#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACE	1636	hgsc.bcm.edu	37	17	61560856	61560856	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr17:61560856G>A	ENST00000290866.4	+	10	1547	c.1523G>A	c.(1522-1524)cGa>cAa	p.R508Q	ACE_ENST00000413513.3_5'Flank|ACE_ENST00000428043.1_Missense_Mutation_p.R508Q|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000490216.2_5'Flank|ACE_ENST00000538928.1_Missense_Mutation_p.E460K|ACE_ENST00000421982.2_5'Flank|ACE_ENST00000577647.1_5'Flank|ACE_ENST00000584529.1_3'UTR	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	508	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.R508Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CCTGTTACCCGAAACGAAACC	0.468																																																1	Substitution - Missense(1)	ovary(1)	17											137.0	127.0	130.0					17																	61560856		2203	4300	6503	58914588	SO:0001583	missense	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1523G>A	17.37:g.61560856G>A	ENSP00000290866:p.Arg508Gln	Somatic		Capture	SOLID	Phase_IV	58914588	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	SNP	37	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.7|25.7	4.660426|4.660426	0.88154|0.88154	.|.	.|.	ENSG00000159640|ENSG00000159640	ENST00000538928|ENST00000290866;ENST00000428043	T|T;T	0.32272|0.47528	1.46|0.84;0.84	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80623|0.80623	0.4658|0.4658	H|H	0.97291|0.97291	3.975|3.975	0.80722|0.80722	D|D	1|1	P|D;D	0.44946|0.89917	0.846|1.0;1.0	B|D;D	0.39738|0.91635	0.308|0.999;0.999	D|D	0.87947|0.87947	0.2721|0.2721	9|10	0.87932|0.87932	D|D	0|0	-10.8505|-10.8505	18.2715|18.2715	0.90070|0.90070	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	460|508;508	F5H1K1|P12821-2;P12821	.|.;ACE_HUMAN	K|Q	460|508	ENSP00000439591:E460K|ENSP00000290866:R508Q;ENSP00000397593:R508Q	ENSP00000439591:E460K|ENSP00000290866:R508Q	E|R	+|+	1|2	0|0	ACE|ACE	58914588|58914588	1.000000|1.000000	0.71417|0.71417	0.364000|0.364000	0.25888|0.25888	0.535000|0.535000	0.34838|0.34838	8.719000|8.719000	0.91436|0.91436	2.541000|2.541000	0.85698|0.85698	0.455000|0.455000	0.32223|0.32223	GAA|CGA		0.468	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			Missense_Mutation
ADRBK2	157	hgsc.bcm.edu	37	22	26118326	26118326	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr22:26118326G>C	ENST00000324198.6	+	21	2168	c.1976G>C	c.(1975-1977)cGt>cCt	p.R659P		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	659					receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)	p.R659P(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	CGGCTATTGCGTCGTGCCCCG	0.542																																																1	Substitution - Missense(1)	ovary(1)	22											109.0	103.0	105.0					22																	26118326		2203	4300	6503	24448326	SO:0001583	missense	157			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.1976G>C	22.37:g.26118326G>C	ENSP00000317578:p.Arg659Pro	Somatic		Capture	SOLID	Phase_IV	24448326	Q9UGW9	Missense_Mutation	SNP	ENST00000324198.6	37	CCDS13832.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825113	0.50739	.	.	ENSG00000100077	ENST00000324198	T	0.58506	0.33	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	N	0.08118	0	0.80722	D	1	P	0.43885	0.82	P	0.45449	0.481	T	0.51036	-0.8756	10	0.40728	T	0.16	-14.5486	18.1943	0.89815	0.0:0.0:1.0:0.0	.	659	P35626	ARBK2_HUMAN	P	659	ENSP00000317578:R659P	ENSP00000317578:R659P	R	+	2	0	ADRBK2	24448326	1.000000	0.71417	0.060000	0.19600	0.001000	0.01503	6.977000	0.76141	2.536000	0.85505	0.650000	0.86243	CGT		0.542	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317296.4	NM_005160		Missense_Mutation
ALOX5	240	hgsc.bcm.edu	37	10	45891366	45891366	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr10:45891366C>G	ENST00000374391.2	+	3	466	c.413C>G	c.(412-414)aCa>aGa	p.T138R	ALOX5_ENST00000542434.1_Missense_Mutation_p.T138R	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	138	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)	p.T138R(1)		breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GAACTGGAAACACGGCAAAAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	10											147.0	122.0	131.0					10																	45891366		2203	4300	6503	45211372	SO:0001583	missense	240			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.413C>G	10.37:g.45891366C>G	ENSP00000363512:p.Thr138Arg	Somatic		Capture	SOLID	Phase_IV	45211372	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.74	2.027825	0.35797	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.89681	-2.55;-2.55	5.96	4.01	0.46588	Lipoxygenase, C-terminal (2);	0.667656	0.15923	N	0.238040	T	0.76126	0.3944	N	0.20685	0.6	0.28583	N	0.910017	B;B;B	0.32040	0.353;0.004;0.056	B;B;B	0.20184	0.028;0.009;0.009	T	0.66578	-0.5888	10	0.25751	T	0.34	-1.6084	6.9033	0.24295	0.1726:0.7411:0.0:0.0863	.	138;138;138	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	R	138	ENSP00000437634:T138R;ENSP00000363512:T138R	ENSP00000363512:T138R	T	+	2	0	ALOX5	45211372	0.372000	0.25064	0.996000	0.52242	0.998000	0.95712	1.604000	0.36804	1.527000	0.49086	0.655000	0.94253	ACA		0.448	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1			Missense_Mutation
APOL3	80833	hgsc.bcm.edu	37	22	36556809	36556809	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr22:36556809G>T	ENST00000349314.2	-	1	168	c.131C>A	c.(130-132)tCt>tAt	p.S44Y	APOL3_ENST00000424878.2_De_novo_Start_OutOfFrame|APOL3_ENST00000397293.2_De_novo_Start_InFrame|APOL3_ENST00000397287.2_De_novo_Start_OutOfFrame|APOL3_ENST00000361710.2_De_novo_Start_OutOfFrame	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	44					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)	p.S44Y(1)		endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						ATAATAACCAGACACGTTCTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	22											145.0	120.0	129.0					22																	36556809		2203	4300	6503	34886755	SO:0001583	missense	80833			AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.131C>A	22.37:g.36556809G>T	ENSP00000344577:p.Ser44Tyr	Somatic		Capture	SOLID	Phase_IV	34886755	B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Missense_Mutation	SNP	ENST00000349314.2	37	CCDS13922.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.186	0.794931	0.16327	.	.	ENSG00000128284	ENST00000349314;ENST00000531095	T;T	0.62639	3.54;0.01	2.76	-2.17	0.07059	.	3.302060	0.02038	N	0.049086	T	0.38453	0.1041	N	0.08118	0	0.19575	N	0.999966	P	0.50528	0.936	B	0.39590	0.304	T	0.39418	-0.9615	10	0.87932	D	0	.	4.1285	0.10138	0.258:0.4083:0.3336:0.0	.	44	O95236	APOL3_HUMAN	Y	44;8	ENSP00000344577:S44Y;ENSP00000432271:S8Y	ENSP00000344577:S44Y	S	-	2	0	APOL3	34886755	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.042000	0.13949	-0.357000	0.08175	-0.199000	0.12753	TCT		0.483	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319268.1	NM_145641		Missense_Mutation
ARMC5	79798	hgsc.bcm.edu	37	16	31473965	31473965	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr16:31473965G>T	ENST00000563544.1	+	4	1643	c.1097G>T	c.(1096-1098)cGg>cTg	p.R366L	ARMC5_ENST00000412665.2_Intron|ARMC5_ENST00000538189.1_Missense_Mutation_p.R398L|RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000268314.4_Missense_Mutation_p.R366L|ARMC5_ENST00000457010.2_Missense_Mutation_p.R366L|ARMC5_ENST00000408912.3_Missense_Mutation_p.R461L			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	366										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GCCCGACTGCGGGATGCTGGT	0.637																																																0			16											46.0	52.0	50.0					16																	31473965		2006	4170	6176	31381466	SO:0001583	missense	79798			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1097G>T	16.37:g.31473965G>T	ENSP00000456877:p.Arg366Leu	Somatic		Capture	SOLID	Phase_IV	31381466	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	g	18.55	3.647666	0.67358	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.058560	0.64402	D	0.000003	T	0.31979	0.0814	L	0.50333	1.59	0.80722	D	1	P;P;P;D	0.71674	0.792;0.884;0.792;0.998	B;B;B;D	0.65987	0.361;0.361;0.361;0.94	T	0.06499	-1.0823	10	0.11794	T	0.64	-13.8939	9.507	0.39053	0.097:0.0:0.903:0.0	.	398;461;366;366	F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;ARMC5_HUMAN;.	L	461;398;366;366	ENSP00000386125:R461L;ENSP00000443995:R398L;ENSP00000268314:R366L;ENSP00000399561:R366L	ENSP00000268314:R366L	R	+	2	0	ARMC5	31381466	1.000000	0.71417	0.998000	0.56505	0.809000	0.45718	2.988000	0.49386	2.335000	0.79485	0.457000	0.33378	CGG		0.637	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742		Missense_Mutation
ARMC9	80210	hgsc.bcm.edu	37	2	232081351	232081351	+	Splice_Site	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr2:232081351G>A	ENST00000349938.4	+	5	543	c.349G>A	c.(349-351)Gac>Aac	p.D117N	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	117						extracellular vesicular exosome (GO:0070062)		p.D117N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CTTCTTCTAGGACAAAGAGGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											164.0	156.0	159.0					2																	232081351		2203	4300	6503	231789595	SO:0001630	splice_region_variant	80210			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.349-1G>A	2.37:g.232081351G>A		Somatic		Capture	SOLID	Phase_IV	231789595	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019664	0.75275	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000440107	T;T	0.48201	2.04;0.82	5.5	5.5	0.81552	.	0.094077	0.64402	D	0.000001	T	0.48295	0.1492	M	0.63843	1.955	0.58432	D	0.999994	B	0.29432	0.244	B	0.36335	0.222	T	0.41662	-0.9496	9	.	.	.	-32.6324	11.9644	0.53027	0.0797:0.0:0.9203:0.0	.	117	Q7Z3E5	ARMC9_HUMAN	N	117	ENSP00000258417:D117N;ENSP00000387391:D117N	.	D	+	1	0	ARMC9	231789595	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.259000	0.65485	2.573000	0.86826	0.655000	0.94253	GAC		0.493	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	Missense_Mutation	Missense_Mutation
BCCIP	56647	hgsc.bcm.edu	37	10	127520025	127520025	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr10:127520025C>G	ENST00000278100.6	+	5	460	c.448C>G	c.(448-450)Cta>Gta	p.L150V	BCCIP_ENST00000478798.1_3'UTR|BCCIP_ENST00000429863.2_Missense_Mutation_p.L120V|BCCIP_ENST00000368759.5_Missense_Mutation_p.L150V|BCCIP_ENST00000299130.3_Missense_Mutation_p.L150V	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	150	Interaction with BRCA2.				cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)	p.L150V(1)		breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AGAGTTGGTTCTACGCTTCTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	10											131.0	122.0	125.0					10																	127520025		2203	4300	6503	127510015	SO:0001583	missense	56647			AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.448C>G	10.37:g.127520025C>G	ENSP00000278100:p.Leu150Val	Somatic		Capture	SOLID	Phase_IV	127510015	B3KP45|Q8ND15|Q96GC4|Q9P288	Missense_Mutation	SNP	ENST00000278100.6	37	CCDS7651.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.21	2.170504	0.38315	.	.	ENSG00000107949	ENST00000278100;ENST00000299130;ENST00000368759;ENST00000429863;ENST00000392718	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.24	4.34	0.51931	.	0.073499	0.56097	D	0.000032	T	0.46737	0.1408	L	0.58101	1.795	0.58432	D	0.999994	P;P;P;P;P	0.43607	0.793;0.752;0.708;0.812;0.65	P;B;B;B;P	0.46452	0.517;0.336;0.269;0.355;0.487	T	0.33777	-0.9855	10	0.22109	T	0.4	-28.3452	8.6829	0.34221	0.0:0.772:0.0:0.228	.	120;150;150;150;150	B4E318;B4DUS0;Q9P287-2;Q9P287-4;Q9P287	.;.;.;.;BCCIP_HUMAN	V	150;150;150;120;150	ENSP00000278100:L150V;ENSP00000299130:L150V;ENSP00000357748:L150V;ENSP00000394758:L120V	ENSP00000278100:L150V	L	+	1	2	BCCIP	127510015	0.110000	0.22057	0.949000	0.38748	0.424000	0.31475	0.537000	0.23144	1.210000	0.43336	0.650000	0.86243	CTA		0.428	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1			Missense_Mutation
BMP2	650	hgsc.bcm.edu	37	20	6758978	6758978	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr20:6758978A>C	ENST00000378827.4	+	3	1652	c.433A>C	c.(433-435)Atc>Ctc	p.I145L		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	145					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)	p.I145L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						GGAGGAGTTTATCACCTCAGC	0.378																																																1	Substitution - Missense(1)	ovary(1)	20											56.0	59.0	58.0					20																	6758978		2203	4300	6503	6706978	SO:0001583	missense	650				CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.433A>C	20.37:g.6758978A>C	ENSP00000368104:p.Ile145Leu	Somatic		Capture	SOLID	Phase_IV	6706978		Missense_Mutation	SNP	ENST00000378827.4	37	CCDS13099.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	7.990	0.753148	0.15778	.	.	ENSG00000125845	ENST00000378827	T	0.61742	0.08	5.86	1.04	0.20106	Transforming growth factor-beta, N-terminal (1);	0.269566	0.45126	N	0.000394	T	0.34454	0.0898	N	0.17922	0.545	0.25316	N	0.989154	B	0.02656	0.0	B	0.10450	0.005	T	0.20638	-1.0269	10	0.12103	T	0.63	.	8.107	0.30892	0.5943:0.1049:0.3008:0.0	.	145	P12643	BMP2_HUMAN	L	145	ENSP00000368104:I145L	ENSP00000368104:I145L	I	+	1	0	BMP2	6706978	0.993000	0.37304	0.923000	0.36655	0.905000	0.53344	0.596000	0.24044	-0.261000	0.09405	-1.162000	0.01777	ATC		0.378	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3			Missense_Mutation
CAMKV	79012	hgsc.bcm.edu	37	3	49899765	49899765	+	Silent	SNP	C	C	T	rs202049256		TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:49899765C>T	ENST00000477224.1	-	2	535	c.57G>A	c.(55-57)gaG>gaA	p.E19E	CAMKV_ENST00000463537.1_Silent_p.E19E|CAMKV_ENST00000498324.1_5'UTR|CAMKV_ENST00000466940.1_Silent_p.E19E|CAMKV_ENST00000467248.1_De_novo_Start_OutOfFrame|RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000488336.1_Silent_p.E19E|CAMKV_ENST00000296471.7_Silent_p.E19E			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	19						cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.E19E(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGTCAGTCACCTCCGATGGCT	0.582													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20409	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3											144.0	125.0	132.0					3																	49899765		2203	4300	6503	49874769	SO:0001819	synonymous_variant	79012			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.57G>A	3.37:g.49899765C>T		Somatic		Capture	SOLID	Phase_IV	49874769	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Silent	SNP	ENST00000477224.1	37	CCDS33762.1	SNP	24	Baylor																																																																																				0.582	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046		Silent
CCAR1	55749	hgsc.bcm.edu	37	10	70502274	70502274	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr10:70502274A>G	ENST00000265872.6	+	6	585	c.466A>G	c.(466-468)Aaa>Gaa	p.K156E	CCAR1_ENST00000543719.1_Missense_Mutation_p.K141E|CCAR1_ENST00000535016.1_Missense_Mutation_p.K141E	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	156					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.K156E(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						GGTGGTTACAAAACTACATGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	10											249.0	231.0	237.0					10																	70502274		2203	4300	6503	70172280	SO:0001583	missense	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.466A>G	10.37:g.70502274A>G	ENSP00000265872:p.Lys156Glu	Somatic		Capture	SOLID	Phase_IV	70172280	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.3	4.516603	0.85495	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000538031;ENST00000543719;ENST00000539539;ENST00000543225	T;T;T;T;T	0.39787	1.6;1.06;1.06;1.11;1.42	5.82	5.82	0.92795	Nucleic acid-binding, OB-fold-like (1);	0.054856	0.64402	D	0.000001	T	0.63803	0.2542	M	0.65498	2.005	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.998	D;D;D	0.81914	0.987;0.995;0.991	T	0.66618	-0.5878	10	0.72032	D	0.01	-18.0229	16.19	0.81981	1.0:0.0:0.0:0.0	.	141;156;130	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	E	156;141;156;141;141;130	ENSP00000265872:K156E;ENSP00000441820:K141E;ENSP00000445254:K141E;ENSP00000439252:K141E;ENSP00000438610:K130E	ENSP00000265872:K156E	K	+	1	0	CCAR1	70172280	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.255000	0.95524	2.225000	0.72522	0.460000	0.39030	AAA		0.418	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237		Missense_Mutation
CCNL2	81669	hgsc.bcm.edu	37	1	1322691	1322691	+	Silent	SNP	G	G	T			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:1322691G>T	ENST00000400809.3	-	11	1488	c.1483C>A	c.(1483-1485)Cga>Aga	p.R495R	CCNL2_ENST00000408952.5_Silent_p.R273R|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	495					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R495R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		GAGCGCTCTCGTCGCTGATCT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	1											151.0	159.0	156.0					1																	1322691		2203	4296	6499	1312554	SO:0001819	synonymous_variant	81669			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.1483C>A	1.37:g.1322691G>T		Somatic		Capture	SOLID	Phase_IV	1312554	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	ENST00000400809.3	37	CCDS30557.1	SNP	40	Baylor																																																																																				0.592	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937		Silent
CELA3B	23436	hgsc.bcm.edu	37	1	22313137	22313137	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:22313137G>A	ENST00000337107.6	+	7	775	c.756G>A	c.(754-756)gtG>gtA	p.V252V	RN7SL386P_ENST00000485776.2_RNA|CELA3B_ENST00000473526.1_3'UTR|RNU6-1022P_ENST00000365049.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	252	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.V252V(1)		breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						AGCCCACGGTGTTCACTCGAG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											63.0	55.0	58.0					1																	22313137		2203	4300	6503	22185724	SO:0001819	synonymous_variant	23436			M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.756G>A	1.37:g.22313137G>A		Somatic		Capture	SOLID	Phase_IV	22185724	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	ENST00000337107.6	37	CCDS219.1	SNP	48	Baylor																																																																																				0.617	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352		Silent
CENPF	1063	hgsc.bcm.edu	37	1	214818878	214818878	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:214818878C>G	ENST00000366955.3	+	13	6133	c.5965C>G	c.(5965-5967)Caa>Gaa	p.Q1989E		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2085					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.Q1989E(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGAGAAAACACAAGAGCTTGA	0.443																																					Colon(80;575 1284 11000 14801 43496)											1	Substitution - Missense(1)	ovary(1)	1											72.0	75.0	74.0					1																	214818878		2203	4300	6503	212885501	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5965C>G	1.37:g.214818878C>G	ENSP00000355922:p.Gln1989Glu	Somatic		Capture	SOLID	Phase_IV	212885501	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.483465	0.00163	.	.	ENSG00000117724	ENST00000366955	T	0.38722	1.12	5.46	2.01	0.26516	.	0.966526	0.08422	N	0.948212	T	0.19604	0.0471	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21895	-1.0232	10	0.07482	T	0.82	.	7.5445	0.27759	0.2942:0.3566:0.3492:0.0	.	2085	P49454	CENPF_HUMAN	E	1989	ENSP00000355922:Q1989E	ENSP00000355922:Q1989E	Q	+	1	0	CENPF	212885501	0.026000	0.19158	0.016000	0.15963	0.165000	0.22458	0.196000	0.17176	1.262000	0.44165	0.609000	0.83330	CAA		0.443	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		Missense_Mutation
CHAD	1101	hgsc.bcm.edu	37	17	48545482	48545482	+	Silent	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr17:48545482C>G	ENST00000508540.1	-	1	845	c.693G>C	c.(691-693)ctG>ctC	p.L231L	ACSF2_ENST00000300441.4_Intron|CHAD_ENST00000258969.4_Silent_p.L231L|ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000427954.2_Intron|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000502667.1_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	231					bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)		p.L231L(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GGATGCTTTTCAGGGGGTTGT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	17											120.0	111.0	114.0					17																	48545482		2203	4300	6503	45900481	SO:0001819	synonymous_variant	1101			U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.693G>C	17.37:g.48545482C>G		Somatic		Capture	SOLID	Phase_IV	45900481	A8K812|Q6GTU0|Q96RJ5	Silent	SNP	ENST00000508540.1	37	CCDS11568.1	SNP	29	Baylor																																																																																				0.592	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267		Silent
COL9A2	1298	hgsc.bcm.edu	37	1	40771848	40771848	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:40771848G>A	ENST00000372748.3	-	20	1116	c.1020C>T	c.(1018-1020)ggC>ggT	p.G340G	COL9A2_ENST00000466267.1_5'Flank	NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	340	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.G340G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TCCCAGGCTGGCCTGGCACAC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											64.0	59.0	60.0					1																	40771848		2203	4300	6503	40544435	SO:0001819	synonymous_variant	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.1020C>T	1.37:g.40771848G>A		Somatic		Capture	SOLID	Phase_IV	40544435	B2RMP9	Silent	SNP	ENST00000372748.3	37	CCDS450.1	SNP	42	Baylor																																																																																				0.582	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3	NM_001852		Silent
CTR9	9646	hgsc.bcm.edu	37	11	10778347	10778347	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr11:10778347A>G	ENST00000361367.2	+	5	980	c.554A>G	c.(553-555)tAc>tGc	p.Y185C		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	185					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)		p.Y185C(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GCTCTTGCTTACTATAAGAAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	11											111.0	121.0	118.0					11																	10778347		2201	4294	6495	10734923	SO:0001583	missense	9646			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.554A>G	11.37:g.10778347A>G	ENSP00000355013:p.Tyr185Cys	Somatic		Capture	SOLID	Phase_IV	10734923	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	CCDS7805.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.85	2.658487	0.47467	.	.	ENSG00000198730	ENST00000361367;ENST00000524523	T;T	0.77358	-1.09;1.18	5.6	5.6	0.85130	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.113150	0.64402	D	0.000007	T	0.74306	0.3699	L	0.52905	1.665	0.80722	D	1	B	0.15930	0.015	B	0.21546	0.035	T	0.69789	-0.5050	10	0.36615	T	0.2	-13.1844	14.3561	0.66738	1.0:0.0:0.0:0.0	.	185	Q6PD62	CTR9_HUMAN	C	185;172	ENSP00000355013:Y185C;ENSP00000431458:Y172C	ENSP00000355013:Y185C	Y	+	2	0	CTR9	10734923	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.311000	0.96282	2.136000	0.66102	0.383000	0.25322	TAC		0.348	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633		Missense_Mutation
CYP7B1	9420	hgsc.bcm.edu	37	8	65528284	65528284	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr8:65528284C>T	ENST00000310193.3	-	3	987	c.814G>A	c.(814-816)Gag>Aag	p.E272K	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	272					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.E272K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TAATATTTCTCCAGGACATCT	0.353																																																1	Substitution - Missense(1)	ovary(1)	8											186.0	186.0	186.0					8																	65528284		2203	4299	6502	65690838	SO:0001583	missense	9420			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.814G>A	8.37:g.65528284C>T	ENSP00000310721:p.Glu272Lys	Somatic		Capture	SOLID	Phase_IV	65690838	B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	37	CCDS6180.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851398	0.32699	.	.	ENSG00000172817	ENST00000310193	D	0.85258	-1.96	5.52	4.63	0.57726	.	0.137584	0.64402	N	0.000004	T	0.80939	0.4720	L	0.42245	1.32	0.32465	N	0.5436	P	0.36733	0.567	B	0.37943	0.261	D	0.84020	0.0353	10	0.44086	T	0.13	-17.7455	13.4312	0.61057	0.0:0.9234:0.0:0.0766	.	272	O75881	CP7B1_HUMAN	K	272	ENSP00000310721:E272K	ENSP00000310721:E272K	E	-	1	0	CYP7B1	65690838	1.000000	0.71417	0.998000	0.56505	0.305000	0.27757	2.333000	0.43912	1.302000	0.44855	0.561000	0.74099	GAG		0.353	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1			Missense_Mutation
DPY19L3	147991	hgsc.bcm.edu	37	19	32955670	32955670	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr19:32955670C>G	ENST00000342179.5	+	15	1809	c.1594C>G	c.(1594-1596)Ctg>Gtg	p.L532V	DPY19L3_ENST00000392250.2_Missense_Mutation_p.L532V|DPY19L3_ENST00000586987.1_Missense_Mutation_p.L532V|DPY19L3_ENST00000590651.1_3'UTR	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	532						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L532V(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GATATTAATACTGCTGTATCT	0.269																																																1	Substitution - Missense(1)	ovary(1)	19											114.0	107.0	109.0					19																	32955670		2201	4299	6500	37647510	SO:0001583	missense	147991				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1594C>G	19.37:g.32955670C>G	ENSP00000344937:p.Leu532Val	Somatic		Capture	SOLID	Phase_IV	37647510	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.54	2.564575	0.45694	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	T;T	0.58506	0.33;0.33	5.24	5.24	0.73138	.	0.236010	0.37219	N	0.002199	T	0.53077	0.1774	L	0.53249	1.67	0.45733	D	0.998636	B	0.32324	0.364	B	0.32624	0.149	T	0.51903	-0.8646	10	0.32370	T	0.25	-6.9876	14.3099	0.66410	0.0:1.0:0.0:0.0	.	532	Q6ZPD9	D19L3_HUMAN	V	532	ENSP00000376081:L532V;ENSP00000344937:L532V	ENSP00000315672:L532V	L	+	1	2	DPY19L3	37647510	0.990000	0.36364	0.998000	0.56505	0.982000	0.71751	1.329000	0.33770	2.442000	0.82660	0.557000	0.71058	CTG		0.269	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325		Missense_Mutation
DUS2	54920	hgsc.bcm.edu	37	16	68110598	68110599	+	Frame_Shift_Del	DEL	GT	GT	-	rs537723472		TCGA-24-1604-01	TCGA-24-1604-10	GT	GT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr16:68110598_68110599delGT	ENST00000565263.1	+	15	1640_1641	c.1146_1147delGT	c.(1144-1149)aagttgfs	p.KL382fs	DUS2_ENST00000432752.1_Frame_Shift_Del_p.KL347fs|DUS2_ENST00000358896.6_Frame_Shift_Del_p.KL382fs|RP11-67A1.2_ENST00000548144.1_RNA	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	382	DRBM.				negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)	p.K382fs*7(1)									GGAGGGAGAAGTTGGCACAGCC	0.579																																																1	Deletion - Frameshift(1)	ovary(1)	16																																								66668100	SO:0001589	frameshift_variant	54920				CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.1146_1147delGT	16.37:g.68110598_68110599delGT	ENSP00000455229:p.Lys382fs	Somatic		Capture	SOLID	Phase_IV	66668099	A8K3G3|Q4H4D9	Frame_Shift_Del	DEL	ENST00000565263.1	37	CCDS10859.1	DEL	36	Baylor																																																																																				0.579	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268869.2	NM_017803		Frame_Shift_Del
DUS2	54920	hgsc.bcm.edu	37	16	68110602	68110602	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr16:68110602G>T	ENST00000565263.1	+	15	1644	c.1150G>T	c.(1150-1152)Gca>Tca	p.A384S	DUS2_ENST00000432752.1_Missense_Mutation_p.A349S|DUS2_ENST00000358896.6_Missense_Mutation_p.A384S|RP11-67A1.2_ENST00000548144.1_RNA	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	384	DRBM.				negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)										GGAGAAGTTGGCACAGCCTGT	0.582																																																0			16											191.0	144.0	160.0					16																	68110602		2198	4300	6498	66668103	SO:0001583	missense	54920				CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.1150G>T	16.37:g.68110602G>T	ENSP00000455229:p.Ala384Ser	Somatic		Capture	SOLID	Phase_IV	66668103	A8K3G3|Q4H4D9	Missense_Mutation	SNP	ENST00000565263.1	37	CCDS10859.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.123	1.009478	0.19277	.	.	ENSG00000167264	ENST00000358896;ENST00000432752	T;T	0.62639	0.01;0.01	5.42	0.778	0.18543	Double-stranded RNA-binding (2);Double-stranded RNA-binding-like (1);	0.337361	0.30911	N	0.008627	T	0.43942	0.1270	N	0.20881	0.62	0.25679	N	0.985812	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.27606	-1.0069	10	0.26408	T	0.33	-32.6921	12.3779	0.55291	0.0:0.6025:0.2877:0.1098	.	349;384	E7EUN9;Q9NX74	.;DUS2L_HUMAN	S	384;349	ENSP00000351769:A384S;ENSP00000409498:A349S	ENSP00000351769:A384S	A	+	1	0	DUS2L	66668103	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.644000	0.37228	0.303000	0.22785	-0.257000	0.10917	GCA		0.582	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268869.2	NM_017803		Missense_Mutation
ECM1	1893	hgsc.bcm.edu	37	1	150485940	150485940	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:150485940A>C	ENST00000369047.4	+	10	1745	c.1620A>C	c.(1618-1620)gaA>gaC	p.E540D	ECM1_ENST00000369049.4_Missense_Mutation_p.E567D|ECM1_ENST00000346569.6_Missense_Mutation_p.E415D|ECM1_ENST00000470432.1_3'UTR|LINC00568_ENST00000416894.1_lincRNA	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	540					angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCAAGGAAGAATGAGTCACCC	0.562																																					Melanoma(156;1696 2560 11093 19685)											0			1											31.0	34.0	33.0					1																	150485940		2203	4300	6503	148752564	SO:0001583	missense	1893			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.1620A>C	1.37:g.150485940A>C	ENSP00000358043:p.Glu540Asp	Somatic		Capture	SOLID	Phase_IV	148752564	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	ENST00000369047.4	37	CCDS953.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.65	3.668891	0.67814	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	T;T;T	0.80304	-1.36;-1.36;-1.36	4.4	-2.86	0.05717	.	0.132511	0.34046	N	0.004305	T	0.70684	0.3252	M	0.62723	1.935	0.20196	N	0.999928	P;D;P	0.61697	0.849;0.99;0.856	P;P;P	0.53062	0.555;0.717;0.652	T	0.71679	-0.4520	10	0.87932	D	0	.	9.286	0.37758	0.4693:0.0:0.5307:0.0	.	567;415;540	Q16610-4;Q16610-2;Q16610	.;.;ECM1_HUMAN	D	567;540;415	ENSP00000358045:E567D;ENSP00000358043:E540D;ENSP00000271630:E415D	ENSP00000271630:E415D	E	+	3	2	ECM1	148752564	0.975000	0.34042	0.981000	0.43875	0.857000	0.48899	-0.047000	0.11963	-0.596000	0.05821	0.460000	0.39030	GAA		0.562	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425		Missense_Mutation
EML5	161436	hgsc.bcm.edu	37	14	89151472	89151472	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr14:89151472C>A	ENST00000380664.5	-	20	2868	c.2869G>T	c.(2869-2871)Gat>Tat	p.D957Y	EML5_ENST00000352093.5_Missense_Mutation_p.D919Y|EML5_ENST00000554922.1_Missense_Mutation_p.D957Y			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	957						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)	p.D957Y(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GATGGATTATCTTCCAAGAGA	0.328																																																1	Substitution - Missense(1)	ovary(1)	14											116.0	105.0	109.0					14																	89151472		1836	4087	5923	88221225	SO:0001583	missense	161436			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2869G>T	14.37:g.89151472C>A	ENSP00000370039:p.Asp957Tyr	Somatic		Capture	SOLID	Phase_IV	88221225	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212553	0.79240	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.52983	1.58;0.64;0.96	4.96	4.96	0.65561	Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.70795	-0.4775	10	0.44086	T	0.13	-20.7037	17.9806	0.89140	0.0:1.0:0.0:0.0	.	957;957	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	Y	957;919;957	ENSP00000451998:D957Y;ENSP00000298315:D919Y;ENSP00000370039:D957Y	ENSP00000298315:D919Y	D	-	1	0	EML5	88221225	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.288000	0.78691	2.584000	0.87258	0.591000	0.81541	GAT		0.328	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1			Missense_Mutation
FGF6	2251	hgsc.bcm.edu	37	12	4554510	4554510	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr12:4554510C>A	ENST00000228837.2	-	1	270	c.227G>T	c.(226-228)aGt>aTt	p.S76I		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	76					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)	p.S76I(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CAAATAGCCACTTTCCCAGTT	0.657																																																1	Substitution - Missense(1)	ovary(1)	12											94.0	85.0	88.0					12																	4554510		2203	4300	6503	4424771	SO:0001583	missense	2251			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.227G>T	12.37:g.4554510C>A	ENSP00000228837:p.Ser76Ile	Somatic		Capture	SOLID	Phase_IV	4424771	Q0VAE1	Missense_Mutation	SNP	ENST00000228837.2	37	CCDS8527.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135397	0.37728	.	.	ENSG00000111241	ENST00000228837	T	0.75260	-0.92	5.3	2.38	0.29361	.	0.177985	0.64402	D	0.000009	T	0.64843	0.2635	L	0.46157	1.445	0.44825	D	0.997833	P	0.38370	0.628	B	0.41271	0.352	T	0.57057	-0.7876	10	0.30078	T	0.28	.	6.1423	0.20266	0.0:0.4941:0.2504:0.2555	.	76	P10767	FGF6_HUMAN	I	76	ENSP00000228837:S76I	ENSP00000228837:S76I	S	-	2	0	FGF6	4424771	0.902000	0.30710	0.064000	0.19789	0.984000	0.73092	1.256000	0.32921	0.698000	0.31739	0.655000	0.94253	AGT		0.657	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	NM_020996		Missense_Mutation
ARHGEF38	54848	hgsc.bcm.edu	37	4	106473934	106473934	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr4:106473934A>C	ENST00000420470.2	+	1	156	c.12A>C	c.(10-12)aaA>aaC	p.K4N	ARHGEF38_ENST00000265154.2_Missense_Mutation_p.K4N|AC004066.3_ENST00000514879.1_RNA	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	4						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K4N(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						TGGAGCCCAAAGAAGCCACTG	0.478																																																1	Substitution - Missense(1)	ovary(1)	4											70.0	69.0	69.0					4																	106473934		2203	4300	6503	106693383	SO:0001583	missense	54848			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.12A>C	4.37:g.106473934A>C	ENSP00000416125:p.Lys4Asn	Somatic		Capture	SOLID	Phase_IV	106693383	C9JIB4	Missense_Mutation	SNP	ENST00000420470.2	37	CCDS56338.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	4.970	0.180209	0.09443	.	.	ENSG00000236699	ENST00000265154;ENST00000420470	T;T	0.58060	1.72;0.36	5.98	0.727	0.18254	.	0.514231	0.20963	N	0.082534	T	0.41465	0.1160	L	0.51422	1.61	0.25898	N	0.983385	P	0.36282	0.546	B	0.31812	0.136	T	0.33752	-0.9856	10	0.66056	D	0.02	-3.6246	9.7857	0.40675	0.6608:0.0:0.3392:0.0	.	4	Q9NXL2	ARH38_HUMAN	N	4	ENSP00000265154:K4N;ENSP00000416125:K4N	ENSP00000265154:K4N	K	+	3	2	ARHGEF38	106693383	0.988000	0.35896	0.625000	0.29200	0.015000	0.08874	0.204000	0.17335	0.171000	0.19730	-0.296000	0.09543	AAA		0.478	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000336934.3	NM_017700		Missense_Mutation
SIGLECL1	284369	hgsc.bcm.edu	37	19	51768858	51768858	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr19:51768858A>T	ENST00000316401.7	+	3	640	c.259A>T	c.(259-261)Aag>Tag	p.K87*	CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000593968.1_Intron|SIGLECL1_ENST00000597824.1_Intron	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	449	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.K87*(1)									CTGTGAGGGGAAGAACCAAAA	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	19											95.0	91.0	92.0					19																	51768858		2203	4300	6503	56460670	SO:0001587	stop_gained	284369			AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.259A>T	19.37:g.51768858A>T	ENSP00000321249:p.Lys87*	Somatic		Capture	SOLID	Phase_IV	56460670	Q8IYH7	Nonsense_Mutation	SNP	ENST00000316401.7	37	CCDS12827.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	31	5.064183	0.93898	.	.	ENSG00000179213	ENST00000316401	.	.	.	3.83	3.83	0.44106	.	0.000000	0.40064	N	0.001189	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1757	0.37109	1.0:0.0:0.0:0.0	.	.	.	.	X	87	.	ENSP00000321249:K87X	K	+	1	0	C19orf75	56460670	0.740000	0.28207	0.856000	0.33681	0.098000	0.18820	2.224000	0.42945	1.721000	0.51461	0.455000	0.32223	AAG		0.552	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635		Nonsense_Mutation
GALNT1	2589	hgsc.bcm.edu	37	18	33267020	33267020	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr18:33267020G>A	ENST00000269195.5	+	5	833	c.730G>A	c.(730-732)Gat>Aat	p.D244N	GALNT1_ENST00000537549.1_Missense_Mutation_p.D184N	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	244					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D244N(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						GATCAGTGATGATACTTTTGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	18											220.0	186.0	198.0					18																	33267020		2203	4300	6503	31521018	SO:0001583	missense	2589				CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.730G>A	18.37:g.33267020G>A	ENSP00000269195:p.Asp244Asn	Somatic		Capture	SOLID	Phase_IV	31521018	Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	CCDS11915.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861785	0.71949	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.60171	0.21;0.21	5.5	5.5	0.81552	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.52191	0.1719	L	0.42529	1.33	0.80722	D	1	B	0.17268	0.021	B	0.23716	0.048	T	0.43782	-0.9370	10	0.25751	T	0.34	.	16.8858	0.86075	0.0:0.0:1.0:0.0	.	244	Q10472	GALT1_HUMAN	N	244;244;184	ENSP00000269195:D244N;ENSP00000440910:D184N	ENSP00000269195:D244N	D	+	1	0	GALNT1	31521018	1.000000	0.71417	0.997000	0.53966	0.929000	0.56500	9.869000	0.99810	2.595000	0.87683	0.585000	0.79938	GAT		0.418	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474		Missense_Mutation
GOLGB1	2804	hgsc.bcm.edu	37	3	121415640	121415640	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:121415640G>C	ENST00000340645.5	-	13	3840	c.3715C>G	c.(3715-3717)Caa>Gaa	p.Q1239E	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Q1244E	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1239					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q1239E(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCCCTTACTTGAATCTGGAGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											192.0	177.0	182.0					3																	121415640		2203	4300	6503	122898330	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3715C>G	3.37:g.121415640G>C	ENSP00000341848:p.Gln1239Glu	Somatic		Capture	SOLID	Phase_IV	122898330	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.846	0.722868	0.15439	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.21031	2.62;2.62;2.03	5.98	5.98	0.97165	.	0.220652	0.32134	N	0.006531	T	0.20251	0.0487	L	0.52364	1.645	0.25930	N	0.983008	B;P;B;P;B	0.36837	0.004;0.571;0.004;0.571;0.002	B;B;B;B;B	0.36608	0.006;0.229;0.006;0.229;0.004	T	0.38222	-0.9671	10	0.05351	T	0.99	.	17.9385	0.89020	0.0:0.0:1.0:0.0	.	1164;1203;1244;1244;1239	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	E	1239;1244;1203	ENSP00000341848:Q1239E;ENSP00000377275:Q1244E;ENSP00000418231:Q1203E	ENSP00000341848:Q1239E	Q	-	1	0	GOLGB1	122898330	0.292000	0.24362	0.997000	0.53966	0.714000	0.41099	1.177000	0.31969	2.834000	0.97654	0.655000	0.94253	CAA		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		Missense_Mutation
HEG1	57493	hgsc.bcm.edu	37	3	124748076	124748076	+	Silent	SNP	C	C	T			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:124748076C>T	ENST00000311127.4	-	2	640	c.573G>A	c.(571-573)gaG>gaA	p.E191E		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	191					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.E191E(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						CTGTTGCTATCTCCAGTGAGT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	3											69.0	72.0	71.0					3																	124748076		2013	4204	6217	126230766	SO:0001819	synonymous_variant	57493			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.573G>A	3.37:g.124748076C>T		Somatic		Capture	SOLID	Phase_IV	126230766	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	ENST00000311127.4	37	CCDS46898.1	SNP	32	Baylor																																																																																				0.478	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386		Silent
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156999	26156999	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr6:26156999G>A	ENST00000304218.3	+	1	441	c.381G>A	c.(379-381)aaG>aaA	p.K127K	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	127					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCGCGGCCAAGGCCAAGAAGC	0.627																																																0			6											16.0	23.0	21.0					6																	26156999		2202	4298	6500	26264978	SO:0001819	synonymous_variant	3008			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.381G>A	6.37:g.26156999G>A		Somatic		Capture	SOLID	Phase_IV	26264978	Q4VB25	Silent	SNP	ENST00000304218.3	37	CCDS4586.1	SNP	35	Baylor																																																																																				0.627	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321		Silent
HIST1H3H	8357	hgsc.bcm.edu	37	6	27778121	27778121	+	Silent	SNP	G	G	T			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr6:27778121G>T	ENST00000369163.2	+	1	280	c.270G>T	c.(268-270)gtG>gtT	p.V90V	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	90					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.V90V(1)		haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						GCTCCGCGGTGATGGCGCTGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	6											69.0	63.0	65.0					6																	27778121		2203	4300	6503	27886100	SO:0001819	synonymous_variant	8357			Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.270G>T	6.37:g.27778121G>T		Somatic		Capture	SOLID	Phase_IV	27886100	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000369163.2	37	CCDS4627.1	SNP	45	Baylor																																																																																				0.607	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040151.1	NM_003536		Silent
IARS2	55699	hgsc.bcm.edu	37	1	220311336	220311336	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1604-01	TCGA-24-1604-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:220311336T>A	ENST00000302637.5	+	17	2230	c.2126T>A	c.(2125-2127)gTt>gAt	p.V709D	snoU13_ENST00000459443.1_RNA|IARS2_ENST00000366922.1_Missense_Mutation_p.V637D	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	709					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.V709D(1)		NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTCACCGAAGTTGCAATTGGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											151.0	134.0	140.0					1																	220311336		2203	4300	6503	218377959	SO:0001583	missense	55699			AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.2126T>A	1.37:g.220311336T>A	ENSP00000303279:p.Val709Asp	Somatic		Capture	SOLID	Phase_IV	218377959	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	37	CCDS1523.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936029	0.73442	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.46451	0.87;0.87	6.0	6.0	0.97389	Aminoacyl-tRNA synthetase, class Ia (1);	0.176308	0.49305	D	0.000144	T	0.76521	0.3999	H	0.97390	3.995	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	D	0.85140	0.0980	10	0.87932	D	0	-21.4364	15.1271	0.72493	0.0:0.0:0.0:1.0	.	709	Q9NSE4	SYIM_HUMAN	D	637;709	ENSP00000355889:V637D;ENSP00000303279:V709D	ENSP00000303279:V709D	V	+	2	0	IARS2	218377959	1.000000	0.71417	0.967000	0.41034	0.223000	0.24884	7.337000	0.79256	2.310000	0.77875	0.451000	0.29950	GTT		0.403	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060		Missense_Mutation
IL16	3603	hgsc.bcm.edu	37	15	81585328	81585328	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr15:81585328A>G	ENST00000302987.4	+	11	1852	c.1852A>G	c.(1852-1854)Aga>Gga	p.R618G	IL16_ENST00000394660.2_Missense_Mutation_p.R618G			Q14005	IL16_HUMAN	interleukin 16	618					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						TCTGGAAGAGAGAGAGAACTC	0.507																																																0			15											40.0	40.0	40.0					15																	81585328		1864	4108	5972	79372383	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.1852A>G	15.37:g.81585328A>G	ENSP00000302935:p.Arg618Gly	Somatic		Capture	SOLID	Phase_IV	79372383	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	CCDS42069.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.337	1.062116	0.19987	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842	T;T	0.10382	2.88;2.88	4.78	1.05	0.20165	.	0.671079	0.13153	N	0.409756	T	0.08582	0.0213	L	0.41236	1.265	0.18873	N	0.999986	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.30060	-0.9991	10	0.56958	D	0.05	.	5.1572	0.15040	0.6876:0.1521:0.1603:0.0	.	112;618;618	Q6ZTT5;Q14005;Q14005-2	.;IL16_HUMAN;.	G	618;450;618;155	ENSP00000378155:R618G;ENSP00000302935:R618G	ENSP00000302935:R618G	R	+	1	2	IL16	79372383	0.036000	0.19791	0.002000	0.10522	0.516000	0.34256	1.543000	0.36147	0.010000	0.14839	0.459000	0.35465	AGA		0.507	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217		Missense_Mutation
ITM2A	9452	hgsc.bcm.edu	37	X	78616971	78616971	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chrX:78616971delG	ENST00000373298.2	-	5	701	c.558delC	c.(556-558)ggcfs	p.G186fs	ITM2A_ENST00000469541.1_5'UTR|ITM2A_ENST00000434584.2_Frame_Shift_Del_p.G142fs	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	186	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					integral component of membrane (GO:0016021)		p.R187fs*13(1)		breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						GCAGATATCTGCCACTCTAAA	0.343																																																1	Deletion - Frameshift(1)	ovary(1)	X											49.0	45.0	46.0					X																	78616971		2201	4296	6497	78503627	SO:0001589	frameshift_variant	9452			BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.558delC	X.37:g.78616971delG	ENSP00000362395:p.Gly186fs	Somatic		Capture	SOLID	Phase_IV	78503627	B2R7X5|B4E062|Q6IBC9	Frame_Shift_Del	DEL	ENST00000373298.2	37	CCDS14444.1	DEL	46	Baylor																																																																																				0.343	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057329.1	NM_004867		Frame_Shift_Del
ITPR1	3708	hgsc.bcm.edu	37	3	4842273	4842273	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:4842273G>A	ENST00000443694.2	+	51	7051	c.7051G>A	c.(7051-7053)Ggc>Agc	p.G2351S	ITPR1_ENST00000463980.1_3'UTR|ITPR1_ENST00000423119.2_Missense_Mutation_p.G2318S|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.G2351S|ITPR1_ENST00000302640.8_Missense_Mutation_p.G2351S|ITPR1_ENST00000357086.4_Missense_Mutation_p.G2318S|ITPR1_ENST00000456211.2_Missense_Mutation_p.G2303S			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2366					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.G2303S(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GTTTCTTCTGGGCGCTTTCAA	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	104.0	105.0					3																	4842273		1904	4122	6026	4817273	SO:0001583	missense	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7051G>A	3.37:g.4842273G>A	ENSP00000401671:p.Gly2351Ser	Somatic		Capture	SOLID	Phase_IV	4817273	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.172342	0.94807	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.98105	-4.72;-4.72;-4.72;-4.72;-4.72;-4.72	5.1	5.1	0.69264	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98991	0.9656	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	0.971;1.0	P;D	0.87578	0.905;0.998	D	0.99271	1.0893	10	0.51188	T	0.08	.	18.8652	0.92289	0.0:0.0:1.0:0.0	.	2366;2318	Q14643;G5E9P1	ITPR1_HUMAN;.	S	2366;2351;2351;2318;812;2318;2303;2351	ENSP00000306253:G2351S;ENSP00000346595:G2351S;ENSP00000405934:G2318S;ENSP00000349597:G2318S;ENSP00000397885:G2303S;ENSP00000401671:G2351S	ENSP00000306253:G2351S	G	+	1	0	ITPR1	4817273	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.338000	0.96553	2.535000	0.85469	0.591000	0.81541	GGC		0.478	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222		Missense_Mutation
KCNAB1	7881	hgsc.bcm.edu	37	3	156234150	156234150	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:156234150G>A	ENST00000490337.1	+	11	1021	c.957G>A	c.(955-957)ctG>ctA	p.L319L	KCNAB1_ENST00000389634.5_Silent_p.L272L|KCNAB1_ENST00000302490.8_Silent_p.L301L|KCNAB1_ENST00000471742.1_Silent_p.L308L|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389636.5_Silent_p.L290L	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	319					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.L301L(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GGGCTTCACTGAAGGTATTTT	0.498																																																1	Substitution - coding silent(1)	ovary(1)	3											69.0	71.0	70.0					3																	156234150		2203	4300	6503	157716844	SO:0001819	synonymous_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.957G>A	3.37:g.156234150G>A		Somatic		Capture	SOLID	Phase_IV	157716844	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	ENST00000490337.1	37	CCDS3174.1	SNP	45	Baylor																																																																																				0.498	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471		Silent
KDM1A	23028	hgsc.bcm.edu	37	1	23395088	23395088	+	Silent	SNP	T	T	A			TCGA-24-1604-01	TCGA-24-1604-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:23395088T>A	ENST00000356634.3	+	9	1313	c.1164T>A	c.(1162-1164)gcT>gcA	p.A388A	RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000400181.4_Silent_p.A412A|KDM1A_ENST00000542151.1_Silent_p.A412A	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	388	Demethylase activity.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						TGCTAGAAGCTACATCTTACC	0.388																																																0			1											107.0	91.0	96.0					1																	23395088		2203	4300	6503	23267675	SO:0001819	synonymous_variant	23028			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.1164T>A	1.37:g.23395088T>A		Somatic		Capture	SOLID	Phase_IV	23267675	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Silent	SNP	ENST00000356634.3	37	CCDS30627.1	SNP	53	Baylor																																																																																				0.388	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013		Silent
KDM5C	8242	hgsc.bcm.edu	37	X	53254005	53254005	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chrX:53254005C>G	ENST00000375401.3	-	1	599	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	KDM5C_ENST00000404049.3_Missense_Mutation_p.E23Q|KDM5C_ENST00000375379.3_Missense_Mutation_p.E23Q|KDM5C_ENST00000375383.3_Missense_Mutation_p.E23Q|KDM5C_ENST00000452825.3_Missense_Mutation_p.E23Q	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	23	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.			E -> G (in Ref. 2; BAG65494). {ECO:0000305}.	histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.E23K(2)|p.E23Q(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TCTCGGAACTCGGCCCAGCTA	0.667			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	3	Substitution - Missense(3)	lung(2)|ovary(1)	X											42.0	36.0	38.0					X																	53254005		2203	4300	6503	53270730	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.67G>C	X.37:g.53254005C>G	ENSP00000364550:p.Glu23Gln	Somatic		Capture	SOLID	Phase_IV	53270730	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.1	4.237987	0.79800	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	4.94	4.94	0.65067	Transcription factor jumonji, JmjN (3);	0.104953	0.64402	D	0.000005	T	0.69744	0.3145	M	0.66506	2.035	0.47621	D	0.999471	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.81914	0.995;0.979;0.979	T	0.72083	-0.4397	10	0.59425	D	0.04	-6.3804	14.6974	0.69132	0.0:1.0:0.0:0.0	.	23;23;23	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	Q	23	ENSP00000445176:E23Q;ENSP00000364550:E23Q;ENSP00000385394:E23Q;ENSP00000364528:E23Q;ENSP00000364532:E23Q	ENSP00000344004:E23Q	E	-	1	0	KDM5C	53270730	1.000000	0.71417	0.967000	0.41034	0.987000	0.75469	7.044000	0.76578	2.441000	0.82636	0.600000	0.82982	GAG		0.667	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		Missense_Mutation
KIAA0196	9897	hgsc.bcm.edu	37	8	126079941	126079941	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr8:126079941G>A	ENST00000318410.7	-	10	1520	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C	KIAA0196_ENST00000517845.1_Missense_Mutation_p.R243C	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	391					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.R391C(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TGACGAAGGCGTTTGTTGTTT	0.363																																																1	Substitution - Missense(1)	ovary(1)	8											193.0	179.0	184.0					8																	126079941		2203	4300	6503	126149123	SO:0001583	missense	9897				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1171C>T	8.37:g.126079941G>A	ENSP00000318016:p.Arg391Cys	Somatic		Capture	SOLID	Phase_IV	126149123	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990757	0.74589	.	.	ENSG00000164961	ENST00000318410;ENST00000517845	D;D	0.86366	-2.11;-2.11	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.92567	0.7639	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92745	0.6211	10	0.72032	D	0.01	-10.1884	19.6315	0.95704	0.0:0.0:1.0:0.0	.	391	Q12768	STRUM_HUMAN	C	391;243	ENSP00000318016:R391C;ENSP00000429676:R243C	ENSP00000318016:R391C	R	-	1	0	KIAA0196	126149123	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	5.394000	0.66285	2.647000	0.89833	0.491000	0.48974	CGC		0.363	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846		Missense_Mutation
MBD4	8930	hgsc.bcm.edu	37	3	129152027	129152027	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:129152027C>G	ENST00000249910.1	-	6	1650	c.1475G>C	c.(1474-1476)aGa>aCa	p.R492T	MBD4_ENST00000393278.2_Missense_Mutation_p.R174T|MBD4_ENST00000507208.1_Missense_Mutation_p.R492T|MBD4_ENST00000503197.1_Missense_Mutation_p.R492T|MBD4_ENST00000509587.1_5'Flank|MBD4_ENST00000429544.2_Missense_Mutation_p.R486T	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	492					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.R492T(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						GTCTGCGGTTCTTGCTACCTC	0.428								Base excision repair (BER), DNA glycosylases																																								1	Substitution - Missense(1)	ovary(1)	3											127.0	126.0	126.0					3																	129152027		2203	4300	6503	130634717	SO:0001583	missense	8930			AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1475G>C	3.37:g.129152027C>G	ENSP00000249910:p.Arg492Thr	Somatic		Capture	SOLID	Phase_IV	130634717	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	37	CCDS3058.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.19	2.758562	0.49468	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000393278;ENST00000507208	D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95	6.05	6.05	0.98169	HhH-GPD domain (1);DNA glycosylase (2);	0.000000	0.85682	D	0.000000	D	0.89044	0.6603	L	0.31926	0.97	0.80722	D	1	P;P;B;D;B	0.89917	0.482;0.457;0.32;1.0;0.371	B;B;B;D;B	0.91635	0.171;0.145;0.124;0.999;0.127	D	0.86253	0.1650	10	0.30854	T	0.27	-20.7297	20.2554	0.98417	0.0:1.0:0.0:0.0	.	492;174;486;492;492	E9PEE4;Q2MD36;O95243-2;O95243-3;O95243	.;.;.;.;MBD4_HUMAN	T	486;492;492;174;492	ENSP00000394080:R486T;ENSP00000249910:R492T;ENSP00000424873:R492T;ENSP00000376959:R174T;ENSP00000422327:R492T	ENSP00000249910:R492T	R	-	2	0	MBD4	130634717	0.998000	0.40836	0.020000	0.16555	0.966000	0.64601	5.575000	0.67430	2.886000	0.99085	0.650000	0.86243	AGA		0.428	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925		Missense_Mutation
MGAM	8972	hgsc.bcm.edu	37	7	141722144	141722144	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr7:141722144G>A	ENST00000549489.2	+	7	882	c.787G>A	c.(787-789)Gtg>Atg	p.V263M	MGAM_ENST00000475668.2_Missense_Mutation_p.V263M	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	263	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.V263M(2)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TAGCACTAACGTGTATGGCCT	0.507																																																2	Substitution - Missense(2)	ovary(2)	7											153.0	146.0	149.0					7																	141722144		2030	4197	6227	141368613	SO:0001583	missense	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.787G>A	7.37:g.141722144G>A	ENSP00000447378:p.Val263Met	Somatic		Capture	SOLID	Phase_IV	141368613	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567250	0.65651	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.86497	-2.13	5.55	5.55	0.83447	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.47093	D	0.000245	D	0.84257	0.5432	L	0.59436	1.845	0.39749	D	0.971857	D	0.64830	0.994	B	0.43301	0.415	D	0.85489	0.1184	10	0.54805	T	0.06	.	10.2562	0.43399	0.0868:0.0:0.9132:0.0	.	263	O43451	MGA_HUMAN	M	263;263;140	ENSP00000447378:V263M	ENSP00000316431:V140M	V	+	1	0	MGAM	141368613	1.000000	0.71417	0.973000	0.42090	0.757000	0.42996	6.072000	0.71238	2.885000	0.99019	0.655000	0.94253	GTG		0.507	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			Missense_Mutation
MMP27	64066	hgsc.bcm.edu	37	11	102564712	102564712	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr11:102564712A>T	ENST00000260229.4	-	8	1209	c.1118T>A	c.(1117-1119)gTg>gAg	p.V373E		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	373					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V373E(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	TATTTTCTTCACACGTCCTGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											150.0	142.0	145.0					11																	102564712		2203	4299	6502	102069922	SO:0001583	missense	64066			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1118T>A	11.37:g.102564712A>T	ENSP00000260229:p.Val373Glu	Somatic		Capture	SOLID	Phase_IV	102069922	Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	CCDS8319.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.86	3.238370	0.58886	.	.	ENSG00000137675	ENST00000260229	T	0.15834	2.39	4.79	3.64	0.41730	Hemopexin/matrixin (2);	0.287996	0.24532	N	0.037706	T	0.45256	0.1333	M	0.88377	2.95	0.50039	D	0.999841	D	0.89917	1.0	D	0.85130	0.997	T	0.52426	-0.8577	10	0.87932	D	0	.	10.6059	0.45394	0.9123:0.0:0.0877:0.0	.	373	Q9H306	MMP27_HUMAN	E	373	ENSP00000260229:V373E	ENSP00000260229:V373E	V	-	2	0	MMP27	102069922	0.934000	0.31675	0.994000	0.49952	0.493000	0.33554	6.909000	0.75735	1.996000	0.58369	0.533000	0.62120	GTG		0.418	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122		Missense_Mutation
MTFMT	123263	hgsc.bcm.edu	37	15	65308791	65308791	+	Missense_Mutation	SNP	G	G	T	rs35302908	byFrequency	TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr15:65308791G>T	ENST00000220058.4	-	6	809	c.796C>A	c.(796-798)Cgt>Agt	p.R266S		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	266						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)	p.R266S(3)		endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	CCAATGGCACGGTAAAGTCTG	0.348																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	15											152.0	150.0	151.0					15																	65308791		1830	4092	5922	63095844	SO:0001583	missense	123263			AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.796C>A	15.37:g.65308791G>T	ENSP00000220058:p.Arg266Ser	Somatic		Capture	SOLID	Phase_IV	63095844	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182684	0.78677	.	.	ENSG00000103707	ENST00000220058	T	0.61158	0.13	5.76	5.76	0.90799	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.117685	0.64402	D	0.000014	T	0.79106	0.4390	M	0.85373	2.75	0.22171	P	0.999315666	D	0.76494	0.999	D	0.74023	0.982	T	0.81965	-0.0691	9	0.87932	D	0	-1.4501	17.4567	0.87609	0.0:0.0:1.0:0.0	.	266	Q96DP5	FMT_HUMAN	S	266	ENSP00000220058:R266S	ENSP00000220058:R266S	R	-	1	0	MTFMT	63095844	1.000000	0.71417	0.937000	0.37676	0.576000	0.36127	7.455000	0.80726	2.695000	0.91970	0.563000	0.77884	CGT		0.348	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242		Missense_Mutation
MTMR12	54545	hgsc.bcm.edu	37	5	32263287	32263287	+	Silent	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr5:32263287C>A	ENST00000382142.3	-	7	815	c.645G>T	c.(643-645)ctG>ctT	p.L215L	MTMR12_ENST00000280285.5_Silent_p.L215L|MTMR12_ENST00000264934.5_Silent_p.L215L	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	215	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)	p.L215L(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGGTCCGTTCCAGTTCCCAAC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	5											346.0	278.0	301.0					5																	32263287		2203	4300	6503	32299044	SO:0001819	synonymous_variant	54545			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.645G>T	5.37:g.32263287C>A		Somatic		Capture	SOLID	Phase_IV	32299044	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Silent	SNP	ENST00000382142.3	37	CCDS34138.1	SNP	21	Baylor																																																																																				0.423	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366579.1	NM_019061		Silent
MYO1F	4542	hgsc.bcm.edu	37	19	8616669	8616669	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr19:8616669G>A	ENST00000338257.8	-	8	993	c.726C>T	c.(724-726)taC>taT	p.Y242Y	AC092316.1_ENST00000598703.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	242	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Y242Y(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CGTCCACCTGGTAGGTGTCCG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	19											148.0	153.0	152.0					19																	8616669		2073	4205	6278	8522669	SO:0001819	synonymous_variant	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.726C>T	19.37:g.8616669G>A		Somatic		Capture	SOLID	Phase_IV	8522669	Q8WWN7	Silent	SNP	ENST00000338257.8	37	CCDS42494.1	SNP	44	Baylor																																																																																				0.607	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2			Silent
MYOT	9499	hgsc.bcm.edu	37	5	137213303	137213303	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr5:137213303A>T	ENST00000239926.4	+	4	1000	c.626A>T	c.(625-627)gAc>gTc	p.D209V	MYOT_ENST00000515645.1_Missense_Mutation_p.D94V|MYOT_ENST00000421631.2_Missense_Mutation_p.D25V|RP11-381K20.2_ENST00000514616.1_RNA|MYOT_ENST00000509812.1_3'UTR	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	209					muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)	p.D209V(1)		cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GGTGCACAAGACTCGCAGGTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	5											96.0	96.0	96.0					5																	137213303		2203	4300	6503	137241202	SO:0001583	missense	9499			AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.626A>T	5.37:g.137213303A>T	ENSP00000239926:p.Asp209Val	Somatic		Capture	SOLID	Phase_IV	137241202	A0A4R6|B4DT79	Missense_Mutation	SNP	ENST00000239926.4	37	CCDS4194.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.98	1.503086	0.26949	.	.	ENSG00000120729	ENST00000239926;ENST00000421631;ENST00000515645	T;T;T	0.68903	-0.31;-0.21;-0.36	5.7	5.7	0.88788	.	0.148595	0.44902	D	0.000406	T	0.52948	0.1766	N	0.19112	0.55	0.58432	D	0.999993	B	0.27559	0.181	B	0.20577	0.03	T	0.53012	-0.8498	10	0.51188	T	0.08	.	15.9618	0.79936	1.0:0.0:0.0:0.0	.	209	Q9UBF9	MYOTI_HUMAN	V	209;25;94	ENSP00000239926:D209V;ENSP00000391185:D25V;ENSP00000426281:D94V	ENSP00000239926:D209V	D	+	2	0	MYOT	137241202	0.998000	0.40836	0.902000	0.35471	0.143000	0.21401	4.087000	0.57671	2.170000	0.68504	0.482000	0.46254	GAC		0.388	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251219.2	NM_006790		Missense_Mutation
NAV1	89796	hgsc.bcm.edu	37	1	201751874	201751874	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:201751874C>A	ENST00000367296.4	+	6	2654	c.2234C>A	c.(2233-2235)gCa>gAa	p.A745E	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367297.4_Missense_Mutation_p.A745E|NAV1_ENST00000367300.3_Missense_Mutation_p.A745E|NAV1_ENST00000469130.1_3'UTR|NAV1_ENST00000367295.1_Missense_Mutation_p.A354E|NAV1_ENST00000295624.6_Missense_Mutation_p.A745E|NAV1_ENST00000367302.1_Missense_Mutation_p.A758E	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	745					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.A745E(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						AAAGCCAAGGCAGTGGCCTTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											45.0	45.0	45.0					1																	201751874		2203	4300	6503	200018497	SO:0001583	missense	89796			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.2234C>A	1.37:g.201751874C>A	ENSP00000356265:p.Ala745Glu	Somatic		Capture	SOLID	Phase_IV	200018497	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673983	0.67928	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	T;T;T;T;T;T	0.07021	3.23;3.25;3.25;3.25;3.23;3.27	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.23611	0.0571	L	0.47716	1.5	0.58432	D	0.99999	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.998;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.977;0.994;0.998	T	0.00657	-1.1623	10	0.27082	T	0.32	-19.9139	18.9382	0.92594	0.0:1.0:0.0:0.0	.	745;354;745;253;745	Q8NEY1-6;Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.;.;NAV1_HUMAN;.;.	E	758;745;745;745;745;253;354	ENSP00000356271:A758E;ENSP00000356265:A745E;ENSP00000295624:A745E;ENSP00000356266:A745E;ENSP00000356269:A745E;ENSP00000356264:A354E	ENSP00000295624:A745E	A	+	2	0	NAV1	200018497	1.000000	0.71417	0.982000	0.44146	0.972000	0.66771	7.449000	0.80643	2.592000	0.87571	0.591000	0.81541	GCA		0.562	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		Missense_Mutation
NAV1	89796	hgsc.bcm.edu	37	1	201781663	201781663	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:201781663G>C	ENST00000367296.4	+	27	5515	c.5095G>C	c.(5095-5097)Gta>Cta	p.V1699L	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367297.4_Missense_Mutation_p.V1691L|NAV1_ENST00000367300.3_Missense_Mutation_p.V1639L|NAV1_ENST00000367295.1_Missense_Mutation_p.V1305L|NAV1_ENST00000295624.6_Missense_Mutation_p.V1696L|NAV1_ENST00000367302.1_Missense_Mutation_p.V1652L	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1699					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.V1696L(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GAGGAAGCTGGTAGAGTCAGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											196.0	164.0	175.0					1																	201781663		2203	4300	6503	200048286	SO:0001583	missense	89796			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.5095G>C	1.37:g.201781663G>C	ENSP00000356265:p.Val1699Leu	Somatic		Capture	SOLID	Phase_IV	200048286	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117432	0.37339	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295;ENST00000367301	T;T;T;T;T;T	0.06849	3.25;3.25;3.25;3.25;3.25;3.25	6.05	4.15	0.48705	.	0.130225	0.53938	D	0.000044	T	0.06188	0.0160	N	0.11756	0.17	0.39884	D	0.973677	B;B	0.10296	0.001;0.003	B;B	0.09377	0.003;0.004	T	0.27123	-1.0083	10	0.29301	T	0.29	-11.4865	16.9573	0.86263	0.0:0.5344:0.4656:0.0	.	1305;1696	Q8NEY1-5;Q8NEY1-3	.;.	L	1652;1699;1696;1691;1639;1305;108	ENSP00000356271:V1652L;ENSP00000356265:V1699L;ENSP00000295624:V1696L;ENSP00000356266:V1691L;ENSP00000356269:V1639L;ENSP00000356264:V1305L	ENSP00000295624:V1696L	V	+	1	0	NAV1	200048286	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	1.451000	0.35145	0.849000	0.35215	0.650000	0.86243	GTA		0.542	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		Missense_Mutation
NMD3	51068	hgsc.bcm.edu	37	3	160952914	160952914	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1604-01	TCGA-24-1604-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr3:160952914T>A	ENST00000460469.1	+	6	946	c.491T>A	c.(490-492)tTg>tAg	p.L164*	NMD3_ENST00000351193.2_Nonsense_Mutation_p.L164*|NMD3_ENST00000478160.1_3'UTR|NMD3_ENST00000472947.1_Nonsense_Mutation_p.L164*			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	164					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)	p.L164*(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			TTTTAGACTTTGCATAAAAAA	0.303																																																1	Substitution - Nonsense(1)	ovary(1)	3											27.0	31.0	30.0					3																	160952914		2166	4271	6437	162435608	SO:0001587	stop_gained	51068			BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.491T>A	3.37:g.160952914T>A	ENSP00000419004:p.Leu164*	Somatic		Capture	SOLID	Phase_IV	162435608	D3DNM7|Q9Y2Z6	Nonsense_Mutation	SNP	ENST00000460469.1	37	CCDS3194.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.6	5.019749	0.93462	.	.	ENSG00000169251	ENST00000493066;ENST00000351193;ENST00000472947;ENST00000463518;ENST00000460469;ENST00000540137	.	.	.	4.63	4.63	0.57726	.	0.216977	0.37483	N	0.002071	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-17.8263	13.1989	0.59756	0.0:0.0:0.0:1.0	.	.	.	.	X	164;164;164;164;164;44	.	ENSP00000307525:L164X	L	+	2	0	NMD3	162435608	0.995000	0.38212	1.000000	0.80357	0.994000	0.84299	2.942000	0.49018	1.854000	0.53819	0.477000	0.44152	TTG		0.303	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353114.1	NM_015938		Nonsense_Mutation
NUPL2	11097	hgsc.bcm.edu	37	7	23240232	23240233	+	Frame_Shift_Ins	INS	-	-	C			TCGA-24-1604-01	TCGA-24-1604-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr7:23240232_23240233insC	ENST00000258742.5	+	7	1399_1400	c.1140_1141insC	c.(1141-1143)gcafs	p.A381fs		NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	381	Interaction with GLE1.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)	p.A381fs*4(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCAGCATCATTGCAACAGATAA	0.396																																																1	Insertion - Frameshift(1)	ovary(1)	7																																								23206758	SO:0001589	frameshift_variant	11097			U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	Exception_encountered	7.37:g.23240232_23240233insC	ENSP00000258742:p.Ala381fs	Somatic		Capture	SOLID	Phase_IV	23206757	A4D143|B4DP42|Q49AE7|Q9BS49	Frame_Shift_Ins	INS	ENST00000258742.5	37	CCDS5379.1	INS	63	Baylor																																																																																				0.396	NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214017.2	NM_007342		Frame_Shift_Ins
OR10A6	390093	hgsc.bcm.edu	37	11	7949668	7949668	+	Missense_Mutation	SNP	G	G	T	rs199758044		TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr11:7949668G>T	ENST00000309838.2	-	1	541	c.542C>A	c.(541-543)aCc>aAc	p.T181N		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T181N(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CACTGCTGGGGTTTCACAAGA	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											44.0	43.0	44.0					11																	7949668		2201	4296	6497	7906244	SO:0001583	missense	390093			AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.542C>A	11.37:g.7949668G>T	ENSP00000312470:p.Thr181Asn	Somatic		Capture	SOLID	Phase_IV	7906244	Q6IF59	Missense_Mutation	SNP	ENST00000309838.2	37	CCDS31420.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068410	0.36470	.	.	ENSG00000175393	ENST00000309838	T	0.37058	1.22	4.33	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	D	0.000424	T	0.39682	0.1087	L	0.31578	0.945	0.09310	N	1	D	0.71674	0.998	D	0.69824	0.966	T	0.10382	-1.0632	10	0.59425	D	0.04	.	4.8979	0.13760	0.1086:0.0:0.6811:0.2103	.	181	Q8NH74	O10A6_HUMAN	N	181	ENSP00000312470:T181N	ENSP00000312470:T181N	T	-	2	0	OR10A6	7906244	0.000000	0.05858	0.985000	0.45067	0.622000	0.37654	0.303000	0.19210	2.405000	0.81733	0.655000	0.94253	ACC		0.368	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1	NM_001004461		Missense_Mutation
PLEK	5341	hgsc.bcm.edu	37	2	68615531	68615531	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1604-01	TCGA-24-1604-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr2:68615531T>C	ENST00000234313.7	+	6	849	c.670T>C	c.(670-672)Ttc>Ctc	p.F224L		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	224					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)	p.F224L(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		AGACAGTGGGTTCTTCTGTGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	126.0	126.0					2																	68615531		2203	4300	6503	68469035	SO:0001583	missense	5341			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.670T>C	2.37:g.68615531T>C	ENSP00000234313:p.Phe224Leu	Somatic		Capture	SOLID	Phase_IV	68469035	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	24.6	4.547714	0.86022	.	.	ENSG00000115956	ENST00000234313	T	0.19105	2.17	5.17	5.17	0.71159	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.43122	0.1233	M	0.68317	2.08	0.80722	D	1	D;D	0.61697	0.99;0.99	D;D	0.66497	0.944;0.944	T	0.29912	-0.9996	10	0.46703	T	0.11	.	15.0181	0.71605	0.0:0.0:0.0:1.0	.	242;224	Q59GZ2;P08567	.;PLEK_HUMAN	L	224	ENSP00000234313:F224L	ENSP00000234313:F224L	F	+	1	0	PLEK	68469035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.413000	0.80104	1.952000	0.56665	0.533000	0.62120	TTC		0.468	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664		Missense_Mutation
POLR1B	84172	hgsc.bcm.edu	37	2	113325654	113325654	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr2:113325654G>A	ENST00000263331.5	+	11	2437	c.1857G>A	c.(1855-1857)ctG>ctA	p.L619L	POLR1B_ENST00000541869.1_Silent_p.L657L|POLR1B_ENST00000409894.3_Silent_p.L436L|POLR1B_ENST00000417433.2_Silent_p.L563L|POLR1B_ENST00000537335.1_Silent_p.L408L	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	619					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.L619L(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CTTGTAGACTGGTACGGCCTG	0.433																																					Ovarian(16;256 576 9537 23969 41147)											1	Substitution - coding silent(1)	ovary(1)	2											211.0	187.0	195.0					2																	113325654		2203	4300	6503	113042125	SO:0001819	synonymous_variant	84172			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1857G>A	2.37:g.113325654G>A		Somatic		Capture	SOLID	Phase_IV	113042125	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Silent	SNP	ENST00000263331.5	37	CCDS2097.1	SNP	47	Baylor																																																																																				0.433	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014		Silent
PRKCH	5583	hgsc.bcm.edu	37	14	61924287	61924287	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr14:61924287G>A	ENST00000332981.5	+	9	1553	c.1168G>A	c.(1168-1170)Gtg>Atg	p.V390M	PRKCH_ENST00000555082.1_Missense_Mutation_p.V229M	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	390	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.V390M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		GAAGAAGGACGTGATTCTGCA	0.502																																					Melanoma(135;863 1779 8064 14443 26348)											1	Substitution - Missense(1)	ovary(1)	14											254.0	236.0	242.0					14																	61924287		2203	4300	6503	60994040	SO:0001583	missense	5583			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1168G>A	14.37:g.61924287G>A	ENSP00000329127:p.Val390Met	Somatic		Capture	SOLID	Phase_IV	60994040	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925072	0.73213	.	.	ENSG00000027075	ENST00000332981;ENST00000555082	T;T	0.65732	-0.17;-0.17	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000014	T	0.67664	0.2917	N	0.16478	0.41	0.52501	D	0.999953	D	0.89917	1.0	D	0.66196	0.942	T	0.72516	-0.4269	10	0.87932	D	0	.	19.9357	0.97140	0.0:0.0:1.0:0.0	.	390	P24723	KPCL_HUMAN	M	390;229	ENSP00000329127:V390M;ENSP00000450981:V229M	ENSP00000329127:V390M	V	+	1	0	PRKCH	60994040	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.541000	0.60670	2.715000	0.92844	0.655000	0.94253	GTG		0.502	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255		Missense_Mutation
PRMT2	3275	hgsc.bcm.edu	37	21	48064295	48064295	+	Silent	SNP	C	C	T			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr21:48064295C>T	ENST00000397637.1	+	4	1176	c.222C>T	c.(220-222)ggC>ggT	p.G74G	PRMT2_ENST00000291705.6_Silent_p.G74G|PRMT2_ENST00000451211.2_Silent_p.G74G|PRMT2_ENST00000397628.1_Silent_p.G74G|PRMT2_ENST00000440086.1_Silent_p.G74G|PRMT2_ENST00000458387.2_Silent_p.G74G|PRMT2_ENST00000334494.4_Silent_p.G74G|PRMT2_ENST00000397638.2_Silent_p.G74G|PRMT2_ENST00000355680.3_Silent_p.G74G			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	74	Interaction with ESR1.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.G74G(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		AGCGTGCGGGCTGCTGTGGGT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	21											116.0	110.0	112.0					21																	48064295		2203	4300	6503	46888723	SO:0001819	synonymous_variant	3275			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.222C>T	21.37:g.48064295C>T		Somatic		Capture	SOLID	Phase_IV	46888723	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Silent	SNP	ENST00000397637.1	37	CCDS13737.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	2.267	-0.367986	0.05069	.	.	ENSG00000160310	ENST00000455177	.	.	.	5.4	1.43	0.22495	.	.	.	.	.	T	0.52484	0.1737	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40384	-0.9566	4	.	.	.	-17.1493	5.9022	0.18972	0.0:0.6167:0.1414:0.2419	.	.	.	.	V	14	.	.	A	+	2	0	PRMT2	46888723	0.999000	0.42202	0.972000	0.41901	0.037000	0.13140	0.438000	0.21559	0.321000	0.23259	0.591000	0.81541	GCT		0.488	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535		Silent
RNF213	57674	hgsc.bcm.edu	37	17	78363028	78363028	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr17:78363028G>A	ENST00000582970.1	+	65	15199	c.15056G>A	c.(15055-15057)aGc>aAc	p.S5019N	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000427003.3_3'UTR|RNF213_ENST00000508628.2_Missense_Mutation_p.S5068N|RNF213_ENST00000336301.6_Missense_Mutation_p.S3092N|CTD-2047H16.4_ENST00000573394.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	5019					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S3092N(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CAGTCCTACAGCGATGCCTGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	17											137.0	120.0	126.0					17																	78363028		2203	4300	6503	75977623	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.15056G>A	17.37:g.78363028G>A	ENSP00000464087:p.Ser5019Asn	Somatic		Capture	SOLID	Phase_IV	75977623	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128685	0.77549	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T	0.24723	1.84	5.39	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.54191	0.1843	M	0.83692	2.655	0.34625	D	0.718991	D;D	0.89917	1.0;0.999	D;D	0.71414	0.973;0.94	T	0.72724	-0.4207	10	0.72032	D	0.01	.	16.1563	0.81670	0.0:0.1336:0.8664:0.0	.	5019;3092	D6RI12;Q63HN8	.;RN213_HUMAN	N	5019;5068;3092;369	ENSP00000338218:S3092N	ENSP00000338218:S3092N	S	+	2	0	RNF213	75977623	1.000000	0.71417	0.865000	0.33974	0.610000	0.37248	3.318000	0.51975	1.246000	0.43901	0.655000	0.94253	AGC		0.537	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		Missense_Mutation
SAMSN1	64092	hgsc.bcm.edu	37	21	15889331	15889331	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr21:15889331C>T	ENST00000400566.1	-	3	242	c.161G>A	c.(160-162)gGa>gAa	p.G54E	SAMSN1_ENST00000285670.2_Missense_Mutation_p.G122E|SAMSN1_ENST00000400564.1_Intron	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	54					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.G54E(1)|p.G54V(1)|p.G122V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		ACTTTGTTCTCCACTTCCATT	0.318																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	21											121.0	103.0	109.0					21																	15889331		1806	4078	5884	14811202	SO:0001583	missense	64092			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.161G>A	21.37:g.15889331C>T	ENSP00000383411:p.Gly54Glu	Somatic		Capture	SOLID	Phase_IV	14811202	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	37	CCDS42906.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.784697	0.00628	.	.	ENSG00000155307	ENST00000285670;ENST00000400566	T;T	0.38401	1.14;1.14	4.97	-2.29	0.06805	.	0.660362	0.15682	N	0.249841	T	0.16471	0.0396	N	0.20807	0.61	0.25974	N	0.98247	B;B	0.19583	0.037;0.008	B;B	0.19148	0.024;0.015	T	0.31530	-0.9940	10	0.10902	T	0.67	-9.7997	6.7319	0.23388	0.0:0.3909:0.1203:0.4888	.	122;54	F8WAA1;Q9NSI8	.;SAMN1_HUMAN	E	122;54	ENSP00000285670:G122E;ENSP00000383411:G54E	ENSP00000285670:G122E	G	-	2	0	SAMSN1	14811202	0.936000	0.31750	0.864000	0.33941	0.178000	0.23041	0.339000	0.19875	-0.436000	0.07254	0.655000	0.94253	GGA		0.318	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1			Missense_Mutation
SMARCA4	6597	hgsc.bcm.edu	37	19	11113731	11113731	+	Silent	SNP	C	C	T			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr19:11113731C>T	ENST00000429416.3	+	13	2120	c.1839C>T	c.(1837-1839)agC>agT	p.S613S	SMARCA4_ENST00000358026.2_Silent_p.S613S|SMARCA4_ENST00000344626.4_Silent_p.S613S|SMARCA4_ENST00000444061.3_Silent_p.S613S|SMARCA4_ENST00000590574.1_Silent_p.S613S|SMARCA4_ENST00000413806.3_Silent_p.S613S|SMARCA4_ENST00000450717.3_Silent_p.S613S|SMARCA4_ENST00000589677.1_Silent_p.S613S|SMARCA4_ENST00000541122.2_Silent_p.S613S	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	613					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)|p.S613S(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GCCAGATGAGCGACCTCCCGG	0.592			"""F, N, Mis"""		NSCLC																																		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	2	Unknown(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	19											83.0	79.0	81.0					19																	11113731		2203	4300	6503	10974731	SO:0001819	synonymous_variant	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1839C>T	19.37:g.11113731C>T		Somatic		Capture	SOLID	Phase_IV	10974731	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Silent	SNP	ENST00000429416.3	37	CCDS12253.1	SNP	27	Baylor																																																																																				0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		Silent
SPR	6697	hgsc.bcm.edu	37	2	73118556	73118556	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr2:73118556A>T	ENST00000234454.5	+	3	749	c.676A>T	c.(676-678)Aag>Tag	p.K226*	SPR_ENST00000498749.1_3'UTR	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	226					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)	p.K226*(1)		lung(4)|ovary(2)	6						GCAGGAGCTGAAGGCAAAGGG	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	2											82.0	76.0	78.0					2																	73118556		2203	4300	6503	72972064	SO:0001587	stop_gained	6697				CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.676A>T	2.37:g.73118556A>T	ENSP00000234454:p.Lys226*	Somatic		Capture	SOLID	Phase_IV	72972064	A8K741|D6W5H2|Q53GI9|Q9UBB1	Nonsense_Mutation	SNP	ENST00000234454.5	37	CCDS1920.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.97	3.519601	0.64634	.	.	ENSG00000116096	ENST00000234454	.	.	.	5.0	3.85	0.44370	.	0.682380	0.15901	N	0.239091	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.9088	8.541	0.33393	0.9091:0.0:0.0909:0.0	.	.	.	.	X	226	.	ENSP00000234454:K226X	K	+	1	0	SPR	72972064	1.000000	0.71417	0.457000	0.27056	0.538000	0.34931	2.744000	0.47450	0.949000	0.37715	0.459000	0.35465	AAG		0.557	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251993.2			Nonsense_Mutation
TAF5L	27097	hgsc.bcm.edu	37	1	229738153	229738153	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:229738153G>A	ENST00000366676.1	-	3	760	c.761C>T	c.(760-762)cCc>cTc	p.P254L	TAF5L_ENST00000366675.3_Missense_Mutation_p.P254L|TAF5L_ENST00000258281.2_Missense_Mutation_p.P254L			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	254					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.P254L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				AGTGAGGGAGGGAGGCCCATC	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	89.0	90.0					1																	229738153		2203	4300	6503	227804776	SO:0001583	missense	27097			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.761C>T	1.37:g.229738153G>A	ENSP00000355636:p.Pro254Leu	Somatic		Capture	SOLID	Phase_IV	227804776	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	ENST00000366676.1	37	CCDS1581.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.1	4.802935	0.90623	.	.	ENSG00000135801	ENST00000366676;ENST00000258281;ENST00000366675	T;T;T	0.58797	0.31;0.31;0.87	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.69333	0.3099	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.64706	-0.6344	9	.	.	.	-37.1495	20.0291	0.97531	0.0:0.0:1.0:0.0	.	254;254	O75529-2;O75529	.;TAF5L_HUMAN	L	254	ENSP00000355636:P254L;ENSP00000258281:P254L;ENSP00000355635:P254L	.	P	-	2	0	TAF5L	227804776	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.450000	0.97607	2.738000	0.93877	0.650000	0.86243	CCC		0.542	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095229.1	NM_014409		Missense_Mutation
TEP1	7011	hgsc.bcm.edu	37	14	20851455	20851455	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr14:20851455G>A	ENST00000262715.5	-	27	3965	c.3925C>T	c.(3925-3927)Cag>Tag	p.Q1309*	TEP1_ENST00000556935.1_Nonsense_Mutation_p.Q1201*|TEP1_ENST00000545983.1_5'Flank	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1309	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.Q1309*(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCCTGGCTCTGCTCAAGGGTC	0.617																																																1	Substitution - Nonsense(1)	ovary(1)	14											55.0	49.0	51.0					14																	20851455		2203	4300	6503	19921295	SO:0001587	stop_gained	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3925C>T	14.37:g.20851455G>A	ENSP00000262715:p.Gln1309*	Somatic		Capture	SOLID	Phase_IV	19921295	A0AUV9	Nonsense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	41	9.151803	0.99082	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	.	.	.	5.63	4.55	0.56014	.	0.335334	0.28778	N	0.014180	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-12.3772	14.3716	0.66843	0.086:0.0:0.914:0.0	.	.	.	.	X	1309;1309;1201	.	ENSP00000262715:Q1309X	Q	-	1	0	TEP1	19921295	0.993000	0.37304	1.000000	0.80357	0.991000	0.79684	2.073000	0.41519	2.642000	0.89623	0.655000	0.94253	CAG		0.617	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		Nonsense_Mutation
TG	7038	hgsc.bcm.edu	37	8	133911108	133911108	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr8:133911108C>A	ENST00000220616.4	+	14	3323	c.3283C>A	c.(3283-3285)Caa>Aaa	p.Q1095K	TG_ENST00000377869.1_Missense_Mutation_p.Q1095K	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1095	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.Q1095K(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGCTAGATCCCAAGAAAACCC	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											79.0	66.0	70.0					8																	133911108		2203	4300	6503	133980290	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3283C>A	8.37:g.133911108C>A	ENSP00000220616:p.Gln1095Lys	Somatic		Capture	SOLID	Phase_IV	133980290	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	SNP	21	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.912|7.912	0.736654|0.736654	0.15574|0.15574	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000543313|ENST00000377869;ENST00000220616	.|T;T	.|0.62232	.|0.04;0.04	5.74|5.74	4.85|4.85	0.62838|0.62838	.|Thyroglobulin type-1 (4);	.|0.333863	.|0.25848	.|N	.|0.027910	T|T	0.50377|0.50377	0.1612|0.1612	L|L	0.55103|0.55103	1.725|1.725	0.09310|0.09310	N|N	1|1	.|B	.|0.18461	.|0.028	.|B	.|0.14578	.|0.011	T|T	0.30446|0.30446	-0.9978|-0.9978	5|10	.|0.11182	.|T	.|0.66	.|.	8.0944|8.0944	0.30820|0.30820	0.1517:0.626:0.2223:0.0|0.1517:0.626:0.2223:0.0	.|.	.|1095	.|P01266	.|THYG_HUMAN	Q|K	2|1095	.|ENSP00000367100:Q1095K;ENSP00000220616:Q1095K	.|ENSP00000220616:Q1095K	P|Q	+|+	2|1	0|0	TG|TG	133980290|133980290	0.011000|0.011000	0.17503|0.17503	0.039000|0.039000	0.18376|0.18376	0.351000|0.351000	0.29236|0.29236	1.418000|1.418000	0.34782|0.34782	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	CCA|CAA		0.552	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		Missense_Mutation
THSD7B	80731	hgsc.bcm.edu	37	2	138417303	138417303	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr2:138417303C>A	ENST00000409968.1	+	25	4623	c.4445C>A	c.(4444-4446)tCc>tAc	p.S1482Y	THSD7B_ENST00000413152.2_Missense_Mutation_p.S1454Y|THSD7B_ENST00000272643.3_Missense_Mutation_p.S1485Y|THSD7B_ENST00000543459.1_Missense_Mutation_p.P317T			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1484						integral component of membrane (GO:0016021)		p.S1485Y(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AAACCTTTCTCCTACTGTACA	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											36.0	37.0	37.0					2																	138417303		1939	4139	6078	138133773	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4445C>A	2.37:g.138417303C>A	ENSP00000387145:p.Ser1482Tyr	Somatic		Capture	SOLID	Phase_IV	138133773		Missense_Mutation	SNP	ENST00000409968.1	37		SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.69|14.69	2.611748|2.611748	0.46631|0.46631	.|.	.|.	ENSG00000144229|ENSG00000144229	ENST00000543459|ENST00000409968;ENST00000272643;ENST00000413152	T|T;T;T	0.26067|0.28255	1.76|2.14;2.01;1.62	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.55081|0.55081	0.1898|0.1898	M|M	0.72118|0.72118	2.19|2.19	0.36939|0.36939	D|D	0.892282|0.892282	.|D	.|0.71674	.|0.998	.|P	.|0.60789	.|0.879	T|T	0.60727|0.60727	-0.7206|-0.7206	7|10	0.36615|0.72032	T|D	0.2|0.01	.|.	20.2822|20.2822	0.98520|0.98520	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1454	.|C9JKN6	.|.	T|Y	317|1482;1485;1454	ENSP00000443370:P317T|ENSP00000387145:S1482Y;ENSP00000272643:S1485Y;ENSP00000413841:S1454Y	ENSP00000443370:P317T|ENSP00000272643:S1485Y	P|S	+|+	1|2	0|0	THSD7B|THSD7B	138133773|138133773	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.971000|6.971000	0.76105|0.76105	2.806000|2.806000	0.96561|0.96561	0.655000|0.655000	0.94253|0.94253	CCT|TCC		0.512	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		Missense_Mutation
TIE1	7075	hgsc.bcm.edu	37	1	43786955	43786955	+	Silent	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:43786955C>A	ENST00000372476.3	+	20	3202	c.3123C>A	c.(3121-3123)gtC>gtA	p.V1041V	TIE1_ENST00000433781.2_Silent_p.V686V	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	1041	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V1041V(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCTTTGGAGTCCTTCTTTGGG	0.552																																																1	Substitution - coding silent(1)	ovary(1)	1											285.0	245.0	258.0					1																	43786955		2203	4300	6503	43559542	SO:0001819	synonymous_variant	7075			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.3123C>A	1.37:g.43786955C>A		Somatic		Capture	SOLID	Phase_IV	43559542	B5A949|B5A950	Silent	SNP	ENST00000372476.3	37	CCDS482.1	SNP	30	Baylor																																																																																				0.552	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424		Silent
TNRC6A	27327	hgsc.bcm.edu	37	16	24801546	24801546	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1604-01	TCGA-24-1604-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr16:24801546A>G	ENST00000395799.3	+	6	1712	c.1583A>G	c.(1582-1584)aAt>aGt	p.N528S	TNRC6A_ENST00000315183.7_Missense_Mutation_p.N528S	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	528	Interaction with argonaute family proteins.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.N528S(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TATGGTTCTAATTACTCTGGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	16											125.0	123.0	124.0					16																	24801546		2197	4300	6497	24709047	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1583A>G	16.37:g.24801546A>G	ENSP00000379144:p.Asn528Ser	Somatic		Capture	SOLID	Phase_IV	24709047	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	5.305	0.241734	0.10077	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.11169	2.8;2.8	5.49	1.92	0.25849	.	0.248924	0.40144	N	0.001162	T	0.05090	0.0136	N	0.19112	0.55	0.80722	D	1	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.06405	0.002;0.001;0.001	T	0.39121	-0.9629	10	0.08837	T	0.75	-1.0289	5.4465	0.16537	0.4868:0.2516:0.2617:0.0	.	275;528;528	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	S	528	ENSP00000326900:N528S;ENSP00000379144:N528S	ENSP00000326900:N528S	N	+	2	0	TNRC6A	24709047	0.999000	0.42202	0.984000	0.44739	0.869000	0.49853	1.125000	0.31332	0.102000	0.17638	0.460000	0.39030	AAT		0.473	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7576927	7576927	+	Splice_Site	SNP	C	C	T	rs587781702		TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr17:7576927C>T	ENST00000269305.4	-	9	1109		c.e9-1		TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(20)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGGGCAGTGCTAGGAAAGAG	0.493		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Unknown(20)|Whole gene deletion(8)|Deletion - Frameshift(2)	upper_aerodigestive_tract(7)|ovary(5)|bone(4)|central_nervous_system(3)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|liver(2)|stomach(1)|gastrointestinal_tract_(site_indeterminate)(1)	17											138.0	124.0	129.0					17																	7576927		2203	4300	6503	7517652	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.920-1G>A	17.37:g.7576927C>T		Somatic		Capture	SOLID	Phase_IV	7517652	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.756	1.168861	0.21621	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0356	0.58870	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517652	0.043000	0.20138	0.996000	0.52242	0.305000	0.27757	0.852000	0.27764	2.462000	0.83206	0.561000	0.74099	.		0.493	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
TRIM33	51592	hgsc.bcm.edu	37	1	114967266	114967266	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:114967266G>A	ENST00000358465.2	-	10	1890	c.1807C>T	c.(1807-1809)Ccc>Tcc	p.P603S	TRIM33_ENST00000450349.2_Missense_Mutation_p.P211S|TRIM33_ENST00000369543.2_Missense_Mutation_p.P603S	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	603					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P603S(1)		breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGTGCCTGGGTATCCCTGGT	0.443			T	RET	papillary thyroid																																		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	1	Substitution - Missense(1)	ovary(1)	1											139.0	124.0	129.0					1																	114967266		2203	4300	6503	114768789	SO:0001583	missense	51592			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1807C>T	1.37:g.114967266G>A	ENSP00000351250:p.Pro603Ser	Somatic		Capture	SOLID	Phase_IV	114768789	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	26.7	4.758366	0.89843	.	.	ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349	T;T;T	0.76448	-0.88;-0.82;-1.02	5.86	5.86	0.93980	.	0.095826	0.64402	D	0.000001	D	0.85349	0.5676	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	0.993;0.999;1.0;1.0	P;D;D;D	0.87578	0.758;0.941;0.998;0.994	D	0.83520	0.0085	10	0.46703	T	0.11	-7.0888	20.1823	0.98208	0.0:0.0:1.0:0.0	.	211;211;603;603	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9	.;.;.;TRI33_HUMAN	S	603;603;211	ENSP00000351250:P603S;ENSP00000358556:P603S;ENSP00000412077:P211S	ENSP00000351250:P603S	P	-	1	0	TRIM33	114768789	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.572000	0.90756	2.771000	0.95319	0.650000	0.86243	CCC		0.443	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906		Missense_Mutation
TRIOBP	11078	hgsc.bcm.edu	37	22	38120176	38120178	+	In_Frame_Del	DEL	CCT	CCT	-	rs529080937|rs36219868	byFrequency	TCGA-24-1604-01	TCGA-24-1604-10	CCT	CCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr22:38120176_38120178delCCT	ENST00000406386.3	+	7	1868_1870	c.1613_1615delCCT	c.(1612-1617)gcctcc>gcc	p.S540del		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	540					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.S540delS(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AATCCCAGAGCCTCCTCTCCCAA	0.606														1254	0.250399	0.1362	0.2277	5008	,	,		30273	0.3651		0.2932	False		,,,				2504	0.2587															1	Deletion - In frame(1)	ovary(1)	22								598,3166		11,576,1295						-6.6	0.0		dbSNP_126	143	2675,5301		8,2659,1321	no	coding	TRIOBP	NM_001039141.2		19,3235,2616	A1A1,A1R,RR		33.5381,15.8874,27.879				3273,8467				36450124	SO:0001651	inframe_deletion	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1613_1615delCCT	22.37:g.38120179_38120181delCCT	ENSP00000384312:p.Ser540del	Somatic		Capture	SOLID	Phase_IV	36450122	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	In_Frame_Del	DEL	ENST00000406386.3	37	CCDS43015.1	DEL	26	Baylor																																																																																				0.606	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			In_Frame_Del
TRMT2B	79979	hgsc.bcm.edu	37	X	100276968	100276968	+	Silent	SNP	G	G	A			TCGA-24-1604-01	TCGA-24-1604-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chrX:100276968G>A	ENST00000372936.3	-	9	1612	c.840C>T	c.(838-840)taC>taT	p.Y280Y	TRMT2B_ENST00000338687.7_Silent_p.Y235Y|TRMT2B_ENST00000372931.5_Silent_p.Y280Y|TRMT2B_ENST00000545398.1_Silent_p.Y280Y|TRMT2B_ENST00000372935.1_Silent_p.Y280Y|TRMT2B_ENST00000478422.1_5'Flank|TRMT2B_ENST00000372939.1_Silent_p.Y235Y	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	280						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)	p.Y280Y(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						TTTCCTGGAAGTAAAGTGAGG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	X											70.0	65.0	67.0					X																	100276968		2203	4300	6503	100163624	SO:0001819	synonymous_variant	79979			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.840C>T	X.37:g.100276968G>A		Somatic		Capture	SOLID	Phase_IV	100163624	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Silent	SNP	ENST00000372936.3	37	CCDS14477.1	SNP	36	Baylor																																																																																				0.488	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1	NM_024917		Silent
UBIAD1	29914	hgsc.bcm.edu	37	1	11333862	11333862	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1604-01	TCGA-24-1604-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-24-1604-01	TCGA-24-1604-10	g.chr1:11333862C>A	ENST00000376810.5	+	1	600	c.274C>A	c.(274-276)Ctg>Atg	p.L92M	UBIAD1_ENST00000376804.2_Missense_Mutation_p.L92M	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	92					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		CGTGGCTGTCCTGGCTGTGCA	0.567																																																0			1											118.0	114.0	115.0					1																	11333862		2203	4300	6503	11256449	SO:0001583	missense	29914				CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.274C>A	1.37:g.11333862C>A	ENSP00000366006:p.Leu92Met	Somatic		Capture	SOLID	Phase_IV	11256449	B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	ENST00000376810.5	37	CCDS129.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829577	0.90955	.	.	ENSG00000120942	ENST00000376810;ENST00000376804	D;D	0.94092	-3.35;-3.35	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	D	0.94122	0.8115	M	0.62723	1.935	0.80722	D	1	P	0.51933	0.949	P	0.50537	0.643	D	0.94118	0.7377	10	0.49607	T	0.09	-3.1271	17.7165	0.88338	0.0:1.0:0.0:0.0	.	92	Q9Y5Z9	UBIA1_HUMAN	M	92	ENSP00000366006:L92M;ENSP00000366000:L92M	ENSP00000366000:L92M	L	+	1	2	UBIAD1	11256449	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.460000	0.60108	2.484000	0.83849	0.453000	0.30009	CTG		0.567	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005773.1	NM_013319		Missense_Mutation
