#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
RPS6KA1	6195	broad.mit.edu	37	1	26885427	26885427	+	Splice_Site	SNP	A	A	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:26885427A>G	ENST00000374168.2	+	14	1368	c.1214A>G	c.(1213-1215)cAg>cGg	p.Q405R	RPS6KA1_ENST00000531382.1_Splice_Site_p.Q414R|RPS6KA1_ENST00000374166.4_Splice_Site_p.Q394R|RPS6KA1_ENST00000374162.2_Splice_Site_p.Q313R|RPS6KA1_ENST00000526792.1_Splice_Site_p.Q313R|RPS6KA1_ENST00000530003.1_Splice_Site_p.Q389R	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	405					axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.Q414R(1)		lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		TCGGTGGTACAGGTGAGGGGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											23.0	26.0	25.0					1																	26885427		2202	4296	6498	26758014	SO:0001630	splice_region_variant	6195			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1215+1A>G	1.37:g.26885427A>G		Unknown		x	x	x	26758014	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	ENST00000374168.2	37	CCDS284.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	11.62	1.691646	0.30052	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000374164;ENST00000531382;ENST00000403732	T;T;T;T;T;T;T	0.63744	1.14;1.14;1.14;1.14;1.14;1.14;-0.06	5.89	5.89	0.94794	Protein kinase-like domain (1);	0.106561	0.64402	D	0.000003	T	0.53094	0.1775	N	0.24115	0.695	0.80722	D	1	B;B;B	0.33549	0.417;0.122;0.075	B;B;B	0.37780	0.258;0.059;0.027	T	0.56013	-0.8049	10	0.49607	T	0.09	.	14.8869	0.70575	1.0:0.0:0.0:0.0	.	389;414;405	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	R	405;394;313;313;389;125;414;63	ENSP00000363283:Q405R;ENSP00000363281:Q394R;ENSP00000431651:Q313R;ENSP00000363277:Q313R;ENSP00000432281:Q389R;ENSP00000435412:Q414R;ENSP00000383967:Q63R	ENSP00000363277:Q313R	Q	+	2	0	RPS6KA1	26758014	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	8.397000	0.90193	2.254000	0.74563	0.533000	0.62120	CAG		0.607	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	Missense_Mutation	Missense_Mutation
RPS6KA1	6195	broad.mit.edu	37	1	26898047	26898047	+	Silent	SNP	T	T	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:26898047T>G	ENST00000374168.2	+	18	1852	c.1698T>G	c.(1696-1698)gcT>gcG	p.A566A	RPS6KA1_ENST00000531382.1_Silent_p.A575A|RPS6KA1_ENST00000374166.4_Silent_p.A555A|RPS6KA1_ENST00000374162.2_Silent_p.A474A|RPS6KA1_ENST00000526792.1_Silent_p.A474A|RPS6KA1_ENST00000530003.1_Silent_p.A550A	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	566	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.A575A(1)		lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGCTGCGGGCTGAGAATGGGC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	1											82.0	71.0	74.0					1																	26898047		2203	4300	6503	26770634	SO:0001819	synonymous_variant	6195			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1698T>G	1.37:g.26898047T>G		Unknown		x	x	x	26770634	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1	SNP	55	Broad																																																																																				0.572	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953		Silent
GJB4	127534	broad.mit.edu	37	1	35227197	35227197	+	Silent	SNP	G	G	A	rs146404415		TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:35227197G>A	ENST00000339480.1	+	2	712	c.342G>A	c.(340-342)ccG>ccA	p.P114P	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	114					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.P114P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CCAATGCCCCGTCCCTGTACG	0.617													g|||	1	0.000199681	0.0	0.0	5008	,	,		21908	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						A		0,4406		0,0,2203	96.0	70.0	79.0		342	-7.1	0.0	1	dbSNP_134	79	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	GJB4	NM_153212.2		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		114/267	35227197	4,13002	2203	4300	6503	34999784	SO:0001819	synonymous_variant	127534				CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.342G>A	1.37:g.35227197G>A		Unknown		x	x	x	34999784	B3KQ82	Silent	SNP	ENST00000339480.1	37	CCDS383.1	SNP	40	Broad																																																																																				0.617	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011560.1	NM_153212		Silent
ZFP69B	65243	broad.mit.edu	37	1	40929247	40929247	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:40929247A>G	ENST00000411995.2	+	6	1966	c.1591A>G	c.(1591-1593)Agc>Ggc	p.S531G	ZFP69B_ENST00000484445.1_3'UTR|RP1-228H13.5_ENST00000565390.1_RNA|ZFP69B_ENST00000361584.3_Missense_Mutation_p.S429G	NM_023070.2	NP_075558.2	Q9UJL9	ZF69B_HUMAN	ZFP69 zinc finger protein B	531					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S429G(1)									AAATACCTTCAGCAATGTTGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	39.0	38.0					1																	40929247		2186	4269	6455	40701834	SO:0001583	missense	65243			BC017498	CCDS452.1, CCDS452.2	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187801	ENSG00000187801		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	28053	protein-coding gene	gene with protein product			"""zinc finger protein 643"""	ZNF643			Standard	NM_023070		Approved	ZKSCAN23B, FLJ34293, ZSCAN54B	uc001cfn.2	Q9UJL9	OTTHUMG00000007302	ENST00000411995.2:c.1591A>G	1.37:g.40929247A>G	ENSP00000399664:p.Ser531Gly	Unknown		x	x	x	40701834	Q5QPL4	Missense_Mutation	SNP	ENST00000411995.2	37	CCDS452.2	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	.	12.18	1.860882	0.32884	.	.	ENSG00000187801	ENST00000431552;ENST00000411995;ENST00000361584	T;T	0.09073	3.48;3.02	3.01	0.709	0.18150	.	.	.	.	.	T	0.04092	0.0114	N	0.17345	0.48	0.09310	N	1	B	0.29716	0.255	B	0.26614	0.071	T	0.43572	-0.9383	9	0.26408	T	0.33	.	2.9989	0.06007	0.5084:0.2316:0.26:0.0	.	531	Q9UJL9	ZN643_HUMAN	G	462;531;429	ENSP00000399664:S531G;ENSP00000354547:S429G	ENSP00000354547:S429G	S	+	1	0	ZNF643	40701834	.	.	0.005000	0.12908	0.052000	0.14988	.	.	0.133000	0.18654	0.533000	0.62120	AGC		0.348	ZFP69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019078.2	NM_023070		Missense_Mutation
CYP4B1	1580	broad.mit.edu	37	1	47279975	47279975	+	Silent	SNP	C	C	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:47279975C>G	ENST00000271153.4	+	7	903	c.867C>G	c.(865-867)ctC>ctG	p.L289L	CYP4B1_ENST00000371919.4_Silent_p.L275L|CYP4B1_ENST00000371923.4_Silent_p.L290L|CYP4B1_ENST00000452782.2_Silent_p.L127L			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	289					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.L289L(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	TGGACATTCTCCTGGGTGCCC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											68.0	69.0	69.0					1																	47279975		2203	4300	6503	47052562	SO:0001819	synonymous_variant	1580			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.867C>G	1.37:g.47279975C>G		Unknown		x	x	x	47052562	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Silent	SNP	ENST00000271153.4	37	CCDS542.1	SNP	30	Broad																																																																																				0.582	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779		Silent
ADAMTSL4	54507	broad.mit.edu	37	1	150531087	150531087	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:150531087T>A	ENST00000369038.2	+	13	2722	c.2521T>A	c.(2521-2523)Tgt>Agt	p.C841S	ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.C841S|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.C864S|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.C841S			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	841	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.C841S(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CATGGGGCCCTGTACTACTGC	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	64.0	63.0					1																	150531087		2203	4300	6503	148797711	SO:0001583	missense	54507			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2521T>A	1.37:g.150531087T>A	ENSP00000358034:p.Cys841Ser	Unknown		x	x	x	148797711	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	28.9	4.959995	0.92791	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12	5.46	5.46	0.80206	.	.	.	.	.	D	0.99441	0.9802	H	0.97465	4.01	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.998	D	0.98342	1.0539	9	0.87932	D	0	.	13.4707	0.61281	0.0:0.0:0.0:1.0	.	802;864;841;841	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	S	841;841;379;864;841	ENSP00000358037:C841S;ENSP00000271643:C841S;ENSP00000358035:C864S;ENSP00000358034:C841S	ENSP00000271643:C841S	C	+	1	0	ADAMTSL4	148797711	1.000000	0.71417	0.997000	0.53966	0.879000	0.50718	5.788000	0.69020	2.071000	0.62044	0.379000	0.24179	TGT		0.632	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032		Missense_Mutation
GNPAT	8443	broad.mit.edu	37	1	231411174	231411174	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr1:231411174T>G	ENST00000366647.4	+	14	2036	c.1867T>G	c.(1867-1869)Tta>Gta	p.L623V	GNPAT_ENST00000366646.3_Missense_Mutation_p.L562V|GNPAT_ENST00000469332.1_3'UTR	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	623					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.L623V(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TTATGATGTATTATCTTCTGA	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											113.0	108.0	110.0					1																	231411174		2203	4300	6503	229477797	SO:0001583	missense	8443			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1867T>G	1.37:g.231411174T>G	ENSP00000355607:p.Leu623Val	Unknown		x	x	x	229477797	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	ENST00000366647.4	37	CCDS1592.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	14.16	2.453235	0.43531	.	.	ENSG00000116906	ENST00000366647;ENST00000366646	T;T	0.72615	-0.67;-0.63	5.47	-2.79	0.05841	.	0.079660	0.49305	D	0.000152	T	0.77226	0.4099	M	0.65498	2.005	0.36365	D	0.860965	D;D	0.71674	0.998;0.996	D;D	0.67548	0.952;0.95	T	0.77973	-0.2386	10	0.37606	T	0.19	.	13.0603	0.59003	0.0:0.6585:0.0:0.3415	.	562;623	B4DNM9;O15228	.;GNPAT_HUMAN	V	623;562	ENSP00000355607:L623V;ENSP00000355606:L562V	ENSP00000355606:L562V	L	+	1	2	GNPAT	229477797	0.008000	0.16893	0.008000	0.14137	0.185000	0.23345	0.042000	0.13949	-0.435000	0.07264	0.377000	0.23210	TTA		0.428	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			Missense_Mutation
CNNM2	54805	broad.mit.edu	37	10	104679547	104679547	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr10:104679547G>A	ENST00000369878.4	+	1	1498	c.1310G>A	c.(1309-1311)gGg>gAg	p.G437E	CNNM2_ENST00000369875.3_Missense_Mutation_p.G437E|CNNM2_ENST00000433628.2_Missense_Mutation_p.G437E	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	437					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.G437E(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ATCATCCAAGGGGCGCTGGAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	10											69.0	67.0	68.0					10																	104679547		2203	4300	6503	104669537	SO:0001583	missense	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1310G>A	10.37:g.104679547G>A	ENSP00000358894:p.Gly437Glu	Unknown		x	x	x	104669537	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	ENST00000369878.4	37	CCDS44474.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050866	0.75960	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	T;T;T	0.76709	-1.04;-1.04;-1.04	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.90638	0.7064	M	0.90977	3.165	0.80722	D	1	D;P;D	0.89917	0.997;0.874;1.0	D;P;D	0.97110	0.988;0.903;1.0	D	0.93038	0.6454	10	0.87932	D	0	.	17.8745	0.88821	0.0:0.0:1.0:0.0	.	437;437;437	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	E	437	ENSP00000392875:G437E;ENSP00000358891:G437E;ENSP00000358894:G437E	ENSP00000286899:G437E	G	+	2	0	CNNM2	104669537	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.852000	0.99516	2.187000	0.69744	0.555000	0.69702	GGG		0.577	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649		Missense_Mutation
CCDC87	55231	broad.mit.edu	37	11	66359793	66359793	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr11:66359793G>A	ENST00000333861.3	-	1	761	c.694C>T	c.(694-696)Caa>Taa	p.Q232*	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	232					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CGGCTGAGTTGGATGAGGTAG	0.547																																																0			11											86.0	68.0	74.0					11																	66359793		2200	4295	6495	66116369	SO:0001587	stop_gained	55231			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.694C>T	11.37:g.66359793G>A	ENSP00000328487:p.Gln232*	Unknown		x	x	x	66116369	Q8NE76	Nonsense_Mutation	SNP	ENST00000333861.3	37	CCDS8145.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207678	0.79240	.	.	ENSG00000182791	ENST00000333861	.	.	.	5.54	3.63	0.41609	.	0.335275	0.21800	N	0.068940	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	6.8971	0.24262	0.087:0.0:0.7415:0.1715	.	.	.	.	X	232	.	ENSP00000328487:Q232X	Q	-	1	0	CCDC87	66116369	0.998000	0.40836	0.940000	0.37924	0.511000	0.34104	1.516000	0.35856	0.848000	0.35191	0.655000	0.94253	CAA		0.547	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219		Nonsense_Mutation
USP15	9958	broad.mit.edu	37	12	62708592	62708592	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr12:62708592G>T	ENST00000280377.5	+	4	428	c.370G>T	c.(370-372)Gta>Tta	p.V124L	USP15_ENST00000312635.6_Missense_Mutation_p.V124L|USP15_ENST00000353364.3_Missense_Mutation_p.V124L|USP15_ENST00000393654.3_Missense_Mutation_p.V124L|USP15_ENST00000550632.1_3'UTR	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	124					BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.V124L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		GGGTATGTTTGTAAAGCACTG	0.313																																					Melanoma(181;615 2041 39364 49691 50001)											1	Substitution - Missense(1)	ovary(1)	12											240.0	265.0	256.0					12																	62708592		2203	4300	6503	60994859	SO:0001583	missense	9958			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.370G>T	12.37:g.62708592G>T	ENSP00000280377:p.Val124Leu	Unknown		x	x	x	60994859	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	ENST00000280377.5	37	CCDS58251.1	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.58|13.58	2.279850|2.279850	0.40294|0.40294	.|.	.|.	ENSG00000135655|ENSG00000135655	ENST00000549237|ENST00000353364;ENST00000549523;ENST00000280377;ENST00000312635;ENST00000393654;ENST00000548836;ENST00000546694	.|T;T;T	.|0.19394	.|2.16;2.16;2.15	5.6|5.6	4.7|4.7	0.59300|0.59300	.|.	.|0.070116	.|0.56097	.|D	.|0.000029	T|T	0.29256|0.29256	0.0728|0.0728	L|L	0.60455|0.60455	1.87|1.87	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;B	.|0.43314	.|0.702;0.803;0.395	.|B;P;B	.|0.45195	.|0.281;0.473;0.123	T|T	0.02560|0.02560	-1.1141|-1.1141	5|9	.|.	.|.	.|.	-11.7453|-11.7453	16.473|16.473	0.84119|0.84119	0.0:0.1314:0.8686:0.0|0.0:0.1314:0.8686:0.0	.|.	.|124;124;124	.|Q9Y4E8;Q9Y4E8-2;Q9H8G9	.|UBP15_HUMAN;.;.	F|L	119|124;132;124;124;124;70;3	.|ENSP00000258123:V124L;ENSP00000280377:V124L;ENSP00000377264:V124L	.|.	L|V	+|+	3|1	2|0	USP15|USP15	60994859|60994859	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.374000|0.374000	0.29953|0.29953	9.837000|9.837000	0.99465|0.99465	1.334000|1.334000	0.45468|0.45468	-0.312000|-0.312000	0.09012|0.09012	TTG|GTA		0.313	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313		Missense_Mutation
TMEM132D	121256	broad.mit.edu	37	12	129563124	129563124	+	Silent	SNP	G	G	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr12:129563124G>T	ENST00000422113.2	-	8	2396	c.2070C>A	c.(2068-2070)atC>atA	p.I690I	TMEM132D_ENST00000389441.4_Silent_p.I228I	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	690					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.I690I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CAGTGGCAAAGATGGCCCTGT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	12											127.0	111.0	117.0					12																	129563124		2203	4300	6503	128129077	SO:0001819	synonymous_variant	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2070C>A	12.37:g.129563124G>T		Unknown		x	x	x	128129077	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1	SNP	33	Broad																																																																																				0.582	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		Silent
ARHGEF7	8874	broad.mit.edu	37	13	111935537	111935537	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr13:111935537G>A	ENST00000375741.2	+	17	2090	c.1840G>A	c.(1840-1842)Gcg>Acg	p.A614T	ARHGEF7_ENST00000375739.2_Missense_Mutation_p.A564T|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.A436T|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.A511T|ARHGEF7_ENST00000375736.4_Missense_Mutation_p.A436T|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.A358T|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.A593T|ARHGEF7_ENST00000544132.1_3'UTR|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.A436T|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.A521T|ARHGEF7_ENST00000218789.5_Missense_Mutation_p.A436T	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	614					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A593T(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CAGCAAGCCCGCGCCGCTGAC	0.687																																																1	Substitution - Missense(1)	ovary(1)	13											37.0	35.0	35.0					13																	111935537		2184	4289	6473	110733538	SO:0001583	missense	8874			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1840G>A	13.37:g.111935537G>A	ENSP00000364893:p.Ala614Thr	Unknown		x	x	x	110733538	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	37	CCDS45068.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	9.037	0.988827	0.18966	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000466143;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T;T	0.61627	0.67;0.67;0.67;0.64;0.68;0.63;0.64;0.64;0.69;0.63;0.09	4.43	1.7	0.24286	.	0.486626	0.23074	N	0.052223	T	0.29882	0.0747	N	0.08118	0	0.38588	D	0.950346	B;B;B;B;B;B	0.20780	0.005;0.0;0.004;0.048;0.026;0.027	B;B;B;B;B;B	0.18263	0.002;0.001;0.002;0.016;0.018;0.021	T	0.05131	-1.0904	10	0.21014	T	0.42	.	5.9899	0.19454	0.5483:0.0:0.4517:0.0	.	358;511;436;564;614;593	E9PDQ5;B7Z6G2;Q14155-6;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	T	593;614;564;521;591;436;436;436;436;511;436;358	ENSP00000325994:A593T;ENSP00000364893:A614T;ENSP00000364891:A564T;ENSP00000359657:A521T;ENSP00000418067:A436T;ENSP00000218789:A436T;ENSP00000364888:A436T;ENSP00000397068:A436T;ENSP00000364889:A511T;ENSP00000364875:A436T;ENSP00000417596:A358T	ENSP00000218789:A436T	A	+	1	0	ARHGEF7	110733538	0.759000	0.28416	0.002000	0.10522	0.935000	0.57460	1.373000	0.34272	0.434000	0.26340	0.561000	0.74099	GCG		0.687	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511		Missense_Mutation
SEC23A	10484	broad.mit.edu	37	14	39536469	39536469	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr14:39536469T>C	ENST00000307712.6	-	10	1652	c.1135A>G	c.(1135-1137)Act>Gct	p.T379A	SEC23A_ENST00000536508.1_Missense_Mutation_p.T253A|SEC23A_ENST00000537403.1_Missense_Mutation_p.T177A|SEC23A_ENST00000553925.1_5'Flank|SEC23A_ENST00000545328.2_Missense_Mutation_p.T350A	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	379					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.T379A(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		AATAAGGAAGTATTGAAAGAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	14											95.0	92.0	93.0					14																	39536469		2203	4300	6503	38606220	SO:0001583	missense	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1135A>G	14.37:g.39536469T>C	ENSP00000306881:p.Thr379Ala	Unknown		x	x	x	38606220	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	18.32	3.598622	0.66332	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.4	5.4	0.78164	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	T	0.79667	0.4485	M	0.78916	2.43	0.80722	D	1	B;B;B;B	0.31910	0.346;0.321;0.321;0.257	B;B;B;B	0.37989	0.262;0.205;0.205;0.145	T	0.76413	-0.2968	10	0.19147	T	0.46	-18.3099	15.433	0.75116	0.0:0.0:0.0:1.0	.	267;350;253;379	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	A	177;379;253;350;267	ENSP00000444193:T177A;ENSP00000306881:T379A;ENSP00000437715:T253A;ENSP00000445393:T350A	ENSP00000306881:T379A	T	-	1	0	SEC23A	38606220	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.937000	0.87672	2.053000	0.61076	0.454000	0.30748	ACT		0.358	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			Missense_Mutation
ZC2HC1C	79696	broad.mit.edu	37	14	75537379	75537379	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr14:75537379T>A	ENST00000524913.1	+	2	592	c.103T>A	c.(103-105)Tac>Aac	p.Y35N	ACYP1_ENST00000555463.1_5'Flank|ZC2HC1C_ENST00000526748.1_Intron|ZC2HC1C_ENST00000439583.2_Missense_Mutation_p.Y35N|ZC2HC1C_ENST00000238686.8_Missense_Mutation_p.Y35N	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	35							metal ion binding (GO:0046872)	p.Y35N(1)									GCAAGACTCTTACGAACAAGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	14											91.0	89.0	90.0					14																	75537379		1940	4157	6097	74607132	SO:0001583	missense	79696			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.103T>A	14.37:g.75537379T>A	ENSP00000435550:p.Tyr35Asn	Unknown		x	x	x	74607132	E9PJQ0|Q9BTA8|Q9H5S9	Missense_Mutation	SNP	ENST00000524913.1	37	CCDS41972.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	19.07	3.755039	0.69648	.	.	ENSG00000119703	ENST00000534151;ENST00000524913;ENST00000238686;ENST00000554763;ENST00000439583;ENST00000526130;ENST00000525046	T	0.58210	0.35	4.72	4.72	0.59763	.	0.147857	0.31404	N	0.007702	T	0.59128	0.2171	M	0.72118	2.19	0.37484	D	0.91611	P;P	0.48016	0.904;0.845	P;B	0.48063	0.565;0.361	T	0.70189	-0.4940	10	0.87932	D	0	-1.037	12.6243	0.56620	0.0:0.0:0.0:1.0	.	35;35	Q53FD0;E9PJQ0	F164C_HUMAN;.	N	35	ENSP00000435550:Y35N	ENSP00000238686:Y35N	Y	+	1	0	FAM164C	74607132	0.000000	0.05858	0.968000	0.41197	0.850000	0.48378	0.409000	0.21082	1.995000	0.58328	0.455000	0.32223	TAC		0.522	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394616.4	NM_001042430		Missense_Mutation
CHRNA5	1138	broad.mit.edu	37	15	78880661	78880661	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr15:78880661G>C	ENST00000299565.5	+	4	509	c.309G>C	c.(307-309)tgG>tgC	p.W103C	CHRNA5_ENST00000559554.1_Missense_Mutation_p.W103C|RP11-650L12.2_ENST00000567141.1_RNA	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	103					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.W103C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	TAAAGGAATGGATAGATGTAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	15											84.0	86.0	85.0					15																	78880661		2196	4293	6489	76667716	SO:0001583	missense	1138				CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.309G>C	15.37:g.78880661G>C	ENSP00000299565:p.Trp103Cys	Unknown		x	x	x	76667716	Q15824|Q99554	Missense_Mutation	SNP	ENST00000299565.5	37	CCDS10304.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160440	0.78226	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	D	0.98684	-5.07	5.08	5.08	0.68730	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97633	1.0143	10	0.87932	D	0	.	18.9117	0.92489	0.0:0.0:1.0:0.0	.	103	P30532	ACHA5_HUMAN	C	103;54	ENSP00000299565:W103C	ENSP00000299565:W103C	W	+	3	0	CHRNA5	76667716	1.000000	0.71417	0.972000	0.41901	0.993000	0.82548	9.790000	0.99075	2.522000	0.85027	0.555000	0.69702	TGG		0.333	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290106.1			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr17:7578370C>T	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)	17											48.0	46.0	47.0					17																	7578370		2203	4300	6503	7519095	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>A	17.37:g.7578370C>T		Unknown		x	x	x	7519095	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774230	0.31411	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
CCDC40	55036	broad.mit.edu	37	17	78063658	78063659	+	Missense_Mutation	DNP	TG	TG	AC			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr17:78063658_78063659TG>AC	ENST00000397545.4	+	17	2834_2835	c.2807_2808TG>AC	c.(2806-2808)aTG>aAC	p.M936N	CCDC40_ENST00000374877.3_Missense_Mutation_p.M936N|CCDC40_ENST00000573903.1_3'UTR	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	936					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.M936N(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ATCCGGGCCATGAAGGGCGAGA	0.579																																																1	Substitution - Missense(1)	ovary(1)	17																																								75678254	SO:0001583	missense	55036			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	Exception_encountered	17.37:g.78063658_78063659delinsAC	ENSP00000380679:p.Met936Asn	Unknown		x	x	x	75678253	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	DNP	ENST00000397545.4	37	CCDS42395.1	DNP	51	Broad																																																																																				0.579	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082		Missense_Mutation
MPND	84954	broad.mit.edu	37	19	4355115	4355115	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:4355115T>G	ENST00000262966.8	+	8	1008	c.941T>G	c.(940-942)tTc>tGc	p.F314C	AC007292.4_ENST00000594776.1_RNA|MPND_ENST00000599840.1_Missense_Mutation_p.F314C|MPND_ENST00000359935.4_Intron|AC007292.3_ENST00000593524.1_RNA	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	314	MPN.						peptidase activity (GO:0008233)	p.F314C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCAGAGCCTTCCCTTGTCGG	0.677																																																1	Substitution - Missense(1)	ovary(1)	19											32.0	41.0	38.0					19																	4355115		2067	4210	6277	4306115	SO:0001583	missense	84954				CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.941T>G	19.37:g.4355115T>G	ENSP00000262966:p.Phe314Cys	Unknown		x	x	x	4306115	Q96SJ0|Q9Y2P1|Q9Y2P2	Missense_Mutation	SNP	ENST00000262966.8	37	CCDS42470.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	t	18.20	3.571923	0.65765	.	.	ENSG00000008382	ENST00000262966	T	0.61510	0.1	4.56	4.56	0.56223	.	0.241235	0.42053	D	0.000763	T	0.79329	0.4427	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.983	D	0.83775	0.0222	10	0.72032	D	0.01	-10.9838	12.1935	0.54284	0.0:0.0:0.0:1.0	.	314;314	A6NI36;Q8N594	.;MPND_HUMAN	C	314	ENSP00000262966:F314C	ENSP00000262966:F314C	F	+	2	0	MPND	4306115	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	6.832000	0.75329	1.841000	0.53522	0.449000	0.29647	TTC		0.677	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868		Missense_Mutation
PTPRS	5802	broad.mit.edu	37	19	5214445	5214445	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:5214445C>A	ENST00000587303.1	-	29	4640	c.4541G>T	c.(4540-4542)gGc>gTc	p.G1514V	PTPRS_ENST00000588012.1_Missense_Mutation_p.G1476V|PTPRS_ENST00000592099.1_Missense_Mutation_p.G1067V|PTPRS_ENST00000372412.4_Missense_Mutation_p.G1515V|PTPRS_ENST00000353284.2_Missense_Mutation_p.G1067V|PTPRS_ENST00000357368.4_Missense_Mutation_p.G1514V|PTPRS_ENST00000262963.6_Missense_Mutation_p.G1494V|PTPRS_ENST00000348075.2_Missense_Mutation_p.G1476V|PTPRS_ENST00000588552.1_5'UTR			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1514	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G1514V(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CTGGATGAAGCCGTAGGTCTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											137.0	103.0	114.0					19																	5214445		2203	4300	6503	5165445	SO:0001583	missense	5802			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4541G>T	19.37:g.5214445C>A	ENSP00000467537:p.Gly1514Val	Unknown		x	x	x	5165445	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066333	0.55539	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	3.12	3.12	0.35913	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.64402	U	0.000004	T	0.74030	0.3663	H	0.95850	3.73	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.976;1.0;0.997;1.0;1.0	D	0.84257	0.0481	10	0.87932	D	0	.	14.721	0.69305	0.0:1.0:0.0:0.0	.	1096;1067;1071;1476;1514;1109	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	V	1109;1515;1514;1514;1505;1494;1476;1096;1071;1067	ENSP00000361489:G1515V;ENSP00000349932:G1514V;ENSP00000262963:G1494V;ENSP00000269907:G1476V;ENSP00000327313:G1067V	ENSP00000262963:G1494V	G	-	2	0	PTPRS	5165445	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	7.447000	0.80620	1.772000	0.52199	0.313000	0.20887	GGC		0.587	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2			Missense_Mutation
ANO8	57719	broad.mit.edu	37	19	17435810	17435810	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:17435810C>A	ENST00000159087.4	-	17	3205	c.3047G>T	c.(3046-3048)gGc>gTc	p.G1016V		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	1016					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.G1016V(1)		autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GGTGTCGCTGCCTGTGGGTGA	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	80.0	74.0					19																	17435810		2203	4300	6503	17296810	SO:0001583	missense	57719			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.3047G>T	19.37:g.17435810C>A	ENSP00000159087:p.Gly1016Val	Unknown		x	x	x	17296810	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	37	CCDS32949.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	10.91	1.483405	0.26598	.	.	ENSG00000074855	ENST00000159087	T	0.68181	-0.31	3.8	2.65	0.31530	.	0.151991	0.42294	U	0.000725	T	0.65312	0.2679	L	0.42245	1.32	0.48762	D	0.999704	D	0.64830	0.994	P	0.53549	0.729	T	0.66670	-0.5865	10	0.54805	T	0.06	.	9.2482	0.37539	0.0:0.6074:0.3926:0.0	.	1016	Q9HCE9	ANO8_HUMAN	V	1016	ENSP00000159087:G1016V	ENSP00000159087:G1016V	G	-	2	0	ANO8	17296810	0.941000	0.31946	0.281000	0.24762	0.349000	0.29174	1.987000	0.40687	1.662000	0.50781	0.478000	0.44815	GGC		0.672	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644		Missense_Mutation
ZNF208	7757	broad.mit.edu	37	19	22156106	22156106	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:22156106A>C	ENST00000397126.4	-	4	1878	c.1730T>G	c.(1729-1731)gTa>gGa	p.V577G	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	577					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V477G(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GGGTTTCTCTACAGTATGAAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	19											27.0	28.0	28.0					19																	22156106		1971	4162	6133	21947946	SO:0001583	missense	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1730T>G	19.37:g.22156106A>C	ENSP00000380315:p.Val577Gly	Unknown		x	x	x	21947946		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	a	0.003	-2.541960	0.00142	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.13089	2.62	2.8	1.69	0.24217	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05090	0.0136	.	.	.	0.34128	D	0.664942	B	0.06786	0.001	B	0.09377	0.004	T	0.45381	-0.9265	8	0.02654	T	1	.	7.3874	0.26891	0.1912:0.6236:0.1852:0.0	.	477	O43345	ZN208_HUMAN	G	577;477	ENSP00000380315:V577G	ENSP00000380315:V577G	V	-	2	0	ZNF208	21947946	0.000000	0.05858	0.011000	0.14972	0.018000	0.09664	-0.039000	0.12124	-0.204000	0.10235	-0.672000	0.03802	GTA		0.353	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		Missense_Mutation
ZNF529	57711	broad.mit.edu	37	19	37038675	37038675	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:37038675G>A	ENST00000591340.1	-	5	943	c.785C>T	c.(784-786)aCc>aTc	p.T262I	ZNF529_ENST00000334116.7_Missense_Mutation_p.T157I	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T261I(1)		breast(1)	1	Esophageal squamous(110;0.198)					TCTTTCAAAGGTCCTTCTGTA	0.328																																																1	Substitution - Missense(1)	ovary(1)	19											119.0	118.0	119.0					19																	37038675		1852	4101	5953	41730515	SO:0001583	missense	57711			AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.785C>T	19.37:g.37038675G>A	ENSP00000465578:p.Thr262Ile	Unknown		x	x	x	41730515	K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	ENST00000591340.1	37	CCDS54256.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	8.269	0.812999	0.16537	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.36	-0.197	0.13228	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39009	0.1062	L	0.60845	1.875	0.09310	N	1	B;B	0.16396	0.017;0.003	B;B	0.12837	0.008;0.002	T	0.41215	-0.9521	8	0.87932	D	0	.	4.0756	0.09902	0.2072:0.2083:0.5845:0.0	.	157;229	Q6P280-2;Q6P280	.;ZN529_HUMAN	I	262	.	ENSP00000334695:T262I	T	-	2	0	ZNF529	41730515	0.000000	0.05858	0.000000	0.03702	0.786000	0.44442	-0.617000	0.05584	-0.048000	0.13401	-0.274000	0.10170	ACC		0.328	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452730.1	NM_020951		Missense_Mutation
PRKD2	25865	broad.mit.edu	37	19	47207425	47207425	+	Splice_Site	SNP	C	C	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:47207425C>G	ENST00000291281.4	-	5	1115		c.e5+1		PRKD2_ENST00000601806.1_Splice_Site|PRKD2_ENST00000595515.1_Splice_Site|PRKD2_ENST00000600194.1_Splice_Site|PRKD2_ENST00000433867.1_Splice_Site			Q9BZL6	KPCD2_HUMAN	protein kinase D2						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GCCCAGCTAACCTTTGCATTG	0.607																																																1	Unknown(1)	ovary(1)	19											77.0	73.0	74.0					19																	47207425		2203	4300	6503	51899265	SO:0001630	splice_region_variant	25865			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.889+1G>C	19.37:g.47207425C>G		Unknown		x	x	x	51899265	Q8TB08|Q9P0T6|Q9Y3X8	Splice_Site_SNP	SNP	ENST00000291281.4	37	CCDS12689.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881161	0.51801	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5668	0.50811	0.0:0.9163:0.0:0.0837	.	.	.	.	.	-1	.	.	.	-	.	.	PRKD2	51899265	1.000000	0.71417	0.998000	0.56505	0.398000	0.30690	5.719000	0.68462	2.637000	0.89404	0.448000	0.29417	.		0.607	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	Intron	Splice_Site_SNP
PLEKHA4	57664	broad.mit.edu	37	19	49344562	49344562	+	Silent	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:49344562C>T	ENST00000263265.6	-	17	2304	c.1749G>A	c.(1747-1749)ccG>ccA	p.P583P	PLEKHA4_ENST00000355496.5_Intron	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	583						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.P583P(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GCCGGGCCACCGGGGCCTAGG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	19											19.0	23.0	22.0					19																	49344562		2202	4298	6500	54036374	SO:0001819	synonymous_variant	57664			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1749G>A	19.37:g.49344562C>T		Unknown		x	x	x	54036374	Q8N4M8|Q8N658	Silent	SNP	ENST00000263265.6	37	CCDS12737.1	SNP	23	Broad																																																																																				0.647	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1			Silent
CPT1C	126129	broad.mit.edu	37	19	50214064	50214064	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr19:50214064A>G	ENST00000392518.4	+	16	2188	c.1816A>G	c.(1816-1818)Acg>Gcg	p.T606A	CPT1C_ENST00000354199.5_Missense_Mutation_p.T606A|CPT1C_ENST00000405931.2_Missense_Mutation_p.T595A|CPT1C_ENST00000323446.5_Missense_Mutation_p.T606A|CPT1C_ENST00000598293.1_Missense_Mutation_p.T606A	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	606					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.T606A(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		GCGGTCTTGCACGAGGGAGGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											52.0	49.0	50.0					19																	50214064		2203	4300	6503	54905876	SO:0001583	missense	126129			AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.1816A>G	19.37:g.50214064A>G	ENSP00000376303:p.Thr606Ala	Unknown		x	x	x	54905876	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	ENST00000392518.4	37	CCDS12779.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	a	20.6	4.012745	0.75161	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446	D;D;D;D	0.91180	-1.97;-2.8;-1.97;-1.97	3.96	2.91	0.33838	.	0.208179	0.24236	N	0.040308	D	0.95175	0.8436	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.985;0.991	D	0.94173	0.7425	10	0.72032	D	0.01	-15.2784	8.9624	0.35856	0.8333:0.0:0.0:0.1667	.	595;606	Q8TCG5-2;Q8TCG5	.;CPT1C_HUMAN	A	606;606;595;606	ENSP00000376303:T606A;ENSP00000346138:T606A;ENSP00000384465:T595A;ENSP00000319343:T606A	ENSP00000319343:T606A	T	+	1	0	CPT1C	54905876	1.000000	0.71417	0.954000	0.39281	0.846000	0.48090	5.701000	0.68325	0.675000	0.31264	0.249000	0.18162	ACG		0.577	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465873.1	NM_152359		Missense_Mutation
BIRC6	57448	broad.mit.edu	37	2	32770875	32770875	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:32770875C>T	ENST00000421745.2	+	63	12892	c.12758C>T	c.(12757-12759)gCt>gTt	p.A4253V		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4253					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.A4225V(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGTCTCTCTGCTTTGAGCCAC	0.393																																					Pancreas(94;175 1509 16028 18060 45422)											1	Substitution - Missense(1)	ovary(1)	2											190.0	156.0	168.0					2																	32770875		2203	4300	6503	32624379	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12758C>T	2.37:g.32770875C>T	ENSP00000393596:p.Ala4253Val	Unknown		x	x	x	32624379	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.94	2.386849	0.42308	.	.	ENSG00000115760	ENST00000421745	T	0.73152	-0.72	5.18	5.18	0.71444	.	0.115379	0.64402	D	0.000019	T	0.49304	0.1549	N	0.04508	-0.205	0.80722	D	1	B	0.24618	0.107	B	0.19946	0.027	T	0.48896	-0.8994	10	0.12430	T	0.62	.	18.7585	0.91840	0.0:1.0:0.0:0.0	.	4253	Q9NR09	BIRC6_HUMAN	V	4253	ENSP00000393596:A4253V	ENSP00000393596:A4253V	A	+	2	0	BIRC6	32624379	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.087000	0.71362	2.406000	0.81754	0.586000	0.80456	GCT		0.393	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		Missense_Mutation
MRPS5	64969	broad.mit.edu	37	2	95780880	95780880	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:95780880G>A	ENST00000272418.2	-	3	416	c.208C>T	c.(208-210)Caa>Taa	p.Q70*	MRPS5_ENST00000475040.1_5'UTR	NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	70					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						ATACAGCATTGTGTCTGCAGT	0.463											OREG0014795	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											166.0	149.0	154.0					2																	95780880		2203	4300	6503	95144607	SO:0001587	stop_gained	64969			AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.208C>T	2.37:g.95780880G>A	ENSP00000272418:p.Gln70*	Unknown	1315	x	x	x	95144607	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Nonsense_Mutation	SNP	ENST00000272418.2	37	CCDS2010.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	6.788	0.514427	0.12944	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.08	5.08	0.68730	.	0.329495	0.32416	N	0.006136	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-6.1193	14.1533	0.65401	0.0:0.0:1.0:0.0	.	.	.	.	X	70	.	ENSP00000272418:Q70X	Q	-	1	0	MRPS5	95144607	1.000000	0.71417	0.997000	0.53966	0.033000	0.12548	4.987000	0.63857	2.786000	0.95864	0.563000	0.77884	CAA		0.463	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902		Nonsense_Mutation
TMEM131	23505	broad.mit.edu	37	2	98428988	98428988	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:98428988C>A	ENST00000186436.5	-	17	1987	c.1759G>T	c.(1759-1761)Gac>Tac	p.D587Y		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	587						integral component of membrane (GO:0016021)		p.D474Y(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GATAAACCGTCTCCTATGATA	0.308																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	91.0	94.0					2																	98428988		1820	4079	5899	97795420	SO:0001583	missense	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1759G>T	2.37:g.98428988C>A	ENSP00000186436:p.Asp587Tyr	Unknown		x	x	x	97795420		Missense_Mutation	SNP	ENST00000186436.5	37	CCDS46368.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206548	0.79127	.	.	ENSG00000075568	ENST00000186436	T	0.33216	1.42	5.14	5.14	0.70334	.	0.142496	0.64402	D	0.000006	T	0.37705	0.1013	L	0.32530	0.975	0.80722	D	1	D	0.65815	0.995	P	0.53401	0.725	T	0.09271	-1.0682	10	0.59425	D	0.04	-19.0955	17.3239	0.87242	0.0:1.0:0.0:0.0	.	587	Q92545	TM131_HUMAN	Y	587	ENSP00000186436:D587Y	ENSP00000186436:D587Y	D	-	1	0	TMEM131	97795420	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.115000	0.71566	2.832000	0.97577	0.655000	0.94253	GAC		0.308	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542		Missense_Mutation
GLI2	2736	broad.mit.edu	37	2	121708839	121708839	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:121708839G>A	ENST00000452319.1	+	4	335	c.275G>A	c.(274-276)aGc>aAc	p.S92N	GLI2_ENST00000361492.4_Missense_Mutation_p.S92N|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2									p.S92N(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTCAGCGGCAGCCCTGTCATC	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											99.0	111.0	107.0					2																	121708839		2203	4300	6503	121425309	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.275G>A	2.37:g.121708839G>A	ENSP00000390436:p.Ser92Asn	Unknown		x	x	x	121425309		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962291	0.53400	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.45276	0.9;0.9	5.28	5.28	0.74379	.	0.046510	0.85682	D	0.000000	T	0.67720	0.2923	M	0.78637	2.42	0.80722	D	1	D;D;P	0.89917	1.0;0.976;0.919	D;P;P	0.91635	0.999;0.761;0.45	T	0.70938	-0.4736	10	0.87932	D	0	.	19.1082	0.93305	0.0:0.0:1.0:0.0	.	92;92;92	B4DT63;P10070;Q0VGA0	.;GLI2_HUMAN;.	N	92	ENSP00000390436:S92N;ENSP00000354586:S92N	ENSP00000354586:S92N	S	+	2	0	GLI2	121425309	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.558000	0.73942	2.751000	0.94390	0.555000	0.69702	AGC		0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		Missense_Mutation
MOB4	25843	broad.mit.edu	37	2	198380855	198380855	+	Silent	SNP	G	G	A	rs150417095		TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:198380855G>A	ENST00000323303.4	+	1	300	c.45G>A	c.(43-45)ccG>ccA	p.P15P	MOB4_ENST00000409916.1_Intron|MOB4_ENST00000448447.2_Silent_p.P15P|MOB4_ENST00000497443.1_3'UTR|MOB4_ENST00000409360.1_5'Flank|HSPE1-MOB4_ENST00000604458.1_Intron|MOB4_ENST00000233892.4_Intron	NM_001202485.1|NM_015387.4	NP_001189414.1|NP_056202.2	Q9Y3A3	PHOCN_HUMAN	MOB family member 4, phocein	15					transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	metal ion binding (GO:0046872)	p.P15P(1)									GGAACAGGCCGGGCACCAAGG	0.667																																																1	Substitution - coding silent(1)	ovary(1)	2						G	,,,	0,4404		0,0,2202	44.0	44.0	44.0		45,,45,	0.1	1.0	2	dbSNP_134	44	1,8595		0,1,4297	no	coding-synonymous,intron,coding-synonymous,intron	MOB4,HSPE1-PHOCN	NM_001100819.2,NM_001202485.1,NM_015387.4,NM_199482.3	,,,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,,,	15/205,,15/226,	198380855	1,12999	2202	4298	6500	198089100	SO:0001819	synonymous_variant	25843			AF151853	CCDS2321.1, CCDS2322.1, CCDS46480.1	2q33.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000115540	ENSG00000115540		"""MOB kinase activators"""	17261	protein-coding gene	gene with protein product	"""phocein"", ""phocein, Mob-like protein"""	609361	"""preimplantation protein 3"", ""MOB1, Mps One Binder kinase activator-like 3 (yeast)"""	PREI3, MOBKL3		17853115, 10810093, 11230166, 11319234	Standard	NM_199482		Approved	MOB3, DKFZP564M112, CGI-95, 2C4D, PHOCN		Q9Y3A3	OTTHUMG00000132748	ENST00000323303.4:c.45G>A	2.37:g.198380855G>A		Unknown		x	x	x	198089100	B4DML0|Q53SE0|Q7Z4Y6|Q9H2P3|Q9H5J1|Q9Y4T8	Silent	SNP	ENST00000323303.4	37	CCDS2321.1	SNP	39	Broad																																																																																				0.667	MOB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256110.4	NM_015387		Silent
BCS1L	617	broad.mit.edu	37	2	219527935	219527935	+	Silent	SNP	C	C	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:219527935C>G	ENST00000431802.1	+	8	1785	c.1086C>G	c.(1084-1086)acC>acG	p.T362T	BCS1L_ENST00000412366.1_Silent_p.T362T|BCS1L_ENST00000439945.1_Silent_p.T362T|BCS1L_ENST00000392109.1_Silent_p.T362T|BCS1L_ENST00000392110.2_Silent_p.T362T|BCS1L_ENST00000392111.2_Silent_p.T362T|BCS1L_ENST00000465706.1_3'UTR|BCS1L_ENST00000359273.3_Silent_p.T362T			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	362					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCAGCTGACCCAGATGTTCC	0.572																																																0			2											97.0	98.0	97.0					2																	219527935		2203	4300	6503	219236179	SO:0001819	synonymous_variant	617			AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.1086C>G	2.37:g.219527935C>G		Unknown		x	x	x	219236179	B3KTW9|Q7Z2V7	Silent	SNP	ENST00000431802.1	37	CCDS2419.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	7.608	0.674295	0.14841	.	.	ENSG00000074582	ENST00000426649	.	.	.	5.12	2.23	0.28157	.	.	.	.	.	T	0.57125	0.2032	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48969	-0.8987	4	.	.	.	-11.4629	8.4088	0.32632	0.3918:0.5378:0.0:0.0703	.	.	.	.	A	144	.	.	P	+	1	0	BCS1L	219236179	0.027000	0.19231	0.996000	0.52242	0.984000	0.73092	-0.094000	0.11094	0.275000	0.22094	0.561000	0.74099	CCA		0.572	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336756.1	NM_004328		Silent
FBXO36	130888	broad.mit.edu	37	2	230875525	230875525	+	Silent	SNP	C	C	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr2:230875525C>A	ENST00000283946.3	+	4	510	c.492C>A	c.(490-492)acC>acA	p.T164T	FBXO36_ENST00000373652.3_Silent_p.T133T|FBXO36_ENST00000409992.1_Silent_p.T144T	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	164								p.T164T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGTTCTTCACCAACAAGCTCC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	2											47.0	44.0	45.0					2																	230875525		2203	4300	6503	230583769	SO:0001819	synonymous_variant	130888			BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.492C>A	2.37:g.230875525C>A		Unknown		x	x	x	230583769	B3KVQ6|Q53TE6|Q8WWD4	Silent	SNP	ENST00000283946.3	37	CCDS2472.1	SNP	21	Broad																																																																																				0.532	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256919.2	NM_174899		Silent
PLCB1	23236	broad.mit.edu	37	20	8717739	8717739	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr20:8717739G>C	ENST00000338037.6	+	20	2135	c.2108G>C	c.(2107-2109)gGt>gCt	p.G703A	PLCB1_ENST00000378637.2_Missense_Mutation_p.G703A|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.G703A	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	703	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.G703A(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						GATATGTTTGGTTTGCCTGTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	20											130.0	124.0	126.0					20																	8717739		2203	4300	6503	8665739	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2108G>C	20.37:g.8717739G>C	ENSP00000338185:p.Gly703Ala	Unknown		x	x	x	8665739	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643533	0.87859	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719;ENST00000338061;ENST00000439627	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.43	5.43	0.79202	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.987;1.0	T	0.78476	-0.2189	10	0.87932	D	0	.	19.6011	0.95561	0.0:0.0:1.0:0.0	.	703;703	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	A	703;703;703;623;623;49;22	ENSP00000367908:G703A;ENSP00000338185:G703A;ENSP00000367904:G703A;ENSP00000391162:G22A	ENSP00000338185:G703A	G	+	2	0	PLCB1	8665739	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	9.813000	0.99286	2.703000	0.92315	0.557000	0.71058	GGT		0.368	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			Missense_Mutation
PCNT	5116	broad.mit.edu	37	21	47766096	47766096	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr21:47766096G>T	ENST00000359568.5	+	4	801	c.694G>T	c.(694-696)Gat>Tat	p.D232Y	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	232	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.D232Y(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CGGCCGTGAAGATGAGGCTGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	21											99.0	88.0	91.0					21																	47766096		2203	4300	6503	46590524	SO:0001583	missense	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.694G>T	21.37:g.47766096G>T	ENSP00000352572:p.Asp232Tyr	Unknown		x	x	x	46590524	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445435	0.25987	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01560	4.77	3.27	3.27	0.37495	.	.	.	.	.	T	0.02929	0.0087	N	0.14661	0.345	0.09310	N	1	D;D	0.63046	0.992;0.987	P;P	0.57425	0.82;0.665	T	0.53885	-0.8375	9	0.59425	D	0.04	.	10.2928	0.43605	0.0:0.0:1.0:0.0	.	114;232	O95613-2;O95613	.;PCNT_HUMAN	Y	232;219	ENSP00000352572:D232Y	ENSP00000338675:D219Y	D	+	1	0	PCNT	46590524	0.014000	0.17966	0.018000	0.16275	0.016000	0.09150	1.190000	0.32126	2.164000	0.68074	0.313000	0.20887	GAT		0.557	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		Missense_Mutation
PCNT	5116	broad.mit.edu	37	21	47766901	47766901	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr21:47766901G>T	ENST00000359568.5	+	5	1072	c.965G>T	c.(964-966)gGa>gTa	p.G322V	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	322	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.G322V(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CTCAGGTGTGGACAGGAAGCA	0.662																																																1	Substitution - Missense(1)	ovary(1)	21											43.0	27.0	33.0					21																	47766901		2203	4297	6500	46591329	SO:0001583	missense	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.965G>T	21.37:g.47766901G>T	ENSP00000352572:p.Gly322Val	Unknown		x	x	x	46591329	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	9.966	1.224187	0.22457	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.31510	1.49	5.16	-0.997	0.10215	.	5.653410	0.01056	N	0.004546	T	0.21674	0.0522	L	0.36672	1.1	0.09310	N	1	P;P	0.44734	0.617;0.842	B;B	0.33960	0.173;0.084	T	0.33033	-0.9884	10	0.30078	T	0.28	.	8.3041	0.32032	0.1929:0.5063:0.3009:0.0	.	204;322	O95613-2;O95613	.;PCNT_HUMAN	V	322;309	ENSP00000352572:G322V	ENSP00000338675:G309V	G	+	2	0	PCNT	46591329	0.003000	0.15002	0.000000	0.03702	0.491000	0.33493	0.565000	0.23578	-0.087000	0.12528	0.563000	0.77884	GGA		0.662	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		Missense_Mutation
APOBEC3A	200315	broad.mit.edu	37	22	39353718	39353718	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr22:39353718G>A	ENST00000402255.1	+	2	226	c.22G>A	c.(22-24)Ggg>Agg	p.G8R	APOBEC3A_ENST00000249116.2_Missense_Mutation_p.G8R			P31941	ABC3A_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A	8					cellular response to xenobiotic stimulus (GO:0071466)|clearance of foreign intracellular DNA by conversion of DNA cytidine to uridine (GO:0044356)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|zinc ion binding (GO:0008270)	p.G8R(1)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5	Melanoma(58;0.04)					CCCAGCATCCGGGCCCAGGTA	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											122.0	105.0	111.0					22																	39353718		2199	4299	6498	37683664	SO:0001583	missense	200315			U03891	CCDS13981.1	22q13.1-q13.2	2014-01-28			ENSG00000128383	ENSG00000128383		"""Apolipoprotein B mRNA editing enzymes"""	17343	protein-coding gene	gene with protein product	"""phorbolin I"""	607109				11863358, 10469298	Standard	NM_145699		Approved	ARP3, PHRBN		P31941	OTTHUMG00000151004	ENST00000402255.1:c.22G>A	22.37:g.39353718G>A	ENSP00000384359:p.Gly8Arg	Unknown		x	x	x	37683664	A0AVM1|Q12807|Q5JZ93|Q9UH18	Missense_Mutation	SNP	ENST00000402255.1	37	CCDS13981.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	.	1.423	-0.572341	0.03882	.	.	ENSG00000128383	ENST00000402255;ENST00000249116	T;T	0.61510	0.1;0.1	2.0	-4.0	0.04057	.	.	.	.	.	T	0.16085	0.0387	N	0.00347	-1.61	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.11108	-1.0601	9	0.06099	T	0.92	.	8.1543	0.31160	0.1837:0.0:0.6759:0.1403	.	8;8	B7ZLZ1;P31941	.;ABC3A_HUMAN	R	8	ENSP00000384359:G8R;ENSP00000249116:G8R	ENSP00000249116:G8R	G	+	1	0	APOBEC3A	37683664	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.024000	0.01436	-2.887000	0.00316	-1.305000	0.01319	GGG		0.597	APOBEC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320915.2	NM_145699		Missense_Mutation
FAM208A	23272	broad.mit.edu	37	3	56667289	56667289	+	Missense_Mutation	SNP	A	A	G	rs369681222		TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr3:56667289A>G	ENST00000493960.2	-	18	3540	c.3530T>C	c.(3529-3531)aTt>aCt	p.I1177T	FAM208A_ENST00000355628.5_Missense_Mutation_p.I1116T|FAM208A_ENST00000431842.2_Missense_Mutation_p.I740T	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1177							poly(A) RNA binding (GO:0044822)	p.I740T(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						ACCAGGTACAATATGATCAGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	3						A	THR/ILE,THR/ILE	1,4405	2.1+/-5.4	0,1,2202	162.0	156.0	158.0		3530,2219	1.8	1.0	3		158	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	FAM208A	NM_001112736.1,NM_015224.3	89,89	0,3,6500	GG,GA,AA		0.0233,0.0227,0.0231	benign,benign	1177/1513,740/1234	56667289	3,13003	2203	4300	6503	56642329	SO:0001583	missense	23272			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3530T>C	3.37:g.56667289A>G	ENSP00000417509:p.Ile1177Thr	Unknown		x	x	x	56642329	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	0.607	-0.826682	0.02734	2.27E-4	2.33E-4	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.09163	3.01;3.17;3.2	5.62	1.76	0.24704	.	0.331493	0.29830	N	0.011085	T	0.01661	0.0053	N	0.00186	-1.895	0.20403	N	0.999904	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.44483	-0.9325	10	0.02654	T	1	-0.4561	5.4953	0.16799	0.1979:0.0:0.5605:0.2416	.	1177;1116;740;1177	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	T	740;1177;1116	ENSP00000399410:I740T;ENSP00000417509:I1177T;ENSP00000347845:I1116T	ENSP00000347845:I1116T	I	-	2	0	C3orf63	56642329	0.988000	0.35896	0.997000	0.53966	0.938000	0.57974	1.256000	0.32921	0.110000	0.17919	-0.208000	0.12717	ATT		0.423	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224		Missense_Mutation
ARHGEF3	50650	broad.mit.edu	37	3	56771276	56771276	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr3:56771276G>C	ENST00000296315.3	-	8	1146	c.978C>G	c.(976-978)gaC>gaG	p.D326E	ARHGEF3_ENST00000413728.2_Missense_Mutation_p.D332E|ARHGEF3_ENST00000338458.4_Missense_Mutation_p.D358E|ARHGEF3_ENST00000496106.1_Missense_Mutation_p.D332E|ARHGEF3_ENST00000495373.1_Missense_Mutation_p.D326E|ARHGEF3_ENST00000497267.1_Missense_Mutation_p.D297E	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	326	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D326E(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CGATCAGGGAGTCTTTCTGGC	0.463																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	88.0	89.0					3																	56771276		2203	4300	6503	56746316	SO:0001583	missense	50650			AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.978C>G	3.37:g.56771276G>C	ENSP00000296315:p.Asp326Glu	Unknown		x	x	x	56746316	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360496	0.41801	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267;ENST00000495373	T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57	5.93	3.16	0.36331	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.093762	0.64402	D	0.000001	T	0.17492	0.0420	L	0.34521	1.04	0.45762	D	0.998659	B;B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001;0.001;0.001	B;B;B;B;B;B;B	0.08055	0.001;0.001;0.003;0.001;0.003;0.001;0.003	T	0.07809	-1.0753	10	0.06099	T	0.92	-5.3143	7.8142	0.29249	0.3932:0.0:0.6068:0.0	.	332;297;124;326;358;326;332	E9PG37;E7EU49;Q9NR81-4;C9J586;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;.;ARHG3_HUMAN;.	E	326;358;332;332;297;326	ENSP00000296315:D326E;ENSP00000341071:D358E;ENSP00000410922:D332E;ENSP00000420420:D332E;ENSP00000418826:D297E;ENSP00000417986:D326E	ENSP00000296315:D326E	D	-	3	2	ARHGEF3	56746316	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.521000	0.45563	0.839000	0.34971	0.555000	0.69702	GAC		0.463	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555		Missense_Mutation
PRICKLE2	166336	broad.mit.edu	37	3	64085270	64085270	+	Silent	SNP	G	G	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr3:64085270G>T	ENST00000295902.6	-	8	2577	c.1992C>A	c.(1990-1992)ccC>ccA	p.P664P	PRICKLE2-AS1_ENST00000460946.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2_ENST00000564377.1_Silent_p.P720P	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	664					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P664P(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GTTCACTCATGGGCTGGATCC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	3											68.0	64.0	66.0					3																	64085270		2203	4300	6503	64060310	SO:0001819	synonymous_variant	166336			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1992C>A	3.37:g.64085270G>T		Unknown		x	x	x	64060310	Q0VF44	Silent	SNP	ENST00000295902.6	37	CCDS2902.1	SNP	47	Broad																																																																																				0.617	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859		Silent
CHST2	9435	broad.mit.edu	37	3	142841152	142841152	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr3:142841152T>A	ENST00000309575.3	+	2	2878	c.1494T>A	c.(1492-1494)ttT>ttA	p.F498L		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	498					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						TGGAGGAGTTTTGCTACCAGC	0.602																																																0			3											51.0	54.0	53.0					3																	142841152		2203	4300	6503	144323842	SO:0001583	missense	9435			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1494T>A	3.37:g.142841152T>A	ENSP00000307911:p.Phe498Leu	Unknown		x	x	x	144323842	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	9.329	1.059932	0.19987	.	.	ENSG00000175040	ENST00000309575	D	0.81739	-1.53	4.74	1.06	0.20224	Sulfotransferase domain (1);	0.145674	0.47455	D	0.000233	T	0.48804	0.1520	N	0.00926	-1.1	0.35208	D	0.774872	B	0.33345	0.409	B	0.37550	0.253	T	0.50516	-0.8819	10	0.10902	T	0.67	-3.6959	6.8149	0.23824	0.0:0.4126:0.0:0.5874	.	498	Q9Y4C5	CHST2_HUMAN	L	498	ENSP00000307911:F498L	ENSP00000307911:F498L	F	+	3	2	CHST2	144323842	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.834000	0.27518	0.326000	0.23384	0.496000	0.49642	TTT		0.602	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267		Missense_Mutation
GMPS	8833	broad.mit.edu	37	3	155633844	155633844	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr3:155633844C>G	ENST00000496455.2	+	9	1410	c.1075C>G	c.(1075-1077)Cca>Gca	p.P359A	GMPS_ENST00000295920.7_Missense_Mutation_p.P260A	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	359	GMPS ATP-PPase. {ECO:0000255|PROSITE- ProRule:PRU00886}.				glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)	p.P359A(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	GAACTTGAAACCAGAGGAGGT	0.373			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	1	Substitution - Missense(1)	ovary(1)	3											86.0	79.0	81.0					3																	155633844		1837	4105	5942	157116538	SO:0001583	missense	8833			U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1075C>G	3.37:g.155633844C>G	ENSP00000419851:p.Pro359Ala	Unknown		x	x	x	157116538	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	37	CCDS46941.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	12.76	2.036001	0.35893	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.36	4.49	0.54785	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.118784	0.64402	D	0.000019	T	0.57080	0.2029	L	0.55481	1.735	0.80722	D	1	B;B	0.19817	0.029;0.039	B;B	0.17433	0.018;0.008	T	0.53365	-0.8449	9	0.32370	T	0.25	-3.832	14.0575	0.64779	0.0:0.9271:0.0:0.0729	.	260;359	F8W720;P49915	.;GUAA_HUMAN	A	359;260;308;359	.	ENSP00000295920:P260A	P	+	1	0	GMPS	157116538	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	5.545000	0.67237	1.260000	0.44134	-0.275000	0.10095	CCA		0.373	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2			Missense_Mutation
ENAM	10117	broad.mit.edu	37	4	71508194	71508194	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr4:71508194A>G	ENST00000396073.3	+	9	1332	c.1051A>G	c.(1051-1053)Aga>Gga	p.R351G	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	351					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.R351G(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			GCCTTTTTACAGAAATCAACA	0.413																																																1	Substitution - Missense(1)	ovary(1)	4											97.0	99.0	98.0					4																	71508194		2203	4300	6503	71727058	SO:0001583	missense	10117			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1051A>G	4.37:g.71508194A>G	ENSP00000379383:p.Arg351Gly	Unknown		x	x	x	71727058	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	10.87	1.471566	0.26423	.	.	ENSG00000132464	ENST00000396073	T	0.35789	1.29	5.83	0.344	0.16006	.	0.138317	0.32753	N	0.005682	T	0.50718	0.1632	M	0.70787	2.145	0.09310	N	1	D	0.76494	0.999	D	0.70016	0.967	T	0.39057	-0.9632	10	0.33141	T	0.24	-13.6848	9.439	0.38657	0.621:0.2604:0.1186:0.0	.	351	Q9NRM1	ENAM_HUMAN	G	351	ENSP00000379383:R351G	ENSP00000379383:R351G	R	+	1	2	ENAM	71727058	0.935000	0.31712	0.962000	0.40283	0.003000	0.03518	-0.126000	0.10563	0.288000	0.22398	-0.331000	0.08364	AGA		0.413	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889		Missense_Mutation
ZNF622	90441	broad.mit.edu	37	5	16451862	16451862	+	Silent	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr5:16451862C>T	ENST00000308683.2	-	6	1464	c.1338G>A	c.(1336-1338)caG>caA	p.Q446Q		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	446					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q446Q(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						TTTGGACATACTGCATGTCTC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	5											187.0	165.0	173.0					5																	16451862		2203	4300	6503	16504862	SO:0001819	synonymous_variant	90441			AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.1338G>A	5.37:g.16451862C>T		Unknown		x	x	x	16504862		Silent	SNP	ENST00000308683.2	37	CCDS3886.1	SNP	20	Broad																																																																																				0.428	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414		Silent
TRIM23	373	broad.mit.edu	37	5	64892337	64892337	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr5:64892337T>G	ENST00000231524.9	-	9	1702	c.1331A>C	c.(1330-1332)gAa>gCa	p.E444A	TRIM23_ENST00000274327.7_Missense_Mutation_p.E444A|TRIM23_ENST00000381018.3_Missense_Mutation_p.E444A	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	444	ARF-like.				GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E444A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		ATTTTTATATTCTACAGTTTC	0.294																																																1	Substitution - Missense(1)	ovary(1)	5											92.0	92.0	92.0					5																	64892337		2202	4291	6493	64928093	SO:0001583	missense	373			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.1331A>C	5.37:g.64892337T>G	ENSP00000231524:p.Glu444Ala	Unknown		x	x	x	64928093	Q9BZY4|Q9BZY5	Missense_Mutation	SNP	ENST00000231524.9	37	CCDS3987.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	25.1	4.603665	0.87157	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.63580	-0.05;-0.05;-0.05	5.72	5.72	0.89469	Small GTP-binding protein domain (1);	0.044953	0.85682	D	0.000000	T	0.74007	0.3660	M	0.67700	2.07	0.80722	D	1	P;D;D	0.59357	0.939;0.985;0.962	P;P;P	0.56823	0.778;0.807;0.67	T	0.77451	-0.2583	10	0.87932	D	0	.	15.9946	0.80230	0.0:0.0:0.0:1.0	.	444;444;444	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	A	444	ENSP00000231524:E444A;ENSP00000370406:E444A;ENSP00000274327:E444A	ENSP00000231524:E444A	E	-	2	0	TRIM23	64928093	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.966000	0.87956	2.184000	0.69523	0.397000	0.26171	GAA		0.294	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215058.2	NM_001656		Missense_Mutation
SERINC5	256987	broad.mit.edu	37	5	79446708	79446708	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr5:79446708C>A	ENST00000507668.2	-	9	1200	c.1050G>T	c.(1048-1050)ttG>ttT	p.L350F	SERINC5_ENST00000512972.2_Missense_Mutation_p.L350F|SERINC5_ENST00000509193.1_Missense_Mutation_p.L348F|SERINC5_ENST00000512721.1_Missense_Mutation_p.L350F	NM_001174071.1|NM_178276.5	NP_001167542.1|NP_840060.1	Q86VE9	SERC5_HUMAN	serine incorporator 5	350					myelination (GO:0042552)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	L-serine transmembrane transporter activity (GO:0015194)	p.L349F(1)		endometrium(3)|kidney(1)|lung(3)|ovary(1)	8		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)		AACTTACCTCCAATTCAGGAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											119.0	119.0	119.0					5																	79446708		2025	4180	6205	79482464	SO:0001583	missense	256987			AF498273	CCDS54874.1	5q14.1	2014-01-28	2005-10-14	2005-10-14		ENSG00000164300			18825	protein-coding gene	gene with protein product		614551	"""chromosome 5 open reading frame 12"""	C5orf12		12688535	Standard	NM_178276		Approved	TPO1	uc011ctj.2	Q86VE9		ENST00000507668.2:c.1050G>T	5.37:g.79446708C>A	ENSP00000426237:p.Leu350Phe	Unknown		x	x	x	79482464	B4DMH7|Q495A4|Q495A6	Missense_Mutation	SNP	ENST00000507668.2	37	CCDS54873.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	7.964	0.747649	0.15710	.	.	ENSG00000164300	ENST00000507668;ENST00000329637;ENST00000509193;ENST00000512972;ENST00000512721	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	4.92	0.704	0.18121	.	0.769559	0.12016	N	0.507413	T	0.05318	0.0141	N	0.11284	0.12	0.32343	N	0.559548	B;B;B;B	0.20368	0.016;0.002;0.044;0.016	B;B;B;B	0.23419	0.027;0.003;0.046;0.027	T	0.43491	-0.9388	10	0.07325	T	0.83	.	3.7547	0.08581	0.1768:0.4406:0.0:0.3826	.	350;350;348;350	B4DMH7;Q86VE9-2;D6RHG7;Q86VE9	.;.;.;SERC5_HUMAN	F	350;349;348;350;350	ENSP00000426237:L350F;ENSP00000426134:L348F;ENSP00000421665:L350F;ENSP00000420863:L350F	ENSP00000327542:L349F	L	-	3	2	SERINC5	79482464	0.568000	0.26635	0.833000	0.33012	0.893000	0.52053	-0.278000	0.08490	0.187000	0.20147	0.643000	0.83706	TTG		0.448	SERINC5-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_178276		Missense_Mutation
RASGRF2	5924	broad.mit.edu	37	5	80409390	80409390	+	Missense_Mutation	SNP	C	C	A	rs189697457		TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr5:80409390C>A	ENST00000265080.4	+	15	2188	c.2121C>A	c.(2119-2121)aaC>aaA	p.N707K	CTD-2193P3.2_ENST00000508993.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	707	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N707K(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CCAGCCAGAACAACAGAGGTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	99.0	99.0					5																	80409390		2203	4300	6503	80445146	SO:0001583	missense	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2121C>A	5.37:g.80409390C>A	ENSP00000265080:p.Asn707Lys	Unknown		x	x	x	80445146	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669649	0.47677	.	.	ENSG00000113319	ENST00000265080	T	0.49720	0.77	5.31	2.58	0.30949	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.272201	0.41823	D	0.000817	T	0.44008	0.1273	L	0.57536	1.79	0.41127	D	0.985859	B	0.21225	0.053	B	0.30716	0.119	T	0.32188	-0.9916	10	0.33940	T	0.23	.	9.8584	0.41098	0.0:0.777:0.0:0.223	.	707	O14827	RGRF2_HUMAN	K	707	ENSP00000265080:N707K	ENSP00000265080:N707K	N	+	3	2	RASGRF2	80445146	0.245000	0.23899	0.980000	0.43619	0.994000	0.84299	0.119000	0.15626	0.644000	0.30656	0.650000	0.86243	AAC		0.458	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		Missense_Mutation
VCAN	1462	broad.mit.edu	37	5	82837526	82837526	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr5:82837526G>C	ENST00000265077.3	+	8	9269	c.8704G>C	c.(8704-8706)Gaa>Caa	p.E2902Q	VCAN_ENST00000343200.5_Missense_Mutation_p.E1915Q|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2902	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.E2902Q(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGAACCTTCAGAAGATGATGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											70.0	75.0	73.0					5																	82837526		2203	4300	6503	82873282	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8704G>C	5.37:g.82837526G>C	ENSP00000265077:p.Glu2902Gln	Unknown		x	x	x	82873282	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842274	0.51057	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.23950	1.88;1.88	5.3	4.42	0.53409	.	0.307999	0.28301	N	0.015841	T	0.34308	0.0893	M	0.62723	1.935	0.09310	N	0.999995	D;D	0.60575	0.98;0.988	P;P	0.53649	0.731;0.676	T	0.20571	-1.0271	10	0.49607	T	0.09	.	7.2775	0.26292	0.1289:0.1638:0.7074:0.0	.	1915;2902	P13611-2;P13611	.;CSPG2_HUMAN	Q	2902;1915	ENSP00000265077:E2902Q;ENSP00000340062:E1915Q	ENSP00000265077:E2902Q	E	+	1	0	VCAN	82873282	0.089000	0.21612	0.521000	0.27850	0.220000	0.24768	0.709000	0.25734	2.861000	0.98227	0.655000	0.94253	GAA		0.383	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		Missense_Mutation
RIOK1	83732	broad.mit.edu	37	6	7395357	7395357	+	Silent	SNP	T	T	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr6:7395357T>C	ENST00000379834.2	+	3	855	c.348T>C	c.(346-348)ttT>ttC	p.F116F		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	116							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.F109F(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					TACGGAAATTTGAGAATAAAA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	6											42.0	40.0	41.0					6																	7395357		2203	4300	6503	7340356	SO:0001819	synonymous_variant	83732			BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.348T>C	6.37:g.7395357T>C		Unknown		x	x	x	7340356	B2RB28|Q8NDC8|Q96NV9	Silent	SNP	ENST00000379834.2	37	CCDS4500.1	SNP	63	Broad																																																																																				0.383	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039780.2	NM_031480		Silent
VEGFA	7422	broad.mit.edu	37	6	43746215	43746215	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr6:43746215C>T	ENST00000523873.1	+	4	372	c.334C>T	c.(334-336)Cac>Tac	p.H112Y	VEGFA_ENST00000482630.2_Missense_Mutation_p.H292Y|VEGFA_ENST00000520948.1_Missense_Mutation_p.H112Y|VEGFA_ENST00000372055.4_Missense_Mutation_p.H292Y|VEGFA_ENST00000372064.4_Missense_Mutation_p.H292Y|VEGFA_ENST00000324450.6_Missense_Mutation_p.H292Y|VEGFA_ENST00000230480.6_Missense_Mutation_p.H84Y|VEGFA_ENST00000457104.2_Missense_Mutation_p.H112Y|VEGFA_ENST00000372077.4_Missense_Mutation_p.H112Y|VEGFA_ENST00000523950.1_Missense_Mutation_p.H112Y|VEGFA_ENST00000417285.2_Missense_Mutation_p.H292Y|VEGFA_ENST00000425836.2_Missense_Mutation_p.H292Y|VEGFA_ENST00000523125.1_Missense_Mutation_p.H112Y|VEGFA_ENST00000518824.1_Missense_Mutation_p.H112Y|VEGFA_ENST00000372067.3_Missense_Mutation_p.H292Y|VEGFA_ENST00000518689.1_Missense_Mutation_p.H112Y|VEGFA_ENST00000413642.3_Missense_Mutation_p.H292Y			P15692	VEGFA_HUMAN	vascular endothelial growth factor A	112					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)	p.H292Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	GATCAAACCTCACCAAGGCCA	0.517																																																1	Substitution - Missense(1)	ovary(1)	6											128.0	100.0	110.0					6																	43746215		2203	4300	6503	43854193	SO:0001583	missense	7422			AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745	ENST00000523873.1:c.334C>T	6.37:g.43746215C>T	ENSP00000430479:p.His112Tyr	Unknown		x	x	x	43854193	B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	Missense_Mutation	SNP	ENST00000523873.1	37	CCDS55010.1	SNP	29	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.38|10.38	1.334339|1.334339	0.24253|0.24253	.|.	.|.	ENSG00000112715|ENSG00000112715	ENST00000372067;ENST00000324450;ENST00000417285;ENST00000413642;ENST00000372055;ENST00000482630;ENST00000425836;ENST00000372064;ENST00000372077;ENST00000520948;ENST00000523873;ENST00000523950;ENST00000457104;ENST00000518689;ENST00000523125;ENST00000518824;ENST00000230480|ENST00000519767	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.79141|.	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24|.	5.71|5.71	5.71|5.71	0.89125|0.89125	Platelet-derived growth factor (PDGF) (3);|.	0.418216|.	0.28026|.	N|.	0.016885|.	T|T	0.62901|0.62901	0.2466|0.2466	L|L	0.49350|0.49350	1.555|1.555	0.47214|0.47214	D|D	0.999355|0.999355	B;B;B;P;B;D;B;B|.	0.76494|.	0.009;0.198;0.007;0.676;0.016;0.999;0.126;0.055|.	B;B;B;B;B;D;B;B|.	0.85130|.	0.018;0.159;0.019;0.421;0.028;0.997;0.07;0.072|.	T|T	0.58154|0.58154	-0.7686|-0.7686	10|5	0.09084|.	T|.	0.74|.	-17.5583|-17.5583	18.8433|18.8433	0.92194|0.92194	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	112;292;112;292;112;292;292;112|.	P15692-10;P15692-12;P15692-8;P15692-14;P15692-3;P15692-13;P15692-11;P15692|.	.;.;.;.;.;.;.;VEGFA_HUMAN|.	Y|L	292;292;292;292;292;292;292;292;112;112;112;112;112;112;112;112;84|263	ENSP00000361137:H292Y;ENSP00000317598:H292Y;ENSP00000388663:H292Y;ENSP00000389864:H292Y;ENSP00000361125:H292Y;ENSP00000421561:H292Y;ENSP00000388465:H292Y;ENSP00000361134:H292Y;ENSP00000361148:H112Y;ENSP00000428321:H112Y;ENSP00000430479:H112Y;ENSP00000429643:H112Y;ENSP00000409911:H112Y;ENSP00000430829:H112Y;ENSP00000429008:H112Y;ENSP00000430002:H112Y;ENSP00000230480:H84Y|.	ENSP00000230480:H84Y|.	H|S	+|+	1|2	0|0	VEGFA|VEGFA	43854193|43854193	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.849000|2.849000	0.48286|0.48286	2.707000|2.707000	0.92482|0.92482	0.561000|0.561000	0.74099|0.74099	CAC|TCA		0.517	VEGFA-021	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374460.1	NM_001025366		Missense_Mutation
TSPAN33	340348	broad.mit.edu	37	7	128806678	128806678	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr7:128806678C>G	ENST00000289407.4	+	6	628	c.519C>G	c.(517-519)tgC>tgG	p.C173W	Y_RNA_ENST00000363759.1_RNA|RP11-286H14.6_ENST00000498745.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	173					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)	p.C173W(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						ATTTCAACTGCTCAGAAGACA	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											280.0	249.0	260.0					7																	128806678		2203	4300	6503	128593914	SO:0001583	missense	340348				CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.519C>G	7.37:g.128806678C>G	ENSP00000289407:p.Cys173Trp	Unknown		x	x	x	128593914		Missense_Mutation	SNP	ENST00000289407.4	37	CCDS5810.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340552	0.60963	.	.	ENSG00000158457	ENST00000289407	T	0.79352	-1.26	5.68	2.66	0.31614	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	D	0.88672	0.6500	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87603	0.2498	10	0.87932	D	0	-26.7103	9.4641	0.38802	0.0:0.8274:0.0:0.1726	.	173	Q86UF1	TSN33_HUMAN	W	173	ENSP00000289407:C173W	ENSP00000289407:C173W	C	+	3	2	TSPAN33	128593914	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	0.836000	0.27545	0.225000	0.20959	0.655000	0.94253	TGC		0.517	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350983.1	NM_178562		Missense_Mutation
AGK	55750	broad.mit.edu	37	7	141315310	141315310	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr7:141315310G>A	ENST00000355413.4	+	8	723	c.463G>A	c.(463-465)Gga>Aga	p.G155R	AGK_ENST00000535825.1_Missense_Mutation_p.G152R|AGK_ENST00000473247.1_Missense_Mutation_p.G127R	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	155	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.G155R(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					TATCCCACTGGGAGAGACCAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	7											182.0	184.0	183.0					7																	141315310		2203	4300	6503	140961779	SO:0001583	missense	55750			BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.463G>A	7.37:g.141315310G>A	ENSP00000347581:p.Gly155Arg	Unknown		x	x	x	140961779	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	ENST00000355413.4	37	CCDS5865.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812770	0.90707	.	.	ENSG00000006530	ENST00000355413;ENST00000473247;ENST00000535825	D;D;D	0.91792	-2.91;-2.91;-2.91	5.2	5.2	0.72013	ATP-NAD kinase, PpnK-type, alpha/beta (1);Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.97679	0.9239	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99035	1.0822	10	0.87932	D	0	.	17.8583	0.88773	0.0:0.0:1.0:0.0	.	155	Q53H12	AGK_HUMAN	R	155;127;152	ENSP00000347581:G155R;ENSP00000420776:G127R;ENSP00000444349:G152R	ENSP00000347581:G155R	G	+	1	0	AGK	140961779	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.392000	0.79840	2.581000	0.87130	0.591000	0.81541	GGA		0.448	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348969.1	NM_018238		Missense_Mutation
CYP7A1	1581	broad.mit.edu	37	8	59404148	59404148	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr8:59404148C>G	ENST00000301645.3	-	6	1538	c.1401G>C	c.(1399-1401)ttG>ttC	p.L467F		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	467					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.L467F(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CTATAAGCTCCAATTCAAAAT	0.413									Neonatal Giant Cell Hepatitis																																							1	Substitution - Missense(1)	ovary(1)	8											60.0	62.0	61.0					8																	59404148		2203	4300	6503	59566702	SO:0001583	missense	1581	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1401G>C	8.37:g.59404148C>G	ENSP00000301645:p.Leu467Phe	Unknown		x	x	x	59566702	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	CCDS6171.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822808	0.50739	.	.	ENSG00000167910	ENST00000301645	T	0.13089	2.62	5.87	0.128	0.14733	.	0.178708	0.64402	D	0.000018	T	0.07503	0.0189	L	0.33293	1	0.42490	D	0.992899	P	0.49783	0.928	B	0.38985	0.287	T	0.44236	-0.9341	10	0.21014	T	0.42	-5.7947	6.4972	0.22148	0.107:0.5288:0.0:0.3641	.	467	P22680	CP7A1_HUMAN	F	467	ENSP00000301645:L467F	ENSP00000301645:L467F	L	-	3	2	CYP7A1	59566702	0.857000	0.29778	0.990000	0.47175	0.720000	0.41350	0.006000	0.13152	-0.185000	0.10550	0.655000	0.94253	TTG		0.413	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780		Missense_Mutation
HNF4G	3174	broad.mit.edu	37	8	76476246	76476246	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr8:76476246G>A	ENST00000354370.1	+	11	1412	c.1142G>A	c.(1141-1143)gGc>gAc	p.G381D	HNF4G_ENST00000396423.2_Missense_Mutation_p.G418D			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	381					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.G381D(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CCACCACAAGGCTCTGGGCAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											200.0	185.0	190.0					8																	76476246		2203	4300	6503	76638801	SO:0001583	missense	3174				CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.1142G>A	8.37:g.76476246G>A	ENSP00000346339:p.Gly381Asp	Unknown		x	x	x	76638801	Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	ENST00000354370.1	37		SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041816	0.75732	.	.	ENSG00000164749	ENST00000354370;ENST00000396423	T;T	0.71817	-0.6;-0.6	5.72	4.83	0.62350	.	1.637000	0.03177	N	0.171608	T	0.79610	0.4475	M	0.63843	1.955	0.43191	D	0.995022	P;P	0.48998	0.918;0.918	P;P	0.47827	0.558;0.558	T	0.66069	-0.6015	10	0.72032	D	0.01	.	16.6153	0.84909	0.0:0.1301:0.8699:0.0	.	418;381	F1D8Q4;Q14541	.;HNF4G_HUMAN	D	381;418	ENSP00000346339:G381D;ENSP00000379701:G418D	ENSP00000346339:G381D	G	+	2	0	HNF4G	76638801	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.767000	0.55288	1.382000	0.46385	0.655000	0.94253	GGC		0.448	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133		Missense_Mutation
NDRG1	10397	broad.mit.edu	37	8	134260120	134260120	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr8:134260120C>T	ENST00000414097.2	-	12	1672	c.805G>A	c.(805-807)Gtg>Atg	p.V269M	NDRG1_ENST00000521414.1_5'UTR|NDRG1_ENST00000522476.1_Missense_Mutation_p.V203M|NDRG1_ENST00000537882.1_Missense_Mutation_p.V188M|NDRG1_ENST00000354944.5_Missense_Mutation_p.V199M|NDRG1_ENST00000518176.1_Intron|NDRG1_ENST00000518066.1_Intron|NDRG1_ENST00000323851.7_Missense_Mutation_p.V269M	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	269					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)	p.V269M(1)	NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CTACATACCACGGCATCCACT	0.517			T	ERG	prostate																																		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	1	Substitution - Missense(1)	ovary(1)	8											95.0	97.0	96.0					8																	134260120		2203	4300	6503	134329302	SO:0001583	missense	10397			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.805G>A	8.37:g.134260120C>T	ENSP00000404854:p.Val269Met	Unknown		x	x	x	134329302	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	ENST00000414097.2	37	CCDS34945.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506041	0.64410	.	.	ENSG00000104419	ENST00000323851;ENST00000354944;ENST00000414097;ENST00000537882;ENST00000535532;ENST00000522476	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.58	5.58	0.84498	.	0.058563	0.64402	D	0.000002	T	0.60183	0.2249	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.68364	-0.5428	10	0.87932	D	0	-40.4611	18.5557	0.91083	0.0:1.0:0.0:0.0	.	269	Q92597	NDRG1_HUMAN	M	269;199;269;188;97;203	ENSP00000319977:V269M;ENSP00000347028:V199M;ENSP00000404854:V269M;ENSP00000437443:V188M;ENSP00000427894:V203M	ENSP00000319977:V269M	V	-	1	0	NDRG1	134329302	1.000000	0.71417	0.960000	0.40013	0.066000	0.16364	7.461000	0.80834	2.640000	0.89533	0.561000	0.74099	GTG		0.517	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378805.1			Missense_Mutation
DDX58	23586	broad.mit.edu	37	9	32485257	32485257	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr9:32485257G>A	ENST00000379883.2	-	10	1553	c.1396C>T	c.(1396-1398)Cgg>Tgg	p.R466W	DDX58_ENST00000542096.1_Missense_Mutation_p.R395W|DDX58_ENST00000379868.1_Missense_Mutation_p.R263W|DDX58_ENST00000545044.1_Missense_Mutation_p.R263W|DDX58_ENST00000379882.1_Missense_Mutation_p.R421W	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	466	Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.R466W(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TCGCTAATCCGTGATTCCACT	0.373																																																1	Substitution - Missense(1)	ovary(1)	9											120.0	118.0	118.0					9																	32485257		2203	4300	6503	32475257	SO:0001583	missense	23586			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.1396C>T	9.37:g.32485257G>A	ENSP00000369213:p.Arg466Trp	Unknown		x	x	x	32475257	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	16.58	3.164293	0.57476	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096;ENST00000545044	T;T;T;T;T	0.11604	3.28;3.29;3.19;3.15;2.76	4.95	4.02	0.46733	.	0.203371	0.33110	N	0.005273	T	0.36524	0.0970	M	0.87381	2.88	0.24928	N	0.991933	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.994;0.986;0.996	T	0.26087	-1.0113	10	0.66056	D	0.02	-7.9665	12.4751	0.55809	0.0:0.0:0.8314:0.1686	.	263;421;395;466	F5H5W6;O95786-2;B3KWW1;O95786	.;.;.;DDX58_HUMAN	W	421;466;263;395;263	ENSP00000369212:R421W;ENSP00000369213:R466W;ENSP00000369197:R263W;ENSP00000442160:R395W;ENSP00000443055:R263W	ENSP00000369197:R263W	R	-	1	2	DDX58	32475257	0.002000	0.14202	0.789000	0.31954	0.708000	0.40852	0.302000	0.19192	1.166000	0.42689	0.655000	0.94253	CGG		0.373	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314		Missense_Mutation
KIF24	347240	broad.mit.edu	37	9	34257626	34257626	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr9:34257626T>C	ENST00000402558.2	-	10	2003	c.1979A>G	c.(1978-1980)aAa>aGa	p.K660R	KIF24_ENST00000345050.2_Missense_Mutation_p.K526R|KIF24_ENST00000379166.2_Missense_Mutation_p.K660R|KIF24_ENST00000379174.3_Missense_Mutation_p.K526R			Q5T7B8	KIF24_HUMAN	kinesin family member 24	660					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			TTCTGGCTTTTTTTTGGCCAC	0.527																																																0			9											63.0	64.0	64.0					9																	34257626		2203	4300	6503	34247626	SO:0001583	missense	347240			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.1979A>G	9.37:g.34257626T>C	ENSP00000384433:p.Lys660Arg	Unknown		x	x	x	34247626	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	14.49	2.550744	0.45383	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;D;T;D	0.83506	-1.38;-1.73;-1.38;-1.73	5.69	5.69	0.88448	.	0.000000	0.45126	D	0.000400	D	0.91129	0.7207	M	0.81497	2.545	0.38403	D	0.945724	D	0.89917	1.0	D	0.83275	0.996	D	0.92821	0.6272	10	0.59425	D	0.04	.	15.1232	0.72460	0.0:0.0:0.0:1.0	.	660	Q5T7B8	KIF24_HUMAN	R	660;526;660;526;660	ENSP00000384433:K660R;ENSP00000368472:K526R;ENSP00000368464:K660R;ENSP00000340179:K526R	ENSP00000340179:K526R	K	-	2	0	KIF24	34247626	0.996000	0.38824	0.122000	0.21767	0.011000	0.07611	2.852000	0.48310	2.162000	0.67917	0.533000	0.62120	AAA		0.527	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			Missense_Mutation
ACE2	59272	broad.mit.edu	37	X	15596408	15596408	+	Silent	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chrX:15596408G>A	ENST00000252519.3	-	9	1203	c.1101C>T	c.(1099-1101)gaC>gaT	p.D367D	ACE2_ENST00000427411.1_Silent_p.D367D			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	367					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.D367D(2)		endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	TCAGGAAGTCGTCCATTGTCA	0.408																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	X											93.0	75.0	81.0					X																	15596408		2203	4300	6503	15506329	SO:0001819	synonymous_variant	59272			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.1101C>T	X.37:g.15596408G>A		Unknown		x	x	x	15506329	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Silent	SNP	ENST00000252519.3	37	CCDS14169.1	SNP	40	Broad																																																																																				0.408	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			Silent
MAGEB6	158809	broad.mit.edu	37	X	26212380	26212380	+	Silent	SNP	C	C	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chrX:26212380C>A	ENST00000379034.1	+	2	566	c.417C>A	c.(415-417)tcC>tcA	p.S139S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	139	Ser-rich.							p.S139S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						CAAGCACTTCCCATGATGTCT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	X											83.0	77.0	79.0					X																	26212380		2202	4300	6502	26122301	SO:0001819	synonymous_variant	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.417C>A	X.37:g.26212380C>A		Unknown		x	x	x	26122301	Q6GS19|Q9H219	Silent	SNP	ENST00000379034.1	37	CCDS14217.1	SNP	22	Broad																																																																																				0.542	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		Silent
DMD	1756	broad.mit.edu	37	X	31165530	31165530	+	Silent	SNP	G	G	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chrX:31165530G>T	ENST00000357033.4	-	75	10865	c.10659C>A	c.(10657-10659)ccC>ccA	p.P3553P	DMD_ENST00000378680.2_Silent_p.P375P|DMD_ENST00000361471.4_Silent_p.P472P|DMD_ENST00000343523.2_Silent_p.P983P|DMD_ENST00000541735.1_Silent_p.P983P|DMD_ENST00000378723.3_Silent_p.P485P|DMD_ENST00000474231.1_Silent_p.P1093P|DMD_ENST00000378677.2_Silent_p.P3549P|DMD_ENST00000378707.3_Silent_p.P1093P|DMD_ENST00000359836.1_Silent_p.P1080P|DMD_ENST00000378702.4_Silent_p.P485P	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3553					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.P3548P(1)|p.P1093P(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CAGCATCCCGGGGACTCTGGG	0.557																																																2	Substitution - coding silent(2)	ovary(2)	X											67.0	54.0	58.0					X																	31165530		2202	4300	6502	31075451	SO:0001819	synonymous_variant	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10659C>A	X.37:g.31165530G>T		Unknown		x	x	x	31075451	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	9.181	1.023598	0.19433	.	.	ENSG00000198947	ENST00000465285	T	0.03181	4.02	4.62	2.82	0.32997	.	0.000000	0.34879	U	0.003610	T	0.04770	0.0129	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51764	-0.8664	6	.	.	.	.	3.4664	0.07552	0.085:0.1438:0.4711:0.3001	.	.	.	.	T	1282	ENSP00000420046:P1282T	.	P	-	1	0	DMD	31075451	0.390000	0.25213	1.000000	0.80357	0.993000	0.82548	-0.379000	0.07437	0.380000	0.24823	-0.371000	0.07208	CCG		0.557	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Silent
PSMD10	5716	broad.mit.edu	37	X	107328302	107328302	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chrX:107328302C>T	ENST00000217958.3	-	5	680	c.583G>A	c.(583-585)Gga>Aga	p.G195R	PSMD10_ENST00000361815.5_3'UTR|PSMD10_ENST00000372295.1_Missense_Mutation_p.G154R|PSMD10_ENST00000372296.1_3'UTR|PSMD10_ENST00000340200.5_Missense_Mutation_p.G162R	NM_002814.3|NM_170750.2	NP_002805.1|NP_736606.1	O75832	PSD10_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 10	195	Interaction with RB1.|Interaction with RELA.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell growth (GO:0030307)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	transcription factor binding (GO:0008134)	p.G195R(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						ATACTTGCTCCTTGGGACACC	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											154.0	151.0	152.0					X																	107328302		2203	4300	6503	107214958	SO:0001583	missense	5716			AB009619	CCDS14536.1, CCDS14537.1	Xq22.3	2013-01-10			ENSG00000101843	ENSG00000101843		"""Proteasome (prosome, macropain) subunits"", ""Ankyrin repeat domain containing"""	9555	protein-coding gene	gene with protein product	"""gankyrin"""	300880				9714768	Standard	NM_002814		Approved	p28	uc004enp.2	O75832	OTTHUMG00000022177	ENST00000217958.3:c.583G>A	X.37:g.107328302C>T	ENSP00000217958:p.Gly195Arg	Unknown		x	x	x	107214958	Q5U0B2|Q8IZK9	Missense_Mutation	SNP	ENST00000217958.3	37	CCDS14536.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	27.8	4.859685	0.91433	.	.	ENSG00000101843	ENST00000217958;ENST00000372295;ENST00000340200	T;T;T	0.65549	-0.16;-0.16;-0.16	4.98	4.98	0.66077	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88182	0.2871	10	0.72032	D	0.01	-12.0119	17.6919	0.88270	0.0:1.0:0.0:0.0	.	195	O75832	PSD10_HUMAN	R	195;154;162	ENSP00000217958:G195R;ENSP00000361369:G154R;ENSP00000345963:G162R	ENSP00000217958:G195R	G	-	1	0	PSMD10	107214958	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	7.272000	0.78516	2.452000	0.82932	0.594000	0.82650	GGA		0.443	PSMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057868.1	NM_170750		Missense_Mutation
ZNF280C	55609	broad.mit.edu	37	X	129377604	129377604	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chrX:129377604G>A	ENST00000370978.4	-	5	467	c.314C>T	c.(313-315)tCg>tTg	p.S105L		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	105	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S105L(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						AAATCTAGGCGAGGCAGCCAC	0.358																																																1	Substitution - Missense(1)	ovary(1)	X											62.0	65.0	64.0					X																	129377604		2203	4300	6503	129205285	SO:0001583	missense	55609			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.314C>T	X.37:g.129377604G>A	ENSP00000360017:p.Ser105Leu	Unknown		x	x	x	129205285	A8K2V8|Q9NXR3	Missense_Mutation	SNP	ENST00000370978.4	37	CCDS14622.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.338275	0.01287	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.20881	2.04;2.04	3.76	-2.51	0.06365	.	.	.	.	.	T	0.06600	0.0169	N	0.02315	-0.6	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.002;0.003	T	0.42849	-0.9427	9	0.09084	T	0.74	.	9.2955	0.37813	0.3185:0.0:0.6815:0.0	.	105;105	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	L	105	ENSP00000360017:S105L;ENSP00000408521:S105L	ENSP00000066465:S105L	S	-	2	0	ZNF280C	129205285	0.005000	0.15991	0.001000	0.08648	0.007000	0.05969	0.628000	0.24522	-0.704000	0.05042	-1.352000	0.01234	TCG		0.358	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666		Missense_Mutation
FLNA	2316	broad.mit.edu	37	X	153593316	153593317	+	Missense_Mutation	DNP	TT	TT	CC			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chrX:153593316_153593317TT>CC	ENST00000369850.3	-	12	1936_1937	c.1700_1701AA>GG	c.(1699-1701)gAA>gGG	p.E567G	FLNA_ENST00000422373.1_Missense_Mutation_p.E567G|FLNA_ENST00000360319.4_Missense_Mutation_p.E567G|FLNA_ENST00000344736.4_Missense_Mutation_p.E567G	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	567					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.E567G(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCACCTTCACTTCGAAGGGACT	0.639																																																1	Substitution - Missense(1)	ovary(1)	X																																								153246511	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1700_1701delinsCC	X.37:g.153593316_153593317delinsCC	ENSP00000358866:p.Glu567Gly	Unknown		x	x	x	153246510	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	DNP	ENST00000369850.3	37	CCDS48194.1	DNP	56	Broad																																																																																				0.639	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			Missense_Mutation
TRPV2	51393	broad.mit.edu	37	17	16335366	16335367	+	Frame_Shift_Ins	INS	-	-	A			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr17:16335366_16335367insA	ENST00000338560.7	+	12	2140_2141	c.1741_1742insA	c.(1741-1743)cagfs	p.Q581fs	TRPV2_ENST00000577397.1_Frame_Shift_Ins_p.Q151fs|TRPV2_ENST00000583241.1_3'UTR	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	581					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)	p.E582fs*74(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CATGGAGGGACAGGAGGACGAG	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								16276092	SO:0001589	frameshift_variant	51393			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1742dupA	17.37:g.16335367_16335367dupA	ENSP00000342222:p.Gln581fs	Unknown		Capture	Illumina GAIIx	Phase_I	16276091	A6NML2|A8K0Z0|Q9Y670	Frame_Shift_Ins	INS	ENST00000338560.7	37	CCDS32576.1	INS	17	Broad																																																																																				0.629	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113		Frame_Shift_Ins
OR4F21	441308	broad.mit.edu	37	8	116893	116894	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-24-2030-01	TCGA-24-2030-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2030-01	TCGA-24-2030-10	g.chr8:116893_116894delGA	ENST00000320901.3	-	1	149_150	c.131_132delTC	c.(130-132)ttcfs	p.F44fs		NM_001005504.1	NP_001005504.1	O95013	O4F21_HUMAN	olfactory receptor, family 4, subfamily F, member 21	44				F -> L (in Ref. 1; AAD05195). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						all_cancers(2;8.42e-24)|all_epithelial(2;5.38e-15)|Lung NSC(2;2.68e-06)|all_lung(2;5.05e-06)|Ovarian(12;0.0731)|Colorectal(14;0.0785)|all_hematologic(2;0.157)|Myeloproliferative disorder(644;0.185)|all_neural(12;0.186)|Acute lymphoblastic leukemia(644;0.244)		Epithelial(5;5.01e-18)|all cancers(2;6.06e-17)|OV - Ovarian serous cystadenocarcinoma(5;8.27e-09)|BRCA - Breast invasive adenocarcinoma(11;1.63e-06)|Colorectal(2;5.31e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0649)		AAAACACAATGAAGATGTTTCC	0.47																																																0			8																																								106894	SO:0001589	frameshift_variant	441308				CCDS34792.1	8p23.3	2012-08-09		2004-03-10	ENSG00000176269	ENSG00000176269		"""GPCR / Class A : Olfactory receptors"""	19583	protein-coding gene	gene with protein product				OR4F21P			Standard	NM_001005504		Approved		uc011kwf.2	O95013	OTTHUMG00000163908	ENST00000320901.3:c.131_132delTC	8.37:g.116893_116894delGA	ENSP00000318878:p.Phe44fs	Unknown		Capture	Illumina GAIIx	Phase_I	106893	A6NIU1	Frame_Shift_Del	DEL	ENST00000320901.3	37	CCDS34792.1	DEL	45	Broad																																																																																				0.470	OR4F21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376340.1			Frame_Shift_Del
