#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
NPHP4	261734	broad.mit.edu	37	1	6008230	6008230	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:6008230C>G	ENST00000378156.4	-	8	1157	c.892G>C	c.(892-894)Gtg>Ctg	p.V298L	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	298					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.V298L(1)		NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GGCCTCTGCACGAAGCCCAGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											55.0	60.0	58.0					1																	6008230		2164	4262	6426	5930817	SO:0001583	missense	261734			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.892G>C	1.37:g.6008230C>G	ENSP00000367398:p.Val298Leu	Unknown		x	x	x	5930817	Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	37	CCDS44052.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	15.87	2.962117	0.53400	.	.	ENSG00000131697	ENST00000378156	D	0.91011	-2.77	5.56	2.55	0.30701	.	0.209975	0.31589	N	0.007385	D	0.88157	0.6361	L	0.58669	1.825	0.39359	D	0.965896	D	0.56746	0.977	P	0.46718	0.525	D	0.84343	0.0528	10	0.40728	T	0.16	.	7.636	0.28267	0.0:0.5982:0.3157:0.0861	.	298	O75161	NPHP4_HUMAN	L	298	ENSP00000367398:V298L	ENSP00000367398:V298L	V	-	1	0	NPHP4	5930817	0.909000	0.30893	0.725000	0.30721	0.951000	0.60555	1.634000	0.37123	0.258000	0.21686	0.563000	0.77884	GTG		0.622	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2			Missense_Mutation
PADI6	353238	broad.mit.edu	37	1	17727896	17727896	+	RNA	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:17727896G>C	ENST00000434762.2	+	0	2098							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.V682L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CATCCGCCGGGTGCCCTTTGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											45.0	48.0	47.0					1																	17727896		2054	4190	6244	17600483			353238			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17727896G>C		Unknown		x	x	x	17600483	Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37		SNP	44	Broad																																																																																				0.577	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421		Missense_Mutation
KIF17	57576	broad.mit.edu	37	1	21024944	21024944	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:21024944C>G	ENST00000247986.2	-	6	1471	c.1161G>C	c.(1159-1161)caG>caC	p.Q387H	KIF17_ENST00000400463.3_Missense_Mutation_p.Q387H|KIF17_ENST00000490034.1_5'Flank|KIF17_ENST00000375044.1_Missense_Mutation_p.Q287H			Q9P2E2	KIF17_HUMAN	kinesin family member 17	387					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.Q387H(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCTCCTCCACCTGCACAGGGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	52.0	55.0					1																	21024944		2203	4300	6503	20897531	SO:0001583	missense	57576			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1161G>C	1.37:g.21024944C>G	ENSP00000247986:p.Gln387His	Unknown		x	x	x	20897531	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	7.950	0.744676	0.15710	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.72394	-0.65;-0.53;-0.53	5.0	2.01	0.26516	.	0.281404	0.18836	N	0.129814	T	0.57621	0.2066	L	0.52573	1.65	0.09310	N	1	B;B	0.15473	0.007;0.013	B;B	0.15484	0.01;0.013	T	0.50406	-0.8832	10	0.48119	T	0.1	.	2.7575	0.05297	0.1486:0.5356:0.1447:0.1711	.	387;387	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	H	287;387;387	ENSP00000364184:Q287H;ENSP00000383311:Q387H;ENSP00000247986:Q387H	ENSP00000247986:Q387H	Q	-	3	2	KIF17	20897531	0.066000	0.20996	0.073000	0.20177	0.008000	0.06430	0.178000	0.16820	0.603000	0.29913	0.563000	0.77884	CAG		0.602	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816		Missense_Mutation
HMGCL	3155	broad.mit.edu	37	1	24130925	24130925	+	Silent	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:24130925G>A	ENST00000374490.3	-	8	884	c.841C>T	c.(841-843)Ctg>Ttg	p.L281L	HMGCL_ENST00000436439.2_Silent_p.L210L|HMGCL_ENST00000374483.4_Silent_p.L256L|HMGCL_ENST00000509389.1_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	281					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.L281L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		ATGTAGACCAGGTCTTCTGTG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											172.0	139.0	150.0					1																	24130925		2203	4300	6503	24003512	SO:0001819	synonymous_variant	3155			BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.841C>T	1.37:g.24130925G>A		Unknown		x	x	x	24003512	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Silent	SNP	ENST00000374490.3	37	CCDS243.1	SNP	35	Broad																																																																																				0.587	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191		Silent
SRSF4	6429	broad.mit.edu	37	1	29474973	29474973	+	Silent	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:29474973A>C	ENST00000373795.4	-	6	1668	c.1434T>G	c.(1432-1434)tcT>tcG	p.S478S	SRSF4_ENST00000546138.1_3'UTR|SRSF4_ENST00000466448.1_5'Flank|RP11-242O24.3_ENST00000413004.1_lincRNA	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	478	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S478S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						ATCTGGAAGCAGACCTGGATC	0.488																																																1	Substitution - coding silent(1)	ovary(1)	1											139.0	136.0	137.0					1																	29474973		2203	4300	6503	29347560	SO:0001819	synonymous_variant	6429			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.1434T>G	1.37:g.29474973A>C		Unknown		x	x	x	29347560	Q5VXP1|Q9BUA4|Q9UEB5	Silent	SNP	ENST00000373795.4	37	CCDS333.1	SNP	7	Broad																																																																																				0.488	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626		Silent
AMPD1	270	broad.mit.edu	37	1	115216593	115216593	+	Silent	SNP	G	G	A	rs34778674	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:115216593G>A	ENST00000520113.2	-	14	2025	c.2010C>T	c.(2008-2010)ttC>ttT	p.F670F	AMPD1_ENST00000369538.3_Silent_p.F666F|AMPD1_ENST00000353928.6_Silent_p.F637F			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	670					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.F637F(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CTTTCTGAAGGAAATCCAAAA	0.388													G|||	28	0.00559105	0.0204	0.0014	5008	,	,		17351	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						G	,	56,4350	54.9+/-90.9	0,56,2147	103.0	102.0	102.0		2010,1998	1.7	1.0	1	dbSNP_126	102	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AMPD1	NM_000036.2,NM_001172626.1	,	0,57,6446	AA,AG,GG		0.0116,1.271,0.4383	,	670/781,666/777	115216593	57,12949	2203	4300	6503	115018116	SO:0001819	synonymous_variant	270			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.2010C>T	1.37:g.115216593G>A		Unknown		x	x	x	115018116	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	ENST00000520113.2	37	CCDS876.2	SNP	41	Broad																																																																																				0.388	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4			Silent
ADAR	103	broad.mit.edu	37	1	154558743	154558743	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:154558743T>C	ENST00000368474.4	-	12	3315	c.3116A>G	c.(3115-3117)aAa>aGa	p.K1039R	ADAR_ENST00000368471.3_Missense_Mutation_p.K744R|ADAR_ENST00000292205.5_Missense_Mutation_p.K1082R	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	1039	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.K1039R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GCGTAGGATTTTGTCACTACA	0.552																																																1	Substitution - Missense(1)	ovary(1)	1	GRCh37	CM060799	ADAR	M							119.0	102.0	108.0					1																	154558743		2203	4300	6503	152825367	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.3116A>G	1.37:g.154558743T>C	ENSP00000357459:p.Lys1039Arg	Unknown		x	x	x	152825367	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	27.5	4.840978	0.91197	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.98732	-5.1;-5.1;-5.1;-5.1	5.58	5.58	0.84498	Adenosine deaminase/editase (3);	0.000000	0.85682	D	0.000000	D	0.99405	0.9790	H	0.95224	3.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.981	D;D;D	0.97110	1.0;1.0;0.945	D	0.98507	1.0617	10	0.87932	D	0	-21.8524	15.756	0.78025	0.0:0.0:0.0:1.0	.	994;1013;1039	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	R	1082;1039;744;1008	ENSP00000292205:K1082R;ENSP00000357459:K1039R;ENSP00000357456:K744R;ENSP00000431794:K1008R	ENSP00000292205:K1082R	K	-	2	0	ADAR	152825367	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.131000	0.65755	0.533000	0.62120	AAA		0.552	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111		Missense_Mutation
CCT3	7203	broad.mit.edu	37	1	156281993	156281993	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:156281993C>G	ENST00000295688.3	-	11	1274	c.994G>C	c.(994-996)Gtc>Ctc	p.V332L	CCT3_ENST00000368261.3_Missense_Mutation_p.V287L|CCT3_ENST00000472765.2_Missense_Mutation_p.V287L|CCT3_ENST00000368259.2_Missense_Mutation_p.V294L	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	332					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.V332L(1)		endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GGTCGGCTGACTATCCGGGCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	72.0	70.0					1																	156281993		2203	4300	6503	154548617	SO:0001583	missense	7203			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.994G>C	1.37:g.156281993C>G	ENSP00000295688:p.Val332Leu	Unknown		x	x	x	154548617	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	37	CCDS1140.2	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335529	0.81801	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3	6.15	6.15	0.99193	.	0.356407	0.28011	N	0.016960	T	0.77798	0.4184	M	0.69248	2.105	0.54753	D	0.999984	B;B;B	0.15930	0.002;0.001;0.015	B;B;B	0.31812	0.016;0.016;0.136	T	0.73059	-0.4102	10	0.54805	T	0.06	-20.1991	18.3325	0.90274	0.0:1.0:0.0:0.0	.	294;331;332	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	L	332;294;287;287	ENSP00000295688:V332L;ENSP00000357242:V294L;ENSP00000357244:V287L;ENSP00000431543:V287L	ENSP00000295688:V332L	V	-	1	0	CCT3	154548617	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.737000	0.84957	2.932000	0.99384	0.643000	0.83706	GTC		0.468	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998		Missense_Mutation
INSRR	3645	broad.mit.edu	37	1	156819129	156819129	+	Silent	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:156819129T>C	ENST00000368195.3	-	6	1749	c.1353A>G	c.(1351-1353)gaA>gaG	p.E451E	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	451					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E451E(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGTAGATGTGTTCCAAGCAGA	0.627																																																2	Substitution - coding silent(2)	ovary(2)	1											115.0	116.0	116.0					1																	156819129		2203	4300	6503	155085753	SO:0001819	synonymous_variant	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1353A>G	1.37:g.156819129T>C		Unknown		x	x	x	155085753	O60724|Q5VZS3	Silent	SNP	ENST00000368195.3	37	CCDS1160.1	SNP	60	Broad																																																																																				0.627	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		Silent
CASQ1	844	broad.mit.edu	37	1	160164869	160164869	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:160164869A>G	ENST00000368078.3	+	4	729	c.533A>G	c.(532-534)gAt>gGt	p.D178G	CASQ1_ENST00000368079.3_Missense_Mutation_p.D172G			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	178					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)	p.D172G(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AATATTGAGGATGAGATCAAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											152.0	136.0	142.0					1																	160164869		2203	4300	6503	158431493	SO:0001583	missense	844			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.533A>G	1.37:g.160164869A>G	ENSP00000357057:p.Asp178Gly	Unknown		x	x	x	158431493	B1AKZ2|B2R863|Q8TBW7	Missense_Mutation	SNP	ENST00000368078.3	37	CCDS1198.2	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	17.02	3.281734	0.59758	.	.	ENSG00000143318	ENST00000368079;ENST00000368078;ENST00000441151	T;T	0.80304	-1.36;-1.36	4.24	4.24	0.50183	Thioredoxin-like fold (2);	0.165361	0.52532	D	0.000068	T	0.74650	0.3744	L	0.52011	1.625	0.52501	D	0.999956	P	0.50369	0.934	P	0.50192	0.634	T	0.77222	-0.2667	10	0.49607	T	0.09	.	12.7494	0.57300	1.0:0.0:0.0:0.0	.	178	P31415	CASQ1_HUMAN	G	172;178;93	ENSP00000357058:D172G;ENSP00000357057:D178G	ENSP00000357057:D178G	D	+	2	0	CASQ1	158431493	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.345000	0.65987	1.904000	0.55121	0.455000	0.32223	GAT		0.502	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231		Missense_Mutation
DARS2	55157	broad.mit.edu	37	1	173802526	173802526	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:173802526C>G	ENST00000361951.4	+	6	1232	c.505C>G	c.(505-507)Ctt>Gtt	p.L169V	DARS2_ENST00000239457.5_5'UTR	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	169					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.L169V(1)		breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	AACAGAGGCTCTTCGGTTGCA	0.328																																																1	Substitution - Missense(1)	ovary(1)	1											61.0	56.0	58.0					1																	173802526		2203	4300	6503	172069149	SO:0001583	missense	55157			AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.505C>G	1.37:g.173802526C>G	ENSP00000355086:p.Leu169Val	Unknown		x	x	x	172069149		Missense_Mutation	SNP	ENST00000361951.4	37	CCDS1311.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359902	0.61403	.	.	ENSG00000117593	ENST00000361951	D	0.84516	-1.86	5.94	5.01	0.66863	Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.062472	0.64402	D	0.000007	T	0.79311	0.4424	L	0.56124	1.755	0.80722	D	1	D	0.63046	0.992	P	0.60236	0.871	T	0.80264	-0.1455	10	0.06099	T	0.92	-11.9656	9.4231	0.38563	0.1459:0.7794:0.0:0.0747	.	169	Q6PI48	SYDM_HUMAN	V	169	ENSP00000355086:L169V	ENSP00000355086:L169V	L	+	1	0	DARS2	172069149	0.601000	0.26907	0.995000	0.50966	0.949000	0.60115	1.155000	0.31700	1.468000	0.48064	0.561000	0.74099	CTT		0.328	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084220.1	NM_018122		Missense_Mutation
CACNA1S	779	broad.mit.edu	37	1	201047109	201047109	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:201047109C>A	ENST00000362061.3	-	11	1743	c.1517G>T	c.(1516-1518)aGc>aTc	p.S506I	CACNA1S_ENST00000367338.3_Missense_Mutation_p.S506I	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	506					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.S506I(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGGATACCGCTACACACCAC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											114.0	91.0	99.0					1																	201047109		2203	4300	6503	199313732	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1517G>T	1.37:g.201047109C>A	ENSP00000355192:p.Ser506Ile	Unknown		x	x	x	199313732	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924313	0.52653	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97256	-4.31;-4.31	4.77	4.77	0.60923	Ion transport (1);	0.462906	0.27522	N	0.018999	D	0.92802	0.7711	N	0.13198	0.31	0.31851	N	0.62229	B	0.17038	0.02	B	0.19666	0.026	D	0.91994	0.5605	10	0.66056	D	0.02	.	14.2175	0.65802	0.0:0.8042:0.1958:0.0	.	506	Q13698	CAC1S_HUMAN	I	506	ENSP00000355192:S506I;ENSP00000356307:S506I	ENSP00000355192:S506I	S	-	2	0	CACNA1S	199313732	0.265000	0.24102	1.000000	0.80357	0.991000	0.79684	1.492000	0.35594	2.346000	0.79739	0.637000	0.83480	AGC		0.577	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		Missense_Mutation
PKP1	5317	broad.mit.edu	37	1	201286803	201286803	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:201286803G>T	ENST00000352845.3	+	5	950	c.950G>T	c.(949-951)aGg>aTg	p.R317M	PKP1_ENST00000263946.3_Missense_Mutation_p.R317M|PKP1_ENST00000367324.3_Missense_Mutation_p.R317M|PKP1_ENST00000475988.1_3'UTR			Q13835	PKP1_HUMAN	plakophilin 1	317					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)	p.R317M(1)		NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CTGGTGTTCAGGAGCACCACC	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											32.0	33.0	33.0					1																	201286803		2203	4300	6503	199553426	SO:0001583	missense	5317			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.950G>T	1.37:g.201286803G>T	ENSP00000295597:p.Arg317Met	Unknown		x	x	x	199553426	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197803	0.79015	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.50813	0.73;0.73;0.73	5.24	5.24	0.73138	Armadillo-like helical (1);Armadillo-type fold (1);	0.101083	0.64402	D	0.000003	T	0.55417	0.1919	L	0.55481	1.735	0.41370	D	0.987484	D;D	0.62365	0.986;0.991	P;P	0.56216	0.794;0.784	T	0.59231	-0.7493	10	0.72032	D	0.01	-5.3623	10.4998	0.44800	0.1507:0.0:0.8493:0.0	.	317;317	Q13835-2;Q13835	.;PKP1_HUMAN	M	317	ENSP00000356293:R317M;ENSP00000263946:R317M;ENSP00000295597:R317M	ENSP00000263946:R317M	R	+	2	0	PKP1	199553426	1.000000	0.71417	0.969000	0.41365	0.986000	0.74619	5.457000	0.66672	2.466000	0.83321	0.551000	0.68910	AGG		0.647	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299		Missense_Mutation
CHI3L1	1116	broad.mit.edu	37	1	203149748	203149748	+	Silent	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:203149748C>A	ENST00000255409.3	-	8	869	c.744G>T	c.(742-744)ggG>ggT	p.G248G		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	248					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.G248G(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						TGGCAGGAGCCCCCAGCCTCA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	1											25.0	25.0	25.0					1																	203149748		2203	4300	6503	201416371	SO:0001819	synonymous_variant	1116			BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.744G>T	1.37:g.203149748C>A		Unknown		x	x	x	201416371	B2R7B0|P30923|Q8IVA4|Q96HI7	Silent	SNP	ENST00000255409.3	37	CCDS1435.1	SNP	22	Broad																																																																																				0.572	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100265.1	NM_001276		Silent
KIAA1804	84451	broad.mit.edu	37	1	233511709	233511709	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:233511709C>T	ENST00000366624.3	+	7	1984	c.1723C>T	c.(1723-1725)Cga>Tga	p.R575*	MLK4_ENST00000366622.1_Nonsense_Mutation_p.R21*	NM_032435.2	NP_115811.2												p.R575*(3)									CACAGTCTTTCGACAAGAAGA	0.318																																																3	Substitution - Nonsense(3)	ovary(1)|prostate(1)|large_intestine(1)	1											80.0	83.0	82.0					1																	233511709		2203	4299	6502	231578332	SO:0001587	stop_gained	84451																														ENST00000366624.3:c.1723C>T	1.37:g.233511709C>T	ENSP00000355583:p.Arg575*	Unknown		x	x	x	231578332		Nonsense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	43	9.898159	0.99290	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	.	.	.	5.44	5.44	0.79542	.	0.076288	0.49305	D	0.000143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4568	0.94895	0.0:1.0:0.0:0.0	.	.	.	.	X	575;21	.	ENSP00000355581:R21X	R	+	1	2	RP5-862P8.2	231578332	0.932000	0.31603	0.993000	0.49108	0.988000	0.76386	4.339000	0.59322	2.832000	0.97577	0.655000	0.94253	CGA		0.318	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1			Nonsense_Mutation
TRIM58	25893	broad.mit.edu	37	1	248039645	248039645	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr1:248039645C>A	ENST00000366481.3	+	6	1363	c.1315C>A	c.(1315-1317)Ctc>Atc	p.L439I	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	439	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.L439I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATTCAACCAACTCTTCTCTGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											182.0	181.0	181.0					1																	248039645		2203	4300	6503	246106268	SO:0001583	missense	25893			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1315C>A	1.37:g.248039645C>A	ENSP00000355437:p.Leu439Ile	Unknown		x	x	x	246106268	Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	37	CCDS1636.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.704	-0.789787	0.02884	.	.	ENSG00000162722	ENST00000366481	T	0.69806	-0.43	4.05	2.1	0.27182	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.599099	0.14517	N	0.314691	T	0.49949	0.1587	N	0.19112	0.55	0.09310	N	1	B	0.23249	0.082	B	0.29663	0.105	T	0.37103	-0.9720	10	0.22706	T	0.39	.	10.4603	0.44575	0.0:0.6568:0.3432:0.0	.	439	Q8NG06	TRI58_HUMAN	I	439	ENSP00000355437:L439I	ENSP00000355437:L439I	L	+	1	0	TRIM58	246106268	0.000000	0.05858	0.010000	0.14722	0.027000	0.11550	0.396000	0.20867	0.629000	0.30376	0.650000	0.86243	CTC		0.438	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431		Missense_Mutation
AKR1C1	1645	broad.mit.edu	37	10	5008151	5008151	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:5008151G>A	ENST00000380872.4	+	2	322	c.130G>A	c.(130-132)Gct>Act	p.A44T	AKR1C1_ENST00000380859.1_Missense_Mutation_p.A46T|AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000434459.2_Missense_Mutation_p.A44T	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	44					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.A44T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	GGCAATTGAAGCTGGCTTCCG	0.443																																					Colon(130;2054 2316 13360 15380)											1	Substitution - Missense(1)	ovary(1)	10											96.0	87.0	90.0					10																	5008151		2203	4300	6503	4998151	SO:0001583	missense	1645			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.130G>A	10.37:g.5008151G>A	ENSP00000370254:p.Ala44Thr	Unknown		x	x	x	4998151	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	ENST00000380872.4	37	CCDS7061.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259761	0.23051	.	.	ENSG00000187134	ENST00000434459;ENST00000380872;ENST00000380859	T;T;T	0.27890	1.64;1.64;1.64	2.48	2.48	0.30137	NADP-dependent oxidoreductase domain (3);	0.849137	0.09698	N	0.767387	T	0.31702	0.0805	N	0.21324	0.655	0.09310	N	1	B;B;B	0.31548	0.328;0.122;0.055	P;B;B	0.47915	0.561;0.105;0.171	T	0.46373	-0.9196	10	0.38643	T	0.18	.	7.2778	0.26294	0.0:0.2777:0.7223:0.0	.	44;44;44	B4E0M1;Q2XPP3;Q04828	.;.;AK1C1_HUMAN	T	44;44;46	ENSP00000412248:A44T;ENSP00000370254:A44T;ENSP00000370240:A46T	ENSP00000370240:A46T	A	+	1	0	AKR1C1	4998151	0.065000	0.20965	0.009000	0.14445	0.005000	0.04900	2.419000	0.44671	1.388000	0.46506	0.305000	0.20034	GCT		0.443	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353		Missense_Mutation
SVIL	6840	broad.mit.edu	37	10	29822315	29822315	+	Silent	SNP	T	T	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:29822315T>G	ENST00000355867.4	-	8	1733	c.981A>C	c.(979-981)gtA>gtC	p.V327V	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Silent_p.V327V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	327					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.V327V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCCTCTGAGTTACGGACTCTG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	10											83.0	73.0	77.0					10																	29822315		2203	4300	6503	29862321	SO:0001819	synonymous_variant	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.981A>C	10.37:g.29822315T>G		Unknown		x	x	x	29862321	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1	SNP	61	Broad																																																																																				0.473	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			Silent
SVIL	6840	broad.mit.edu	37	10	29839983	29839983	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:29839983G>C	ENST00000355867.4	-	6	1122	c.370C>G	c.(370-372)Ctg>Gtg	p.L124V	SVIL_ENST00000375400.3_Missense_Mutation_p.L124V|SVIL_ENST00000375398.2_Missense_Mutation_p.L124V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	124	Interaction with MYLK. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.L124V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCGGGATCCAGAGTCAGCCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	10											175.0	150.0	158.0					10																	29839983		2203	4300	6503	29879989	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.370C>G	10.37:g.29839983G>C	ENSP00000348128:p.Leu124Val	Unknown		x	x	x	29879989	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	9.722	1.160015	0.21454	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.54866	0.55;0.55;0.55	5.41	4.5	0.54988	.	0.068773	0.64402	D	0.000013	T	0.48095	0.1481	M	0.74258	2.255	0.80722	D	1	P;P	0.43314	0.717;0.803	B;B	0.37198	0.243;0.232	T	0.49978	-0.8881	9	.	.	.	-14.5016	8.1977	0.31407	0.0733:0.0:0.6601:0.2666	.	124;124	O95425-2;O95425	.;SVIL_HUMAN	V	124	ENSP00000364549:L124V;ENSP00000364547:L124V;ENSP00000348128:L124V	.	L	-	1	2	SVIL	29879989	0.932000	0.31603	0.757000	0.31301	0.058000	0.15608	1.414000	0.34736	1.250000	0.43966	0.591000	0.81541	CTG		0.532	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			Missense_Mutation
ZNF438	220929	broad.mit.edu	37	10	31137718	31137718	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:31137718A>G	ENST00000361310.3	-	6	1945	c.1616T>C	c.(1615-1617)aTt>aCt	p.I539T	ZNF438_ENST00000442986.1_Missense_Mutation_p.I539T|ZNF438_ENST00000538351.2_Missense_Mutation_p.I490T|ZNF438_ENST00000331737.6_Missense_Mutation_p.I529T|ZNF438_ENST00000375311.1_Missense_Mutation_p.I103T|ZNF438_ENST00000452305.1_Missense_Mutation_p.I529T|ZNF438_ENST00000413025.1_Missense_Mutation_p.I539T|ZNF438_ENST00000436087.2_Missense_Mutation_p.I539T|ZNF438_ENST00000444692.2_Missense_Mutation_p.I529T			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	539					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I539T(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CTTGCGACAAATCCGACAACT	0.483																																																1	Substitution - Missense(1)	ovary(1)	10											261.0	257.0	258.0					10																	31137718		2203	4300	6503	31177724	SO:0001583	missense	220929			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1616T>C	10.37:g.31137718A>G	ENSP00000354663:p.Ile539Thr	Unknown		x	x	x	31177724	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	37	CCDS7168.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	14.84	2.654879	0.47467	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59	5.4	5.4	0.78164	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.771999	0.12889	N	0.430742	T	0.16727	0.0402	L	0.33624	1.015	0.21290	N	0.999733	P;P	0.43231	0.801;0.763	P;B	0.46629	0.522;0.387	T	0.16305	-1.0407	10	0.22109	T	0.4	-7.997	14.5878	0.68339	1.0:0.0:0.0:0.0	.	539;529	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	T	529;539;539;539;539;529;529;490;258;103	ENSP00000333571:I529T;ENSP00000354663:I539T;ENSP00000406934:I539T;ENSP00000412363:I539T;ENSP00000387546:I539T;ENSP00000413060:I529T;ENSP00000410898:I529T;ENSP00000445461:I490T;ENSP00000364460:I103T	ENSP00000333571:I529T	I	-	2	0	ZNF438	31177724	0.804000	0.28969	0.112000	0.21494	0.393000	0.30537	6.711000	0.74675	2.043000	0.60533	0.482000	0.46254	ATT		0.483	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755		Missense_Mutation
C10orf71	118461	broad.mit.edu	37	10	50531413	50531413	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:50531413A>C	ENST00000374144.3	+	3	1111	c.823A>C	c.(823-825)Agt>Cgt	p.S275R	C10orf71_ENST00000323868.4_Missense_Mutation_p.S275R			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	275								p.S275R(1)		endometrium(1)	1						CAGTGAAAATAGTGCTTTTGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	10											61.0	70.0	67.0					10																	50531413		2024	4199	6223	50201419	SO:0001583	missense	118461			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.823A>C	10.37:g.50531413A>C	ENSP00000363259:p.Ser275Arg	Unknown		x	x	x	50201419	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	22.5	4.300825	0.81136	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.41065	1.01;2.12	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000016	T	0.63534	0.2519	M	0.70275	2.135	0.51482	D	0.999925	D	0.71674	0.998	D	0.70227	0.968	T	0.67929	-0.5543	10	0.87932	D	0	.	15.4185	0.74991	1.0:0.0:0.0:0.0	.	275	Q711Q0-3	.	R	275	ENSP00000318713:S275R;ENSP00000363259:S275R	ENSP00000318713:S275R	S	+	1	0	C10orf71	50201419	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	5.806000	0.69150	2.047000	0.60756	0.459000	0.35465	AGT		0.532	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459		Missense_Mutation
LDB3	11155	broad.mit.edu	37	10	88441356	88441356	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:88441356G>C	ENST00000361373.4	+	4	506	c.485G>C	c.(484-486)gGc>gCc	p.G162A	LDB3_ENST00000263066.6_Intron|LDB3_ENST00000372066.3_Intron|LDB3_ENST00000429277.2_Missense_Mutation_p.G162A|LDB3_ENST00000372056.4_Missense_Mutation_p.G162A|LDB3_ENST00000542786.1_Missense_Mutation_p.G162A|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000310944.6_Missense_Mutation_p.G162A	NM_007078.2	NP_009009.1			LIM domain binding 3									p.G162A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						TCTGACCCTGGCCCTCCGCGG	0.716																																																1	Substitution - Missense(1)	ovary(1)	10											19.0	22.0	21.0					10																	88441356		2201	4297	6498	88431336	SO:0001583	missense	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.485G>C	10.37:g.88441356G>C	ENSP00000355296:p.Gly162Ala	Unknown		x	x	x	88431336		Missense_Mutation	SNP	ENST00000361373.4	37	CCDS7377.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	0.552	-0.849022	0.02651	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000372056;ENST00000310944;ENST00000361373;ENST00000542786	T;T;T;T;T	0.50277	0.95;1.16;1.31;0.75;1.29	5.1	3.19	0.36642	.	.	.	.	.	T	0.33876	0.0878	L	0.31664	0.95	0.09310	N	1	B;B;B;B;B	0.26363	0.0;0.002;0.026;0.0;0.147	B;B;B;B;B	0.29862	0.001;0.025;0.032;0.002;0.108	T	0.25710	-1.0124	9	0.18710	T	0.47	.	8.391	0.32528	0.0:0.5564:0.3311:0.1126	.	162;162;162;162;162	B4E3K3;F5H0C2;O75112-4;O75112;O75112-5	.;.;.;LDB3_HUMAN;.	A	162	ENSP00000401437:G162A;ENSP00000361126:G162A;ENSP00000311913:G162A;ENSP00000355296:G162A;ENSP00000438866:G162A	ENSP00000311913:G162A	G	+	2	0	LDB3	88431336	0.928000	0.31464	0.008000	0.14137	0.123000	0.20343	2.075000	0.41538	0.585000	0.29608	0.563000	0.77884	GGC		0.716	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			Missense_Mutation
BTRC	8945	broad.mit.edu	37	10	103296374	103296374	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:103296374T>A	ENST00000370187.3	+	12	1659	c.1541T>A	c.(1540-1542)tTt>tAt	p.F514Y	BTRC_ENST00000408038.2_Missense_Mutation_p.F478Y|BTRC_ENST00000393441.4_Missense_Mutation_p.F473Y|BTRC_ENST00000493877.1_3'UTR	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	514					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.F514Y(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TGTATTCGATTTGATAACAAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	10											233.0	219.0	224.0					10																	103296374		2203	4300	6503	103286364	SO:0001583	missense	8945			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1541T>A	10.37:g.103296374T>A	ENSP00000359206:p.Phe514Tyr	Unknown		x	x	x	103286364	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	CCDS7512.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	35	5.565737	0.96540	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.67698	-0.28;-0.28;-0.28	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	L	0.35644	1.08	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.997	D;D;D	0.85130	0.99;0.989;0.997	T	0.76176	-0.3055	10	0.51188	T	0.08	-16.0614	16.3197	0.82945	0.0:0.0:0.0:1.0	.	488;478;514	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	Y	514;473;478	ENSP00000359206:F514Y;ENSP00000377088:F473Y;ENSP00000385339:F478Y	ENSP00000359206:F514Y	F	+	2	0	BTRC	103286364	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.302000	0.77476	0.533000	0.62120	TTT		0.398	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637		Missense_Mutation
TECTB	6975	broad.mit.edu	37	10	114046094	114046094	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:114046094T>C	ENST00000369422.3	+	4	428	c.428T>C	c.(427-429)gTg>gCg	p.V143A		NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	143	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.V143A(1)		kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		ACTGTTCACGTGAAGAACGGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											133.0	112.0	119.0					10																	114046094		2203	4300	6503	114036084	SO:0001583	missense	6975			AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.428T>C	10.37:g.114046094T>C	ENSP00000358430:p.Val143Ala	Unknown		x	x	x	114036084	Q5VW53	Missense_Mutation	SNP	ENST00000369422.3	37	CCDS7571.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	25.7	4.664466	0.88251	.	.	ENSG00000119913	ENST00000369422	D	0.81739	-1.53	6.17	6.17	0.99709	Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	D	0.89698	0.6790	M	0.78049	2.395	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.89690	0.3897	10	0.49607	T	0.09	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	143	Q96PL2	TECTB_HUMAN	A	143	ENSP00000358430:V143A	ENSP00000358430:V143A	V	+	2	0	TECTB	114036084	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	GTG		0.502	TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1	NM_058222		Missense_Mutation
ATRNL1	26033	broad.mit.edu	37	10	117026438	117026438	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:117026438G>T	ENST00000355044.3	+	12	2063	c.1937G>T	c.(1936-1938)gGg>gTg	p.G646V		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	646	PSI 1.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.G646V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGGGAATCTGGGAATACTAAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	103.0	99.0					10																	117026438		2203	4300	6503	117016428	SO:0001583	missense	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1937G>T	10.37:g.117026438G>T	ENSP00000347152:p.Gly646Val	Unknown		x	x	x	117016428	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234112	0.22626	.	.	ENSG00000107518	ENST00000355044	T	0.12984	2.63	5.93	5.02	0.67125	.	0.225320	0.46442	D	0.000297	T	0.03959	0.0111	N	0.01048	-1.04	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.44065	-0.9352	10	0.10636	T	0.68	-13.0335	10.3046	0.43672	0.0685:0.0:0.7988:0.1327	.	646	Q5VV63	ATRN1_HUMAN	V	646	ENSP00000347152:G646V	ENSP00000347152:G646V	G	+	2	0	ATRNL1	117016428	1.000000	0.71417	0.978000	0.43139	0.721000	0.41392	4.080000	0.57620	2.803000	0.96430	0.585000	0.79938	GGG		0.353	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		Missense_Mutation
INPP5F	22876	broad.mit.edu	37	10	121571370	121571370	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr10:121571370G>A	ENST00000361976.2	+	15	1955	c.1789G>A	c.(1789-1791)Gaa>Aaa	p.E597K		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	ASH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.E597K(1)		breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		AAGCCACCAGGAACTAATTAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											119.0	128.0	125.0					10																	121571370		2203	4300	6503	121561360	SO:0001583	missense	22876			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1789G>A	10.37:g.121571370G>A	ENSP00000354519:p.Glu597Lys	Unknown		x	x	x	121561360	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	37	CCDS7616.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.791873	0.96945	.	.	ENSG00000198825	ENST00000361976	T	0.38401	1.14	5.68	5.68	0.88126	.	0.052878	0.85682	D	0.000000	T	0.58892	0.2154	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.49234	-0.8961	10	0.26408	T	0.33	-27.6394	19.7923	0.96464	0.0:0.0:1.0:0.0	.	597	Q9Y2H2	SAC2_HUMAN	K	597	ENSP00000354519:E597K	ENSP00000354519:E597K	E	+	1	0	INPP5F	121561360	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.795000	0.99099	2.693000	0.91896	0.655000	0.94253	GAA		0.433	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937		Missense_Mutation
MUC5B	727897	broad.mit.edu	37	11	1272554	1272554	+	Missense_Mutation	SNP	C	C	T	rs199943848		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:1272554C>T	ENST00000529681.1	+	31	14502	c.14444C>T	c.(14443-14445)aCg>aTg	p.T4815M	MUC5B_ENST00000447027.1_Missense_Mutation_p.T4818M|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4815	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T4770M(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACTCTGGGGACGACCCGGATC	0.622													c|||	1	0.000199681	0.0	0.0	5008	,	,		18110	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11						C	MET/THR	2,4340		0,2,2169	126.0	157.0	147.0		14444	1.2	0.0	11		147	0,8500		0,0,4250	yes	missense	MUC5B	NM_002458.2	81	0,2,6419	TT,TC,CC		0.0,0.0461,0.0156	possibly-damaging	4815/5763	1272554	2,12840	2171	4250	6421	1229130	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14444C>T	11.37:g.1272554C>T	ENSP00000436812:p.Thr4815Met	Unknown		x	x	x	1229130	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	4.044	0.005843	0.07866	4.61E-4	0.0	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.17854	2.25;2.44	2.38	1.25	0.21368	.	.	.	.	.	T	0.16599	0.0399	M	0.77103	2.36	0.09310	N	1	P;P	0.37352	0.591;0.591	B;B	0.16722	0.016;0.016	T	0.19289	-1.0310	9	0.87932	D	0	.	8.3253	0.32153	0.233:0.767:0.0:0.0	.	5137;4818	A7Y9J9;E9PBJ0	.;.	M	4815;4818;4759;4514	ENSP00000436812:T4815M;ENSP00000415793:T4818M	ENSP00000343037:T4759M	T	+	2	0	MUC5B	1229130	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	-1.998000	0.01469	1.033000	0.39918	0.134000	0.15878	ACG		0.622	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		Missense_Mutation
SBF2	81846	broad.mit.edu	37	11	9878071	9878071	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:9878071T>G	ENST00000256190.8	-	19	2434	c.2297A>C	c.(2296-2298)aAc>aCc	p.N766T	RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	766					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.N766T(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TAGGAGCTTGTTTTTACTTGT	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											206.0	173.0	184.0					11																	9878071		2201	4294	6495	9834647	SO:0001583	missense	81846			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.2297A>C	11.37:g.9878071T>G	ENSP00000256190:p.Asn766Thr	Unknown		x	x	x	9834647	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	t	14.07	2.426558	0.43020	.	.	ENSG00000133812	ENST00000256190	D	0.85171	-1.95	5.29	5.29	0.74685	.	0.046784	0.85682	D	0.000000	T	0.81317	0.4797	L	0.47716	1.5	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.76597	-0.2901	10	0.35671	T	0.21	.	15.5134	0.75802	0.0:0.0:0.0:1.0	.	766	Q86WG5	MTMRD_HUMAN	T	766	ENSP00000256190:N766T	ENSP00000256190:N766T	N	-	2	0	SBF2	9834647	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.001000	0.63946	2.126000	0.65437	0.454000	0.30748	AAC		0.478	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962		Missense_Mutation
ARFGAP2	84364	broad.mit.edu	37	11	47187912	47187912	+	Silent	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:47187912C>G	ENST00000524782.1	-	15	1680	c.1452G>C	c.(1450-1452)ctG>ctC	p.L484L	ARFGAP2_ENST00000419701.2_Silent_p.L377L|ARFGAP2_ENST00000426335.2_Silent_p.L348L|ARFGAP2_ENST00000395449.3_5'UTR|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000319543.6_Silent_p.L215L	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	484	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.L484L(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CCGCTGTAGGCAGCACGTTCC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	11											148.0	129.0	135.0					11																	47187912		2201	4299	6500	47144488	SO:0001819	synonymous_variant	84364			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.1452G>C	11.37:g.47187912C>G		Unknown		x	x	x	47144488	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Silent	SNP	ENST00000524782.1	37	CCDS7926.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	7.499	0.652252	0.14580	.	.	ENSG00000149182	ENST00000527776	.	.	.	5.3	-1.34	0.09143	.	.	.	.	.	T	0.57184	0.2036	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52238	-0.8602	4	.	.	.	-10.159	10.9197	0.47156	0.2111:0.5826:0.2063:0.0	.	.	.	.	P	206	.	.	A	-	1	0	ARFGAP2	47144488	0.376000	0.25098	0.980000	0.43619	0.923000	0.55619	-0.437000	0.06914	-0.455000	0.07054	-0.884000	0.02946	GCC		0.572	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389		Silent
OR4S2	219431	broad.mit.edu	37	11	55418448	55418448	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:55418448A>T	ENST00000312422.2	+	1	69	c.69A>T	c.(67-69)aaA>aaT	p.K23N		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K23N(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				AGATTGAGAAAGTTTGTTTTG	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	85.0	89.0					11																	55418448		2180	4017	6197	55175024	SO:0001583	missense	219431			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.69A>T	11.37:g.55418448A>T	ENSP00000310337:p.Lys23Asn	Unknown		x	x	x	55175024	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	CCDS31505.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	8.035	0.762677	0.15914	.	.	ENSG00000174982	ENST00000312422	T	0.00433	7.43	5.36	-1.74	0.08056	.	0.487177	0.18884	N	0.128494	T	0.00241	0.0007	L	0.43598	1.365	0.09310	N	1	B	0.32717	0.381	B	0.29524	0.103	T	0.47100	-0.9143	10	0.59425	D	0.04	.	3.8668	0.09019	0.4498:0.0:0.299:0.2512	.	23	Q8NH73	OR4S2_HUMAN	N	23	ENSP00000310337:K23N	ENSP00000310337:K23N	K	+	3	2	OR4S2	55175024	0.000000	0.05858	0.011000	0.14972	0.180000	0.23129	-4.142000	0.00286	0.025000	0.15241	0.448000	0.29417	AAA		0.383	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059		Missense_Mutation
OR10W1	81341	broad.mit.edu	37	11	58035166	58035166	+	Silent	SNP	G	G	A	rs202195466		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:58035166G>A	ENST00000395079.2	-	1	566	c.165C>T	c.(163-165)ggC>ggT	p.G55G		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G55G(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				CAGAAAGGCTGCCCAGGAAAT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	11											102.0	87.0	92.0					11																	58035166		2201	4295	6496	57791742	SO:0001819	synonymous_variant	81341			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.165C>T	11.37:g.58035166G>A		Unknown		x	x	x	57791742	A2RUD2|A8MTE1|Q6UXQ2	Silent	SNP	ENST00000395079.2	37	CCDS7968.1	SNP	46	Broad																																																																																				0.488	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		Silent
OR5B3	441608	broad.mit.edu	37	11	58170873	58170873	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:58170873T>C	ENST00000309403.2	-	1	9	c.10A>G	c.(10-12)Aag>Gag	p.K4E		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K4E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACTTCTGTCTTATTTTCCATC	0.353																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	96.0	96.0					11																	58170873		2194	4254	6448	57927449	SO:0001583	missense	441608			AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.10A>G	11.37:g.58170873T>C	ENSP00000308270:p.Lys4Glu	Unknown		x	x	x	57927449	Q6IEV6	Missense_Mutation	SNP	ENST00000309403.2	37	CCDS31549.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	t	1.108	-0.659027	0.03454	.	.	ENSG00000172769	ENST00000309403	T	0.00543	6.68	4.05	0.142	0.14816	.	0.718718	0.12204	N	0.490007	T	0.00328	0.0010	N	0.12887	0.27	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.38200	-0.9672	10	0.30854	T	0.27	-1.8003	4.4031	0.11397	0.0:0.1975:0.17:0.6325	.	4	Q8NH48	OR5B3_HUMAN	E	4	ENSP00000308270:K4E	ENSP00000308270:K4E	K	-	1	0	OR5B3	57927449	0.000000	0.05858	0.006000	0.13384	0.349000	0.29174	-1.126000	0.03254	-0.063000	0.13065	0.397000	0.26171	AAG		0.353	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		Missense_Mutation
OSBP	5007	broad.mit.edu	37	11	59361566	59361566	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:59361566T>C	ENST00000263847.1	-	8	1953	c.1474A>G	c.(1474-1476)Agt>Ggt	p.S492G	MIR3162_ENST00000581818.1_RNA	NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	492					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)	p.S492G(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AATGGCTTACTGGTGCGGAAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	86.0	87.0					11																	59361566		2201	4295	6496	59118142	SO:0001583	missense	5007			AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1474A>G	11.37:g.59361566T>C	ENSP00000263847:p.Ser492Gly	Unknown		x	x	x	59118142	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	37	CCDS7974.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	12.73	2.027003	0.35797	.	.	ENSG00000110048	ENST00000263847;ENST00000378235	T	0.28895	1.59	5.91	5.91	0.95273	.	0.076754	0.85682	N	0.000000	T	0.09992	0.0245	N	0.00760	-1.21	0.47245	D	0.999361	B	0.06786	0.001	B	0.06405	0.002	T	0.26121	-1.0112	10	0.02654	T	1	-29.6028	15.3262	0.74164	0.0:0.0:0.0:1.0	.	492	P22059	OSBP1_HUMAN	G	492;92	ENSP00000263847:S492G	ENSP00000263847:S492G	S	-	1	0	OSBP	59118142	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.776000	0.55356	2.269000	0.75478	0.533000	0.62120	AGT		0.498	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1			Missense_Mutation
NUMA1	4926	broad.mit.edu	37	11	71726747	71726747	+	Missense_Mutation	SNP	G	G	A	rs548451727	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:71726747G>A	ENST00000393695.3	-	15	2133	c.1802C>T	c.(1801-1803)gCg>gTg	p.A601V	NUMA1_ENST00000358965.6_Missense_Mutation_p.A601V|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000351960.6_Intron	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.A601V(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CTTGAGAGCCGCATCCCGCTC	0.607			T	RARA	APL						OREG0021187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0	0.0	5008	,	,		20308	0.0		0.0	False		,,,				2504	0.002						Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	1	Substitution - Missense(1)	ovary(1)	11											50.0	49.0	50.0					11																	71726747		2200	4293	6493	71404395	SO:0001583	missense	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.1802C>T	11.37:g.71726747G>A	ENSP00000377298:p.Ala601Val	Unknown	1132	x	x	x	71404395		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746868	0.30955	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000542977;ENST00000537217	T;T;T;T	0.47528	2.65;2.66;1.44;0.84	6.07	2.94	0.34122	.	1.010270	0.07941	N	0.979168	T	0.30039	0.0752	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.15473	0.005;0.013;0.013;0.013	B;B;B;B	0.13407	0.006;0.009;0.006;0.006	T	0.15009	-1.0452	10	0.40728	T	0.16	.	6.3435	0.21337	0.0709:0.2401:0.5658:0.1233	.	607;85;601;601	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	V	601;601;164;601;601	ENSP00000351851:A601V;ENSP00000377298:A601V;ENSP00000444880:A601V;ENSP00000442936:A601V	ENSP00000351851:A601V	A	-	2	0	NUMA1	71404395	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	0.628000	0.24522	1.543000	0.49345	0.655000	0.94253	GCG		0.607	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			Missense_Mutation
EED	8726	broad.mit.edu	37	11	85956304	85956304	+	Silent	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:85956304G>A	ENST00000263360.6	+	1	719	c.33G>A	c.(31-33)gcG>gcA	p.A11A	EED_ENST00000351625.6_Silent_p.A11A|EED_ENST00000528180.1_Silent_p.A11A|EED_ENST00000327320.4_Silent_p.A11A	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	11					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)	p.A11A(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				CTGCGCCGGCGGGAACAGACA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	11											57.0	49.0	52.0					11																	85956304		2203	4299	6502	85633952	SO:0001819	synonymous_variant	8726			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.33G>A	11.37:g.85956304G>A		Unknown		x	x	x	85633952	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Silent	SNP	ENST00000263360.6	37	CCDS8273.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913226	0.33815	.	.	ENSG00000074266	ENST00000534595	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	T	0.73799	0.3633	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73297	-0.4027	4	.	.	.	-5.2175	18.0155	0.89239	0.0:0.0:1.0:0.0	.	.	.	.	Q	10	.	.	R	+	2	0	EED	85633952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.913000	0.92730	2.542000	0.85734	0.655000	0.94253	CGG		0.622	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	NM_003797		Silent
TRPC6	7225	broad.mit.edu	37	11	101362313	101362313	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:101362313G>T	ENST00000344327.3	-	3	1526	c.1102C>A	c.(1102-1104)Ctt>Att	p.L368I	TRPC6_ENST00000360497.4_Missense_Mutation_p.L368I|TRPC6_ENST00000348423.4_Intron|TRPC6_ENST00000532133.1_Missense_Mutation_p.L368I	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	368					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L368I(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TTAATGGCAAGTTTTAAACGG	0.418																																					Colon(166;1315 1927 11094 12848 34731)											1	Substitution - Missense(1)	ovary(1)	11											133.0	139.0	137.0					11																	101362313		2203	4299	6502	100867523	SO:0001583	missense	7225			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1102C>A	11.37:g.101362313G>T	ENSP00000340913:p.Leu368Ile	Unknown		x	x	x	100867523	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.144950	0.94603	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000360497	T;T;T	0.66460	-0.21;-0.21;-0.21	6.14	5.18	0.71444	.	0.059219	0.64402	D	0.000001	T	0.73369	0.3578	M	0.81179	2.53	0.28837	N	0.896791	B;P	0.43973	0.343;0.823	B;P	0.44732	0.245;0.459	T	0.74636	-0.3599	10	0.87932	D	0	-9.2661	16.4029	0.83649	0.0:0.0:0.8678:0.1322	.	368;368	Q9Y210-3;Q9Y210	.;TRPC6_HUMAN	I	368	ENSP00000340913:L368I;ENSP00000435574:L368I;ENSP00000353687:L368I	ENSP00000340913:L368I	L	-	1	0	TRPC6	100867523	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	CTT		0.418	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		Missense_Mutation
ANGPTL5	253935	broad.mit.edu	37	11	101762205	101762205	+	Silent	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:101762205G>A	ENST00000334289.3	-	9	1567	c.972C>T	c.(970-972)tgC>tgT	p.C324C		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	324	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)		p.C324C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		GGAGGTGACTGCAGCTCTTCA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	11											190.0	173.0	179.0					11																	101762205		2203	4299	6502	101267415	SO:0001819	synonymous_variant	253935			BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.972C>T	11.37:g.101762205G>A		Unknown		x	x	x	101267415	A8K658|Q86VR9	Silent	SNP	ENST00000334289.3	37	CCDS8312.1	SNP	46	Broad																																																																																				0.443	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394138.1	NM_178127		Silent
NCAM1	4684	broad.mit.edu	37	11	113130978	113130978	+	Silent	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:113130978C>T	ENST00000533760.1	+	16	2279	c.1680C>T	c.(1678-1680)aaC>aaT	p.N560N	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Silent_p.N678N	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	688	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.			Y -> H (in Ref. 4; BAF85142). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.N687N(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TGGCTGAGAACCAGCAAGGAA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	11											110.0	121.0	118.0					11																	113130978		1984	4145	6129	112636188	SO:0001819	synonymous_variant	4684				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1680C>T	11.37:g.113130978C>T		Unknown		x	x	x	112636188	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	37		SNP	18	Broad																																																																																				0.557	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615		Silent
SCN4B	6330	broad.mit.edu	37	11	118012004	118012004	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:118012004C>A	ENST00000324727.4	-	4	657	c.511G>T	c.(511-513)Ggc>Tgc	p.G171C	SCN4B_ENST00000529878.1_Missense_Mutation_p.G37C|SCN4B_ENST00000423160.2_5'UTR	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit	171					AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.G171C(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGACCCCGCCCACGACAGCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											117.0	91.0	100.0					11																	118012004		2200	4296	6496	117517214	SO:0001583	missense	6330			AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.511G>T	11.37:g.118012004C>A	ENSP00000322460:p.Gly171Cys	Unknown		x	x	x	117517214	E9PPT5|Q6PIG5	Missense_Mutation	SNP	ENST00000324727.4	37	CCDS8389.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089460	0.36855	.	.	ENSG00000177098	ENST00000324727;ENST00000529878	D;D	0.98889	-5.21;-2.2	4.34	3.41	0.39046	.	0.059041	0.64402	N	0.000002	D	0.95629	0.8579	L	0.34521	1.04	0.80722	D	1	B;P	0.39551	0.247;0.678	B;B	0.32465	0.065;0.146	D	0.94057	0.7323	10	0.72032	D	0.01	-23.4926	12.334	0.55056	0.1711:0.8289:0.0:0.0	.	37;171	E9PPT5;Q8IWT1	.;SCN4B_HUMAN	C	171;37	ENSP00000322460:G171C;ENSP00000436343:G37C	ENSP00000322460:G171C	G	-	1	0	SCN4B	117517214	1.000000	0.71417	0.992000	0.48379	0.441000	0.31987	4.123000	0.57917	0.780000	0.33566	0.558000	0.71614	GGC		0.527	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392326.1			Missense_Mutation
PHLDB1	23187	broad.mit.edu	37	11	118498356	118498356	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr11:118498356A>T	ENST00000361417.2	+	7	1228	c.817A>T	c.(817-819)Agt>Tgt	p.S273C	PHLDB1_ENST00000356063.5_Missense_Mutation_p.S273C	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	273								p.S273C(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TCACTCACCCAGTGGGCAAGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	96.0	94.0					11																	118498356		2200	4295	6495	118003566	SO:0001583	missense	23187				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.817A>T	11.37:g.118498356A>T	ENSP00000354498:p.Ser273Cys	Unknown		x	x	x	118003566	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	14.55	2.569403	0.45798	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000543207;ENST00000356063	T;T	0.35605	1.32;1.3	5.66	4.33	0.51752	.	0.181870	0.51477	D	0.000097	T	0.36717	0.0977	L	0.43152	1.355	0.80722	D	1	P;P;D;P	0.54964	0.932;0.504;0.969;0.947	P;B;P;B	0.50378	0.639;0.28;0.621;0.417	T	0.15896	-1.0421	10	0.59425	D	0.04	-17.5542	7.8888	0.29665	0.7905:0.0:0.2095:0.0	.	272;273;273;273	B4DIX4;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	C	273;32;272;273	ENSP00000354498:S273C;ENSP00000348359:S273C	ENSP00000348359:S273C	S	+	1	0	PHLDB1	118003566	0.944000	0.32072	0.998000	0.56505	0.983000	0.72400	1.487000	0.35540	2.154000	0.67381	0.460000	0.39030	AGT		0.632	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157		Missense_Mutation
PRB3	5544	broad.mit.edu	37	12	11420893	11420893	+	Missense_Mutation	SNP	C	C	G	rs201540020	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:11420893C>G	ENST00000279573.7	-	3	425	c.290G>C	c.(289-291)gGa>gCa	p.G97A	PRB3_ENST00000440870.3_Intron|PRB3_ENST00000538488.1_Missense_Mutation_p.G97A|PRB3_ENST00000381842.3_Missense_Mutation_p.G97A			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	97	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.G97A(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TTCTGGCTTTCCCGGACGAGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	12											151.0	187.0	175.0					12																	11420893		2059	4214	6273	11312160	SO:0001583	missense	5544					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.290G>C	12.37:g.11420893C>G	ENSP00000279573:p.Gly97Ala	Unknown		x	x	x	11312160	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	ENST00000279573.7	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	.	5.712	0.315792	0.10789	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.08102	3.2;3.13	0.704	-0.329	0.12686	.	0.234796	0.19762	U	0.106654	T	0.03564	0.0102	.	.	.	0.09310	N	1	P	0.52061	0.95	B	0.36766	0.232	T	0.47302	-0.9128	9	0.22109	T	0.4	.	5.0066	0.14291	0.0:0.7452:0.0:0.2548	.	97	Q04118	PRB3_HUMAN	A	97	ENSP00000371264:G97A;ENSP00000442626:G97A	ENSP00000279573:G97A	G	-	2	0	PRB3	11312160	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.890000	0.04140	-0.117000	0.11872	0.134000	0.15878	GGA		0.627	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249		Missense_Mutation
RECQL	5965	broad.mit.edu	37	12	21623996	21623996	+	Silent	SNP	C	C	G	rs2417989		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:21623996C>G	ENST00000444129.2	-	14	2172	c.1704G>C	c.(1702-1704)tcG>tcC	p.S568S	RECQL_ENST00000421138.2_Silent_p.S568S	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	568					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.S568S(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TTTTCAAATACGAAATGGTAG	0.358								Other identified genes with known or suspected DNA repair function																																								1	Substitution - coding silent(1)	ovary(1)	12											79.0	73.0	75.0					12																	21623996		2202	4299	6501	21515263	SO:0001819	synonymous_variant	5965			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1704G>C	12.37:g.21623996C>G		Unknown		x	x	x	21515263	A8K6G2	Silent	SNP	ENST00000444129.2	37	CCDS31756.1	SNP	19	Broad																																																																																				0.358	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907		Silent
FAM222A	84915	broad.mit.edu	37	12	110206916	110206916	+	Missense_Mutation	SNP	G	G	C	rs531851071		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:110206916G>C	ENST00000538780.1	+	3	1898	c.1182G>C	c.(1180-1182)aaG>aaC	p.K394N	FAM222A_ENST00000358906.3_Missense_Mutation_p.K394N|FAM222A-AS1_ENST00000541723.1_RNA|FAM222A-AS1_ENST00000541460.1_RNA	NM_032829.2	NP_116218.2	Q5U5X8	F222A_HUMAN	family with sequence similarity 222, member A	394								p.K394N(1)									TGCCCAGCAAGAGTGTGTGCA	0.672																																																1	Substitution - Missense(1)	ovary(1)	12											16.0	15.0	16.0					12																	110206916		2199	4285	6484	108691299	SO:0001583	missense	84915			AK027627	CCDS9133.1	12q24.11	2012-04-27	2012-04-27	2012-04-27	ENSG00000139438	ENSG00000139438			25915	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 34"""	C12orf34		12477932	Standard	NM_032829		Approved	FLJ14721	uc001tpd.2	Q5U5X8	OTTHUMG00000169260	ENST00000538780.1:c.1182G>C	12.37:g.110206916G>C	ENSP00000443292:p.Lys394Asn	Unknown		x	x	x	108691299	Q8NCD5|Q96SP6	Missense_Mutation	SNP	ENST00000538780.1	37	CCDS9133.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	15.62	2.888073	0.52014	.	.	ENSG00000139438	ENST00000538780;ENST00000358906	T;T	0.31247	1.5;1.5	3.95	3.95	0.45737	.	0.051119	0.85682	D	0.000000	T	0.50735	0.1633	M	0.63428	1.95	0.53688	D	0.999976	D	0.71674	0.998	D	0.66979	0.948	T	0.56111	-0.8033	10	0.66056	D	0.02	-13.7834	15.1527	0.72713	0.0:0.0:1.0:0.0	.	394	Q5U5X8	CL034_HUMAN	N	394	ENSP00000443292:K394N;ENSP00000351783:K394N	ENSP00000351783:K394N	K	+	3	2	C12orf34	108691299	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.195000	0.42677	2.051000	0.60960	0.491000	0.48974	AAG		0.672	FAM222A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403175.1	NM_032829		Missense_Mutation
RASAL1	8437	broad.mit.edu	37	12	113543598	113543598	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:113543598G>A	ENST00000261729.5	-	17	2063	c.1748C>T	c.(1747-1749)gCc>gTc	p.A583V	RASAL1_ENST00000546530.1_Missense_Mutation_p.A585V|RASAL1_ENST00000446861.3_Missense_Mutation_p.A583V|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Missense_Mutation_p.A584V			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	583	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						AAAGCGCGTGGCCAGGCCGGC	0.627																																																0			12											65.0	69.0	67.0					12																	113543598		2203	4300	6503	112027981	SO:0001583	missense	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1748C>T	12.37:g.113543598G>A	ENSP00000261729:p.Ala583Val	Unknown		x	x	x	112027981	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150056	0.57151	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	D;D;T;D	0.92805	-3.11;-3.11;2.35;-3.11	5.36	4.35	0.52113	Rho GTPase activation protein (1);Pleckstrin homology-type (1);Pleckstrin homology domain (3);Ras GTPase-activating protein (1);	0.916958	0.09225	N	0.831385	T	0.81427	0.4820	N	0.08118	0	0.31507	N	0.664083	B;B;B;B;B;B	0.18310	0.002;0.022;0.027;0.013;0.016;0.022	B;B;B;B;B;B	0.18871	0.008;0.01;0.017;0.013;0.023;0.01	T	0.74842	-0.3527	10	0.33141	T	0.24	.	4.2129	0.10521	0.3147:0.0:0.6853:0.0	.	584;584;597;585;583;583	B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;RASL1_HUMAN;.	V	585;583;583;584	ENSP00000450244:A585V;ENSP00000261729:A583V;ENSP00000395920:A583V;ENSP00000448510:A584V	ENSP00000261729:A583V	A	-	2	0	RASAL1	112027981	1.000000	0.71417	0.994000	0.49952	0.781000	0.44180	7.150000	0.77403	2.517000	0.84864	0.455000	0.32223	GCC		0.627	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		Missense_Mutation
PXN	5829	broad.mit.edu	37	12	120659534	120659534	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:120659534C>G	ENST00000228307.7	-	6	864	c.723G>C	c.(721-723)gaG>gaC	p.E241D	PXN_ENST00000538144.1_5'UTR|PXN_ENST00000536957.1_Missense_Mutation_p.E239D|PXN_ENST00000424649.2_Missense_Mutation_p.E241D|PXN_ENST00000267257.7_Missense_Mutation_p.E241D|PXN_ENST00000458477.2_Missense_Mutation_p.E108D|PXN_ENST00000397506.3_5'Flank	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	241					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E241D(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCTGCTCATCTCGCCCTGGT	0.652																																																1	Substitution - Missense(1)	ovary(1)	12											60.0	80.0	73.0					12																	120659534		2171	4270	6441	119143917	SO:0001583	missense	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.723G>C	12.37:g.120659534C>G	ENSP00000228307:p.Glu241Asp	Unknown		x	x	x	119143917	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630274	0.28978	.	.	ENSG00000089159	ENST00000458477;ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.32	3.41	0.39046	.	0.068552	0.56097	D	0.000039	T	0.31199	0.0789	L	0.55103	1.725	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.12837	0.002;0.008;0.005	T	0.08166	-1.0735	10	0.13853	T	0.58	-13.3579	5.5104	0.16878	0.1359:0.5295:0.2631:0.0715	.	241;241;241	P49023-2;P49023-3;P49023	.;.;PAXI_HUMAN	D	108;241;241;239;241	ENSP00000395536:E108D;ENSP00000228307:E241D;ENSP00000391283:E241D;ENSP00000443887:E239D;ENSP00000267257:E241D	ENSP00000228307:E241D	E	-	3	2	PXN	119143917	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	1.023000	0.30065	1.234000	0.43709	0.591000	0.81541	GAG		0.652	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859		Missense_Mutation
WDR66	144406	broad.mit.edu	37	12	122389414	122389414	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:122389414G>C	ENST00000288912.4	+	9	2152	c.1298G>C	c.(1297-1299)aGt>aCt	p.S433T	WDR66_ENST00000397454.2_Missense_Mutation_p.S433T	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	433							calcium ion binding (GO:0005509)	p.S433T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CTGGCTCACAGTGCCCCACTT	0.373																																					Esophageal Squamous(85;849 1794 49757 52143)											1	Substitution - Missense(1)	ovary(1)	12											104.0	89.0	94.0					12																	122389414		1838	4096	5934	120873797	SO:0001583	missense	144406			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.1298G>C	12.37:g.122389414G>C	ENSP00000288912:p.Ser433Thr	Unknown		x	x	x	120873797	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	37	CCDS41853.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	6.632	0.485042	0.12641	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.05081	3.52;3.5	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.330632	0.36893	N	0.002353	T	0.10423	0.0255	M	0.70595	2.14	0.39475	D	0.967797	B	0.02656	0.0	B	0.04013	0.001	T	0.09552	-1.0669	10	0.21540	T	0.41	.	15.3559	0.74425	0.0:0.0:1.0:0.0	.	433	Q8TBY9	WDR66_HUMAN	T	433	ENSP00000288912:S433T;ENSP00000380595:S433T	ENSP00000288912:S433T	S	+	2	0	WDR66	120873797	1.000000	0.71417	0.998000	0.56505	0.059000	0.15707	4.693000	0.61753	2.688000	0.91661	0.591000	0.81541	AGT		0.373	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668		Missense_Mutation
B3GNT4	79369	broad.mit.edu	37	12	122691336	122691336	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr12:122691336G>A	ENST00000324189.4	+	3	894	c.538G>A	c.(538-540)Gac>Aac	p.D180N	B3GNT4_ENST00000535274.1_Missense_Mutation_p.D155N|B3GNT4_ENST00000546192.1_Missense_Mutation_p.D155N|B3GNT4_ENST00000545141.1_Intron	NM_030765.2	NP_110392.1	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4	180					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.D180N(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		GGAGTTTGATGACATCCTCCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											32.0	35.0	34.0					12																	122691336		2203	4300	6503	121257289	SO:0001583	missense	79369			AB049586	CCDS9227.1	12q24	2013-02-19						"""Beta 3-glycosyltransferases"""	15683	protein-coding gene	gene with protein product		605864				11042166	Standard	NM_030765		Approved	B3GN-T4, beta3Gn-T4	uc001ubx.3	Q9C0J1		ENST00000324189.4:c.538G>A	12.37:g.122691336G>A	ENSP00000319636:p.Asp180Asn	Unknown		x	x	x	121257289	Q8N5W4|Q8N934|Q8ND21|Q8WWR5|Q8WY02|Q96QH5	Missense_Mutation	SNP	ENST00000324189.4	37	CCDS9227.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.426844	0.96131	.	.	ENSG00000176383	ENST00000324189;ENST00000546192;ENST00000535274	T;T;T	0.76578	-1.03;-1.03;-1.03	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000017	D	0.92257	0.7544	H	0.95950	3.745	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.94420	0.7640	10	0.87932	D	0	.	18.8572	0.92257	0.0:0.0:1.0:0.0	.	180	Q9C0J1	B3GN4_HUMAN	N	180;155;155	ENSP00000319636:D180N;ENSP00000438840:D155N;ENSP00000444534:D155N	ENSP00000319636:D180N	D	+	1	0	B3GNT4	121257289	1.000000	0.71417	0.861000	0.33841	0.972000	0.66771	9.487000	0.97945	2.622000	0.88805	0.655000	0.94253	GAC		0.622	B3GNT4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401595.1	NM_030765		Missense_Mutation
CENPJ	55835	broad.mit.edu	37	13	25480452	25480452	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr13:25480452A>G	ENST00000381884.4	-	7	1909	c.1724T>C	c.(1723-1725)tTa>tCa	p.L575S	CENPJ_ENST00000545981.1_Missense_Mutation_p.L575S	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	575					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.L575S(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		AAATTCATCTAATTCCAAATT	0.338																																																1	Substitution - Missense(1)	ovary(1)	13											47.0	53.0	51.0					13																	25480452		2202	4300	6502	24378452	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1724T>C	13.37:g.25480452A>G	ENSP00000371308:p.Leu575Ser	Unknown		x	x	x	24378452	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898871	0.72754	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.71341	-0.56;-0.03	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000013	D	0.83764	0.5325	M	0.78637	2.42	0.45354	D	0.998344	D	0.89917	1.0	D	0.85130	0.997	T	0.83082	-0.0137	10	0.35671	T	0.21	.	15.5481	0.76123	1.0:0.0:0.0:0.0	.	575	Q9HC77	CENPJ_HUMAN	S	575	ENSP00000371308:L575S;ENSP00000441090:L575S	ENSP00000371308:L575S	L	-	2	0	CENPJ	24378452	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.490000	0.90464	2.302000	0.77476	0.533000	0.62120	TTA		0.338	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		Missense_Mutation
GPR137C	283554	broad.mit.edu	37	14	53100270	53100270	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:53100270G>T	ENST00000321662.6	+	5	890	c.890G>T	c.(889-891)gGa>gTa	p.G297V		NM_001099652.1	NP_001093122.1	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	297						integral component of membrane (GO:0016021)		p.G313V(1)		NS(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8	Breast(41;0.0716)					GACATAAGTGGAGAAGAGTAT	0.398																																																1	Substitution - Missense(1)	ovary(1)	14											123.0	116.0	118.0					14																	53100270		1846	4091	5937	52170020	SO:0001583	missense	283554			BX647179	CCDS45106.1	14q22.1	2012-08-10				ENSG00000180998			25445	protein-coding gene	gene with protein product							Standard	NM_001099652		Approved	DKFZp762F0713, TM7SF1L2	uc001wzu.4	Q8N3F9		ENST00000321662.6:c.890G>T	14.37:g.53100270G>T	ENSP00000315106:p.Gly297Val	Unknown		x	x	x	52170020	Q86SM2	Missense_Mutation	SNP	ENST00000321662.6	37	CCDS45106.1	SNP	41	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.101056|4.101056	0.76983|0.76983	.|.	.|.	ENSG00000180998|ENSG00000180998	ENST00000321662|ENST00000542169	T|.	0.52754|.	0.65|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.046453|.	0.85682|.	D|.	0.000000|.	T|T	0.69061|0.69061	0.3069|0.3069	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.71656|.	0.974;0.974|.	T|T	0.64927|0.64927	-0.6292|-0.6292	10|5	0.72032|.	D|.	0.01|.	-20.5119|-20.5119	19.2153|19.2153	0.93774|0.93774	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	297;126|.	Q8N3F9;B3KW22|.	G137C_HUMAN;.|.	V|C	297|266	ENSP00000315106:G297V|.	ENSP00000315106:G297V|.	G|W	+|+	2|3	0|0	GPR137C|GPR137C	52170020|52170020	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.706000|0.706000	0.40770|0.40770	6.916000|6.916000	0.75776|0.75776	2.609000|2.609000	0.88269|0.88269	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.398	GPR137C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411685.1	XM_290615		Missense_Mutation
FERMT2	10979	broad.mit.edu	37	14	53327162	53327162	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:53327162C>A	ENST00000395631.2	-	13	1840	c.1624G>T	c.(1624-1626)Gcc>Tcc	p.A542S	FERMT2_ENST00000343279.4_Missense_Mutation_p.A549S|FERMT2_ENST00000399304.3_Missense_Mutation_p.A549S|FERMT2_ENST00000557255.1_5'UTR|FERMT2_ENST00000341590.3_Missense_Mutation_p.A542S|FERMT2_ENST00000553373.1_Missense_Mutation_p.A549S			Q96AC1	FERM2_HUMAN	fermitin family member 2	542	FERM.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.A542S(1)	ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TTCTGATGGGCCTCCAAGATT	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											123.0	107.0	113.0					14																	53327162		2203	4300	6503	52396912	SO:0001583	missense	10979			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1624G>T	14.37:g.53327162C>A	ENSP00000378993:p.Ala542Ser	Unknown		x	x	x	52396912	B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	37	CCDS9713.1	SNP	26	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.287893|5.287893	0.95517|0.95517	.|.	.|.	ENSG00000073712|ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000554152;ENST00000343279;ENST00000553373;ENST00000399304|ENST00000553663	T;T;T;T;T;T|.	0.80824|.	-1.42;-1.42;-1.42;-1.42;-1.42;-1.42|.	5.96|5.96	5.96|5.96	0.96718|0.96718	Band 4.1 domain (1);FERM central domain (2);FERM/acyl-CoA-binding protein, 3-helical bundle (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79052|0.79052	0.4381|0.4381	M|M	0.77313|0.77313	2.365|2.365	0.80722|0.80722	D|D	1|1	D;D;B|.	0.71674|.	0.971;0.998;0.197|.	D;D;B|.	0.76575|.	0.931;0.988;0.165|.	T|T	0.77219|0.77219	-0.2668|-0.2668	10|5	0.54805|.	T|.	0.06|.	.|.	20.4084|20.4084	0.99013|0.99013	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	549;542;549|.	Q96AC1-2;Q96AC1;B5TJY2|.	.;FERM2_HUMAN;.|.	S|V	542;542;502;549;549;549|48	ENSP00000378993:A542S;ENSP00000340391:A542S;ENSP00000450741:A502S;ENSP00000342858:A549S;ENSP00000451084:A549S;ENSP00000382243:A549S|.	ENSP00000340391:A542S|.	A|G	-|-	1|2	0|0	FERMT2|FERMT2	52396912|52396912	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.780000|7.780000	0.85658|0.85658	2.833000|2.833000	0.97629|0.97629	0.650000|0.650000	0.86243|0.86243	GCC|GGC		0.393	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832		Missense_Mutation
WDHD1	11169	broad.mit.edu	37	14	55448322	55448322	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:55448322G>A	ENST00000360586.3	-	16	2064	c.1999C>T	c.(1999-2001)Cac>Tac	p.H667Y	WDHD1_ENST00000420358.2_Missense_Mutation_p.H544Y|WDHD1_ENST00000359167.4_Missense_Mutation_p.H185Y|WDHD1_ENST00000421192.1_Missense_Mutation_p.H544Y	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	667					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.H667Y(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						CCTTTGCAGTGCTCTCTTGTA	0.408																																																1	Substitution - Missense(1)	ovary(1)	14											116.0	108.0	111.0					14																	55448322		2203	4300	6503	54518072	SO:0001583	missense	11169			AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.1999C>T	14.37:g.55448322G>A	ENSP00000353793:p.His667Tyr	Unknown		x	x	x	54518072	C9JW18|F6W0U7	Missense_Mutation	SNP	ENST00000360586.3	37	CCDS9721.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792903	0.50102	.	.	ENSG00000198554	ENST00000360586;ENST00000359167;ENST00000421192	T;T;T	0.62232	0.41;0.88;0.04	5.71	5.71	0.89125	.	0.112463	0.64402	D	0.000007	T	0.71426	0.3338	L	0.55103	1.725	0.47862	D	0.999536	D;D	0.76494	0.999;0.988	D;P	0.65010	0.931;0.759	T	0.64166	-0.6471	10	0.02654	T	1	.	19.9281	0.97110	0.0:0.0:1.0:0.0	.	185;667	F8W7P7;O75717	.;WDHD1_HUMAN	Y	667;185;544	ENSP00000353793:H667Y;ENSP00000352085:H185Y;ENSP00000391049:H544Y	ENSP00000352085:H185Y	H	-	1	0	WDHD1	54518072	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.823000	0.55715	2.708000	0.92522	0.585000	0.79938	CAC		0.408	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086		Missense_Mutation
DLGAP5	9787	broad.mit.edu	37	14	55636269	55636269	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:55636269G>C	ENST00000247191.2	-	12	1612	c.1396C>G	c.(1396-1398)Ctt>Gtt	p.L466V	DLGAP5_ENST00000395425.2_Missense_Mutation_p.L466V	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	466					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)	p.L466V(1)		biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						GTGCGAATAAGATCTTTAGCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	14											65.0	60.0	62.0					14																	55636269		2203	4300	6503	54706022	SO:0001583	missense	9787			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1396C>G	14.37:g.55636269G>C	ENSP00000247191:p.Leu466Val	Unknown		x	x	x	54706022	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	37	CCDS9723.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.99	3.927944	0.73327	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.18810	2.19;2.19	5.85	3.98	0.46160	.	0.060038	0.64402	D	0.000002	T	0.39384	0.1076	M	0.76574	2.34	0.38915	D	0.957607	P;P	0.46064	0.872;0.872	P;P	0.55011	0.766;0.766	T	0.31081	-0.9956	10	0.40728	T	0.16	.	13.3001	0.60319	0.0:0.1222:0.7504:0.1274	.	466;466	A8MTM6;Q15398	.;DLGP5_HUMAN	V	466	ENSP00000378815:L466V;ENSP00000247191:L466V	ENSP00000247191:L466V	L	-	1	0	DLGAP5	54706022	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.114000	0.94329	0.894000	0.36317	0.655000	0.94253	CTT		0.363	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750		Missense_Mutation
PAPLN	89932	broad.mit.edu	37	14	73719414	73719414	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:73719414T>A	ENST00000554301.1	+	10	1188	c.1025T>A	c.(1024-1026)aTg>aAg	p.M342K	PAPLN_ENST00000340738.5_Missense_Mutation_p.M315K|PAPLN_ENST00000381166.3_Missense_Mutation_p.M342K|PAPLN_ENST00000555445.1_Missense_Mutation_p.M342K|PAPLN_ENST00000427855.1_Missense_Mutation_p.M342K			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	342	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)	p.M315K(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CCCGACCACATGTGCCAGCGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	14											77.0	78.0	78.0					14																	73719414		2203	4300	6503	72789167	SO:0001583	missense	89932			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1025T>A	14.37:g.73719414T>A	ENSP00000451803:p.Met342Lys	Unknown		x	x	x	72789167	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	37		SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	18.89	3.719950	0.68844	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21	5.22	4.0	0.46444	.	.	.	.	.	T	0.56572	0.1994	N	0.20328	0.56	0.42790	D	0.993897	D;D;D	0.63880	0.991;0.993;0.993	P;P;P	0.62382	0.841;0.901;0.799	T	0.55483	-0.8134	9	0.33940	T	0.23	.	11.7938	0.52084	0.0:0.0:0.1467:0.8533	.	342;342;315	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	K	315;342;342;342;342	ENSP00000345395:M315K;ENSP00000403403:M342K;ENSP00000370558:M342K;ENSP00000451803:M342K;ENSP00000451729:M342K	ENSP00000216658:M342K	M	+	2	0	PAPLN	72789167	1.000000	0.71417	0.990000	0.47175	0.276000	0.26787	4.964000	0.63701	1.966000	0.57179	0.379000	0.24179	ATG		0.647	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462		Missense_Mutation
VRTN	55237	broad.mit.edu	37	14	74823825	74823825	+	Silent	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:74823825G>A	ENST00000256362.4	+	2	580	c.339G>A	c.(337-339)ctG>ctA	p.L113L		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	113					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.L113L(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						TAGAGATGCTGCTGCACAGAC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											56.0	54.0	55.0					14																	74823825		2203	4300	6503	73893578	SO:0001819	synonymous_variant	55237			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.339G>A	14.37:g.74823825G>A		Unknown		x	x	x	73893578	Q9NVC7	Silent	SNP	ENST00000256362.4	37	CCDS9830.1	SNP	46	Broad																																																																																				0.637	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228		Silent
NPAP1	23742	broad.mit.edu	37	15	24924265	24924265	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:24924265C>T	ENST00000329468.2	+	1	3725	c.3251C>T	c.(3250-3252)gCt>gTt	p.A1084V		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1084					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A1084V(1)									TATACTTCTGCTGCCGCCTAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	15											115.0	107.0	110.0					15																	24924265		2203	4300	6503	22475358	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3251C>T	15.37:g.24924265C>T	ENSP00000333735:p.Ala1084Val	Unknown		x	x	x	22475358		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	5.955	0.360202	0.11296	.	.	ENSG00000185823	ENST00000329468	T	0.07114	3.22	1.68	-3.35	0.04928	.	.	.	.	.	T	0.03827	0.0108	N	0.22421	0.69	0.09310	N	1	P	0.50710	0.938	B	0.34931	0.192	T	0.19386	-1.0307	9	0.51188	T	0.08	.	4.926	0.13894	0.2987:0.4619:0.2394:0.0	.	1084	Q9NZP6	CO002_HUMAN	V	1084	ENSP00000333735:A1084V	ENSP00000333735:A1084V	A	+	2	0	C15orf2	22475358	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-2.360000	0.01084	-2.030000	0.00929	0.313000	0.20887	GCT		0.537	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		Missense_Mutation
OCA2	4948	broad.mit.edu	37	15	28261303	28261303	+	Silent	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:28261303A>G	ENST00000354638.3	-	8	992	c.837T>C	c.(835-837)aaT>aaC	p.N279N	OCA2_ENST00000382996.2_Silent_p.N279N|OCA2_ENST00000353809.5_Silent_p.N279N	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	279					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.N279N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TTCTCCTCGGATTTAAATACA	0.522									Oculocutaneous Albinism																																							1	Substitution - coding silent(1)	ovary(1)	15											152.0	118.0	129.0					15																	28261303		2203	4300	6503	25934898	SO:0001819	synonymous_variant	4948	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.837T>C	15.37:g.28261303A>G		Unknown		x	x	x	25934898	Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	ENST00000354638.3	37	CCDS10020.1	SNP	12	Broad																																																																																				0.522	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		Silent
MGA	23269	broad.mit.edu	37	15	42021388	42021388	+	Silent	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:42021388C>G	ENST00000570161.1	+	10	3684	c.3684C>G	c.(3682-3684)gtC>gtG	p.V1228V	MGA_ENST00000389936.4_Silent_p.V1228V|MGA_ENST00000545763.1_Silent_p.V1228V|MGA_ENST00000219905.7_Silent_p.V1228V|MGA_ENST00000566586.1_Silent_p.V1228V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.V1228V(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAGATCCAGTCTACTTGTACT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	15											90.0	87.0	88.0					15																	42021388		1885	4108	5993	39808680	SO:0001819	synonymous_variant	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.3684C>G	15.37:g.42021388C>G		Unknown		x	x	x	39808680	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	37	CCDS55959.1	SNP	32	Broad																																																																																				0.408	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		Silent
PLA2G4B	100137049	broad.mit.edu	37	15	42137216	42137216	+	Missense_Mutation	SNP	G	G	C	rs140183820	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:42137216G>C	ENST00000452633.1	+	14	1539	c.1187G>C	c.(1186-1188)aGc>aCc	p.S396T	JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.S627T|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.S627T|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.S627T|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.S396T			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	396	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)	p.S627T(1)					all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		GGCTACCCAAGCTGCTTCACC	0.677													G|||	2	0.000399361	0.0	0.0	5008	,	,		15796	0.0		0.002	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						G	THR/SER,THR/SER,THR/SER	1,4399		0,1,2199	15.0	16.0	15.0		1187,1880,1880	4.6	0.9	15	dbSNP_134	15	3,8587		0,3,4292	yes	missense,missense,missense	JMJD7-PLA2G4B,PLA2G4B	NM_001114633.1,NM_001198588.1,NM_005090.3	58,58,58	0,4,6491	CC,CG,GG		0.0349,0.0227,0.0308	benign,benign,benign	396/782,627/894,627/1013	42137216	4,12986	2200	4295	6495	39924508	SO:0001583	missense	100137049			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.1187G>C	15.37:g.42137216G>C	ENSP00000396045:p.Ser396Thr	Unknown		x	x	x	39924508	B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000452633.1	37	CCDS45241.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	.	0.015	-1.550121	0.00926	2.27E-4	3.49E-4	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	5.51	4.59	0.56863	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	1.562520	0.03635	N	0.238588	T	0.03695	0.0105	N	0.00483	-1.445	0.21967	N	0.999445	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.09377	0.003;0.001;0.001;0.004	T	0.30909	-0.9962	10	0.08599	T	0.76	-2.4628	9.6714	0.40015	0.0:0.7697:0.1513:0.079	.	396;627;97;627	P0C869;P0C869-7;P0C869-4;P0C869-6	PA24B_HUMAN;.;.;.	T	627;627;396;396	ENSP00000371886:S627T;ENSP00000342785:S627T;ENSP00000416610:S396T;ENSP00000396045:S396T	ENSP00000342785:S627T	S	+	2	0	JMJD7-PLA2G4B;PLA2G4B	39924508	0.027000	0.19231	0.884000	0.34674	0.111000	0.19643	0.595000	0.24029	1.475000	0.48197	-0.311000	0.09066	AGC		0.677	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345969.1	NM_001114633		Missense_Mutation
DMXL2	23312	broad.mit.edu	37	15	51773357	51773357	+	Missense_Mutation	SNP	G	G	T	rs3751584	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:51773357G>T	ENST00000251076.5	-	24	6233	c.5946C>A	c.(5944-5946)caC>caA	p.H1982Q	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.H1346Q|DMXL2_ENST00000543779.2_Missense_Mutation_p.H1982Q	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1982						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.H1982Q(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AGGCACTGTCGTGATCTTCAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	15											211.0	209.0	210.0					15																	51773357		2196	4293	6489	49560649	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.5946C>A	15.37:g.51773357G>T	ENSP00000251076:p.His1982Gln	Unknown		x	x	x	49560649	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	3.768	-0.048136	0.07407	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.21932	2.12;2.12;1.98	5.12	-10.2	0.00374	.	0.250877	0.44285	N	0.000468	T	0.05318	0.0141	N	0.08118	0	0.21762	N	0.999556	B;B;B;B	0.15141	0.006;0.012;0.004;0.002	B;B;B;B	0.11329	0.003;0.006;0.002;0.0	T	0.16600	-1.0397	10	0.16896	T	0.51	.	4.7677	0.13141	0.2391:0.1374:0.4599:0.1637	.	1982;1346;1982;1982	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	Q	1982;1982;1346	ENSP00000251076:H1982Q;ENSP00000441858:H1982Q;ENSP00000400855:H1346Q	ENSP00000251076:H1982Q	H	-	3	2	DMXL2	49560649	0.261000	0.24063	0.017000	0.16124	0.649000	0.38597	-0.332000	0.07904	-1.710000	0.01397	-2.083000	0.00378	CAC		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		Missense_Mutation
MAN2A2	4122	broad.mit.edu	37	15	91449624	91449624	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:91449624G>T	ENST00000559717.1	+	6	1191	c.732G>T	c.(730-732)gaG>gaT	p.E244D	MAN2A2_ENST00000360468.3_Missense_Mutation_p.E244D|MAN2A2_ENST00000431652.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	244					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.E244D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GGCAGCTGGAGATTGCGACAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	15											101.0	91.0	94.0					15																	91449624		2198	4298	6496	89250628	SO:0001583	missense	4122			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.732G>T	15.37:g.91449624G>T	ENSP00000452948:p.Glu244Asp	Unknown		x	x	x	89250628	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649084	0.87958	.	.	ENSG00000196547	ENST00000360468	T	0.38401	1.14	5.28	3.36	0.38483	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.85682	D	0.000000	T	0.67458	0.2895	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.99;0.999	T	0.74562	-0.3624	10	0.87932	D	0	-35.6398	12.3586	0.55190	0.1409:0.0:0.8591:0.0	.	244;244	P49641-1;P49641	.;MA2A2_HUMAN	D	244	ENSP00000353655:E244D	ENSP00000353655:E244D	E	+	3	2	MAN2A2	89250628	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	3.558000	0.53749	0.602000	0.29896	0.456000	0.33151	GAG		0.552	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122		Missense_Mutation
MEFV	4210	broad.mit.edu	37	16	3299756	3299756	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr16:3299756C>A	ENST00000219596.1	-	3	974	c.935G>T	c.(934-936)aGt>aTt	p.S312I	MEFV_ENST00000541159.1_Missense_Mutation_p.S101I|MEFV_ENST00000536379.1_Missense_Mutation_p.S101I|MEFV_ENST00000339854.4_Missense_Mutation_p.S132I	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	312					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.S312I(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GCAGCGGGGACTCGCAGCCGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	16											33.0	37.0	35.0					16																	3299756		2197	4300	6497	3239757	SO:0001583	missense	4210			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.935G>T	16.37:g.3299756C>A	ENSP00000219596:p.Ser312Ile	Unknown		x	x	x	3239757	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	4.941	0.174771	0.09391	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.63913	-0.07;0.34;0.14;0.26	4.11	0.907	0.19321	.	0.468178	0.20364	N	0.093794	T	0.44329	0.1288	L	0.36672	1.1	0.22500	N	0.999042	B	0.26318	0.146	B	0.22152	0.038	T	0.38672	-0.9650	10	0.87932	D	0	.	3.381	0.07255	0.1985:0.5732:0.0:0.2283	.	312	O15553	MEFV_HUMAN	I	312;312;132;101;101;101	ENSP00000219596:S312I;ENSP00000339639:S132I;ENSP00000438711:S101I;ENSP00000445079:S101I	ENSP00000219596:S312I	S	-	2	0	MEFV	3239757	0.640000	0.27243	0.001000	0.08648	0.036000	0.12997	1.291000	0.33330	0.246000	0.21394	0.563000	0.77884	AGT		0.602	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243		Missense_Mutation
ZNF597	146434	broad.mit.edu	37	16	3487014	3487014	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr16:3487014G>A	ENST00000301744.4	-	4	920	c.685C>T	c.(685-687)Cga>Tga	p.R229*		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R229*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TTCATGTGTCGGGATAGATGA	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	16											125.0	118.0	120.0					16																	3487014		2197	4300	6497	3427015	SO:0001587	stop_gained	146434			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.685C>T	16.37:g.3487014G>A	ENSP00000301744:p.Arg229*	Unknown		x	x	x	3427015		Nonsense_Mutation	SNP	ENST00000301744.4	37	CCDS10505.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141356	0.57044	.	.	ENSG00000167981	ENST00000301744	.	.	.	4.59	2.52	0.30459	.	0.605312	0.13807	N	0.361417	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-4.2335	9.3201	0.37959	0.0:0.1574:0.6797:0.1629	.	.	.	.	X	229	.	ENSP00000301744:R229X	R	-	1	2	ZNF597	3427015	0.000000	0.05858	0.689000	0.30133	0.087000	0.18053	-2.348000	0.01094	0.604000	0.29930	0.655000	0.94253	CGA		0.483	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457		Nonsense_Mutation
ACSM5	54988	broad.mit.edu	37	16	20441026	20441026	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr16:20441026G>T	ENST00000331849.4	+	8	1175	c.1028G>T	c.(1027-1029)tGt>tTt	p.C343F		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	343					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.C343F(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CTGAGGCACTGTCTGACCGGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											96.0	98.0	97.0					16																	20441026		2203	4300	6503	20348527	SO:0001583	missense	54988				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1028G>T	16.37:g.20441026G>T	ENSP00000327916:p.Cys343Phe	Unknown		x	x	x	20348527	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643592	0.47258	.	.	ENSG00000183549	ENST00000331849	T	0.38722	1.12	4.4	3.44	0.39384	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000010	T	0.59528	0.2200	M	0.64080	1.96	0.47065	D	0.999302	D	0.71674	0.998	D	0.70935	0.971	T	0.63734	-0.6570	10	0.87932	D	0	-11.0837	13.6294	0.62186	0.0:0.1572:0.8428:0.0	.	343	Q6NUN0	ACSM5_HUMAN	F	343	ENSP00000327916:C343F	ENSP00000327916:C343F	C	+	2	0	ACSM5	20348527	1.000000	0.71417	0.752000	0.31206	0.515000	0.34225	5.904000	0.69886	0.955000	0.37878	-0.274000	0.10170	TGT		0.562	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		Missense_Mutation
NDRG4	65009	broad.mit.edu	37	16	58538166	58538166	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr16:58538166A>T	ENST00000570248.1	+	3	342	c.236A>T	c.(235-237)cAg>cTg	p.Q79L	NDRG4_ENST00000562999.1_Missense_Mutation_p.Q79L|NDRG4_ENST00000566192.1_Missense_Mutation_p.Q79L|NDRG4_ENST00000394279.2_Missense_Mutation_p.Q111L|NDRG4_ENST00000258187.5_Missense_Mutation_p.Q111L|NDRG4_ENST00000394282.4_Missense_Mutation_p.Q131L|NDRG4_ENST00000563799.1_Missense_Mutation_p.Q97L|NDRG4_ENST00000356752.4_Missense_Mutation_p.Q109L|NDRG4_ENST00000569923.1_Missense_Mutation_p.Q24L|NDRG4_ENST00000568640.1_Missense_Mutation_p.Q97L	NM_001242835.1	NP_001229764.1	Q9ULP0	NDRG4_HUMAN	NDRG family member 4	79					cell differentiation (GO:0030154)|cell growth (GO:0016049)|response to stress (GO:0006950)	cytoplasm (GO:0005737)		p.Q111L(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11						GGGGCGTCGCAGTTTCCTCAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	16											97.0	102.0	101.0					16																	58538166		2198	4300	6498	57095667	SO:0001583	missense	65009			AB044947	CCDS10797.1, CCDS45500.1, CCDS55999.1, CCDS58465.1, CCDS58466.1, CCDS58467.1	16q21-q22.3	2008-07-04			ENSG00000103034	ENSG00000103034			14466	protein-coding gene	gene with protein product		614463				11352569, 16408304	Standard	NM_020465		Approved	KIAA1180, SMAP-8	uc002enk.3	Q9ULP0	OTTHUMG00000133485	ENST00000570248.1:c.236A>T	16.37:g.58538166A>T	ENSP00000457659:p.Gln79Leu	Unknown		x	x	x	57095667	B3KNU2|B4DK66|B4DSW5|H7C600|Q6ZNE7|Q6ZTI7|Q96PL9|Q9GZM1|Q9GZN3|Q9GZX0	Missense_Mutation	SNP	ENST00000570248.1	37	CCDS58466.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	19.32	3.805783	0.70682	.	.	ENSG00000103034	ENST00000258187;ENST00000421602;ENST00000394282;ENST00000394279;ENST00000356752	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.19485	0.0468	N	0.14661	0.345	0.80722	D	1	P;D;P;P;P;P;P	0.54047	0.858;0.964;0.765;0.597;0.679;0.859;0.879	P;P;P;B;B;B;P	0.54924	0.551;0.764;0.501;0.173;0.446;0.37;0.654	T	0.04635	-1.0937	10	0.41790	T	0.15	-28.8227	14.5515	0.68070	1.0:0.0:0.0:0.0	.	97;109;97;79;79;131;111	B4DK66;B4DSW5;Q9ULP0-5;Q9ULP0-2;Q9ULP0;Q9ULP0-6;Q9ULP0-3	.;.;.;.;NDRG4_HUMAN;.;.	L	111;24;131;111;109	ENSP00000258187:Q111L;ENSP00000377823:Q131L;ENSP00000377820:Q111L;ENSP00000349193:Q109L	ENSP00000258187:Q111L	Q	+	2	0	NDRG4	57095667	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	3.973000	0.56845	2.031000	0.59945	0.459000	0.35465	CAG		0.602	NDRG4-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422671.2			Missense_Mutation
CMTM4	146223	broad.mit.edu	37	16	66657375	66657375	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr16:66657375G>C	ENST00000330687.4	-	3	575	c.394C>G	c.(394-396)Ctt>Gtt	p.L132V	CMTM4_ENST00000563952.1_Missense_Mutation_p.L103V|CMTM4_ENST00000394106.2_Missense_Mutation_p.L132V	NM_178818.2|NM_181521.2	NP_848933.1|NP_852662.1	Q8IZR5	CKLF4_HUMAN	CKLF-like MARVEL transmembrane domain containing 4	132	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.L132V(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		ATAAAGAAAAGGAAAGCGCTG	0.418																																																1	Substitution - Missense(1)	ovary(1)	16											80.0	76.0	78.0					16																	66657375		2201	4300	6501	65214876	SO:0001583	missense	146223			AF479814	CCDS10817.1, CCDS42170.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000183723	ENSG00000183723			19175	protein-coding gene	gene with protein product		607887	"""chemokine-like factor super family 4"", ""chemokine-like factor superfamily 4"""	CKLFSF4		12782130	Standard	NM_178818		Approved		uc002epz.3	Q8IZR5	OTTHUMG00000137500	ENST00000330687.4:c.394C>G	16.37:g.66657375G>C	ENSP00000333833:p.Leu132Val	Unknown		x	x	x	65214876	Q52M40|Q8IZR4|Q8IZV1	Missense_Mutation	SNP	ENST00000330687.4	37	CCDS10817.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	9.228	1.035114	0.19590	.	.	ENSG00000183723	ENST00000330687;ENST00000394106	T;T	0.33654	1.4;1.4	5.89	4.75	0.60458	Marvel (1);MARVEL-like domain (1);	0.101299	0.64402	N	0.000001	T	0.25457	0.0619	N	0.17564	0.495	0.29811	N	0.831658	B	0.20164	0.042	B	0.28385	0.089	T	0.16867	-1.0388	10	0.40728	T	0.16	.	11.527	0.50586	0.9289:0.0:0.0711:0.0	.	132	Q8IZR5	CKLF4_HUMAN	V	132	ENSP00000333833:L132V;ENSP00000377666:L132V	ENSP00000333833:L132V	L	-	1	0	CMTM4	65214876	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.462000	0.66707	1.043000	0.40175	-0.290000	0.09829	CTT		0.418	CMTM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268807.1			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	17	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	7518988	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Unknown		x	x	x	7518988	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
KDM6B	23135	broad.mit.edu	37	17	7754493	7754493	+	Silent	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:7754493C>T	ENST00000448097.2	+	14	4159	c.3828C>T	c.(3826-3828)acC>acT	p.T1276T	KDM6B_ENST00000254846.5_Silent_p.T1276T			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1276					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.T1276T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CCCACACCACCATTGCCAAGT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	17											127.0	106.0	113.0					17																	7754493		2203	4300	6503	7695218	SO:0001819	synonymous_variant	23135			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3828C>T	17.37:g.7754493C>T		Unknown		x	x	x	7695218	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	37		SNP	21	Broad																																																																																				0.607	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272		Silent
MYH13	8735	broad.mit.edu	37	17	10216526	10216526	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:10216526G>T	ENST00000418404.3	-	29	4293	c.4130C>A	c.(4129-4131)aCc>aAc	p.T1377N	MYH13_ENST00000252172.4_Missense_Mutation_p.T1377N|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1377					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.T1377N(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCGTATTTGGTCCTCCACTG	0.627																																																2	Substitution - Missense(2)	ovary(2)	17											180.0	166.0	171.0					17																	10216526		2203	4300	6503	10157251	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4130C>A	17.37:g.10216526G>T	ENSP00000404570:p.Thr1377Asn	Unknown		x	x	x	10157251	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	14.58	2.579182	0.46006	.	.	ENSG00000006788	ENST00000252172	T	0.78126	-1.15	3.95	2.89	0.33648	Myosin tail (1);	.	.	.	.	T	0.71247	0.3317	L	0.43598	1.365	0.36788	D	0.884712	B	0.09022	0.002	B	0.23574	0.047	T	0.74131	-0.3764	9	0.46703	T	0.11	.	13.4404	0.61109	0.0:0.0:0.8432:0.1568	.	1377	Q9UKX3	MYH13_HUMAN	N	1377	ENSP00000252172:T1377N	ENSP00000252172:T1377N	T	-	2	0	MYH13	10157251	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	3.679000	0.54634	2.202000	0.70862	0.455000	0.32223	ACC		0.627	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		Missense_Mutation
MYO18A	399687	broad.mit.edu	37	17	27449224	27449224	+	Silent	SNP	C	C	T	rs189308674		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:27449224C>T	ENST00000527372.1	-	3	1227	c.1047G>A	c.(1045-1047)acG>acA	p.T349T	MYO18A_ENST00000354329.4_Silent_p.T349T|MYO18A_ENST00000531253.1_Silent_p.T349T|MYO18A_ENST00000533112.1_Silent_p.T349T	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	349	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.T349T(1)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			ACACCTTCTCCGTCTCATTCC	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		21084	0.0		0.001	False		,,,				2504	0.0				Esophageal Squamous(182;472 2015 7001 15270 22562)											1	Substitution - coding silent(1)	ovary(1)	17						C	,	0,4000		0,0,2000	71.0	81.0	78.0		1047,1047	-10.2	0.2	17		78	2,8360		0,2,4179	no	coding-synonymous,coding-synonymous	MYO18A	NM_078471.3,NM_203318.1	,	0,2,6179	TT,TC,CC		0.0239,0.0,0.0162	,	349/2055,349/2040	27449224	2,12360	2000	4181	6181	24473350	SO:0001819	synonymous_variant	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1047G>A	17.37:g.27449224C>T		Unknown		x	x	x	24473350	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	37	CCDS45642.1	SNP	23	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.541	0.873258	0.17322	0.0	2.39E-4	ENSG00000196535	ENST00000528564	.	.	.	5.11	-10.2	0.00374	.	.	.	.	.	T	0.49029	0.1533	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62746	-0.6789	4	.	.	.	.	10.7027	0.45937	0.1625:0.6184:0.0822:0.1369	.	.	.	.	R	55	.	.	G	-	1	0	MYO18A	24473350	0.000000	0.05858	0.194000	0.23346	0.979000	0.70002	-2.282000	0.01156	-2.834000	0.00338	-1.202000	0.01658	GGA		0.557	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471		Silent
FBXL20	84961	broad.mit.edu	37	17	37420519	37420519	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:37420519G>T	ENST00000264658.6	-	14	1372	c.1112C>A	c.(1111-1113)tCc>tAc	p.S371Y	FBXL20_ENST00000583610.1_Missense_Mutation_p.S371Y|FBXL20_ENST00000577399.1_Missense_Mutation_p.S373Y|FBXL20_ENST00000394294.3_Missense_Mutation_p.S339Y	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	371					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)		p.S371Y(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			GTGCTCCAGGGATGCATCTGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											147.0	124.0	132.0					17																	37420519		2203	4300	6503	34674045	SO:0001583	missense	84961			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.1112C>A	17.37:g.37420519G>T	ENSP00000264658:p.Ser371Tyr	Unknown		x	x	x	34674045	A8K729|Q38J52	Missense_Mutation	SNP	ENST00000264658.6	37	CCDS32640.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	30	5.054765	0.93793	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	T;T	0.02916	4.11;4.11	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	M	0.82823	2.61	0.80722	D	1	D;D	0.59357	0.98;0.985	P;P	0.58077	0.807;0.832	T	0.00024	-1.2322	10	0.72032	D	0.01	.	19.8673	0.96808	0.0:0.0:1.0:0.0	.	339;371	Q96IG2-2;Q96IG2	.;FXL20_HUMAN	Y	371;339	ENSP00000264658:S371Y;ENSP00000377832:S339Y	ENSP00000264658:S371Y	S	-	2	0	FBXL20	34674045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.793000	0.96121	0.563000	0.77884	TCC		0.517	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875		Missense_Mutation
FZD2	2535	broad.mit.edu	37	17	42636571	42636571	+	Silent	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:42636571G>C	ENST00000315323.3	+	1	1647	c.1515G>C	c.(1513-1515)ccG>ccC	p.P505P		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	505					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.P505P(2)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGGCCATCCCGTGCCCGGCGC	0.627																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	17											43.0	40.0	41.0					17																	42636571		2203	4300	6503	39992097	SO:0001819	synonymous_variant	2535			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1515G>C	17.37:g.42636571G>C		Unknown		x	x	x	39992097	Q0VG82	Silent	SNP	ENST00000315323.3	37	CCDS11484.1	SNP	40	Broad																																																																																				0.627	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466		Silent
MYCBPAP	84073	broad.mit.edu	37	17	48603431	48603432	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:48603431_48603432CC>AT	ENST00000323776.5	+	14	2263_2264	c.2101_2102CC>AT	c.(2101-2103)CCc>ATc	p.P701I	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.P664I	NM_032133.4	NP_115509.4			MYCBP associated protein									p.P664I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			AACTCAAGTGCCCCGGCCTGAG	0.599																																																1	Substitution - Missense(1)	ovary(1)	17																																								45958431	SO:0001583	missense	84073			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	Exception_encountered	17.37:g.48603431_48603432delinsAT	ENSP00000323184:p.Pro701Ile	Unknown		x	x	x	45958430		Missense_Mutation	DNP	ENST00000323776.5	37	CCDS32680.2	DNP	26	Broad																																																																																				0.599	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133		Missense_Mutation
PSMC5	5705	broad.mit.edu	37	17	61908429	61908429	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr17:61908429C>T	ENST00000310144.6	+	8	1021	c.713C>T	c.(712-714)gCa>gTa	p.A238V	PSMC5_ENST00000375812.4_Missense_Mutation_p.A230V|PSMC5_ENST00000580864.1_Missense_Mutation_p.A230V|PSMC5_ENST00000581882.1_Missense_Mutation_p.A230V|FTSJ3_ENST00000580295.1_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	238	May mediate interaction with PRPF9. {ECO:0000250|UniProtKB:P62196}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.A238V(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						TTTGTCATGGCACGGGAACAT	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											83.0	80.0	81.0					17																	61908429		2203	4300	6503	59262161	SO:0001583	missense	5705			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.713C>T	17.37:g.61908429C>T	ENSP00000310572:p.Ala238Val	Unknown		x	x	x	59262161	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Missense_Mutation	SNP	ENST00000310144.6	37	CCDS11645.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856411	0.91355	.	.	ENSG00000087191	ENST00000310144;ENST00000375812	D;D	0.82081	-1.57;-1.57	5.64	5.64	0.86602	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.91670	0.7367	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.92126	0.5708	10	0.87932	D	0	.	17.243	0.87019	0.0:1.0:0.0:0.0	.	230;238	A8K3Z3;P62195	.;PRS8_HUMAN	V	238;230	ENSP00000310572:A238V;ENSP00000364970:A230V	ENSP00000310572:A238V	A	+	2	0	PSMC5	59262161	1.000000	0.71417	0.994000	0.49952	0.889000	0.51656	5.876000	0.69667	2.937000	0.99478	0.650000	0.86243	GCA		0.562	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805		Missense_Mutation
ZNF521	25925	broad.mit.edu	37	18	22804915	22804915	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr18:22804915G>T	ENST00000361524.3	-	4	3115	c.2967C>A	c.(2965-2967)aaC>aaA	p.N989K	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.N989K|ZNF521_ENST00000584787.1_Missense_Mutation_p.N769K	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	989					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.N989K(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AAATCCGGCAGTTTCCAGTAT	0.473			T	PAX5	ALL																																		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	1	Substitution - Missense(1)	ovary(1)	18											63.0	63.0	63.0					18																	22804915		2203	4300	6503	21058913	SO:0001583	missense	25925			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2967C>A	18.37:g.22804915G>T	ENSP00000354794:p.Asn989Lys	Unknown		x	x	x	21058913	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	9.780	1.175180	0.21704	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.07908	3.15;3.2	5.97	5.1	0.69264	Zinc finger, C2H2-like (1);	0.042471	0.85682	D	0.000000	T	0.03608	0.0103	N	0.14661	0.345	0.39861	D	0.973385	P	0.36412	0.552	B	0.29524	0.103	T	0.28902	-1.0029	10	0.02654	T	1	-48.3642	9.9161	0.41434	0.0693:0.0:0.7923:0.1384	.	989	Q96K83	ZN521_HUMAN	K	989;1023;989	ENSP00000354794:N989K;ENSP00000382352:N989K	ENSP00000354794:N989K	N	-	3	2	ZNF521	21058913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.656000	0.83736	1.518000	0.48934	0.655000	0.94253	AAC		0.473	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		Missense_Mutation
NOTCH3	4854	broad.mit.edu	37	19	15281145	15281145	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:15281145A>C	ENST00000263388.2	-	27	5186	c.5111T>G	c.(5110-5112)aTg>aGg	p.M1704R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1704					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.M1704R(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TTCTCACTTCATGCCCAGCGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											35.0	37.0	36.0					19																	15281145		2203	4300	6503	15142145	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5111T>G	19.37:g.15281145A>C	ENSP00000263388:p.Met1704Arg	Unknown		x	x	x	15142145	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	25.4	4.629854	0.87660	.	.	ENSG00000074181	ENST00000263388	D	0.82255	-1.59	3.97	3.97	0.46021	.	.	.	.	.	D	0.87712	0.6246	M	0.74647	2.275	0.58432	D	0.999998	D	0.65815	0.995	P	0.56788	0.806	D	0.89078	0.3474	9	0.87932	D	0	.	11.9959	0.53204	1.0:0.0:0.0:0.0	.	1704	Q9UM47	NOTC3_HUMAN	R	1704	ENSP00000263388:M1704R	ENSP00000263388:M1704R	M	-	2	0	NOTCH3	15142145	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.129000	0.94430	1.673000	0.50895	0.482000	0.46254	ATG		0.642	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435		Missense_Mutation
HSPB6	126393	broad.mit.edu	37	19	36250358	36250358	+	5'Flank	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:36250358C>A	ENST00000592984.1	-	0	0				C19orf55_ENST00000396908.4_Missense_Mutation_p.T32N|C19orf55_ENST00000544099.1_Missense_Mutation_p.T32N|C19orf55_ENST00000537459.1_Missense_Mutation_p.T32N|C19orf55_ENST00000421853.2_Intron|HSPB6_ENST00000004982.3_5'Flank|HSPB6_ENST00000587965.1_5'Flank|C19orf55_ENST00000536950.1_Missense_Mutation_p.T32N			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)	p.T32N(1)		lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGAGCCAGACCTGGTGTCCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											33.0	36.0	35.0					19																	36250358		1941	4140	6081	40942198	SO:0001631	upstream_gene_variant	148137			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36250358C>A	Exception_encountered	Unknown		x	x	x	40942198	O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	ENST00000592984.1	37	CCDS12475.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059763	0.55325	.	.	ENSG00000167595	ENST00000396908;ENST00000301165	T	0.32023	1.47	3.65	1.35	0.21983	.	0.736081	0.11133	N	0.596079	T	0.20373	0.0490	L	0.51422	1.61	0.09310	N	1	P;P;P	0.40107	0.703;0.539;0.539	B;B;B	0.31751	0.135;0.077;0.077	T	0.13255	-1.0516	10	0.19590	T	0.45	-15.8279	5.9323	0.19146	0.2306:0.5656:0.2038:0.0	.	32;32;32	E5RFB9;Q2NL68-3;Q2NL68-4	.;.;.	N	32	ENSP00000380116:T32N	ENSP00000301165:T32N	T	+	2	0	C19orf55	40942198	0.056000	0.20664	0.031000	0.17742	0.496000	0.33645	-0.196000	0.09532	0.445000	0.26639	0.467000	0.42956	ACC		0.542	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109498.3	NM_144617		Missense_Mutation
NPHS1	4868	broad.mit.edu	37	19	36342473	36342473	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:36342473C>A	ENST00000378910.5	-	2	159	c.160G>T	c.(160-162)Ggg>Tgg	p.G54W	NPHS1_ENST00000591817.1_5'Flank|NPHS1_ENST00000353632.6_Missense_Mutation_p.G54W	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	54	Ig-like C2-type 1.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.G54W(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTGCTGACCCCACAACGCAGC	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											21.0	23.0	22.0					19																	36342473		2201	4297	6498	41034313	SO:0001583	missense	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.160G>T	19.37:g.36342473C>A	ENSP00000368190:p.Gly54Trp	Unknown		x	x	x	41034313	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469730	0.63625	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.64991	-0.13;-0.13	5.43	5.43	0.79202	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.131007	0.51477	D	0.000093	T	0.78278	0.4258	M	0.70595	2.14	0.38362	D	0.94462	D	0.89917	1.0	D	0.75020	0.985	T	0.81861	-0.0738	10	0.66056	D	0.02	-28.3397	16.8018	0.85616	0.0:1.0:0.0:0.0	.	54	O60500	NPHN_HUMAN	W	54	ENSP00000368190:G54W;ENSP00000343634:G54W	ENSP00000343634:G54W	G	-	1	0	NPHS1	41034313	0.367000	0.25023	0.942000	0.38095	0.443000	0.32047	1.873000	0.39558	2.557000	0.86248	0.644000	0.83932	GGG		0.682	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1			Missense_Mutation
ZNF567	163081	broad.mit.edu	37	19	37210566	37210566	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:37210566T>G	ENST00000536254.2	+	6	1162	c.940T>G	c.(940-942)Tgt>Ggt	p.C314G	ZNF567_ENST00000585696.1_Missense_Mutation_p.C283G|ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000392163.2_Missense_Mutation_p.C283G|ZNF567_ENST00000360729.4_Missense_Mutation_p.C283G|ZNF567_ENST00000588311.1_Missense_Mutation_p.C283G			Q8N184	ZN567_HUMAN	zinc finger protein 567	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C283G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TTGCAATGAATGTGGTAAGTC	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											58.0	58.0	58.0					19																	37210566		2203	4300	6503	41902406	SO:0001583	missense	163081			AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.940T>G	19.37:g.37210566T>G	ENSP00000441838:p.Cys314Gly	Unknown		x	x	x	41902406	B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	37		SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	16.61	3.172502	0.57584	.	.	ENSG00000189042	ENST00000536254;ENST00000360729;ENST00000423498;ENST00000392163	D;D;D	0.85861	-2.04;-2.04;-2.04	4.53	4.53	0.55603	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000157	D	0.94709	0.8293	H	0.97315	3.98	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.997	D	0.95826	0.8854	10	0.87932	D	0	.	12.1261	0.53917	0.0:0.0:0.0:1.0	.	314;283	Q8N184;F8WEL6	ZN567_HUMAN;.	G	314;283;313;283	ENSP00000441838:C314G;ENSP00000353957:C283G;ENSP00000376003:C283G	ENSP00000353957:C283G	C	+	1	0	ZNF567	41902406	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.499000	0.53310	2.028000	0.59812	0.379000	0.24179	TGT		0.423	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603		Missense_Mutation
ZNF227	7770	broad.mit.edu	37	19	44739680	44739680	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:44739680A>C	ENST00000313040.7	+	6	1302	c.1097A>C	c.(1096-1098)aAt>aCt	p.N366T	ZNF227_ENST00000589005.1_Missense_Mutation_p.N315T|ZNF227_ENST00000391961.2_Missense_Mutation_p.N315T	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	366					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N366T(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				CAAAGTTCAAATTTTCAGTGC	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											75.0	82.0	80.0					19																	44739680		2203	4300	6503	49431520	SO:0001583	missense	7770			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1097A>C	19.37:g.44739680A>C	ENSP00000321049:p.Asn366Thr	Unknown		x	x	x	49431520	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	CCDS12636.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	8.971	0.972877	0.18736	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.22134	1.97;3.19	4.54	0.761	0.18448	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21674	0.0522	L	0.45228	1.405	0.09310	N	1	B;B;D;B	0.56521	0.063;0.063;0.976;0.063	B;B;P;B	0.50754	0.02;0.02;0.649;0.02	T	0.17258	-1.0375	9	0.22706	T	0.39	.	7.0871	0.25264	0.4383:0.4229:0.0:0.1388	.	287;345;318;366	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	T	366;323;315;345;67	ENSP00000321049:N366T;ENSP00000375823:N315T	ENSP00000321049:N366T	N	+	2	0	ZNF227	49431520	0.000000	0.05858	0.947000	0.38551	0.991000	0.79684	-0.062000	0.11674	0.160000	0.19432	0.460000	0.39030	AAT		0.423	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490		Missense_Mutation
PLA2G4C	8605	broad.mit.edu	37	19	48556376	48556376	+	Silent	SNP	G	G	A	rs182307505	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:48556376G>A	ENST00000599921.1	-	16	1815	c.1458C>T	c.(1456-1458)taC>taT	p.Y486Y	AC010458.1_ENST00000408668.1_RNA|PLA2G4C_ENST00000413144.2_Silent_p.Y486Y|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000354276.3_Silent_p.Y486Y|PLA2G4C_ENST00000599111.1_Silent_p.Y496Y			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	486	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)	p.Y486Y(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		TGAATGTGTCGTATGTGTCAC	0.408													g|||	2	0.000399361	0.0008	0.0	5008	,	,		20569	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19						G	,,	1,4405	2.1+/-5.4	0,1,2202	186.0	145.0	159.0		1488,1458,1458	0.6	0.0	19		159	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	PLA2G4C	NM_001159322.1,NM_001159323.1,NM_003706.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	496/552,486/528,486/542	48556376	1,13005	2203	4300	6503	53248188	SO:0001819	synonymous_variant	8605			AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1458C>T	19.37:g.48556376G>A		Unknown		x	x	x	53248188	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Silent	SNP	ENST00000599921.1	37	CCDS12710.1	SNP	40	Broad																																																																																				0.408	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1			Silent
SIGLEC10	89790	broad.mit.edu	37	19	51917743	51917743	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr19:51917743A>C	ENST00000339313.5	-	9	1758	c.1642T>G	c.(1642-1644)Ttc>Gtc	p.F548V	CTD-2616J11.2_ENST00000526996.1_RNA|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.F490V|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.F395V|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.F305V|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.F548V|SIGLEC10_ENST00000432469.2_Missense_Mutation_p.F370V|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.F405V|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.F453V|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.F363V			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	548					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.F490V(1)|p.F548V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CCGTTGGAGAATGCCGTTGAG	0.577																																																2	Substitution - Missense(2)	ovary(2)	19											98.0	87.0	90.0					19																	51917743		2203	4300	6503	56609555	SO:0001583	missense	89790			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.1642T>G	19.37:g.51917743A>C	ENSP00000345243:p.Phe548Val	Unknown		x	x	x	56609555	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	.	8.591	0.884501	0.17467	.	.	ENSG00000142512	ENST00000353836;ENST00000432469;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313	T;T;T;T;T;T;T;T;T	0.51817	0.95;2.14;1.61;0.85;1.97;1.83;0.69;1.93;0.85	4.78	3.76	0.43208	.	0.742636	0.12257	N	0.485137	T	0.33527	0.0866	L	0.38175	1.15	0.09310	N	1	B;B;B;B;B;P;B;B	0.36249	0.0;0.063;0.193;0.349;0.292;0.545;0.007;0.004	B;B;B;B;B;B;B;B	0.31812	0.002;0.093;0.036;0.13;0.079;0.136;0.018;0.005	T	0.11348	-1.0591	10	0.32370	T	0.25	.	7.2776	0.26294	0.897:0.0:0.103:0.0	.	405;363;453;305;453;395;490;548	C9JM10;E9PL79;B7ZL04;C9JJ33;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;.;SIG10_HUMAN	V	453;370;305;548;395;363;490;405;548	ENSP00000342389:F453V;ENSP00000396742:F370V;ENSP00000395475:F305V;ENSP00000348646:F548V;ENSP00000408387:F395V;ENSP00000431444:F363V;ENSP00000389132:F490V;ENSP00000414324:F405V;ENSP00000345243:F548V	ENSP00000345243:F548V	F	-	1	0	SIGLEC10	56609555	0.661000	0.27430	0.011000	0.14972	0.005000	0.04900	2.571000	0.45990	0.682000	0.31407	-0.441000	0.05720	TTC		0.577	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130		Missense_Mutation
APOB	338	broad.mit.edu	37	2	21230871	21230871	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:21230871A>T	ENST00000233242.1	-	26	8996	c.8869T>A	c.(8869-8871)Ttt>Att	p.F2957I		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2957					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.F2957I(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACAGTCCAAAGGAAGTGAGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											140.0	144.0	143.0					2																	21230871		2203	4300	6503	21084376	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8869T>A	2.37:g.21230871A>T	ENSP00000233242:p.Phe2957Ile	Unknown		x	x	x	21084376	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	6.406	0.443083	0.12164	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00792	5.69	5.74	1.98	0.26296	.	0.197173	0.35805	N	0.002980	T	0.00967	0.0032	M	0.73962	2.25	0.53005	D	0.999967	P	0.39282	0.666	B	0.29440	0.102	T	0.66284	-0.5962	10	0.48119	T	0.1	.	6.2258	0.20708	0.7257:0.1334:0.1409:0.0	.	2957	P04114	APOB_HUMAN	I	2957	ENSP00000233242:F2957I	ENSP00000233242:F2957I	F	-	1	0	APOB	21084376	0.828000	0.29307	0.716000	0.30569	0.017000	0.09413	1.360000	0.34125	0.429000	0.26202	0.459000	0.35465	TTT		0.408	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
PRKD3	23683	broad.mit.edu	37	2	37509753	37509753	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:37509753A>G	ENST00000379066.1	-	7	1682	c.920T>C	c.(919-921)tTc>tCc	p.F307S	PRKD3_ENST00000234179.2_Missense_Mutation_p.F307S			O94806	KPCD3_HUMAN	protein kinase D3	307					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.F307S(2)		breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ATGGCAGTTGAATTTGCAATC	0.308																																					Melanoma(80;621 1355 8613 11814 51767)											2	Substitution - Missense(2)	ovary(2)	2											94.0	96.0	95.0					2																	37509753		2203	4300	6503	37363257	SO:0001583	missense	23683			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.920T>C	2.37:g.37509753A>G	ENSP00000368356:p.Phe307Ser	Unknown		x	x	x	37363257	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	37	CCDS1789.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	28.6	4.930257	0.92389	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	D;D	0.84442	-1.85;-1.85	5.62	5.62	0.85841	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.93167	0.7824	M	0.86864	2.845	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.79108	0.983;0.992	D	0.94163	0.7416	10	0.72032	D	0.01	-17.3165	16.1172	0.81314	1.0:0.0:0.0:0.0	.	307;307	O94806-2;O94806	.;KPCD3_HUMAN	S	307	ENSP00000368356:F307S;ENSP00000234179:F307S	ENSP00000234179:F307S	F	-	2	0	PRKD3	37363257	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.287000	0.95975	2.266000	0.75297	0.533000	0.62120	TTC		0.308	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813		Missense_Mutation
FAM161A	84140	broad.mit.edu	37	2	62066963	62066963	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:62066963T>A	ENST00000405894.3	-	3	1277	c.1176A>T	c.(1174-1176)ttA>ttT	p.L392F	FAM161A_ENST00000404929.1_Missense_Mutation_p.L392F	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	392					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)		p.L283F(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATGAGTTCTGTAAATGCTCCT	0.458																																																1	Substitution - Missense(1)	ovary(1)	2											97.0	97.0	97.0					2																	62066963		1969	4153	6122	61920467	SO:0001583	missense	84140				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.1176A>T	2.37:g.62066963T>A	ENSP00000385893:p.Leu392Phe	Unknown		x	x	x	61920467	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	CCDS42687.2	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	17.85	3.491109	0.64074	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.26660	1.72;1.72	5.67	-3.96	0.04106	.	0.317682	0.29486	N	0.012011	T	0.46425	0.1392	M	0.87971	2.92	0.27330	N	0.956801	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.37709	-0.9694	10	0.72032	D	0.01	-24.765	7.7496	0.28890	0.1022:0.3905:0.0:0.5072	.	392;392	Q3B820;Q3B820-3	F161A_HUMAN;.	F	392	ENSP00000385158:L392F;ENSP00000385893:L392F	ENSP00000385158:L392F	L	-	3	2	FAM161A	61920467	0.002000	0.14202	0.000000	0.03702	0.031000	0.12232	-1.435000	0.02423	-0.983000	0.03511	0.528000	0.53228	TTA		0.458	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180		Missense_Mutation
ANKRD36	375248	broad.mit.edu	37	2	97779626	97779627	+	Nonsense_Mutation	DNP	CC	CC	GT			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:97779626_97779627CC>GT	ENST00000461153.2	+	1	394_395	c.150_151CC>GT	c.(148-153)taCCtt>taGTtt	p.50_51YL>*F	ANKRD36_ENST00000420699.2_Nonsense_Mutation_p.50_51YL>*F			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	50								p.Y50*(2)		endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						AACTGAAGTACCTTCTGCTCAC	0.52																																																2	Substitution - Nonsense(2)	ovary(2)	2																																								97143354	SO:0001587	stop_gained	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	Exception_encountered	2.37:g.97779626_97779627delinsGT	ENSP00000419530:p.Y50_L51delins*F	Unknown		x	x	x	97143353	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Nonsense_Mutation	DNP	ENST00000461153.2	37	CCDS54379.1	DNP	18	Broad																																																																																				0.520	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			Nonsense_Mutation
TMEM87B	84910	broad.mit.edu	37	2	112847248	112847248	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:112847248C>G	ENST00000283206.4	+	10	1354	c.985C>G	c.(985-987)Cta>Gta	p.L329V	TMEM87B_ENST00000463427.1_3'UTR	NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	329						integral component of membrane (GO:0016021)		p.L329V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						ACTGGGGCTTCTATACTTAAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	136.0	139.0					2																	112847248		2203	4300	6503	112563719	SO:0001583	missense	84910			AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.985C>G	2.37:g.112847248C>G	ENSP00000283206:p.Leu329Val	Unknown		x	x	x	112563719	A8K2M9|Q1RLN2|Q53R54	Missense_Mutation	SNP	ENST00000283206.4	37	CCDS33275.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404942	0.83230	.	.	ENSG00000153214	ENST00000283206	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.63094	0.2482	L	0.43923	1.385	0.80722	D	1	P	0.49696	0.927	P	0.51777	0.679	T	0.61232	-0.7104	9	0.48119	T	0.1	-20.5966	17.952	0.89056	0.0:1.0:0.0:0.0	.	329	Q96K49	TM87B_HUMAN	V	329	.	ENSP00000283206:L329V	L	+	1	2	TMEM87B	112563719	1.000000	0.71417	0.136000	0.22124	0.925000	0.55904	4.735000	0.62051	2.835000	0.97688	0.650000	0.86243	CTA		0.433	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330500.1	NM_032824		Missense_Mutation
LRP1B	53353	broad.mit.edu	37	2	141359112	141359112	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:141359112T>A	ENST00000389484.3	-	42	7867	c.6896A>T	c.(6895-6897)gAc>gTc	p.D2299V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2299					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D2299V(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCGAGTCTGGTCCACAGTGTG	0.498										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											151.0	125.0	133.0					2																	141359112		2203	4300	6503	141075582	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6896A>T	2.37:g.141359112T>A	ENSP00000374135:p.Asp2299Val	Unknown		x	x	x	141075582	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	27.4	4.826423	0.90955	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.92595	-3.07	5.04	5.04	0.67666	Six-bladed beta-propeller, TolB-like (1);	0.067245	0.64402	D	0.000016	D	0.95079	0.8406	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95473	0.8553	10	0.66056	D	0.02	.	15.0609	0.71951	0.0:0.0:0.0:1.0	.	2299	Q9NZR2	LRP1B_HUMAN	V	2299;2237	ENSP00000374135:D2299V	ENSP00000374135:D2299V	D	-	2	0	LRP1B	141075582	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.193000	0.72075	2.015000	0.59207	0.459000	0.35465	GAC		0.498	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
ALS2CR12	130540	broad.mit.edu	37	2	202208981	202208981	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:202208981T>A	ENST00000286190.5	-	5	420	c.374A>T	c.(373-375)aAc>aTc	p.N125I	ALS2CR12_ENST00000448967.1_5'UTR|ALS2CR12_ENST00000392257.3_Missense_Mutation_p.N125I|ALS2CR12_ENST00000405148.2_Missense_Mutation_p.N125I|ALS2CR12_ENST00000439709.1_Missense_Mutation_p.N125I			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	125					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)		p.N125I(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						AGAAATGATGTTGGTCCTGTA	0.458																																																1	Substitution - Missense(1)	ovary(1)	2											243.0	228.0	233.0					2																	202208981		2203	4300	6503	201917226	SO:0001583	missense	130540			AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.374A>T	2.37:g.202208981T>A	ENSP00000286190:p.Asn125Ile	Unknown		x	x	x	201917226	G5E9S3|Q53TT6|Q8N1B6	Missense_Mutation	SNP	ENST00000286190.5	37	CCDS2346.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	15.68	2.904943	0.52333	.	.	ENSG00000155749	ENST00000286190;ENST00000405148;ENST00000392257;ENST00000439709	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.17	2.77	0.32553	.	0.490245	0.18886	N	0.128459	T	0.30603	0.0770	N	0.22421	0.69	0.09310	N	1	P;P	0.43094	0.799;0.799	P;P	0.44990	0.466;0.466	T	0.11567	-1.0582	10	0.72032	D	0.01	-1.122	5.5167	0.16910	0.0:0.0904:0.1741:0.7355	.	125;125	Q96Q35;G5E9S3	AL2SB_HUMAN;.	I	125	ENSP00000286190:N125I;ENSP00000385098:N125I;ENSP00000376086:N125I;ENSP00000412073:N125I	ENSP00000286190:N125I	N	-	2	0	ALS2CR12	201917226	0.002000	0.14202	0.051000	0.19133	0.221000	0.24807	1.064000	0.30579	0.370000	0.24538	0.454000	0.30748	AAC		0.458	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1	NM_139163		Missense_Mutation
MAP2	4133	broad.mit.edu	37	2	210561680	210561680	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr2:210561680T>C	ENST00000360351.4	+	9	4933	c.4427T>C	c.(4426-4428)gTt>gCt	p.V1476A	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.V1472A|MAP2_ENST00000475600.1_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1476					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.V1476A(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAAACAGAAGTTCAGGCCCAC	0.383																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											54.0	57.0	56.0					2																	210561680		2203	4300	6503	210269925	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4427T>C	2.37:g.210561680T>C	ENSP00000353508:p.Val1476Ala	Unknown		x	x	x	210269925	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	15.05	2.719463	0.48728	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25414	1.8;1.8	5.56	5.56	0.83823	MAP2/Tau projection (1);	0.000000	0.53938	D	0.000050	T	0.47116	0.1428	L	0.59436	1.845	0.47994	D	0.999566	D;P	0.71674	0.998;0.794	D;P	0.77557	0.99;0.625	T	0.31779	-0.9931	10	0.36615	T	0.2	-18.4346	15.7258	0.77756	0.0:0.0:0.0:1.0	.	1472;1476	P11137-3;P11137	.;MAP2_HUMAN	A	1476;1472	ENSP00000353508:V1476A;ENSP00000392164:V1472A	ENSP00000353508:V1476A	V	+	2	0	MAP2	210269925	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.427000	0.59888	2.123000	0.65237	0.528000	0.53228	GTT		0.383	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		Missense_Mutation
SNPH	9751	broad.mit.edu	37	20	1285730	1285730	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr20:1285730C>T	ENST00000381873.3	+	6	753	c.517C>T	c.(517-519)Cag>Tag	p.Q173*	SNPH_ENST00000381867.1_Nonsense_Mutation_p.Q217*	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	173					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)	p.Q173*(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CATCAACATCCAGAACAAGAA	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	20											121.0	96.0	105.0					20																	1285730		2203	4300	6503	1233730	SO:0001587	stop_gained	9751				CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.517C>T	20.37:g.1285730C>T	ENSP00000371297:p.Gln173*	Unknown		x	x	x	1233730	Q8IYI3	Nonsense_Mutation	SNP	ENST00000381873.3	37	CCDS13012.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.565695	0.97667	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-21.1257	17.8388	0.88709	0.0:1.0:0.0:0.0	.	.	.	.	X	173;217	.	ENSP00000371291:Q217X	Q	+	1	0	SNPH	1233730	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.548000	0.85928	0.655000	0.94253	CAG		0.557	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723		Nonsense_Mutation
SUN5	140732	broad.mit.edu	37	20	31577460	31577460	+	Silent	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr20:31577460G>A	ENST00000356173.3	-	9	671	c.579C>T	c.(577-579)taC>taT	p.Y193Y	SUN5_ENST00000375523.3_Silent_p.Y168Y	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	193					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.Y193Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						GCTTTTCGATGTAATCTCCGT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	20											246.0	186.0	207.0					20																	31577460		2203	4300	6503	31041121	SO:0001819	synonymous_variant	140732			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.579C>T	20.37:g.31577460G>A		Unknown		x	x	x	31041121	A6NJ82|Q5T9R0	Silent	SNP	ENST00000356173.3	37	CCDS13209.1	SNP	48	Broad																																																																																				0.493	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675		Silent
DIP2A	23181	broad.mit.edu	37	21	47975908	47975908	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr21:47975908A>C	ENST00000417564.2	+	29	3423	c.3402A>C	c.(3400-3402)aaA>aaC	p.K1134N	DIP2A_ENST00000400274.1_Missense_Mutation_p.K1130N|DIP2A_ENST00000318711.7_Missense_Mutation_p.K1135N|DIP2A_ENST00000427143.2_Missense_Mutation_p.K1070N			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1134					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.K1135N(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		ACATCCCAAAAAAGAAGATAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	21											130.0	135.0	133.0					21																	47975908		1966	4147	6113	46800336	SO:0001583	missense	23181			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3402A>C	21.37:g.47975908A>C	ENSP00000392066:p.Lys1134Asn	Unknown		x	x	x	46800336	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578270	0.65878	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000417564	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.39	1.29	0.21616	AMP-dependent synthetase/ligase (1);	0.060510	0.64402	D	0.000004	T	0.22044	0.0531	L	0.59436	1.845	0.48696	D	0.999697	P;D;P	0.64830	0.806;0.994;0.482	P;D;P	0.65684	0.744;0.937;0.677	T	0.00571	-1.1665	10	0.44086	T	0.13	-17.2908	8.7327	0.34510	0.6133:0.0:0.3867:0.0	.	1135;1070;1134	E9PER1;E7EMA5;Q14689	.;.;DIP2A_HUMAN	N	1130;1070;1135;1134	ENSP00000383133:K1130N;ENSP00000400528:K1070N;ENSP00000323633:K1135N;ENSP00000392066:K1134N	ENSP00000323633:K1135N	K	+	3	2	DIP2A	46800336	0.636000	0.27207	0.995000	0.50966	0.808000	0.45660	-0.054000	0.11826	0.350000	0.24002	0.460000	0.39030	AAA		0.502	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		Missense_Mutation
USP18	11274	broad.mit.edu	37	22	18640540	18640540	+	Missense_Mutation	SNP	A	A	G	rs533388580		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr22:18640540A>G	ENST00000215794.7	+	2	540	c.110A>G	c.(109-111)aAg>aGg	p.K37R		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	37					cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.K37R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						AGCAACATGAAGAGAGAGCAG	0.542											OREG0026287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	22											129.0	128.0	128.0					22																	18640540		2203	4300	6503	17020540	SO:0001583	missense	11274			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.110A>G	22.37:g.18640540A>G	ENSP00000215794:p.Lys37Arg	Unknown	727	x	x	x	17020540	Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	ENST00000215794.7	37	CCDS13752.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	.	8.776	0.927180	0.18056	.	.	ENSG00000184979	ENST00000215794	T	0.07021	3.23	4.66	2.54	0.30619	.	0.112837	0.38492	N	0.001679	T	0.04048	0.0113	N	0.14661	0.345	0.25757	N	0.984982	P	0.34522	0.455	B	0.30029	0.11	T	0.39542	-0.9609	10	0.33141	T	0.24	.	6.3166	0.21194	0.8167:0.0:0.1833:0.0	.	37	Q9UMW8	UBP18_HUMAN	R	37	ENSP00000215794:K37R	ENSP00000215794:K37R	K	+	2	0	USP18	17020540	0.998000	0.40836	0.979000	0.43373	0.084000	0.17831	0.243000	0.18106	0.394000	0.25230	0.482000	0.46254	AAG		0.542	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316368.1			Missense_Mutation
SMTN	6525	broad.mit.edu	37	22	31487458	31487458	+	Silent	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr22:31487458C>T	ENST00000347557.2	+	10	1667	c.1449C>T	c.(1447-1449)aaC>aaT	p.N483N	SMTN_ENST00000333137.7_Silent_p.N483N|SMTN_ENST00000404574.1_5'Flank|SMTN_ENST00000358743.1_Silent_p.N483N	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	483					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.N483N(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CCACAGGCAACCAGAGGGCAG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	22											17.0	21.0	20.0					22																	31487458		2111	4189	6300	29817458	SO:0001819	synonymous_variant	6525			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1449C>T	22.37:g.31487458C>T		Unknown		x	x	x	29817458	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Silent	SNP	ENST00000347557.2	37	CCDS13886.1	SNP	18	Broad																																																																																				0.662	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270		Silent
CRELD2	79174	broad.mit.edu	37	22	50319204	50319204	+	Splice_Site	SNP	T	T	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr22:50319204T>A	ENST00000328268.4	+	9	1082	c.1008T>A	c.(1006-1008)gcT>gcA	p.A336A	CRELD2_ENST00000403427.3_Splice_Site_p.A308A|CRELD2_ENST00000407217.3_Splice_Site_p.A304A|CRELD2_ENST00000404488.3_Splice_Site_p.A385A	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2	336						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)	p.A336A(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		CGGCAGAGGCTGGTGAGTGGC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	22											84.0	78.0	80.0					22																	50319204		2203	4300	6503	48705208	SO:0001630	splice_region_variant	79174			BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.1009+1T>A	22.37:g.50319204T>A		Unknown		x	x	x	48705208	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Silent	SNP	ENST00000328268.4	37	CCDS14082.1	SNP	55	Broad																																																																																				0.597	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317409.1	NM_024324	Silent	Silent
TBC1D5	9779	broad.mit.edu	37	3	17202461	17202461	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:17202461G>T	ENST00000253692.7	-	22	4046	c.2382C>A	c.(2380-2382)gaC>gaA	p.D794E	TBC1D5_ENST00000446818.2_Missense_Mutation_p.D816E|TBC1D5_ENST00000429383.4_Missense_Mutation_p.D794E|TBC1D5_ENST00000414318.2_5'UTR	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	794						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)	p.D794E(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						GTGGTCAGATGTCCAGGGGAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											61.0	56.0	58.0					3																	17202461		2203	4300	6503	17177465	SO:0001583	missense	9779			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.2382C>A	3.37:g.17202461G>T	ENSP00000253692:p.Asp794Glu	Unknown		x	x	x	17177465	A6NP25|C9JP52	Missense_Mutation	SNP	ENST00000253692.7	37	CCDS33714.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229646	0.58777	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818	T;T;T	0.46063	0.89;0.89;0.88	5.63	4.76	0.60689	.	0.095482	0.64402	D	0.000001	T	0.29223	0.0727	N	0.24115	0.695	0.80722	D	1	B;B;B	0.22683	0.073;0.016;0.016	B;B;B	0.22386	0.039;0.016;0.016	T	0.07385	-1.0775	10	0.42905	T	0.14	-2.9129	10.5774	0.45235	0.0728:0.1333:0.7939:0.0	.	816;794;794	C9JP52;B9A6K1;Q92609	.;.;TBCD5_HUMAN	E	794;794;816	ENSP00000253692:D794E;ENSP00000398127:D794E;ENSP00000402935:D816E	ENSP00000253692:D794E	D	-	3	2	TBC1D5	17177465	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.666000	0.54540	1.389000	0.46526	0.561000	0.74099	GAC		0.592	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744		Missense_Mutation
TRIM71	131405	broad.mit.edu	37	3	32932208	32932208	+	Silent	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:32932208C>A	ENST00000383763.5	+	4	1575	c.1512C>A	c.(1510-1512)tcC>tcA	p.S504S		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	504					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S504S(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGGTGGCCTCCTTCACAGTCA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											48.0	51.0	50.0					3																	32932208		2076	4204	6280	32907212	SO:0001819	synonymous_variant	131405				CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1512C>A	3.37:g.32932208C>A		Unknown		x	x	x	32907212		Silent	SNP	ENST00000383763.5	37	CCDS43060.1	SNP	24	Broad																																																																																				0.602	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111		Silent
WDR6	11180	broad.mit.edu	37	3	49049644	49049644	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:49049644C>T	ENST00000608424.1	+	2	716	c.677C>T	c.(676-678)aCa>aTa	p.T226I	WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000395474.3_Missense_Mutation_p.T256I|WDR6_ENST00000448293.1_Missense_Mutation_p.T175I|WDR6_ENST00000415265.2_Intron			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	226					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.T226I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TTGCTGGCTACAGCTTCAGAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	92.0	92.0					3																	49049644		2203	4300	6503	49024648	SO:0001583	missense	11180			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.677C>T	3.37:g.49049644C>T	ENSP00000477389:p.Thr226Ile	Unknown		x	x	x	49024648	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37		SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738754	0.89573	.	.	ENSG00000178252	ENST00000395474;ENST00000438660;ENST00000448293	T;T;T	0.67523	-0.27;-0.27;-0.27	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.057375	0.64402	D	0.000001	D	0.83431	0.5253	M	0.85299	2.745	0.58432	D	0.999993	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.66351	0.943;0.915;0.943	D	0.85825	0.1388	10	0.87932	D	0	-14.0452	18.416	0.90570	0.0:1.0:0.0:0.0	.	97;226;175	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	I	256;258;175	ENSP00000378857:T256I;ENSP00000387692:T258I;ENSP00000413432:T175I	ENSP00000378857:T256I	T	+	2	0	WDR6	49024648	1.000000	0.71417	0.978000	0.43139	0.997000	0.91878	5.522000	0.67092	2.650000	0.89964	0.561000	0.74099	ACA		0.557	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1			Missense_Mutation
USP4	7375	broad.mit.edu	37	3	49337974	49337974	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:49337974G>A	ENST00000265560.4	-	11	1484	c.1438C>T	c.(1438-1440)Cca>Tca	p.P480S	USP4_ENST00000351842.4_Missense_Mutation_p.P433S|USP4_ENST00000488520.1_5'Flank	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	480	USP.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.P480S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		AAGGGCAGTGGCAGCGTTAGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											148.0	135.0	140.0					3																	49337974		2203	4300	6503	49312978	SO:0001583	missense	7375			U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.1438C>T	3.37:g.49337974G>A	ENSP00000265560:p.Pro480Ser	Unknown		x	x	x	49312978	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	SNP	42	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.523968|4.523968	0.85600|0.85600	.|.	.|.	ENSG00000114316|ENSG00000114316	ENST00000431357|ENST00000351842;ENST00000265560	.|T;T	.|0.03094	.|4.05;4.05	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.24314|0.24314	0.0589|0.0589	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.998;1.0	.|D;D;D	.|0.97110	.|1.0;0.977;1.0	T|T	0.00398|0.00398	-1.1764|-1.1764	5|10	.|0.87932	.|D	.|0	-12.7741|-12.7741	18.9061|18.9061	0.92462|0.92462	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|433;480;480	.|Q13107-2;Q13107;Q08AK7	.|.;UBP4_HUMAN;.	V|S	218|433;480	.|ENSP00000341028:P433S;ENSP00000265560:P480S	.|ENSP00000265560:P480S	A|P	-|-	2|1	0|0	USP4|USP4	49312978|49312978	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.494000|0.494000	0.33585|0.33585	9.809000|9.809000	0.99208|0.99208	2.802000|2.802000	0.96397|0.96397	0.561000|0.561000	0.74099|0.74099	GCC|CCA		0.473	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443		Missense_Mutation
BBX	56987	broad.mit.edu	37	3	107491881	107491881	+	Missense_Mutation	SNP	T	T	C	rs79840732		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:107491881T>C	ENST00000325805.8	+	11	1600	c.1313T>C	c.(1312-1314)aTt>aCt	p.I438T	BBX_ENST00000406780.1_Missense_Mutation_p.I438T|BBX_ENST00000416476.2_Intron|BBX_ENST00000402543.1_Missense_Mutation_p.I438T|BBX_ENST00000415149.2_Missense_Mutation_p.I438T			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	438					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I438T(1)		breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ATTATGATCATTGAGGATCCC	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											76.0	82.0	80.0					3																	107491881		2203	4300	6503	108974571	SO:0001583	missense	56987			AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.1313T>C	3.37:g.107491881T>C	ENSP00000319974:p.Ile438Thr	Unknown		x	x	x	108974571	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	10.91	1.483155	0.26598	.	.	ENSG00000114439	ENST00000415149;ENST00000325767;ENST00000402543;ENST00000325805;ENST00000402163;ENST00000406780	D;D;D;D;D	0.99060	-4.51;-4.51;-4.49;-5.38;-4.51	6.07	4.85	0.62838	.	0.472469	0.23577	N	0.046695	D	0.97785	0.9273	L	0.29908	0.895	0.32303	N	0.564822	B;B;D	0.58970	0.031;0.065;0.984	B;B;D	0.69479	0.007;0.01;0.964	D	0.95852	0.8875	10	0.54805	T	0.06	-10.6198	0.8308	0.01130	0.1703:0.1573:0.1786:0.4938	.	438;438;438	C9JA69;Q8WY36;Q8WY36-2	.;BBX_HUMAN;.	T	438;289;438;438;438;438	ENSP00000408358:I438T;ENSP00000385317:I438T;ENSP00000319974:I438T;ENSP00000385518:I438T;ENSP00000385530:I438T	ENSP00000319742:I289T	I	+	2	0	BBX	108974571	0.097000	0.21791	1.000000	0.80357	0.885000	0.51271	0.767000	0.26575	2.330000	0.79161	0.477000	0.44152	ATT		0.363	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235		Missense_Mutation
KIAA2018	205717	broad.mit.edu	37	3	113377323	113377323	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:113377323G>A	ENST00000478658.1	-	5	3223	c.3206C>T	c.(3205-3207)cCt>cTt	p.P1069L	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.P1069L			Q68DE3	K2018_HUMAN	KIAA2018	1069						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.P1069L(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CTCTTGATCAGGGAGGCAGGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											149.0	138.0	141.0					3																	113377323		1966	4146	6112	114860013	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3206C>T	3.37:g.113377323G>A	ENSP00000420721:p.Pro1069Leu	Unknown		x	x	x	114860013	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	13.51	2.259371	0.39995	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.13538	2.58;2.58	4.44	4.44	0.53790	.	0.442238	0.23017	N	0.052897	T	0.12987	0.0315	L	0.27053	0.805	0.46823	D	0.999215	P	0.37781	0.608	B	0.37943	0.261	T	0.10154	-1.0642	10	0.62326	D	0.03	-4.2568	17.292	0.87159	0.0:0.0:1.0:0.0	.	1069	Q68DE3	K2018_HUMAN	L	1069	ENSP00000320794:P1069L;ENSP00000420721:P1069L	ENSP00000320794:P1069L	P	-	2	0	KIAA2018	114860013	0.973000	0.33851	0.954000	0.39281	0.775000	0.43874	5.784000	0.68990	2.312000	0.78011	0.455000	0.32223	CCT		0.433	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		Missense_Mutation
C3orf70	285382	broad.mit.edu	37	3	184801229	184801229	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr3:184801229T>C	ENST00000335012.2	-	2	509	c.319A>G	c.(319-321)Aaa>Gaa	p.K107E		NM_001025266.1	NP_001020437.1	A6NLC5	CC070_HUMAN	chromosome 3 open reading frame 70	107								p.K107E(1)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|urinary_tract(1)	13						GATGCAAATTTCAAAAAGTGT	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	85.0	84.0					3																	184801229		2203	4300	6503	186283923	SO:0001583	missense	285382				CCDS33900.1	3q27	2008-08-08			ENSG00000187068	ENSG00000187068			33731	protein-coding gene	gene with protein product							Standard	NM_001025266		Approved		uc003fpd.3	A6NLC5	OTTHUMG00000156696	ENST00000335012.2:c.319A>G	3.37:g.184801229T>C	ENSP00000334974:p.Lys107Glu	Unknown		x	x	x	186283923	B2RNY2|B9EH83	Missense_Mutation	SNP	ENST00000335012.2	37	CCDS33900.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	20.3	3.969098	0.74131	.	.	ENSG00000187068	ENST00000335012	.	.	.	5.61	4.46	0.54185	.	0.047755	0.85682	D	0.000000	T	0.42921	0.1224	N	0.24115	0.695	0.46203	D	0.998922	B	0.28998	0.23	B	0.27170	0.077	T	0.38090	-0.9677	9	0.66056	D	0.02	.	10.9744	0.47456	0.0:0.0734:0.0:0.9266	.	107	A6NLC5	CC070_HUMAN	E	107	.	ENSP00000334974:K107E	K	-	1	0	C3orf70	186283923	1.000000	0.71417	0.988000	0.46212	0.833000	0.47200	5.881000	0.69706	0.965000	0.38133	0.533000	0.62120	AAA		0.473	C3orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345323.1	NM_001025266		Missense_Mutation
SEL1L3	23231	broad.mit.edu	37	4	25819787	25819787	+	Missense_Mutation	SNP	C	C	T	rs190624648		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr4:25819787C>T	ENST00000399878.3	-	9	1659	c.1537G>A	c.(1537-1539)Gca>Aca	p.A513T	SEL1L3_ENST00000264868.5_Missense_Mutation_p.A478T|SEL1L3_ENST00000502949.1_Missense_Mutation_p.A360T	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	513						integral component of membrane (GO:0016021)		p.A360T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TCCAGCAATGCCTGGAACAAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	4											74.0	75.0	75.0					4																	25819787		1958	4160	6118	25428885	SO:0001583	missense	23231			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1537G>A	4.37:g.25819787C>T	ENSP00000382767:p.Ala513Thr	Unknown		x	x	x	25428885	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	37	CCDS47037.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	8.940	0.965668	0.18583	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.14640	2.71;2.71;2.49	5.95	0.0862	0.14445	.	0.830790	0.11167	N	0.592474	T	0.08313	0.0207	L	0.40543	1.245	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.45293	-0.9271	10	0.08381	T	0.77	-0.4173	3.5416	0.07814	0.275:0.4136:0.0:0.3114	.	513	Q68CR1	SE1L3_HUMAN	T	513;478;360	ENSP00000382767:A513T;ENSP00000264868:A478T;ENSP00000425438:A360T	ENSP00000264868:A478T	A	-	1	0	SEL1L3	25428885	0.029000	0.19370	0.041000	0.18516	0.491000	0.33493	-0.093000	0.11111	-0.333000	0.08476	-0.181000	0.13052	GCA		0.542	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187		Missense_Mutation
LIAS	11019	broad.mit.edu	37	4	39469193	39469193	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr4:39469193G>T	ENST00000513731.1	+	3	326	c.274G>T	c.(274-276)Gca>Tca	p.A92S	LIAS_ENST00000381846.1_Intron|LIAS_ENST00000261434.3_Missense_Mutation_p.A222S|LIAS_ENST00000340169.2_Missense_Mutation_p.A222S					lipoic acid synthetase									p.A222S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						TGATCTCAAAGCAATAGAAAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											142.0	138.0	139.0					4																	39469193		2203	4300	6503	39145588	SO:0001583	missense	11019			AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369	ENST00000513731.1:c.274G>T	4.37:g.39469193G>T	ENSP00000425580:p.Ala92Ser	Unknown		x	x	x	39145588		Missense_Mutation	SNP	ENST00000513731.1	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.77	2.636020	0.47049	.	.	ENSG00000121897	ENST00000340169;ENST00000261434;ENST00000513731	T;T;T	0.80393	-1.37;-1.37;-1.37	5.89	5.02	0.67125	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.76564	0.4005	L	0.52206	1.635	0.80722	D	1	B;B	0.20261	0.043;0.001	B;B	0.27380	0.079;0.021	T	0.69745	-0.5062	10	0.21014	T	0.42	-22.3073	15.588	0.76502	0.0:0.0:0.8622:0.1378	.	92;222	D6RCP8;O43766	.;LIAS_HUMAN	S	222;222;92	ENSP00000340676:A222S;ENSP00000261434:A222S;ENSP00000425580:A92S	ENSP00000261434:A222S	A	+	1	0	LIAS	39145588	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	4.086000	0.57664	2.788000	0.95919	0.557000	0.71058	GCA		0.388	LIAS-006	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000361037.1	NM_194451		Missense_Mutation
FRYL	285527	broad.mit.edu	37	4	48559562	48559562	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr4:48559562C>G	ENST00000503238.1	-	31	4032	c.4033G>C	c.(4033-4035)Gtg>Ctg	p.V1345L	FRYL_ENST00000358350.4_Missense_Mutation_p.V1345L|FRYL_ENST00000507711.1_Missense_Mutation_p.V1345L|FRYL_ENST00000537810.1_Missense_Mutation_p.V1345L|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.V1345L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CTACTAGTCACCATAAGTTCT	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											188.0	184.0	185.0					4																	48559562		1954	4160	6114	48254319	SO:0001583	missense	285527			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4033G>C	4.37:g.48559562C>G	ENSP00000426064:p.Val1345Leu	Unknown		x	x	x	48254319	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	SNP	18	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.89|15.89	2.966217|2.966217	0.53507|0.53507	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000514617|ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	.|T;T;T;T	.|0.42513	.|1.97;1.97;1.97;0.97	5.88|5.88	5.88|5.88	0.94601|0.94601	.|Armadillo-type fold (1);	.|0.056278	.|0.64402	.|D	.|0.000001	T|T	0.31888|0.31888	0.0811|0.0811	N|N	0.17379|0.17379	0.485|0.485	0.80722|0.80722	D|D	1|1	.|P;B;B;B	.|0.48764	.|0.915;0.007;0.002;0.001	.|B;B;B;B	.|0.41088	.|0.347;0.003;0.004;0.007	T|T	0.03863|0.03863	-1.0997|-1.0997	5|10	.|0.26408	.|T	.|0.33	.|.	20.2266|20.2266	0.98341|0.98341	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1345;176;1345;1345	.|F2Z2S2;Q6ZR29;O94915;F5GX82	.|.;.;FRYL_HUMAN;.	A|L	215|1345	.|ENSP00000426064:V1345L;ENSP00000351113:V1345L;ENSP00000441114:V1345L;ENSP00000421584:V1345L	.|ENSP00000351113:V1345L	G|V	-|-	2|1	0|0	FRYL|FRYL	48254319|48254319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.558000|0.558000	0.35554|0.35554	7.788000|7.788000	0.85771|0.85771	2.769000|2.769000	0.95229|0.95229	0.655000|0.655000	0.94253|0.94253	GGT|GTG		0.453	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			Missense_Mutation
NMU	10874	broad.mit.edu	37	4	56496615	56496615	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr4:56496615A>T	ENST00000264218.3	-	2	230	c.125T>A	c.(124-126)tTa>tAa	p.L42*	NMU_ENST00000511469.1_Nonsense_Mutation_p.L42*|NMU_ENST00000515325.1_5'UTR|NMU_ENST00000507338.1_Nonsense_Mutation_p.L42*|NMU_ENST00000505262.1_Nonsense_Mutation_p.L42*	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	42					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)	p.L42*(1)		lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		TCCTTGAGGTAATATTGGAGC	0.318																																																1	Substitution - Nonsense(1)	ovary(1)	4											88.0	87.0	87.0					4																	56496615		2203	4298	6501	56191372	SO:0001587	stop_gained	10874			X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.125T>A	4.37:g.56496615A>T	ENSP00000264218:p.Leu42*	Unknown		x	x	x	56191372		Nonsense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	15.64	2.892964	0.52121	.	.	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	.	.	.	4.56	-0.522	0.11928	.	0.731043	0.12406	N	0.471738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.4286	5.0368	0.14438	0.5627:0.1525:0.2848:0.0	.	.	.	.	X	42	.	ENSP00000264218:L42X	L	-	2	0	NMU	56191372	0.408000	0.25360	0.016000	0.15963	0.110000	0.19582	0.777000	0.26718	-0.194000	0.10399	-1.481000	0.00988	TTA		0.318	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2			Nonsense_Mutation
MMRN1	22915	broad.mit.edu	37	4	90816624	90816624	+	Missense_Mutation	SNP	G	G	T	rs139015467		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr4:90816624G>T	ENST00000394980.1	+	2	821	c.502G>T	c.(502-504)Gtt>Ttt	p.V168F	MMRN1_ENST00000394981.1_Missense_Mutation_p.V134F|MMRN1_ENST00000264790.2_Missense_Mutation_p.V168F			Q13201	MMRN1_HUMAN	multimerin 1	168					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.V168F(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		cattggaggcgttggaggcac	0.488																																																1	Substitution - Missense(1)	ovary(1)	4											57.0	58.0	57.0					4																	90816624		2203	4300	6503	91035647	SO:0001583	missense	22915			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.502G>T	4.37:g.90816624G>T	ENSP00000378431:p.Val168Phe	Unknown		x	x	x	91035647	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	7.641	0.680848	0.14907	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981	T;T;T	0.72505	0.06;0.06;-0.66	0.119	-0.238	0.13055	.	.	.	.	.	T	0.55641	0.1933	N	0.08118	0	0.09310	N	1	P;P	0.52577	0.954;0.923	P;P	0.54100	0.742;0.556	T	0.49725	-0.8909	8	0.62326	D	0.03	.	.	.	.	.	134;168	Q13201-2;Q13201	.;MMRN1_HUMAN	F	168;168;134	ENSP00000378431:V168F;ENSP00000264790:V168F;ENSP00000378432:V134F	ENSP00000264790:V168F	V	+	1	0	MMRN1	91035647	0.012000	0.17670	0.042000	0.18584	0.078000	0.17371	-0.687000	0.05156	-1.142000	0.02869	-1.148000	0.01847	GTT		0.488	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351		Missense_Mutation
ANK2	287	broad.mit.edu	37	4	114208786	114208786	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr4:114208786C>T	ENST00000357077.4	+	19	2158	c.2105C>T	c.(2104-2106)gCa>gTa	p.A702V	ANK2_ENST00000394537.3_Missense_Mutation_p.A702V|ANK2_ENST00000506722.1_Missense_Mutation_p.A681V|ANK2_ENST00000264366.6_Missense_Mutation_p.A702V	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	702					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A702V(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTACACCTTGCAGCCCAGGAA	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											121.0	104.0	110.0					4																	114208786		2203	4300	6503	114428235	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2105C>T	4.37:g.114208786C>T	ENSP00000349588:p.Ala702Val	Unknown		x	x	x	114428235	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303451	0.40795	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.80909	-1.29;-1.29;-1.29;-1.29;-1.43;-1.29;-1.29	5.49	4.66	0.58398	Ankyrin repeat-containing domain (3);	0.000000	0.51477	D	0.000084	D	0.90490	0.7021	M	0.88640	2.97	0.80722	D	1	D;D;D;P;D	0.76494	0.999;0.987;0.976;0.907;0.979	D;P;P;P;D	0.75484	0.976;0.841;0.8;0.702;0.986	D	0.91151	0.4953	10	0.46703	T	0.11	.	14.3181	0.66465	0.0:0.9286:0.0:0.0714	.	702;702;702;681;681	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	V	681;648;681;717;702;702;702;681	ENSP00000423799:A681V;ENSP00000421011:A648V;ENSP00000421067:A681V;ENSP00000424722:A717V;ENSP00000378044:A702V;ENSP00000349588:A702V;ENSP00000264366:A702V	ENSP00000264366:A702V	A	+	2	0	ANK2	114428235	1.000000	0.71417	0.996000	0.52242	0.050000	0.14768	6.035000	0.70940	1.299000	0.44798	-0.145000	0.13849	GCA		0.383	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		Missense_Mutation
IRX1	79192	broad.mit.edu	37	5	3599431	3599431	+	Silent	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:3599431C>T	ENST00000302006.3	+	2	421	c.369C>T	c.(367-369)ttC>ttT	p.F123F	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	123					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.F123F(1)		biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ACGGCCAGTTCCAATACGGGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	5											44.0	48.0	47.0					5																	3599431		2203	4300	6503	3652431	SO:0001819	synonymous_variant	79192			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.369C>T	5.37:g.3599431C>T		Unknown		x	x	x	3652431	Q7Z2F8|Q8N312	Silent	SNP	ENST00000302006.3	37	CCDS34132.1	SNP	30	Broad																																																																																				0.657	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		Silent
PRDM9	56979	broad.mit.edu	37	5	23527255	23527255	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:23527255C>G	ENST00000296682.3	+	11	2240	c.2058C>G	c.(2056-2058)caC>caG	p.H686Q		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	686					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.H686Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGAGGACACACACAGGGGAGA	0.607										HNSCC(3;0.000094)																																						1	Substitution - Missense(1)	ovary(1)	5											12.0	8.0	9.0					5																	23527255		1364	3028	4392	23563012	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2058C>G	5.37:g.23527255C>G	ENSP00000296682:p.His686Gln	Unknown		x	x	x	23563012	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	16.84	3.232969	0.58777	.	.	ENSG00000164256	ENST00000296682	T	0.66995	-0.24	2.65	2.65	0.31530	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38548	N	0.001651	T	0.81912	0.4923	M	0.91768	3.24	0.42866	D	0.994127	P	0.45634	0.863	P	0.59703	0.862	D	0.85804	0.1375	10	0.87932	D	0	-10.0827	11.443	0.50107	0.0:1.0:0.0:0.0	.	686	Q9NQV7	PRDM9_HUMAN	Q	686	ENSP00000296682:H686Q	ENSP00000296682:H686Q	H	+	3	2	PRDM9	23563012	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	2.481000	0.45215	1.786000	0.52430	0.505000	0.49811	CAC		0.607	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		Missense_Mutation
RASGRF2	5924	broad.mit.edu	37	5	80508345	80508345	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:80508345A>T	ENST00000265080.4	+	23	3384	c.3317A>T	c.(3316-3318)tAc>tTc	p.Y1106F	CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000503483.2_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1106	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.|Responsible of the affinity for farnesylated versus geranylgeranylated Ras. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y1106F(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AGTGCCATCTACAGGCTGAAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	5											46.0	43.0	44.0					5																	80508345		2203	4300	6503	80544101	SO:0001583	missense	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3317A>T	5.37:g.80508345A>T	ENSP00000265080:p.Tyr1106Phe	Unknown		x	x	x	80544101	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527670	0.64860	.	.	ENSG00000113319	ENST00000265080	T	0.30448	1.53	5.74	5.74	0.90152	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	N	0.10629	0.01	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.23476	-1.0187	10	0.12430	T	0.62	.	15.6999	0.77535	1.0:0.0:0.0:0.0	.	1106	O14827	RGRF2_HUMAN	F	1106	ENSP00000265080:Y1106F	ENSP00000265080:Y1106F	Y	+	2	0	RASGRF2	80544101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.280000	0.72626	2.185000	0.69588	0.533000	0.62120	TAC		0.577	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		Missense_Mutation
MAN2A1	4124	broad.mit.edu	37	5	109103354	109103354	+	Silent	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:109103354T>C	ENST00000261483.4	+	6	2006	c.954T>C	c.(952-954)gtT>gtC	p.V318V		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	318					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.V318V(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ATTATGCAGTTAAAAAACACT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	5											123.0	120.0	121.0					5																	109103354		2202	4300	6502	109131253	SO:0001819	synonymous_variant	4124				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.954T>C	5.37:g.109103354T>C		Unknown		x	x	x	109131253	Q16767	Silent	SNP	ENST00000261483.4	37	CCDS34209.1	SNP	61	Broad																																																																																				0.408	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1			Silent
SNCAIP	9627	broad.mit.edu	37	5	121761207	121761207	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:121761207C>T	ENST00000261368.8	+	5	1425	c.1163C>T	c.(1162-1164)cCa>cTa	p.P388L	SNCAIP_ENST00000503116.2_Missense_Mutation_p.P435L|SNCAIP_ENST00000261367.7_Missense_Mutation_p.P435L|SNCAIP_ENST00000379536.2_Intron|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000379533.2_Missense_Mutation_p.P435L|SNCAIP_ENST00000504884.2_3'UTR	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	388					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)	p.P388L(1)|p.P435L(1)		NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AAGTTGACTCCAGCAGGCCTG	0.502																																																2	Substitution - Missense(2)	ovary(2)	5											65.0	65.0	65.0					5																	121761207		2203	4300	6503	121789106	SO:0001583	missense	9627			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1163C>T	5.37:g.121761207C>T	ENSP00000261368:p.Pro388Leu	Unknown		x	x	x	121789106	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	CCDS4131.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298732	0.60195	.	.	ENSG00000064692	ENST00000261368;ENST00000379533;ENST00000261367;ENST00000503116	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	5.67	4.79	0.61399	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.87059	0.6083	M	0.90252	3.1	0.80722	D	1	P;D;D;D	0.89917	0.954;1.0;0.973;0.978	B;D;P;P	0.97110	0.356;1.0;0.811;0.686	D	0.90135	0.4209	10	0.87932	D	0	-17.2641	16.6575	0.85232	0.0:0.8702:0.1298:0.0	.	16;435;435;388	Q9NVG1;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	L	388;435;435;435	ENSP00000261368:P388L;ENSP00000368848:P435L;ENSP00000261367:P435L;ENSP00000423199:P435L	ENSP00000261367:P435L	P	+	2	0	SNCAIP	121789106	1.000000	0.71417	0.195000	0.23364	0.565000	0.35776	7.256000	0.78350	1.383000	0.46405	-0.176000	0.13171	CCA		0.502	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1			Missense_Mutation
SCGB3A2	117156	broad.mit.edu	37	5	147261066	147261066	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:147261066C>T	ENST00000296694.4	+	2	206	c.113C>T	c.(112-114)cCt>cTt	p.P38L	SCGB3A2_ENST00000504320.1_5'UTR|SCGB3A2_ENST00000514688.1_3'UTR|C5orf46_ENST00000510432.1_Intron	NM_054023.4	NP_473364.1	Q96PL1	SG3A2_HUMAN	secretoglobin, family 3A, member 2	38						endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)		p.P38L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACCTTTACCTCTGGACAAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	5											195.0	191.0	192.0					5																	147261066		2203	4300	6503	147241259	SO:0001583	missense	117156			AF313455	CCDS4287.1	5q32	2011-12-14			ENSG00000164265	ENSG00000164265		"""Secretoglobins"""	18391	protein-coding gene	gene with protein product	"""uteroglobin-related protein 1"", ""pneumo secretory protein 1"", ""uteroglobin related protein 1"""	606531				11682631, 22155607	Standard	NM_054023		Approved	UGRP1, LU103, PNSP1	uc003lot.2	Q96PL1	OTTHUMG00000129729	ENST00000296694.4:c.113C>T	5.37:g.147261066C>T	ENSP00000296694:p.Pro38Leu	Unknown		x	x	x	147241259		Missense_Mutation	SNP	ENST00000296694.4	37	CCDS4287.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229213	0.58777	.	.	ENSG00000164265	ENST00000296694	.	.	.	5.14	4.27	0.50696	.	0.000000	0.64402	D	0.000004	T	0.61248	0.2332	.	.	.	0.80722	D	1	D	0.60575	0.988	P	0.56163	0.793	T	0.57447	-0.7810	8	0.22706	T	0.39	-27.8798	9.7284	0.40346	0.0:0.9037:0.0:0.0963	.	38	Q96PL1	SG3A2_HUMAN	L	38	.	ENSP00000296694:P38L	P	+	2	0	SCGB3A2	147241259	0.175000	0.23083	0.954000	0.39281	0.143000	0.21401	2.075000	0.41538	1.305000	0.44909	0.555000	0.69702	CCT		0.478	SCGB3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251939.1	NM_054023		Missense_Mutation
PDE6A	5145	broad.mit.edu	37	5	149283226	149283226	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:149283226G>C	ENST00000255266.5	-	8	1217	c.1098C>G	c.(1096-1098)gaC>gaG	p.D366E		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	366	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.D366E(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	ATGCAAAAAAGTCCTCCGCAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	5											123.0	125.0	125.0					5																	149283226		2203	4300	6503	149263419	SO:0001583	missense	5145				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.1098C>G	5.37:g.149283226G>C	ENSP00000255266:p.Asp366Glu	Unknown		x	x	x	149263419	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	2.597	-0.293784	0.05568	.	.	ENSG00000132915	ENST00000255266	T	0.63913	-0.07	5.84	3.1	0.35709	GAF (2);	0.168317	0.51477	N	0.000081	T	0.24198	0.0586	N	0.01417	-0.88	0.35124	D	0.767283	B	0.10296	0.003	B	0.15484	0.013	T	0.15292	-1.0442	10	0.07482	T	0.82	.	4.0979	0.10000	0.2507:0.0:0.5857:0.1635	.	366	P16499	PDE6A_HUMAN	E	366	ENSP00000255266:D366E	ENSP00000255266:D366E	D	-	3	2	PDE6A	149263419	0.006000	0.16342	1.000000	0.80357	0.985000	0.73830	0.007000	0.13174	0.814000	0.34374	0.561000	0.74099	GAC		0.418	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2			Missense_Mutation
RBM22	55696	broad.mit.edu	37	5	150080511	150080511	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr5:150080511G>A	ENST00000199814.4	-	1	158	c.37C>T	c.(37-39)Cag>Tag	p.Q13*	RBM22_ENST00000447771.2_Nonsense_Mutation_p.Q13*|RBM22_ENST00000540000.1_Nonsense_Mutation_p.Q13*	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	13					cellular response to drug (GO:0035690)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of RNA splicing (GO:0033120)|protein import into nucleus, translocation (GO:0000060)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|snRNA binding (GO:0017069)	p.Q13*(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCCAGTTCTGCCTGTTGTAG	0.632											OREG0016939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	5											69.0	65.0	66.0					5																	150080511		2203	4300	6503	150060704	SO:0001587	stop_gained	55696			AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430				20013661, 19133299	Standard	NM_018047		Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.37C>T	5.37:g.150080511G>A	ENSP00000199814:p.Gln13*	Unknown	1730	x	x	x	150060704	A6NDM5|B4DLI9|O95607	Nonsense_Mutation	SNP	ENST00000199814.4	37	CCDS34278.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	38	7.147393	0.98096	.	.	ENSG00000086589	ENST00000199814;ENST00000540000;ENST00000447771;ENST00000518917	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-1.1791	19.0956	0.93249	0.0:0.0:1.0:0.0	.	.	.	.	X	13	.	ENSP00000199814:Q13X	Q	-	1	0	RBM22	150060704	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.023000	0.93683	2.494000	0.84150	0.655000	0.94253	CAG		0.632	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374431.2	NM_018047		Nonsense_Mutation
TMEM63B	55362	broad.mit.edu	37	6	44121531	44121531	+	Silent	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr6:44121531G>A	ENST00000259746.9	+	21	2244	c.2061G>A	c.(2059-2061)gcG>gcA	p.A687A	TMEM63B_ENST00000323267.6_Silent_p.A687A			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	687					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.A687A(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			TGGTGGCCGCGCCCATCCTCT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	6											71.0	64.0	66.0					6																	44121531		2203	4300	6503	44229509	SO:0001819	synonymous_variant	55362			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.2061G>A	6.37:g.44121531G>A		Unknown		x	x	x	44229509	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Silent	SNP	ENST00000259746.9	37	CCDS34461.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	8.334	0.827216	0.16749	.	.	ENSG00000137216	ENST00000371893	.	.	.	4.62	-8.27	0.01017	.	.	.	.	.	T	0.37348	0.1000	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58188	-0.7680	4	.	.	.	.	12.3557	0.55174	0.1387:0.2333:0.628:0.0	.	.	.	.	H	616	.	.	R	+	2	0	TMEM63B	44229509	0.001000	0.12720	0.698000	0.30274	0.846000	0.48090	-1.611000	0.02062	-1.837000	0.01189	-0.768000	0.03414	CGC		0.607	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410		Silent
GPR116	221395	broad.mit.edu	37	6	46828475	46828475	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr6:46828475G>A	ENST00000283296.7	-	16	2644	c.2356C>T	c.(2356-2358)Caa>Taa	p.Q786*	GPR116_ENST00000265417.7_Nonsense_Mutation_p.Q786*|GPR116_ENST00000456426.2_Nonsense_Mutation_p.Q644*|GPR116_ENST00000545669.1_Nonsense_Mutation_p.Q215*|GPR116_ENST00000362015.4_Nonsense_Mutation_p.Q786*	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	786					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Q786*(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GAATTTACTTGGGTTGGAACT	0.408																																					NSCLC(59;410 1274 8751 36715 50546)											1	Substitution - Nonsense(1)	ovary(1)	6											138.0	135.0	136.0					6																	46828475		2203	4300	6503	46936434	SO:0001587	stop_gained	221395			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2356C>T	6.37:g.46828475G>A	ENSP00000283296:p.Gln786*	Unknown		x	x	x	46936434	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Nonsense_Mutation	SNP	ENST00000283296.7	37	CCDS4919.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768887	0.90020	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	.	.	.	5.68	2.84	0.33178	.	0.468291	0.20021	N	0.100915	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-0.6835	15.7507	0.77983	0.0:0.3824:0.6176:0.0	.	.	.	.	X	786;786;786;644;157;786;215	.	ENSP00000265417:Q786X	Q	-	1	0	GPR116	46936434	0.364000	0.24997	0.479000	0.27329	0.206000	0.24218	0.231000	0.17872	0.041000	0.15688	-0.795000	0.03280	CAA		0.408	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234		Nonsense_Mutation
COL9A1	1297	broad.mit.edu	37	6	70970367	70970367	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr6:70970367C>A	ENST00000357250.6	-	20	1600	c.1442G>T	c.(1441-1443)gGg>gTg	p.G481V	COL9A1_ENST00000370499.4_Missense_Mutation_p.G238V|COL9A1_ENST00000320755.7_Missense_Mutation_p.G238V|COL9A1_ENST00000489611.1_5'UTR	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	481	Collagen-like 5.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.G481V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TACTTTTTCCCCTTTGTCCCC	0.333																																																1	Substitution - Missense(1)	ovary(1)	6											62.0	62.0	62.0					6																	70970367		2203	4300	6503	71027088	SO:0001583	missense	1297				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1442G>T	6.37:g.70970367C>A	ENSP00000349790:p.Gly481Val	Unknown		x	x	x	71027088	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908262	0.52333	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99488	-6.0;-6.0;-5.77	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.99864	0.9936	H	0.99890	4.9	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.974;1.0;1.0	D	0.96438	0.9324	10	0.87932	D	0	.	17.1033	0.86655	0.0:1.0:0.0:0.0	.	481;238;54	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	V	481;238;238	ENSP00000349790:G481V;ENSP00000315252:G238V;ENSP00000359530:G238V	ENSP00000315252:G238V	G	-	2	0	COL9A1	71027088	0.998000	0.40836	0.967000	0.41034	0.935000	0.57460	5.054000	0.64275	2.775000	0.95449	0.655000	0.94253	GGG		0.333	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			Missense_Mutation
DNAH11	8701	broad.mit.edu	37	7	21747382	21747382	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr7:21747382C>A	ENST00000409508.3	+	40	6643	c.6612C>A	c.(6610-6612)aaC>aaA	p.N2204K	DNAH11_ENST00000328843.6_Missense_Mutation_p.N2211K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2211	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N2211K(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATGACTTAAACCCTAAAGCTG	0.393									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	7											82.0	78.0	79.0					7																	21747382		1856	4095	5951	21713907	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6612C>A	7.37:g.21747382C>A	ENSP00000475939:p.Asn2204Lys	Unknown		x	x	x	21713907	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783256	0.70222	.	.	ENSG00000105877	ENST00000328843	D	0.92647	-3.08	5.87	4.05	0.47172	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.95519	0.8544	.	.	.	0.52501	D	0.999954	D	0.89917	1.0	D	0.91635	0.999	D	0.95744	0.8786	9	0.87932	D	0	.	11.8784	0.52560	0.0:0.8013:0.0:0.1987	.	2211	Q96DT5	DYH11_HUMAN	K	2211	ENSP00000330671:N2211K	ENSP00000330671:N2211K	N	+	3	2	DNAH11	21713907	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.704000	0.25661	1.627000	0.50400	0.655000	0.94253	AAC		0.393	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		Missense_Mutation
EGFR	1956	broad.mit.edu	37	7	55241699	55241699	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr7:55241699A>G	ENST00000275493.2	+	18	2324	c.2147A>G	c.(2146-2148)aAa>aGa	p.K716R	EGFR_ENST00000454757.2_Missense_Mutation_p.K663R|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.K671R	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	716	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.K716R(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AAAAAGATCAAAGTGCTGGGC	0.577		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	1	Substitution - Missense(1)	ovary(1)	7											75.0	78.0	77.0					7																	55241699		2203	4300	6503	55209193	SO:0001583	missense	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2147A>G	7.37:g.55241699A>G	ENSP00000275493:p.Lys716Arg	Unknown		x	x	x	55209193	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	13.92	2.382173	0.42207	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.62364	0.03;0.03;0.03	5.83	5.83	0.93111	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49218	0.1544	N	0.16016	0.355	0.58432	D	0.999998	B;B	0.32040	0.048;0.353	B;B	0.35312	0.073;0.2	T	0.52909	-0.8512	10	0.49607	T	0.09	.	15.0123	0.71557	1.0:0.0:0.0:0.0	.	671;716	Q504U8;P00533	.;EGFR_HUMAN	R	671;586;716;663	ENSP00000415559:K671R;ENSP00000275493:K716R;ENSP00000395243:K663R	ENSP00000275493:K716R	K	+	2	0	EGFR	55209193	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	7.431000	0.80335	2.215000	0.71742	0.460000	0.39030	AAA		0.577	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		Missense_Mutation
TMEM248	55069	broad.mit.edu	37	7	66410044	66410044	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr7:66410044G>C	ENST00000341567.4	+	3	496	c.241G>C	c.(241-243)Gac>Cac	p.D81H		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	81						integral component of membrane (GO:0016021)		p.D81H(1)									TCTCACAAACGACACCACAAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	71.0	72.0					7																	66410044		2203	4300	6503	66047479	SO:0001583	missense	55069				CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.241G>C	7.37:g.66410044G>C	ENSP00000340668:p.Asp81His	Unknown		x	x	x	66047479	Q53H07|Q96FR2	Missense_Mutation	SNP	ENST00000341567.4	37	CCDS5536.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982146	0.74474	.	.	ENSG00000106609	ENST00000341567;ENST00000424964;ENST00000418375	.	.	.	5.84	5.84	0.93424	.	0.043919	0.85682	D	0.000000	T	0.58779	0.2146	N	0.24115	0.695	0.80722	D	1	P	0.46142	0.873	P	0.52109	0.69	T	0.57894	-0.7732	9	0.45353	T	0.12	-3.4421	19.116	0.93340	0.0:0.0:1.0:0.0	.	81	Q9NWD8	CG042_HUMAN	H	81	.	ENSP00000340668:D81H	D	+	1	0	C7orf42	66047479	1.000000	0.71417	0.989000	0.46669	0.251000	0.25915	9.362000	0.97126	2.768000	0.95171	0.561000	0.74099	GAC		0.512	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251745.2	NM_017994		Missense_Mutation
IMMP2L	83943	broad.mit.edu	37	7	110303729	110303729	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr7:110303729G>C	ENST00000405709.2	-	6	899	c.457C>G	c.(457-459)Cca>Gca	p.P153A	IMMP2L_ENST00000452895.1_Missense_Mutation_p.P153A|IMMP2L_ENST00000331762.3_Missense_Mutation_p.P153A|IMMP2L_ENST00000489381.1_5'UTR|IMMP2L_ENST00000415362.1_Missense_Mutation_p.P153A|IMMP2L_ENST00000450877.1_Missense_Mutation_p.P135A	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	153					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		CAGCGCTCTGGGGGCCACAGG	0.448																																																0			7											72.0	73.0	73.0					7																	110303729		2203	4300	6503	110090965	SO:0001583	missense	83943			AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.457C>G	7.37:g.110303729G>C	ENSP00000384966:p.Pro153Ala	Unknown		x	x	x	110090965	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Missense_Mutation	SNP	ENST00000405709.2	37	CCDS5753.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706193	0.89018	.	.	ENSG00000184903	ENST00000405709;ENST00000331762;ENST00000452895;ENST00000450877;ENST00000415362	.	.	.	5.5	5.5	0.81552	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);	0.000000	0.85682	D	0.000000	T	0.77935	0.4205	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.72174	-0.4370	9	0.17369	T	0.5	-25.9393	18.5467	0.91048	0.0:0.0:1.0:0.0	.	153	Q96T52	IMP2L_HUMAN	A	153;153;153;135;153	.	ENSP00000329553:P153A	P	-	1	0	IMMP2L	110090965	1.000000	0.71417	0.975000	0.42487	0.951000	0.60555	6.003000	0.70701	2.756000	0.94617	0.563000	0.77884	CCA		0.448	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549		Missense_Mutation
PLXNA4	91584	broad.mit.edu	37	7	131825497	131825497	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr7:131825497T>C	ENST00000359827.3	-	30	6261	c.5299A>G	c.(5299-5301)Aca>Gca	p.T1767A	PLXNA4_ENST00000321063.4_Missense_Mutation_p.T1767A			Q9HCM2	PLXA4_HUMAN	plexin A4	1767					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.T1767A(1)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CAGGCGTCTGTGATGCTGTTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											111.0	121.0	118.0					7																	131825497		2203	4300	6503	131476037	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5299A>G	7.37:g.131825497T>C	ENSP00000352882:p.Thr1767Ala	Unknown		x	x	x	131476037	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	26.4	4.732713	0.89482	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.11277	2.79;2.79	5.22	5.22	0.72569	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.33760	0.0874	M	0.81802	2.56	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.08186	-1.0734	10	0.40728	T	0.16	.	15.111	0.72355	0.0:0.0:0.0:1.0	.	1767	Q9HCM2	PLXA4_HUMAN	A	1767	ENSP00000323194:T1767A;ENSP00000352882:T1767A	ENSP00000323194:T1767A	T	-	1	0	PLXNA4	131476037	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.948000	0.87774	1.975000	0.57531	0.482000	0.46254	ACA		0.557	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		Missense_Mutation
ARHGEF10	9639	broad.mit.edu	37	8	1808212	1808212	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:1808212G>A	ENST00000398564.1	+	4	415	c.415G>A	c.(415-417)Gag>Aag	p.E139K	ARHGEF10_ENST00000262112.6_Missense_Mutation_p.E139K|ARHGEF10_ENST00000398560.1_Missense_Mutation_p.E139K|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.E139K|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.E115K|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.E115K			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	139					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E139K(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CGCTGAGGAGGAGAATGTGGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	8											143.0	122.0	129.0					8																	1808212		2203	4300	6503	1795619	SO:0001583	missense	9639			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.415G>A	8.37:g.1808212G>A	ENSP00000381571:p.Glu139Lys	Unknown		x	x	x	1795619	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248199	0.59103	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398560;ENST00000398564;ENST00000262112	T;T;T;T;T;T	0.71222	0.16;-0.2;0.14;-0.55;0.14;0.11	5.35	5.35	0.76521	.	0.403414	0.26891	N	0.021968	T	0.70272	0.3205	L	0.59436	1.845	0.41759	D	0.9897	P;P;P;P;P	0.39480	0.493;0.493;0.651;0.675;0.493	B;B;B;B;B	0.38428	0.23;0.085;0.054;0.273;0.085	T	0.75105	-0.3435	10	0.66056	D	0.02	-11.748	18.6289	0.91352	0.0:0.0:1.0:0.0	.	139;139;139;115;115	O15013-4;O15013-6;E9PB39;O15013-7;O15013-5	.;.;.;.;.	K	115;115;139;139;139;139	ENSP00000340297:E115K;ENSP00000427909:E115K;ENSP00000431012:E139K;ENSP00000381568:E139K;ENSP00000381571:E139K;ENSP00000262112:E139K	ENSP00000262112:E139K	E	+	1	0	ARHGEF10	1795619	1.000000	0.71417	0.053000	0.19242	0.029000	0.11900	6.604000	0.74150	2.501000	0.84356	0.557000	0.71058	GAG		0.627	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
TNFRSF10A	8797	broad.mit.edu	37	8	23069637	23069637	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:23069637C>A	ENST00000221132.3	-	2	459	c.395G>T	c.(394-396)tGt>tTt	p.C132F		NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	132					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)	p.C132F(1)		NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		ACCTGGTGGACACAACTCTCC	0.403																																																1	Substitution - Missense(1)	ovary(1)	8											226.0	187.0	201.0					8																	23069637		2203	4300	6503	23125582	SO:0001583	missense	8797			U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.395G>T	8.37:g.23069637C>A	ENSP00000221132:p.Cys132Phe	Unknown		x	x	x	23125582	A8K5I4|Q53Y72|Q96E62	Missense_Mutation	SNP	ENST00000221132.3	37	CCDS6039.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631939	0.29068	.	.	ENSG00000104689	ENST00000221132	T	0.78816	-1.21	2.46	1.54	0.23209	.	0.062604	0.64402	U	0.000004	T	0.81612	0.4859	L	0.55213	1.73	0.23589	N	0.997348	D	0.89917	1.0	D	0.91635	0.999	T	0.69540	-0.5118	10	0.87932	D	0	.	6.3512	0.21377	0.2941:0.7059:0.0:0.0	.	132	O00220	TR10A_HUMAN	F	132	ENSP00000221132:C132F	ENSP00000221132:C132F	C	-	2	0	TNFRSF10A	23125582	0.180000	0.23148	0.009000	0.14445	0.126000	0.20510	0.706000	0.25690	0.563000	0.29222	0.563000	0.77884	TGT		0.403	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215133.2	NM_003844		Missense_Mutation
NEFL	4747	broad.mit.edu	37	8	24813902	24813902	+	RNA	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:24813902T>C	ENST00000221169.5	-	0	722				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)	p.Y43C(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		CGGCGCCGAGTAGCTGGAGTA	0.642																																																1	Substitution - Missense(1)	ovary(1)	8											18.0	21.0	20.0					8																	24813902		2043	4168	6211	24869819			4747				CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24813902T>C		Unknown		x	x	x	24869819	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	37		SNP	57	Broad																																																																																				0.642	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158		Missense_Mutation
ADAM2	2515	broad.mit.edu	37	8	39694697	39694697	+	Silent	SNP	C	C	T	rs369551334		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:39694697C>T	ENST00000265708.4	-	2	193	c.90G>A	c.(88-90)ccG>ccA	p.P30P	ADAM2_ENST00000521880.1_Silent_p.P30P|ADAM2_ENST00000379853.2_Silent_p.P30P|ADAM2_ENST00000347580.4_Silent_p.P30P|ADAM2_ENST00000523181.1_5'UTR	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	30					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P30P(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GTATTTTCTCCGGAACTGTAA	0.303																																																1	Substitution - coding silent(1)	ovary(1)	8						C		1,4405	2.1+/-5.4	0,1,2202	71.0	72.0	72.0		90	-7.7	0.0	8		72	0,8594		0,0,4297	no	coding-synonymous	ADAM2	NM_001464.3		0,1,6499	TT,TC,CC		0.0,0.0227,0.0077		30/736	39694697	1,12999	2203	4297	6500	39813854	SO:0001819	synonymous_variant	2515			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.90G>A	8.37:g.39694697C>T		Unknown		x	x	x	39813854	P78326|Q9UQQ8	Silent	SNP	ENST00000265708.4	37	CCDS34884.1	SNP	23	Broad																																																																																				0.303	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		Silent
RP1	6101	broad.mit.edu	37	8	55542673	55542673	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:55542673G>T	ENST00000220676.1	+	4	6379	c.6231G>T	c.(6229-6231)caG>caT	p.Q2077H		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	2077					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.Q2077Q(1)|p.Q2077H(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ACAGATTCCAGGGCTCAAGAA	0.363																																					Colon(91;1014 1389 7634 14542 40420)											2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|prostate(1)	8											43.0	45.0	44.0					8																	55542673		2203	4297	6500	55705226	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.6231G>T	8.37:g.55542673G>T	ENSP00000220676:p.Gln2077His	Unknown		x	x	x	55705226		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892825	0.33442	.	.	ENSG00000104237	ENST00000220676	T	0.29397	1.57	5.76	4.78	0.61160	.	0.129757	0.35096	N	0.003443	T	0.44953	0.1318	M	0.64997	1.995	0.25369	N	0.988714	D	0.89917	1.0	D	0.69307	0.963	T	0.45338	-0.9268	10	0.87932	D	0	.	4.4642	0.11680	0.2325:0.0:0.7675:0.0	.	2077	P56715	RP1_HUMAN	H	2077	ENSP00000220676:Q2077H	ENSP00000220676:Q2077H	Q	+	3	2	RP1	55705226	0.993000	0.37304	0.567000	0.28434	0.170000	0.22686	2.483000	0.45233	2.726000	0.93360	0.655000	0.94253	CAG		0.363	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		Missense_Mutation
RAD21	5885	broad.mit.edu	37	8	117869611	117869611	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:117869611A>G	ENST00000297338.2	-	6	870	c.583T>C	c.(583-585)Tct>Cct	p.S195P	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	195					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S195P(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					CTCTGTTCAGACTCTAATAGG	0.363																																																1	Substitution - Missense(1)	ovary(1)	8											132.0	127.0	129.0					8																	117869611		2203	4300	6503	117938792	SO:0001583	missense	5885			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.583T>C	8.37:g.117869611A>G	ENSP00000297338:p.Ser195Pro	Unknown		x	x	x	117938792	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	CCDS6321.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	3.935	-0.015416	0.07681	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485	T;T;T	0.53423	0.62;1.5;1.49	5.33	4.45	0.53987	.	0.204155	0.53938	N	0.000056	T	0.32704	0.0838	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07065	-1.0792	10	0.27785	T	0.31	-30.1005	13.5393	0.61664	0.0771:0.0:0.9229:0.0	.	195	O60216	RAD21_HUMAN	P	195	ENSP00000297338:S195P;ENSP00000429342:S195P;ENSP00000427923:S195P	ENSP00000297338:S195P	S	-	1	0	RAD21	117938792	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	3.458000	0.53014	1.363000	0.46019	-0.468000	0.05107	TCT		0.363	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265		Missense_Mutation
DEPTOR	64798	broad.mit.edu	37	8	120977615	120977615	+	Missense_Mutation	SNP	G	G	A	rs375478838		TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:120977615G>A	ENST00000286234.5	+	4	699	c.569G>A	c.(568-570)tGc>tAc	p.C190Y	DEPTOR_ENST00000523492.1_Missense_Mutation_p.C89Y	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	190	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)		p.C190Y(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						GAGCAGCTTTGCCACCGGCTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	8											111.0	89.0	97.0					8																	120977615		2203	4300	6503	121046796	SO:0001583	missense	64798				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.569G>A	8.37:g.120977615G>A	ENSP00000286234:p.Cys190Tyr	Unknown		x	x	x	121046796	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	ENST00000286234.5	37	CCDS6331.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820922	0.71028	.	.	ENSG00000155792	ENST00000523492;ENST00000286234	T;T	0.22743	1.94;1.94	5.31	5.31	0.75309	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.105347	0.64402	D	0.000002	T	0.48714	0.1515	M	0.75615	2.305	0.58432	D	0.99999	D;D	0.89917	1.0;0.999	D;D	0.71870	0.975;0.975	T	0.49881	-0.8892	10	0.62326	D	0.03	-26.8741	18.9927	0.92800	0.0:0.0:1.0:0.0	.	89;190	E7EV87;Q8TB45	.;DPTOR_HUMAN	Y	89;190	ENSP00000430457:C89Y;ENSP00000286234:C190Y	ENSP00000286234:C190Y	C	+	2	0	DEPTOR	121046796	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	7.109000	0.77062	2.487000	0.83934	0.655000	0.94253	TGC		0.537	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783		Missense_Mutation
PARP10	84875	broad.mit.edu	37	8	145058517	145058517	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr8:145058517C>G	ENST00000313028.7	-	6	1635	c.1541G>C	c.(1540-1542)tGc>tCc	p.C514S	PARP10_ENST00000524918.1_Missense_Mutation_p.C514S|PARP10_ENST00000533665.1_5'Flank|PARP10_ENST00000525773.1_Missense_Mutation_p.C526S	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	514					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.C514S(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGCTCCAGGCACAACACATG	0.637																																																1	Substitution - Missense(1)	ovary(1)	8											32.0	35.0	34.0					8																	145058517		2203	4300	6503	145130505	SO:0001583	missense	84875			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1541G>C	8.37:g.145058517C>G	ENSP00000325618:p.Cys514Ser	Unknown		x	x	x	145130505	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.229469	0.00280	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.08458	3.1;3.09;3.09	4.21	1.15	0.20763	.	1.107710	0.07038	N	0.829681	T	0.01976	0.0062	N	0.00538	-1.39	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44375	-0.9332	10	0.06891	T	0.86	.	4.6262	0.12479	0.0:0.3842:0.351:0.2649	.	526;514	E9PNI7;Q53GL7	.;PAR10_HUMAN	S	514;220;514;526	ENSP00000431620:C514S;ENSP00000325618:C514S;ENSP00000434776:C526S	ENSP00000325618:C514S	C	-	2	0	PARP10	145130505	0.000000	0.05858	0.044000	0.18714	0.050000	0.14768	0.150000	0.16263	0.238000	0.21222	-0.270000	0.10280	TGC		0.637	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789		Missense_Mutation
TTC39B	158219	broad.mit.edu	37	9	15225947	15225947	+	Silent	SNP	C	C	G	rs75681700	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr9:15225947C>G	ENST00000512701.2	-	3	375	c.339G>C	c.(337-339)gcG>gcC	p.A113A	TTC39B_ENST00000507993.1_Intron|TTC39B_ENST00000297615.5_Intron|TTC39B_ENST00000380850.4_Silent_p.A113A|TTC39B_ENST00000582994.1_5'UTR|TTC39B_ENST00000541445.1_Silent_p.A47A|TTC39B_ENST00000507285.1_5'UTR|TTC39B_ENST00000355694.2_Silent_p.A47A			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	113								p.A47A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						GCTGTCTGGGCGCCTGTTGTG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	9											114.0	103.0	107.0					9																	15225947		2203	4300	6503	15215947	SO:0001819	synonymous_variant	158219			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.339G>C	9.37:g.15225947C>G		Unknown		x	x	x	15215947	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Silent	SNP	ENST00000512701.2	37	CCDS6477.2	SNP	27	Broad																																																																																				0.488	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051758.3	NM_152574		Silent
CCL27	10850	broad.mit.edu	37	9	34662602	34662602	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr9:34662602A>G	ENST00000259631.4	-	1	87	c.29T>C	c.(28-30)cTc>cCc	p.L10P	CCL27_ENST00000557161.1_Intron|RP11-195F19.30_ENST00000564224.1_RNA	NM_006664.2	NP_006655.1	Q9Y4X3	CCL27_HUMAN	chemokine (C-C motif) ligand 27	10					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.L10P(1)		kidney(1)|large_intestine(3)|ovary(1)	5	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CAGCAGCAGGAGGCTGCAGAA	0.542																																																1	Substitution - Missense(1)	ovary(1)	9											53.0	55.0	55.0					9																	34662602		2203	4300	6503	34652602	SO:0001583	missense	10850			AJ243542	CCDS6569.1	9p13	2014-05-16	2002-08-22	2002-08-23	ENSG00000213927	ENSG00000213927		"""Chemokine ligands"", ""Endogenous ligands"""	10626	protein-coding gene	gene with protein product	"""CC chemokine ILC"", ""IL-11 Ralpha-locus chemokine"", ""cutaneous T-cell attracting chemokine"""	604833	"""small inducible cytokine subfamily A (Cys-Cys), member 27"""	SCYA27		10556532, 10588729	Standard	NM_006664		Approved	ALP, ILC, CTACK, skinkine, ESkine, PESKY, CTAK	uc003zvm.1	Q9Y4X3	OTTHUMG00000019834	ENST00000259631.4:c.29T>C	9.37:g.34662602A>G	ENSP00000259631:p.Leu10Pro	Unknown		x	x	x	34652602		Missense_Mutation	SNP	ENST00000259631.4	37	CCDS6569.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	11.64	1.697941	0.30142	.	.	ENSG00000213927	ENST00000259631	T	0.46063	0.88	4.02	4.02	0.46733	.	0.641780	0.13646	N	0.372619	T	0.47783	0.1464	L	0.29908	0.895	0.52099	D	0.999947	D	0.71674	0.998	D	0.62955	0.909	T	0.45991	-0.9223	10	0.87932	D	0	-1.7671	9.6535	0.39912	1.0:0.0:0.0:0.0	.	10	Q9Y4X3	CCL27_HUMAN	P	10	ENSP00000259631:L10P	ENSP00000259631:L10P	L	-	2	0	CCL27	34652602	1.000000	0.71417	0.919000	0.36401	0.003000	0.03518	3.602000	0.54066	2.053000	0.61076	0.460000	0.39030	CTC		0.542	CCL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052228.1	NM_006664		Missense_Mutation
CNTRL	11064	broad.mit.edu	37	9	123922479	123922479	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr9:123922479T>C	ENST00000373855.1	+	32	5248	c.4988T>C	c.(4987-4989)aTt>aCt	p.I1663T	CNTRL_ENST00000373844.1_Missense_Mutation_p.I108T|CNTRL_ENST00000238341.5_Missense_Mutation_p.I1663T|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.I1111T			Q7Z7A1	CNTRL_HUMAN	centriolin	1663					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.I1663T(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AATGTTCAGATTAGTGAAAGA	0.323																																																1	Substitution - Missense(1)	ovary(1)	9											62.0	71.0	68.0					9																	123922479		2203	4296	6499	122962300	SO:0001583	missense	11064			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4988T>C	9.37:g.123922479T>C	ENSP00000362962:p.Ile1663Thr	Unknown		x	x	x	122962300	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	22.1	4.240087	0.79912	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000431571;ENST00000373845;ENST00000373844	T;T;T	0.29397	1.57;1.57;1.57	5.72	5.72	0.89469	.	.	.	.	.	T	0.45736	0.1357	M	0.62723	1.935	0.40461	D	0.980246	D	0.56521	0.976	P	0.54815	0.761	T	0.39440	-0.9614	9	0.38643	T	0.18	.	15.18	0.72947	0.0:0.0:0.0:1.0	.	1663	Q7Z7A1	CNTRL_HUMAN	T	1663;1663;1663;419;1111;332;345;108	ENSP00000362962:I1663T;ENSP00000238341:I1663T;ENSP00000362956:I1111T	ENSP00000238341:I1663T	I	+	2	0	CNTRL	122962300	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.294000	0.65687	2.179000	0.69175	0.482000	0.46254	ATT		0.323	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018		Missense_Mutation
MXRA5	25878	broad.mit.edu	37	X	3261695	3261695	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:3261695G>C	ENST00000217939.6	-	2	334	c.180C>G	c.(178-180)atC>atG	p.I60M		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	60						extracellular vesicular exosome (GO:0070062)		p.I60M(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				ACCCCAAATTGATTCTTTCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	X											77.0	41.0	53.0					X																	3261695		2203	4300	6503	3271695	SO:0001583	missense	25878			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.180C>G	X.37:g.3261695G>C	ENSP00000217939:p.Ile60Met	Unknown		x	x	x	3271695	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	3.134	-0.177690	0.06380	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.02737	4.18	3.17	3.17	0.36434	.	0.000000	0.38959	U	0.001502	T	0.06690	0.0171	L	0.46819	1.47	0.25825	N	0.984237	P	0.52316	0.952	P	0.51516	0.672	T	0.05954	-1.0854	10	0.87932	D	0	.	14.2168	0.65797	0.0:0.0:1.0:0.0	.	60	Q9NR99	MXRA5_HUMAN	M	60	ENSP00000217939:I60M	ENSP00000217939:I60M	I	-	3	3	MXRA5	3271695	1.000000	0.71417	0.953000	0.39169	0.047000	0.14425	1.916000	0.39986	1.199000	0.43173	0.506000	0.49869	ATC		0.532	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		Missense_Mutation
NDUFB11	54539	broad.mit.edu	37	X	47003934	47003934	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:47003934G>T	ENST00000377811.3	-	1	969	c.145C>A	c.(145-147)Cca>Aca	p.P49T	RBM10_ENST00000345781.6_5'Flank|RBM10_ENST00000329236.7_5'Flank|RBM10_ENST00000377604.3_5'Flank|NDUFB11_ENST00000276062.8_Missense_Mutation_p.P49T	NM_001135998.2	NP_001129470.1	Q9NX14	NDUBB_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa	49					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)		p.P49T(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7						GTCGGTTCTGGGGGCCGCTTT	0.701											OREG0019755	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(77;454 1296 7908 21551 37072)											1	Substitution - Missense(1)	ovary(1)	X											14.0	14.0	14.0					X																	47003934		2120	4132	6252	46888878	SO:0001583	missense	54539			AF044213	CCDS14273.1, CCDS48100.1	Xp11.3	2011-07-04			ENSG00000147123	ENSG00000147123		"""Mitochondrial respiratory chain complex / Complex I"""	20372	protein-coding gene	gene with protein product	"""complex I NP17.3 subunit"""	300403				10544803, 12381726	Standard	NM_019056		Approved	ESSS, NP17.3, Np15	uc004dhc.3	Q9NX14	OTTHUMG00000021433	ENST00000377811.3:c.145C>A	X.37:g.47003934G>T	ENSP00000367042:p.Pro49Thr	Unknown	943	x	x	x	46888878	Q5JRR3|Q5JRR4|Q6IAB6|Q8WZ96|Q9BXX9	Missense_Mutation	SNP	ENST00000377811.3	37	CCDS48100.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	g	3.804	-0.041058	0.07452	.	.	ENSG00000147123	ENST00000377811;ENST00000447793;ENST00000276062	.	.	.	4.1	1.29	0.21616	.	1.201910	0.05925	N	0.634141	T	0.36138	0.0956	L	0.57536	1.79	0.09310	N	1	B;B	0.30146	0.27;0.228	B;B	0.31812	0.136;0.083	T	0.26467	-1.0102	9	0.23302	T	0.38	5.0178	2.3072	0.04177	0.1118:0.1868:0.5056:0.1959	.	49;49	Q9NX14;Q9NX14-2	NDUBB_HUMAN;.	T	49;53;49	.	ENSP00000276062:P49T	P	-	1	0	NDUFB11	46888878	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.174000	0.09839	0.137000	0.18759	0.529000	0.55759	CCA		0.701	NDUFB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056382.1	NM_019056		Missense_Mutation
TFE3	7030	broad.mit.edu	37	X	48895773	48895773	+	Silent	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:48895773C>T	ENST00000315869.7	-	4	988	c.729G>A	c.(727-729)gcG>gcA	p.A243A	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	243					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A243A(1)	NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GGCTGTTGGGCGCACTGCCTG	0.662			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	1	Substitution - coding silent(1)	ovary(1)	X											22.0	23.0	23.0					X																	48895773		2203	4299	6502	48782717	SO:0001819	synonymous_variant	7030			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.729G>A	X.37:g.48895773C>T		Unknown		x	x	x	48782717	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Silent	SNP	ENST00000315869.7	37	CCDS14315.3	SNP	27	Broad																																																																																				0.662	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	NM_006521		Silent
CACNA1F	778	broad.mit.edu	37	X	49067058	49067058	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:49067058C>A	ENST00000376265.2	-	38	4571	c.4510G>T	c.(4510-4512)Gcc>Tcc	p.A1504S	CACNA1F_ENST00000376251.1_Missense_Mutation_p.A1439S|CACNA1F_ENST00000323022.5_Missense_Mutation_p.A1493S	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1504					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A1504S(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCTTGCAGGCCACTCGGTGT	0.612																																																1	Substitution - Missense(1)	ovary(1)	X											33.0	30.0	31.0					X																	49067058		2203	4299	6502	48954002	SO:0001583	missense	778			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4510G>T	X.37:g.49067058C>A	ENSP00000365441:p.Ala1504Ser	Unknown		x	x	x	48954002	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	29.6	5.018070	0.93404	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.90197	-2.63;-2.63;-2.63	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.95424	0.8514	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.95992	0.8986	10	0.87932	D	0	.	16.891	0.86087	0.0:1.0:0.0:0.0	.	1493;1504	F5CIQ9;O60840	.;CAC1F_HUMAN	S	1439;1493;1504	ENSP00000365427:A1439S;ENSP00000321618:A1493S;ENSP00000365441:A1504S	ENSP00000321618:A1493S	A	-	1	0	CACNA1F	48954002	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.746000	0.85057	2.250000	0.74265	0.529000	0.55759	GCC		0.612	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		Missense_Mutation
HUWE1	10075	broad.mit.edu	37	X	53591535	53591535	+	Splice_Site	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:53591535C>A	ENST00000342160.3	-	50	7486	c.7029G>T	c.(7027-7029)caG>caT	p.Q2343H	HUWE1_ENST00000262854.6_Splice_Site_p.Q2343H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2343	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.Q2206H(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GCCTCCCTACCTGCATCTCTT	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											115.0	71.0	86.0					X																	53591535		2203	4300	6503	53608260	SO:0001630	splice_region_variant	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7029+1G>T	X.37:g.53591535C>A		Unknown		x	x	x	53608260	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	24	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.91|17.91	3.504010|3.504010	0.64410|0.64410	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.41065	.|1.01;1.01	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.50103|0.50103	0.1596|0.1596	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;D	.|0.64830	.|0.98;0.994	.|D;D	.|0.78314	.|0.965;0.991	T|T	0.46148|0.46148	-0.9212|-0.9212	5|9	.|.	.|.	.|.	.|.	17.4613|17.4613	0.87620|0.87620	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2343;2343	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	C|H	1377|2343	.|ENSP00000340648:Q2343H;ENSP00000262854:Q2343H	.|.	G|Q	-|-	1|3	0|2	HUWE1|HUWE1	53608260|53608260	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.953000|6.953000	0.75995|0.75995	2.392000|2.392000	0.81423|0.81423	0.513000|0.513000	0.50165|0.50165	GGT|CAG		0.557	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	Missense_Mutation	Missense_Mutation
PHF8	23133	broad.mit.edu	37	X	54014376	54014376	+	Splice_Site	SNP	T	T	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:54014376T>C	ENST00000357988.5	-	15	2198	c.1840A>G	c.(1840-1842)Acg>Gcg	p.T614A	PHF8_ENST00000338154.6_Splice_Site_p.T578A|PHF8_ENST00000322659.8_Splice_Site_p.T578A|PHF8_ENST00000338946.6_Splice_Site_p.T477A	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	614					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.T578A(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						ACCCTTTTCGTACTGAAGGGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											138.0	100.0	113.0					X																	54014376		2203	4300	6503	54031101	SO:0001630	splice_region_variant	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1839-1A>G	X.37:g.54014376T>C		Unknown		x	x	x	54031101	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	SNP	57	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.034|1.034	-0.680999|-0.680999	0.03353|0.03353	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000375189;ENST00000322659|ENST00000443302	T;T;T;T|.	0.39997|.	2.57;2.31;1.05;1.98|.	5.47|5.47	1.3|1.3	0.21679|0.21679	.|.	0.955174|.	0.08812|.	N|.	0.890079|.	T|T	0.17109|0.17109	0.0411|0.0411	N|N	0.08118|0.08118	0|0	0.21802|0.21802	N|N	0.99954|0.99954	B;B;B;B;B|.	0.28291|.	0.206;0.0;0.0;0.0;0.0|.	B;B;B;B;B|.	0.28011|.	0.085;0.0;0.0;0.0;0.0|.	T|T	0.28776|0.28776	-1.0033|-1.0033	10|5	0.07813|.	T|.	0.8|.	-2.6731|-2.6731	7.261|7.261	0.26203|0.26203	0.0:0.4043:0.0:0.5957|0.0:0.4043:0.0:0.5957	.|.	100;578;477;513;614|.	B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;.;.;PHF8_HUMAN|.	A|C	614;578;477;507;54;578|341	ENSP00000350676:T614A;ENSP00000338868:T578A;ENSP00000340051:T477A;ENSP00000319473:T578A|.	ENSP00000319473:T578A|.	T|Y	-|-	1|2	0|0	PHF8|PHF8	54031101|54031101	0.999000|0.999000	0.42202|0.42202	0.754000|0.754000	0.31244|0.31244	0.010000|0.010000	0.07245|0.07245	0.854000|0.854000	0.27791|0.27791	0.223000|0.223000	0.20920|0.20920	-0.368000|-0.368000	0.07277|0.07277	ACG|TAC		0.418	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	Missense_Mutation	Missense_Mutation
ZXDA	7789	broad.mit.edu	37	X	57935681	57935681	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:57935681C>T	ENST00000358697.4	-	1	1386	c.1174G>A	c.(1174-1176)Gcg>Acg	p.A392T		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	392	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A392T(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						CCAGAAAACGCGCACTGGTAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											126.0	112.0	117.0					X																	57935681		2203	4300	6503	57952406	SO:0001583	missense	7789			L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.1174G>A	X.37:g.57935681C>T	ENSP00000351530:p.Ala392Thr	Unknown		x	x	x	57952406	Q9UJP7	Missense_Mutation	SNP	ENST00000358697.4	37	CCDS14376.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	.	14.69	2.610062	0.46527	.	.	ENSG00000198205	ENST00000358697	T	0.36157	1.27	3.45	3.45	0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.167445	0.50627	D	0.000102	T	0.20292	0.0488	N	0.04387	-0.21	0.39998	D	0.975133	P	0.52170	0.951	P	0.46320	0.512	T	0.04825	-1.0924	9	.	.	.	.	11.9651	0.53029	0.0:1.0:0.0:0.0	.	392	P98168	ZXDA_HUMAN	T	392	ENSP00000351530:A392T	.	A	-	1	0	ZXDA	57952406	1.000000	0.71417	0.529000	0.27951	0.970000	0.65996	3.030000	0.49720	1.967000	0.57214	0.415000	0.27848	GCG		0.557	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156		Missense_Mutation
HEPH	9843	broad.mit.edu	37	X	65423371	65423371	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:65423371C>A	ENST00000343002.2	+	12	2907	c.2243C>A	c.(2242-2244)cCt>cAt	p.P748H	HEPH_ENST00000441993.2_Missense_Mutation_p.P751H|HEPH_ENST00000419594.1_Missense_Mutation_p.P559H|HEPH_ENST00000336279.5_Missense_Mutation_p.P481H|HEPH_ENST00000519389.1_Missense_Mutation_p.P802H|HEPH_ENST00000374727.3_Missense_Mutation_p.P751H			Q9BQS7	HEPH_HUMAN	hephaestin	748	Plastocyanin-like 5.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.P748H(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GACTATTGCCCTGACCGGAGC	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											89.0	72.0	78.0					X																	65423371		2203	4300	6503	65340096	SO:0001583	missense	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2243C>A	X.37:g.65423371C>A	ENSP00000343939:p.Pro748His	Unknown		x	x	x	65340096	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576488	0.65878	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99136	-5.47;-5.47;-5.47;-5.47;-5.47;-5.47;-5.47	4.91	4.91	0.64330	Cupredoxin (2);	0.058006	0.64402	D	0.000001	D	0.99284	0.9750	M	0.85777	2.775	0.36448	D	0.865925	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.995;0.988;0.996	D	0.99947	1.1484	10	0.87932	D	0	.	15.6737	0.77297	0.0:1.0:0.0:0.0	.	802;148;559;748	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	H	802;751;481;751;559;748;705	ENSP00000430620:P802H;ENSP00000363859:P751H;ENSP00000337418:P481H;ENSP00000411687:P751H;ENSP00000413211:P559H;ENSP00000343939:P748H;ENSP00000398078:P705H	ENSP00000337418:P481H	P	+	2	0	HEPH	65340096	0.999000	0.42202	1.000000	0.80357	0.838000	0.47535	5.286000	0.65639	2.265000	0.75225	0.600000	0.82982	CCT		0.488	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		Missense_Mutation
OPHN1	4983	broad.mit.edu	37	X	67502950	67502950	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:67502950A>G	ENST00000355520.5	-	4	901	c.260T>C	c.(259-261)tTc>tCc	p.F87S	OPHN1_ENST00000540071.1_Missense_Mutation_p.F87S	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	87					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.F87S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						AAATTCCTTGAAGGATTCAGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											144.0	107.0	119.0					X																	67502950		2203	4300	6503	67419675	SO:0001583	missense	4983			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.260T>C	X.37:g.67502950A>G	ENSP00000347710:p.Phe87Ser	Unknown		x	x	x	67419675	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	CCDS14388.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	18.99	3.740518	0.69304	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.04603	3.59;3.59	4.73	4.73	0.59995	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.16385	0.0394	M	0.61703	1.905	0.48975	D	0.999738	P;D;D	0.76494	0.945;0.98;0.999	D;P;D	0.75484	0.959;0.898;0.986	T	0.00238	-1.1889	10	0.87932	D	0	.	9.6832	0.40082	1.0:0.0:0.0:0.0	.	87;87;87	F5H2E3;Q6PCC1;O60890	.;.;OPHN1_HUMAN	S	87	ENSP00000347710:F87S;ENSP00000438617:F87S	ENSP00000347710:F87S	F	-	2	0	OPHN1	67419675	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.872000	0.69636	1.546000	0.49388	0.425000	0.28330	TTC		0.418	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547		Missense_Mutation
POF1B	79983	broad.mit.edu	37	X	84570724	84570724	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:84570724A>C	ENST00000262753.4	-	8	1016	c.871T>G	c.(871-873)Tct>Gct	p.S291A	POF1B_ENST00000373145.3_Missense_Mutation_p.S291A	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	291						tight junction (GO:0005923)		p.S291A(1)		central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						TCATCTGTAGACTCAAAGTCC	0.269																																																1	Substitution - Missense(1)	ovary(1)	X											64.0	60.0	61.0					X																	84570724		2201	4278	6479	84457380	SO:0001583	missense	79983			BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.871T>G	X.37:g.84570724A>C	ENSP00000262753:p.Ser291Ala	Unknown		x	x	x	84457380	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	ENST00000262753.4	37	CCDS14452.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	a	4.998	0.185249	0.09495	.	.	ENSG00000124429	ENST00000262753;ENST00000373145	T;T	0.21191	2.02;2.02	4.1	2.9	0.33743	.	0.245095	0.34959	N	0.003544	T	0.16300	0.0392	L	0.53249	1.67	0.22888	N	0.998607	B;B	0.19073	0.033;0.013	B;B	0.20955	0.023;0.032	T	0.31943	-0.9925	10	0.12430	T	0.62	.	6.2323	0.20742	0.7754:0.0:0.0:0.2246	.	291;291	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	A	291	ENSP00000262753:S291A;ENSP00000362238:S291A	ENSP00000262753:S291A	S	-	1	0	POF1B	84457380	0.802000	0.28943	0.639000	0.29394	0.107000	0.19398	2.588000	0.46137	0.538000	0.28769	0.438000	0.28831	TCT		0.269	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921		Missense_Mutation
DIAPH2	1730	broad.mit.edu	37	X	96327978	96327978	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:96327978G>T	ENST00000324765.8	+	18	2436	c.2089G>T	c.(2089-2091)Ggg>Tgg	p.G697W	DIAPH2_ENST00000355827.4_Missense_Mutation_p.G697W|DIAPH2_ENST00000373061.3_Missense_Mutation_p.G697W|DIAPH2_ENST00000373054.4_Missense_Mutation_p.G693W|DIAPH2_ENST00000373049.4_Missense_Mutation_p.G697W			O60879	DIAP2_HUMAN	diaphanous-related formin 2	697	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.G697W(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AAAGAAGACTGGGCCTACAAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	X											87.0	78.0	81.0					X																	96327978		2203	4300	6503	96214634	SO:0001583	missense	1730			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2089G>T	X.37:g.96327978G>T	ENSP00000321348:p.Gly697Trp	Unknown		x	x	x	96214634	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	7.897	0.733594	0.15574	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	5.23	-7.36	0.01417	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	3.450430	0.01130	N	0.005976	T	0.14874	0.0359	L	0.39898	1.24	0.09310	N	1	P;P	0.35807	0.522;0.467	B;B	0.39876	0.312;0.208	T	0.23404	-1.0189	10	0.66056	D	0.02	.	4.6931	0.12790	0.5361:0.2202:0.1603:0.0834	.	697;697	O60879;O60879-2	DIAP2_HUMAN;.	W	697;693;697;697;697;704	ENSP00000362152:G697W;ENSP00000362145:G693W;ENSP00000348082:G697W;ENSP00000362140:G697W;ENSP00000321348:G697W	ENSP00000321348:G697W	G	+	1	0	DIAPH2	96214634	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.951000	0.03885	-2.186000	0.00760	-0.268000	0.10319	GGG		0.343	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309		Missense_Mutation
ZMAT1	84460	broad.mit.edu	37	X	101138612	101138612	+	Missense_Mutation	SNP	C	C	T	rs141908807	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:101138612C>T	ENST00000372782.3	-	7	1834	c.1787G>A	c.(1786-1788)cGa>cAa	p.R596Q	ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Missense_Mutation_p.R425Q|ZMAT1_ENST00000540921.1_Missense_Mutation_p.R596Q	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	596						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R425Q(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TTTCTTTTTTCGATGCTTAAG	0.383																																																1	Substitution - Missense(1)	ovary(1)	X						C	GLN/ARG	0,3835		0,0,0,1632,571	184.0	158.0	166.0		1787	1.6	1.0	X	dbSNP_134	166	1,6725		0,0,1,2427,1871	no	missense	ZMAT1	NM_001011657.3	43	0,0,1,4059,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	possibly-damaging	596/639	101138612	1,10560	2203	4299	6502	101025268	SO:0001583	missense	84460			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1787G>A	X.37:g.101138612C>T	ENSP00000361868:p.Arg596Gln	Unknown		x	x	x	101025268	Q8NDS3|Q96JN6	Missense_Mutation	SNP	ENST00000372782.3	37	CCDS35348.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291668	0.40594	0.0	1.49E-4	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	T;T;T	0.27104	2.3;2.3;1.69	4.27	1.56	0.23342	.	0.202088	0.30285	N	0.009977	T	0.21427	0.0516	M	0.72118	2.19	0.30656	N	0.754896	P	0.34662	0.462	B	0.22753	0.041	T	0.13124	-1.0521	10	0.51188	T	0.08	-0.958	7.2569	0.26181	0.0:0.6815:0.0:0.3185	.	596	Q5H9K5	ZMAT1_HUMAN	Q	596;596;425	ENSP00000361868:R596Q;ENSP00000437529:R596Q;ENSP00000413044:R425Q	ENSP00000361868:R596Q	R	-	2	0	ZMAT1	101025268	0.001000	0.12720	0.998000	0.56505	0.993000	0.82548	-0.037000	0.12164	0.190000	0.20209	0.600000	0.82982	CGA		0.383	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1			Missense_Mutation
ZBTB33	10009	broad.mit.edu	37	X	119387890	119387890	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:119387890C>A	ENST00000326624.2	+	2	848	c.620C>A	c.(619-621)aCt>aAt	p.T207N	ZBTB33_ENST00000557385.1_Missense_Mutation_p.T207N	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	207					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)	p.T207N(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						ACAAAGGAGACTTTGCCGAGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											63.0	54.0	57.0					X																	119387890		2202	4300	6502	119271918	SO:0001583	missense	10009			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.620C>A	X.37:g.119387890C>A	ENSP00000314153:p.Thr207Asn	Unknown		x	x	x	119271918	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	ENST00000326624.2	37	CCDS14596.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.715	-0.785575	0.02907	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.09538	2.97;2.97	5.66	2.6	0.31112	.	1.417140	0.03897	N	0.279755	T	0.10208	0.0250	N	0.22421	0.69	0.21064	N	0.999799	B	0.02656	0.0	B	0.01281	0.0	T	0.35549	-0.9784	10	0.54805	T	0.06	-0.5798	9.7819	0.40653	0.3927:0.495:0.1123:0.0	.	207	Q86T24	KAISO_HUMAN	N	207	ENSP00000314153:T207N;ENSP00000450969:T207N	ENSP00000314153:T207N	T	+	2	0	ZBTB33;AC002086.1	119271918	0.989000	0.36119	0.961000	0.40146	0.829000	0.46940	0.675000	0.25232	0.573000	0.29400	0.594000	0.82650	ACT		0.433	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777		Missense_Mutation
SMARCA1	6594	broad.mit.edu	37	X	128614708	128614708	+	Silent	SNP	A	A	G			TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chrX:128614708A>G	ENST00000371122.4	-	19	2541	c.2412T>C	c.(2410-2412)atT>atC	p.I804I	SMARCA1_ENST00000371123.1_Silent_p.I792I|SMARCA1_ENST00000371121.3_Silent_p.I792I	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	804					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.I804I(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						GATAATAAAGAATTTCCTTTT	0.318																																																1	Substitution - coding silent(1)	ovary(1)	X											58.0	57.0	58.0					X																	128614708		2203	4300	6503	128442389	SO:0001819	synonymous_variant	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2412T>C	X.37:g.128614708A>G		Unknown		x	x	x	128442389	Q5JV41|Q5JV42	Silent	SNP	ENST00000371122.4	37	CCDS14612.1	SNP	9	Broad																																																																																				0.318	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		Silent
WARS	7453	broad.mit.edu	37	14	100803369	100803416	+	Splice_Site	DEL	GGCTGTGGGCCCTTGGGGTTCCCTGCTCACCTTCCTGATCTGCTCGAG	GGCTGTGGGCCCTTGGGGTTCCCTGCTCACCTTCCTGATCTGCTCGAG	-	rs367992725|rs576357631|rs370259772|rs535638524	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr14:100803369_100803416delGGCTGTGGGCCCTTGGGGTTCCCTGCTCACCTTCCTGATCTGCTCGAG	ENST00000355338.2	-	10	1855_1873	c.1237_1255delCTCGAGCAGATCAGGAAGGTGAGCAGGGAACCCCAAGGGCCCACAGCC	c.(1237-1257)ctcgagcagatcaggaaggtg>tg	p.LEQIRKV413del	WARS_ENST00000557135.1_Splice_Site_p.LEQIRKV413del|RP11-638I2.9_ENST00000556212.1_RNA|RP11-638I2.8_ENST00000557226.1_RNA|WARS_ENST00000556645.1_Splice_Site_p.LEQIRKV372del|WARS_ENST00000358655.4_Splice_Site_p.LEQIRKV372del|WARS_ENST00000344102.5_Splice_Site_p.LEQIRKV372del|WARS_ENST00000392882.2_Splice_Site_p.LEQIRKV413del	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	413					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)	p.R417M(1)|p.E414K(1)|p.?(1)		breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	GGCAGAAGGCGGCTGTGGGCCCTTGGGGTTCCCTGCTCACCTTCCTGATCTGCTCGAGCTTGTCGTCG	0.585																																																3	Substitution - Missense(2)|Unknown(1)	ovary(1)|lung(1)|endometrium(1)	14																																								99873169	SO:0001630	splice_region_variant	7453			M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.1254+1CTCGAGCAGATCAGGAAGGTGAGCAGGGAACCCCAAGGGCCCACAGCC>-	14.37:g.100803369_100803416delGGCTGTGGGCCCTTGGGGTTCCCTGCTCACCTTCCTGATCTGCTCGAG		Unknown		Capture	Illumina GAIIx	Phase_I	99873122	A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Splice_Site_Del	DEL	ENST00000355338.2	37	CCDS9960.1	DEL	39	Broad																																																																																				0.585	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414236.1	NM_004184	In_Frame_Del	Splice_Site_Del
HERC1	8925	broad.mit.edu	37	15	63950863	63950889	+	In_Frame_Del	DEL	TGCTCTCCTAACGTTATTCTCCCAGAG	TGCTCTCCTAACGTTATTCTCCCAGAG	-	rs369893822|rs2228513	byFrequency	TCGA-24-2289-01	TCGA-24-2289-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2289-01	TCGA-24-2289-10	g.chr15:63950863_63950889delTGCTCTCCTAACGTTATTCTCCCAGAG	ENST00000443617.2	-	48	9540_9566	c.9453_9479delCTCTGGGAGAATAACGTTAGGAGAGCA	c.(9451-9480)tcctctgggagaataacgttaggagagcag>tcg	p.SGRITLGEQ3152del		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3152			S -> F (in dbSNP:rs2228513).		cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S3152_Q3160delSGRITLGEQ(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GGCAGCTGCCTGCTCTCCTAACGTTATTCTCCCAGAGGAGCTCTTTT	0.458																																																1	Deletion - In frame(1)	ovary(1)	15																																								61737942	SO:0001651	inframe_deletion	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.9453_9479delCTCTGGGAGAATAACGTTAGGAGAGCA	15.37:g.63950863_63950889delTGCTCTCCTAACGTTATTCTCCCAGAG	ENSP00000390158:p.Ser3152_Gln3160del	Unknown		Capture	Illumina GAIIx	Phase_I	61737916	Q8IW65	In_Frame_Del	DEL	ENST00000443617.2	37	CCDS45277.1	DEL	55	Broad																																																																																				0.458	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		In_Frame_Del
