S	A	+	1	0	HEPH	65307207	0.977000	0.34250	0.303000	0.25071	0.490000	0.33462	1.283000	0.33237	0.526000	0.28541	-0.503000	0.04515	GCC		0.537	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		Missense_Mutation
KIAA1210	57481	broad.mit.edu	37	X	118250616	118250616	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1564-01	TCGA-24-1564-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-24-1564-01	TCGA-24-1564-10	g.chrX:118250616A>C	ENST00000402510.2	-	4	492	c.493T>G	c.(493-495)Tgc>Ggc	p.C165G		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	165								p.C25G(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TTAAATTTGCATTTCTTCTTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	X											77.0	63.0	67.0					X																	118250616		1854	4075	5929	118134644	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.493T>G	X.37:g.118250616A>C	ENSP00000384670:p.Cys165Gly	Somatic		x	x	x	118134644	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	2.480	-0.319990	0.05386	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.10005	2.92	5.14	5.14	0.70334	.	.	.	.	.	T	0.06872	0.0175	N	0.08118	0	0.26408	N	0.97632	B	0.09022	0.002	B	0.11329	0.006	T	0.23013	-1.0200	9	0.87932	D	0	.	10.561	0.45146	1.0:0.0:0.0:0.0	.	165	Q9ULL0	K1210_HUMAN	G	165;1	ENSP00000384670:C165G	ENSP00000396164:C1G	C	-	1	0	RP13-347D8.5;RP13-347D8.6	118134644	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	4.815000	0.62634	1.832000	0.53329	0.486000	0.48141	TGC		0.413	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		Missense_Mutation
