#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PLOD1	5351	broad.mit.edu	37	1	12018662	12018662	+	Silent	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:12018662C>T	ENST00000196061.4	+	9	960	c.933C>T	c.(931-933)ctC>ctT	p.L311L	PLOD1_ENST00000485046.1_3'UTR|PLOD1_ENST00000376369.3_Silent_p.L358L	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	311					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)	p.L311L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	TCCTGCGGCTCCACTACCCCC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	1											66.0	58.0	61.0					1																	12018662		2203	4300	6503	11941249	SO:0001819	synonymous_variant	5351			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.933C>T	1.37:g.12018662C>T		Unknown		x	x	x	11941249	B4DR87|Q96AV9|Q9H132	Silent	SNP	ENST00000196061.4	37	CCDS142.1	SNP	30	Broad																																																																																				0.597	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302		Silent
GRIK3	2899	broad.mit.edu	37	1	37346431	37346431	+	Silent	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:37346431G>A	ENST00000373091.3	-	3	370	c.354C>T	c.(352-354)acC>acT	p.T118T	GRIK3_ENST00000373093.4_Silent_p.T118T	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	118					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.T118T(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGACGGCATTGGTGCAGGAGC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											125.0	117.0	120.0					1																	37346431		2203	4300	6503	37119018	SO:0001819	synonymous_variant	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.354C>T	1.37:g.37346431G>A		Unknown		x	x	x	37119018	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	37	CCDS416.1	SNP	47	Broad																																																																																				0.627	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831		Silent
LRRC41	10489	broad.mit.edu	37	1	46744680	46744680	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:46744680G>A	ENST00000343304.6	-	10	2581	c.2296C>T	c.(2296-2298)Cac>Tac	p.H766Y	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	766					protein ubiquitination (GO:0016567)	membrane (GO:0016020)		p.H766Y(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					AGGCGCAGGTGACCAAAGGCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	46.0	44.0					1																	46744680		2203	4300	6503	46517267	SO:0001583	missense	10489			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.2296C>T	1.37:g.46744680G>A	ENSP00000343298:p.His766Tyr	Unknown		x	x	x	46517267	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	CCDS533.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	10.96	1.497679	0.26861	.	.	ENSG00000132128	ENST00000343304	T	0.52295	0.67	5.35	4.43	0.53597	.	0.073131	0.56097	D	0.000027	T	0.26702	0.0653	N	0.14661	0.345	0.42620	D	0.993347	B	0.28713	0.22	B	0.26310	0.068	T	0.09662	-1.0664	10	0.19590	T	0.45	-11.1244	9.2581	0.37595	0.0758:0.0:0.7781:0.1461	.	766	Q15345	LRC41_HUMAN	Y	766	ENSP00000343298:H766Y	ENSP00000343298:H766Y	H	-	1	0	LRRC41	46517267	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.271000	0.58902	2.505000	0.84491	0.484000	0.47621	CAC		0.602	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369		Missense_Mutation
CDKN2C	1031	broad.mit.edu	37	1	51439625	51439625	+	Missense_Mutation	SNP	G	G	A	rs142420524	byFrequency	TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:51439625G>A	ENST00000262662.1	+	4	2224	c.190G>A	c.(190-192)Gat>Aat	p.D64N	CDKN2C_ENST00000396148.1_Missense_Mutation_p.D64N|CDKN2C_ENST00000371761.3_Missense_Mutation_p.D64N			P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	64					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|oligodendrocyte differentiation (GO:0048709)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0?(11)|p.D64N(1)|p.?(1)		central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|thyroid(1)	23				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		TGCTAATCCCGATTTGAAAGA	0.443			D		"""glioma, MM"""								G|||	2	0.000399361	0.0015	0.0	5008	,	,		20290	0.0		0.0	False		,,,				2504	0.0				Melanoma(47;50 1155 4767 22863 47597)		Rec	yes		1	1p32	1031	"""cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)"""		"""O, L"""	13	Whole gene deletion(11)|Substitution - Missense(1)|Unknown(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(5)|thyroid(1)|ovary(1)	1						G	ASN/ASP,ASN/ASP	2,4404	4.2+/-10.8	0,2,2201	99.0	99.0	99.0		190,190	2.0	1.0	1	dbSNP_134	99	0,8600		0,0,4300	yes	missense,missense	CDKN2C	NM_001262.2,NM_078626.2	23,23	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign,benign	64/169,64/169	51439625	2,13004	2203	4300	6503	51212213	SO:0001583	missense	1031			BC000598	CCDS555.1	1p32.3	2013-01-10			ENSG00000123080	ENSG00000123080		"""Ankyrin repeat domain containing"""	1789	protein-coding gene	gene with protein product		603369				8001816, 9636670	Standard	NM_001262		Approved	INK4C, p18	uc001csg.3	P42773	OTTHUMG00000008046	ENST00000262662.1:c.190G>A	1.37:g.51439625G>A	ENSP00000262662:p.Asp64Asn	Unknown		x	x	x	51212213	Q8TB83	Missense_Mutation	SNP	ENST00000262662.1	37	CCDS555.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	4.074	0.011661	0.07912	4.54E-4	0.0	ENSG00000123080	ENST00000262662;ENST00000396148;ENST00000371761	T;T;T	0.58940	0.3;0.3;0.3	5.31	1.98	0.26296	Ankyrin repeat-containing domain (4);	0.266421	0.42420	N	0.000704	T	0.16428	0.0395	N	0.00325	-1.645	0.28590	N	0.909705	B	0.02656	0.0	B	0.01281	0.0	T	0.38178	-0.9673	10	0.02654	T	1	-3.2819	8.4697	0.32977	0.6071:0.0:0.3929:0.0	.	64	P42773	CDN2C_HUMAN	N	64	ENSP00000262662:D64N;ENSP00000379452:D64N;ENSP00000360826:D64N	ENSP00000262662:D64N	D	+	1	0	CDKN2C	51212213	0.447000	0.25673	0.988000	0.46212	0.984000	0.73092	0.796000	0.26986	0.194000	0.20326	0.655000	0.94253	GAT		0.443	CDKN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022058.1	NM_001262		Missense_Mutation
LRRIQ3	127255	broad.mit.edu	37	1	74648285	74648285	+	Silent	SNP	A	A	G			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:74648285A>G	ENST00000395089.1	-	2	509	c.510T>C	c.(508-510)ctT>ctC	p.L170L	LRRIQ3_ENST00000370911.3_Silent_p.L170L|LRRIQ3_ENST00000354431.4_Silent_p.L170L|LRRIQ3_ENST00000370909.2_Intron			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	170	LRRCT.							p.L170L(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						ATCTTTCAGGAAGATGCCAGT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	1											80.0	80.0	80.0					1																	74648285		2203	4299	6502	74420873	SO:0001819	synonymous_variant	127255			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.510T>C	1.37:g.74648285A>G		Unknown		x	x	x	74420873	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Silent	SNP	ENST00000395089.1	37	CCDS41350.1	SNP	9	Broad																																																																																				0.348	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		Silent
KDM5B	10765	broad.mit.edu	37	1	202715088	202715088	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:202715088G>T	ENST00000367265.3	-	16	3385	c.2221C>A	c.(2221-2223)Ctc>Atc	p.L741I	KDM5B_ENST00000367264.2_Missense_Mutation_p.L777I	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	741					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.L878I(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						ATAGGGTAGAGATCATCCAGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											155.0	144.0	148.0					1																	202715088		2203	4300	6503	200981711	SO:0001583	missense	10765			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2221C>A	1.37:g.202715088G>T	ENSP00000356234:p.Leu741Ile	Unknown		x	x	x	200981711	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.154975	0.94686	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790;ENST00000543924	D;D;D	0.95238	-3.65;-3.65;-3.65	5.96	5.96	0.96718	Zinc finger, C5HC2-type (1);	0.000000	0.85682	D	0.000000	D	0.97256	0.9103	M	0.85099	2.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.97377	0.9980	10	0.87932	D	0	-16.2777	13.5822	0.61909	0.0707:0.0:0.9293:0.0	.	777;741	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	I	741;583;777;583;110	ENSP00000356234:L741I;ENSP00000356233:L777I;ENSP00000235790:L583I	ENSP00000235790:L583I	L	-	1	0	KDM5B	200981711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.799000	0.69101	2.826000	0.97356	0.655000	0.94253	CTC		0.393	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618		Missense_Mutation
IL2RA	3559	broad.mit.edu	37	10	6063497	6063497	+	Missense_Mutation	SNP	C	C	T	rs55841382		TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr10:6063497C>T	ENST00000379959.3	-	4	700	c.527G>A	c.(526-528)aGg>aAg	p.R176K	IL2RA_ENST00000379954.1_Intron|IL2RA_ENST00000256876.6_Missense_Mutation_p.R176K	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	176	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)	p.R176K(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CTGGGTCCACCTTGTCTTCCC	0.552																																																1	Substitution - Missense(1)	ovary(1)	10											198.0	176.0	184.0					10																	6063497		2203	4300	6503	6103503	SO:0001583	missense	3559			X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.527G>A	10.37:g.6063497C>T	ENSP00000369293:p.Arg176Lys	Unknown		x	x	x	6103503	Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	CCDS7076.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	7.778	0.708992	0.15239	.	.	ENSG00000134460	ENST00000379959;ENST00000256876	T;T	0.64618	-0.11;-0.11	4.41	-1.08	0.09936	Complement control module (2);Sushi/SCR/CCP (3);	0.683107	0.13866	N	0.357333	T	0.42787	0.1218	L	0.47716	1.5	0.09310	N	1	B	0.17268	0.021	B	0.15052	0.012	T	0.29274	-1.0017	10	0.06891	T	0.86	-36.2391	4.1785	0.10363	0.0:0.3736:0.3315:0.2949	rs55841382	176	P01589	IL2RA_HUMAN	K	176	ENSP00000369293:R176K;ENSP00000256876:R176K	ENSP00000256876:R176K	R	-	2	0	IL2RA	6103503	0.000000	0.05858	0.007000	0.13788	0.071000	0.16799	-3.667000	0.00398	-0.016000	0.14127	0.650000	0.86243	AGG		0.552	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417		Missense_Mutation
NLRP10	338322	broad.mit.edu	37	11	7984901	7984901	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr11:7984901C>T	ENST00000328600.2	-	1	303	c.142G>A	c.(142-144)Gag>Aag	p.E48K		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	48	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.E48K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCCTCCAACTCCCCTCTGGCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	11											73.0	76.0	75.0					11																	7984901		2201	4296	6497	7941477	SO:0001583	missense	338322			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.142G>A	11.37:g.7984901C>T	ENSP00000327763:p.Glu48Lys	Unknown		x	x	x	7941477	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	CCDS7784.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054460	0.36277	.	.	ENSG00000182261	ENST00000328600;ENST00000526590	T;T	0.49720	0.77;0.77	4.13	3.19	0.36642	Pyrin (2);DEATH-like (2);	0.179758	0.26971	N	0.021566	T	0.47746	0.1462	L	0.52759	1.655	0.25807	N	0.984445	B	0.31503	0.326	B	0.41332	0.354	T	0.50242	-0.8851	10	0.72032	D	0.01	.	10.5414	0.45035	0.0:0.8029:0.1971:0.0	.	48	Q86W26	NAL10_HUMAN	K	48	ENSP00000327763:E48K;ENSP00000436255:E48K	ENSP00000327763:E48K	E	-	1	0	NLRP10	7941477	0.978000	0.34361	1.000000	0.80357	0.220000	0.24768	0.062000	0.14389	1.013000	0.39391	0.563000	0.77884	GAG		0.512	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		Missense_Mutation
TRIM44	54765	broad.mit.edu	37	11	35706833	35706834	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr11:35706833_35706834CG>TT	ENST00000299413.5	+	2	1003_1004	c.696_697CG>TT	c.(694-699)gcCGct>gcTTct	p.A233S		NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	233						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.A233S(1)		endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				GACTGAAGGCCGCTATGATCGA	0.426																																																1	Substitution - Missense(1)	ovary(1)	11																																								35663410	SO:0001583	missense	54765			BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	Exception_encountered	11.37:g.35706833_35706834delinsTT	ENSP00000299413:p.Ala233Ser	Unknown		x	x	x	35663409	D3DR14|Q96QY2|Q9UGK0	Missense_Mutation	DNP	ENST00000299413.5	37	CCDS31461.1	DNP	23	Broad																																																																																				0.426	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389081.1	NM_017583		Missense_Mutation
SORL1	6653	broad.mit.edu	37	11	121457023	121457023	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr11:121457023G>A	ENST00000260197.7	+	27	3928	c.3799G>A	c.(3799-3801)Gat>Aat	p.D1267N	SORL1_ENST00000525532.1_Missense_Mutation_p.D211N|SORL1_ENST00000534286.1_Missense_Mutation_p.D177N|SORL1_ENST00000532694.1_Missense_Mutation_p.D113N	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1267	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.D1267N(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TGATGGCTCCGATGAACAGCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											178.0	167.0	171.0					11																	121457023		2203	4299	6502	120962233	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3799G>A	11.37:g.121457023G>A	ENSP00000260197:p.Asp1267Asn	Unknown		x	x	x	120962233	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520922	0.85495	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286	D;D;D;D	0.99214	-5.57;-5.57;-5.57;-5.57	5.7	5.7	0.88788	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97978	1.0347	10	0.87932	D	0	.	19.8326	0.96642	0.0:0.0:1.0:0.0	.	1267	Q92673	SORL_HUMAN	N	1267;211;113;177	ENSP00000260197:D1267N;ENSP00000434634:D211N;ENSP00000432131:D113N;ENSP00000436447:D177N	ENSP00000260197:D1267N	D	+	1	0	SORL1	120962233	1.000000	0.71417	0.683000	0.30040	0.473000	0.32948	8.695000	0.91298	2.686000	0.91538	0.591000	0.81541	GAT		0.483	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		Missense_Mutation
OR10G8	219869	broad.mit.edu	37	11	123901211	123901211	+	Silent	SNP	G	G	T	rs550409745		TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr11:123901211G>T	ENST00000431524.1	+	1	915	c.882G>T	c.(880-882)gtG>gtT	p.V294V		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V294V(2)		breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		ACAAGGAGGTGAAGAAAGCTC	0.473																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	11											103.0	97.0	99.0					11																	123901211		2201	4299	6500	123406421	SO:0001819	synonymous_variant	219869			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.882G>T	11.37:g.123901211G>T		Unknown		x	x	x	123406421	B2RNJ3|Q6IEV2	Silent	SNP	ENST00000431524.1	37	CCDS31704.1	SNP	45	Broad																																																																																				0.473	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		Silent
KIRREL3	84623	broad.mit.edu	37	11	126306875	126306875	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr11:126306875C>A	ENST00000525144.2	-	12	1632	c.1383G>T	c.(1381-1383)gaG>gaT	p.E461D	KIRREL3_ENST00000416561.2_5'UTR|KIRREL3_ENST00000525704.2_Missense_Mutation_p.E461D|KIRREL3_ENST00000529097.2_Missense_Mutation_p.E461D	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	461	Ig-like C2-type 5.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E420D(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ATGTGCCCGACTCCAGAACGT	0.647																																																1	Substitution - Missense(1)	ovary(1)	11											54.0	62.0	59.0					11																	126306875		2140	4247	6387	125812085	SO:0001583	missense	84623			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1383G>T	11.37:g.126306875C>A	ENSP00000435466:p.Glu461Asp	Unknown		x	x	x	125812085	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177161	0.38413	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.67865	-0.29;-0.29;-0.29	4.56	3.63	0.41609	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.133580	0.49916	N	0.000134	T	0.59972	0.2233	L	0.45285	1.41	0.80722	D	1	B;B;B	0.17667	0.005;0.0;0.023	B;B;B	0.33521	0.022;0.01;0.165	T	0.58160	-0.7685	10	0.66056	D	0.02	-15.6675	7.2642	0.26219	0.1702:0.7425:0.0:0.0874	.	461;461;461	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	D	461	ENSP00000435466:E461D;ENSP00000434081:E461D;ENSP00000435094:E461D	ENSP00000435466:E461D	E	-	3	2	KIRREL3	125812085	1.000000	0.71417	0.971000	0.41717	0.670000	0.39368	1.298000	0.33412	0.864000	0.35578	0.407000	0.27541	GAG		0.647	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		Missense_Mutation
NFRKB	4798	broad.mit.edu	37	11	129739827	129739827	+	Silent	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr11:129739827G>A	ENST00000446488.3	-	23	3196	c.3093C>T	c.(3091-3093)gcC>gcT	p.A1031A	NFRKB_ENST00000524746.1_Silent_p.A1031A|NFRKB_ENST00000524794.1_Silent_p.A1056A|NFRKB_ENST00000304521.5_Silent_p.A1031A	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	1031					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)	p.A1056A(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		TGGATGAAGGGGCACTGGCTG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	11											163.0	128.0	140.0					11																	129739827		2201	4297	6498	129245037	SO:0001819	synonymous_variant	4798				CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.3093C>T	11.37:g.129739827G>A		Unknown		x	x	x	129245037	Q12869|Q15312|Q9H048	Silent	SNP	ENST00000446488.3	37	CCDS44770.1	SNP	43	Broad																																																																																				0.537	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165		Silent
NRIP2	83714	broad.mit.edu	37	12	2944056	2944056	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr12:2944056C>G	ENST00000337508.4	-	1	134	c.94G>C	c.(94-96)Gag>Cag	p.E32Q		NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	32					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)	p.E32Q(1)		central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			ACCGAGTCCTCTCTGCTTCTT	0.602																																																1	Substitution - Missense(1)	ovary(1)	12											64.0	58.0	60.0					12																	2944056		2203	4300	6503	2814317	SO:0001583	missense	83714			AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.94G>C	12.37:g.2944056C>G	ENSP00000337501:p.Glu32Gln	Unknown		x	x	x	2814317	A2RRE3|B4DV61	Missense_Mutation	SNP	ENST00000337508.4	37	CCDS8514.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.48	1.363038	0.24684	.	.	ENSG00000053702	ENST00000337508;ENST00000546074	.	.	.	3.98	2.06	0.26882	.	.	.	.	.	T	0.17450	0.0419	N	0.22421	0.69	0.09310	N	1	B	0.29432	0.244	B	0.22386	0.039	T	0.22243	-1.0222	8	0.06891	T	0.86	.	5.7804	0.18304	0.0:0.7363:0.0:0.2637	.	32	Q9BQI9	NRIP2_HUMAN	Q	32	.	ENSP00000337501:E32Q	E	-	1	0	NRIP2	2814317	0.000000	0.05858	0.012000	0.15200	0.216000	0.24613	-0.103000	0.10940	0.874000	0.35823	0.484000	0.47621	GAG		0.602	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253090.4	NM_031474		Missense_Mutation
SLC16A7	9194	broad.mit.edu	37	12	60168888	60168888	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr12:60168888A>G	ENST00000261187.4	+	4	976	c.812A>G	c.(811-813)tAt>tGt	p.Y271C	SLC16A7_ENST00000552024.1_Missense_Mutation_p.Y271C|SLC16A7_ENST00000552432.1_Missense_Mutation_p.Y271C|SLC16A7_ENST00000547379.1_Missense_Mutation_p.Y271C|SLC16A7_ENST00000543448.1_Missense_Mutation_p.Y172C	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	271					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.Y271C(1)		endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	TTGGCTCCATATGCTAAAGAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											91.0	89.0	90.0					12																	60168888		2203	4300	6503	58455155	SO:0001583	missense	9194			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.812A>G	12.37:g.60168888A>G	ENSP00000261187:p.Tyr271Cys	Unknown		x	x	x	58455155	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	17.75	3.466036	0.63625	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448	T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.76	4.61	0.57282	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.057343	0.64402	D	0.000001	D	0.82783	0.5112	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84545	0.0641	9	.	.	.	.	12.5087	0.55995	0.8747:0.0:0.0:0.1253	.	271	O60669	MOT2_HUMAN	C	271;271;271;271;271;172	ENSP00000449547:Y271C;ENSP00000448071:Y271C;ENSP00000448742:Y271C;ENSP00000446722:Y271C;ENSP00000261187:Y271C;ENSP00000443731:Y172C	.	Y	+	2	0	SLC16A7	58455155	1.000000	0.71417	0.960000	0.40013	0.781000	0.44180	7.436000	0.80404	1.088000	0.41272	-0.344000	0.07964	TAT		0.383	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731		Missense_Mutation
POLE	5426	broad.mit.edu	37	12	133220531	133220531	+	Silent	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr12:133220531G>A	ENST00000320574.5	-	33	4225	c.4182C>T	c.(4180-4182)gtC>gtT	p.V1394V	POLE_ENST00000535270.1_Silent_p.V1367V|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1394					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.V1394V(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	AGAGATTGTAGACCATGTTGG	0.502								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	12											217.0	183.0	194.0					12																	133220531		2203	4300	6503	131730604	SO:0001819	synonymous_variant	5426				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4182C>T	12.37:g.133220531G>A		Unknown		x	x	x	131730604	Q13533|Q86VH9	Silent	SNP	ENST00000320574.5	37	CCDS9278.1	SNP	33	Broad																																																																																				0.502	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231		Silent
FAM71D	161142	broad.mit.edu	37	14	67671410	67671410	+	3'UTR	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr14:67671410C>T	ENST00000556046.1	+	0	1057							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S172S(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		CCCTCATCTCCCTCTTGAATC	0.468																																																1	Substitution - coding silent(1)	ovary(1)	14											94.0	82.0	86.0					14																	67671410		2203	4300	6503	66741163	SO:0001624	3_prime_UTR_variant	161142				CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*572C>T	14.37:g.67671410C>T		Unknown		x	x	x	66741163	Q86VN4	Silent	SNP	ENST00000556046.1	37		SNP	22	Broad																																																																																				0.468	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	protein_coding	OTTHUMT00000412390.1	NM_173526		Silent
OR4N4	283694	broad.mit.edu	37	15	22382565	22382565	+	Silent	SNP	C	C	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr15:22382565C>A	ENST00000328795.4	+	1	184	c.93C>A	c.(91-93)atC>atA	p.I31I	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I31I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TTGTGCTGATCTTAATTTTCT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	15											158.0	158.0	158.0					15																	22382565		2190	4262	6452	19883929	SO:0001819	synonymous_variant	283694			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.93C>A	15.37:g.22382565C>A		Unknown		x	x	x	19883929	Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	CCDS32173.1	SNP	32	Broad																																																																																				0.413	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			Silent
NOD2	64127	broad.mit.edu	37	16	50733558	50733558	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr16:50733558G>C	ENST00000300589.2	+	2	338	c.233G>C	c.(232-234)gGc>gCc	p.G78A	NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	78	CARD 1. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)	p.G78A(1)		cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CACCTCCTGGGCCAGCCTCTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											39.0	43.0	41.0					16																	50733558		2198	4300	6498	49291059	SO:0001583	missense	64127			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.233G>C	16.37:g.50733558G>C	ENSP00000300589:p.Gly78Ala	Unknown		x	x	x	49291059	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859336	0.71834	.	.	ENSG00000167207	ENST00000526417;ENST00000531674;ENST00000300589	T;T	0.19532	2.14;2.14	5.11	5.11	0.69529	DEATH-like (2);Caspase Recruitment (3);	0.368409	0.23114	N	0.051765	T	0.34542	0.0901	L	0.53249	1.67	0.46927	D	0.999254	D	0.58620	0.983	P	0.55824	0.785	T	0.01884	-1.1254	10	0.40728	T	0.16	.	14.0264	0.64588	0.0:0.0:1.0:0.0	.	78	Q9HC29	NOD2_HUMAN	A	51;51;78	ENSP00000431681:G51A;ENSP00000300589:G78A	ENSP00000300589:G78A	G	+	2	0	NOD2	49291059	1.000000	0.71417	0.998000	0.56505	0.811000	0.45836	5.016000	0.64041	2.379000	0.81126	0.591000	0.81541	GGC		0.632	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162		Missense_Mutation
EDC4	23644	broad.mit.edu	37	16	67915665	67915665	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr16:67915665G>A	ENST00000358933.5	+	22	3160	c.2921G>A	c.(2920-2922)cGt>cAt	p.R974H	CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	974					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R974H(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTGCTGCAGCGTCTGTGTACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	16											43.0	42.0	42.0					16																	67915665		2198	4300	6498	66473166	SO:0001583	missense	23644			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.2921G>A	16.37:g.67915665G>A	ENSP00000351811:p.Arg974His	Unknown		x	x	x	66473166	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436725	0.83885	.	.	ENSG00000038358	ENST00000358933	.	.	.	5.91	5.91	0.95273	.	0.342393	0.33792	N	0.004546	T	0.43612	0.1255	L	0.27053	0.805	0.34302	D	0.684471	D	0.67145	0.996	P	0.49502	0.613	T	0.56685	-0.7938	9	0.51188	T	0.08	-12.408	13.2074	0.59805	0.0732:0.0:0.9268:0.0	.	974	Q6P2E9	EDC4_HUMAN	H	974	.	ENSP00000351811:R974H	R	+	2	0	EDC4	66473166	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.519000	0.67074	2.822000	0.97130	0.558000	0.71614	CGT		0.597	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329		Missense_Mutation
KARS	3735	broad.mit.edu	37	16	75662510	75662510	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr16:75662510A>T	ENST00000302445.3	-	13	1691	c.1652T>A	c.(1651-1653)aTt>aAt	p.I551N	KARS_ENST00000319410.5_Missense_Mutation_p.I579N|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	551					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)	p.I551N(1)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	GACTCGATCAATGCCCATGCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											95.0	91.0	93.0					16																	75662510		2198	4300	6498	74220011	SO:0001583	missense	3735			AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.1652T>A	16.37:g.75662510A>T	ENSP00000303043:p.Ile551Asn	Unknown		x	x	x	74220011	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	ENST00000302445.3	37	CCDS10923.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	17.60	3.430120	0.62844	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.81247	-1.47;-1.47	6.16	6.16	0.99307	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.043106	0.85682	D	0.000000	D	0.94785	0.8316	H	0.99732	4.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.97042	0.9758	10	0.87932	D	0	-7.1771	15.6411	0.77001	1.0:0.0:0.0:0.0	.	579;551	Q15046-2;Q15046	.;SYK_HUMAN	N	579;551	ENSP00000325448:I579N;ENSP00000303043:I551N	ENSP00000303043:I551N	I	-	2	0	KARS	74220011	1.000000	0.71417	0.927000	0.36925	0.068000	0.16541	9.277000	0.95755	2.367000	0.80283	0.528000	0.53228	ATT		0.542	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577117	7577117	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr17:7577117A>C	ENST00000269305.4	-	8	1010	c.821T>G	c.(820-822)gTt>gGt	p.V274G	TP53_ENST00000445888.2_Missense_Mutation_p.V274G|TP53_ENST00000359597.4_Missense_Mutation_p.V274G|TP53_ENST00000455263.2_Missense_Mutation_p.V274G|TP53_ENST00000420246.2_Missense_Mutation_p.V274G|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	274	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V274A(19)|p.V274D(9)|p.V274G(8)|p.0?(8)|p.?(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V274_P278del(1)|p.F270_D281del12(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACAGGCACAAACACGCACCTC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	52	Substitution - Missense(36)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(2)|Deletion - Frameshift(1)	breast(8)|upper_aerodigestive_tract(6)|liver(6)|haematopoietic_and_lymphoid_tissue(5)|lung(4)|ovary(4)|bone(4)|large_intestine(3)|central_nervous_system(2)|urinary_tract(2)|prostate(2)|stomach(1)|soft_tissue(1)|endometrium(1)|skin(1)|oesophagus(1)|pancreas(1)	17											70.0	60.0	64.0					17																	7577117		2203	4300	6503	7517842	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.821T>G	17.37:g.7577117A>C	ENSP00000269305:p.Val274Gly	Unknown		x	x	x	7517842	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257582	0.80246	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99836	-7.05;-7.05;-7.05;-7.05;-7.05;-7.05	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.312804	0.33382	N	0.004980	D	0.99802	0.9915	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.61697	0.99;0.983;0.97;0.977	D;D;D;D	0.91635	0.998;0.996;0.999;0.998	D	0.96805	0.9592	10	0.87932	D	0	-10.2267	12.5624	0.56288	1.0:0.0:0.0:0.0	.	274;274;274;274	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	G	274;274;274;274;274;263;142	ENSP00000352610:V274G;ENSP00000269305:V274G;ENSP00000398846:V274G;ENSP00000391127:V274G;ENSP00000391478:V274G;ENSP00000425104:V142G	ENSP00000269305:V274G	V	-	2	0	TP53	7517842	0.970000	0.33590	0.681000	0.30009	0.775000	0.43874	9.060000	0.93907	2.067000	0.61834	0.379000	0.24179	GTT		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
EFNB3	1949	broad.mit.edu	37	17	7611766	7611766	+	Silent	SNP	G	G	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr17:7611766G>C	ENST00000226091.2	+	3	826	c.429G>C	c.(427-429)ggG>ggC	p.G143G		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	143	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)	p.G143G(1)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				CATCGGATGGGACCCGGGAGG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	17											40.0	39.0	39.0					17																	7611766		2203	4300	6503	7552491	SO:0001819	synonymous_variant	1949			U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.429G>C	17.37:g.7611766G>C		Unknown		x	x	x	7552491	B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Silent	SNP	ENST00000226091.2	37	CCDS11120.1	SNP	41	Broad																																																																																				0.607	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226965.1	NM_001406		Silent
RBFA	79863	broad.mit.edu	37	18	77798522	77798522	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr18:77798522C>A	ENST00000306735.5	+	4	534	c.396C>A	c.(394-396)gaC>gaA	p.D132E	RBFA_ENST00000262197.7_Missense_Mutation_p.D132E|RP11-795F19.5_ENST00000564012.1_Intron|RP11-795F19.5_ENST00000569722.1_Intron	NM_024805.2	NP_079081.2	Q8N0V3	RBFA_HUMAN	ribosome binding factor A (putative)	132					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)		p.D132E(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						TGACTCCAGACTTCTCAGCCT	0.537																																																1	Substitution - Missense(1)	ovary(1)	18											93.0	94.0	94.0					18																	77798522		2203	4300	6503	75899510	SO:0001583	missense	79863			BC014195	CCDS12021.1, CCDS54194.1	18q23	2010-10-21	2010-10-21	2010-10-21	ENSG00000101546	ENSG00000101546			26120	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 22"""	C18orf22		12477932	Standard	NM_024805		Approved	FLJ21172, HsT169	uc002lns.3	Q8N0V3	OTTHUMG00000132923	ENST00000306735.5:c.396C>A	18.37:g.77798522C>A	ENSP00000305696:p.Asp132Glu	Unknown		x	x	x	75899510	Q6PF07|Q8WZ65|Q9H776	Missense_Mutation	SNP	ENST00000306735.5	37	CCDS12021.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674771	0.67928	.	.	ENSG00000101546	ENST00000262197;ENST00000306735	T;T	0.71341	-0.25;-0.56	4.68	0.232	0.15381	K homology domain-like, alpha/beta (1);Ribosome-binding factor A domain (1);	0.101750	0.42682	D	0.000663	T	0.81230	0.4779	M	0.85859	2.78	0.38310	D	0.943221	D;D	0.76494	0.999;0.99	D;D	0.69142	0.962;0.942	T	0.81090	-0.1090	10	0.87932	D	0	-5.057	8.1694	0.31245	0.0:0.451:0.0:0.549	.	132;132	Q8N0V3-2;Q8N0V3	.;RBFA_HUMAN	E	132	ENSP00000262197:D132E;ENSP00000305696:D132E	ENSP00000262197:D132E	D	+	3	2	RBFA	75899510	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	0.485000	0.22324	0.090000	0.17273	0.561000	0.74099	GAC		0.537	RBFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256436.2	NM_024805		Missense_Mutation
FAM129C	199786	broad.mit.edu	37	19	17662661	17662661	+	Intron	SNP	T	T	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr19:17662661T>C	ENST00000335393.4	+	16	1981				FAM129C_ENST00000599124.1_Missense_Mutation_p.I570T|FAM129C_ENST00000449408.2_Intron|FAM129C_ENST00000352727.3_Missense_Mutation_p.I601T|FAM129C_ENST00000332386.5_Missense_Mutation_p.I637T|FAM129C_ENST00000600871.1_Missense_Mutation_p.I555T|FAM129C_ENST00000601861.1_Intron|FAM129C_ENST00000599164.1_Missense_Mutation_p.I606T	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C											autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						GGTGCCCAGATCCAGCCACTC	0.493																																																0			19											51.0	57.0	56.0					19																	17662661		1898	4126	6024	17523661	SO:0001627	intron_variant	199786			AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1844-1461T>C	19.37:g.17662661T>C		Unknown		x	x	x	17523661	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	CCDS12362.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	5.142	0.211878	0.09757	.	.	ENSG00000167483	ENST00000332386;ENST00000352727;ENST00000435646	T;T	0.24908	2.16;1.83	1.48	-0.694	0.11294	.	.	.	.	.	T	0.10121	0.0248	N	0.08118	0	0.09310	N	1	B;B;B	0.32160	0.231;0.358;0.358	B;B;B	0.25140	0.04;0.058;0.058	T	0.19844	-1.0293	9	0.59425	D	0.04	.	4.1824	0.10381	0.0:0.4486:0.0:0.5514	.	555;637;601	E7ENP6;Q86XR2-3;Q86XR2-4	.;.;.	T	637;601;555	ENSP00000333447:I637T;ENSP00000341067:I601T	ENSP00000333447:I637T	I	+	2	0	FAM129C	17523661	0.007000	0.16637	0.011000	0.14972	0.056000	0.15407	0.570000	0.23653	-0.283000	0.09115	0.379000	0.24179	ATC		0.493	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544		Missense_Mutation
ECH1	1891	broad.mit.edu	37	19	39322127	39322127	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr19:39322127T>C	ENST00000221418.4	-	2	314	c.82A>G	c.(82-84)Agt>Ggt	p.S28G	ECH1_ENST00000597805.1_Intron|AC104534.3_ENST00000594769.1_Silent_p.S197S	NM_001398.2	NP_001389.2	Q13011	ECH1_HUMAN	enoyl CoA hydratase 1, peroxisomal	28					fatty acid beta-oxidation (GO:0006635)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	isomerase activity (GO:0016853)|receptor binding (GO:0005102)	p.S28G(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			AGGCTAATACTGAGTCCCGGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											52.0	55.0	54.0					19																	39322127		2203	4300	6503	44013967	SO:0001583	missense	1891			U16660	CCDS33014.1	19q13.1	2010-04-30	2010-04-30			ENSG00000104823			3149	protein-coding gene	gene with protein product		600696	"""enoyl Coenzyme A hydratase 1, peroxisomal"""			7558027	Standard	XM_005258610		Approved	HPXEL		Q13011		ENST00000221418.4:c.82A>G	19.37:g.39322127T>C	ENSP00000221418:p.Ser28Gly	Unknown		x	x	x	44013967	A8K745|Q8WVX0|Q96EZ9	Missense_Mutation	SNP	ENST00000221418.4	37	CCDS33014.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	8.406	0.843152	0.16963	.	.	ENSG00000104823	ENST00000221418	T	0.64260	-0.09	5.04	-4.89	0.03103	.	1.603470	0.03218	N	0.177148	T	0.38878	0.1057	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07009	-1.0795	10	0.23891	T	0.37	.	1.4211	0.02312	0.2233:0.1133:0.3424:0.321	.	28;28	B4DVS4;Q13011	.;ECH1_HUMAN	G	28	ENSP00000221418:S28G	ENSP00000221418:S28G	S	-	1	0	ECH1	44013967	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.719000	0.04974	-0.925000	0.03775	-2.353000	0.00241	AGT		0.567	ECH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462650.1			Missense_Mutation
ZNF582	147948	broad.mit.edu	37	19	56895626	56895626	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr19:56895626C>A	ENST00000301310.4	-	5	1318	c.1160G>T	c.(1159-1161)aGa>aTa	p.R387I	ZNF582_ENST00000586929.1_Missense_Mutation_p.R387I	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R387I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		AGTGTGAATTCTCTGATGTTG	0.428																																					Ovarian(183;1887 2032 4349 30507 51343)											1	Substitution - Missense(1)	ovary(1)	19											98.0	96.0	97.0					19																	56895626		2203	4300	6503	61587438	SO:0001583	missense	147948			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.1160G>T	19.37:g.56895626C>A	ENSP00000301310:p.Arg387Ile	Unknown		x	x	x	61587438	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	37	CCDS33121.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035212	0.75617	.	.	ENSG00000018869	ENST00000301310	T	0.24908	1.83	4.76	4.76	0.60689	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37761	N	0.001946	T	0.46268	0.1384	M	0.68728	2.09	0.46356	D	0.999007	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.40213	-0.9575	10	0.59425	D	0.04	.	10.3293	0.43812	0.0:0.9095:0.0:0.0905	.	387;418	Q96NG8;B4DQZ9	ZN582_HUMAN;.	I	387	ENSP00000301310:R387I	ENSP00000301310:R387I	R	-	2	0	ZNF582	61587438	0.043000	0.20138	0.850000	0.33497	0.528000	0.34623	2.846000	0.48262	2.480000	0.83734	0.655000	0.94253	AGA		0.428	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690		Missense_Mutation
ALLC	55821	broad.mit.edu	37	2	3729268	3729268	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr2:3729268G>C	ENST00000252505.3	+	6	505	c.343G>C	c.(343-345)Gca>Cca	p.A115P		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	134					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.A115P(1)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GACAGGAGCTGCAGCCACTCC	0.448										HNSCC(21;0.051)																																						1	Substitution - Missense(1)	ovary(1)	2											52.0	57.0	55.0					2																	3729268		1917	4127	6044	3707143	SO:0001583	missense	55821			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.343G>C	2.37:g.3729268G>C	ENSP00000252505:p.Ala115Pro	Unknown		x	x	x	3707143	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	CCDS46223.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	7.660	0.684701	0.14973	.	.	ENSG00000151360	ENST00000252505	.	.	.	4.98	3.15	0.36227	Allantoicase domain (1);Galactose-binding domain-like (1);	0.047980	0.85682	D	0.000000	T	0.45518	0.1346	M	0.68952	2.095	0.09310	N	0.999996	B	0.31790	0.34	B	0.36534	0.227	T	0.45906	-0.9229	9	0.62326	D	0.03	-1.8779	6.6932	0.23185	0.0908:0.0:0.7351:0.1741	.	134	Q8N6M5	ALLC_HUMAN	P	115	.	ENSP00000252505:A115P	A	+	1	0	ALLC	3707143	0.623000	0.27094	0.007000	0.13788	0.008000	0.06430	3.839000	0.55835	0.778000	0.33520	-0.175000	0.13238	GCA		0.448	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1			Missense_Mutation
GREB1	9687	broad.mit.edu	37	2	11755345	11755345	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr2:11755345A>T	ENST00000381486.2	+	20	3551	c.3251A>T	c.(3250-3252)aAc>aTc	p.N1084I	GREB1_ENST00000396123.1_Missense_Mutation_p.N82I|GREB1_ENST00000234142.5_Missense_Mutation_p.N1084I	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1084						integral component of membrane (GO:0016021)		p.N1084I(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGGGCTAGGAACGAGGCCTTG	0.577																																					Ovarian(39;850 945 2785 23371 33093)											1	Substitution - Missense(1)	ovary(1)	2											74.0	79.0	78.0					2																	11755345		2103	4224	6327	11672796	SO:0001583	missense	9687				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3251A>T	2.37:g.11755345A>T	ENSP00000370896:p.Asn1084Ile	Unknown		x	x	x	11672796	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	10.48	1.362258	0.24684	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.21543	3.32;3.32;2.0	5.32	-7.65	0.01281	.	0.931300	0.09174	N	0.838343	T	0.12646	0.0307	L	0.36672	1.1	0.09310	N	1	B	0.22983	0.078	B	0.15870	0.014	T	0.24657	-1.0154	10	0.26408	T	0.33	-25.0896	10.446	0.44495	0.2782:0.1989:0.5229:0.0	.	1084	Q4ZG55	GREB1_HUMAN	I	1084;1084;82	ENSP00000370896:N1084I;ENSP00000234142:N1084I;ENSP00000379429:N82I	ENSP00000234142:N1084I	N	+	2	0	GREB1	11672796	0.009000	0.17119	0.015000	0.15790	0.885000	0.51271	0.455000	0.21843	-1.381000	0.02112	-0.466000	0.05196	AAC		0.577	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179628950	179628950	+	Silent	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr2:179628950A>T	ENST00000591111.1	-	43	10292	c.10068T>A	c.(10066-10068)acT>acA	p.T3356T	TTN_ENST00000460472.2_Silent_p.T3310T|TTN_ENST00000359218.5_Silent_p.T3310T|TTN_ENST00000342175.6_Silent_p.T3310T|TTN_ENST00000589042.1_Silent_p.T3356T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Silent_p.T3356T|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Silent_p.T3356T			Q8WZ42	TITIN_HUMAN	titin	13672	Ig-like 20.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T3356T(2)|p.T3310T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCCTTCAGAAGTGACAGTGT	0.453																																																3	Substitution - coding silent(3)	ovary(3)	2											92.0	92.0	92.0					2																	179628950		2203	4300	6503	179337195	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10068T>A	2.37:g.179628950A>T		Unknown		x	x	x	179337195	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	3	Broad																																																																																				0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
RBM12	10137	broad.mit.edu	37	20	34242048	34242048	+	Silent	SNP	T	T	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr20:34242048T>C	ENST00000374114.3	-	3	1460	c.1197A>G	c.(1195-1197)ggA>ggG	p.G399G	RBM12_ENST00000374104.3_Silent_p.G399G|CPNE1_ENST00000317677.5_5'Flank|RBM12_ENST00000359646.1_Silent_p.G399G|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397445.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	399						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G399G(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GATGAGTTTGTCCAGAAGGTC	0.478											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - coding silent(1)	ovary(1)	20											135.0	132.0	133.0					20																	34242048		2203	4300	6503	33705462	SO:0001819	synonymous_variant	10137			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1197A>G	20.37:g.34242048T>C		Unknown	846	x	x	x	33705462	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	37	CCDS13261.1	SNP	58	Broad																																																																																				0.478	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047		Silent
ZBP1	81030	broad.mit.edu	37	20	56190001	56190001	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr20:56190001C>G	ENST00000371173.3	-	4	621	c.444G>C	c.(442-444)aaG>aaC	p.K148N	ZBP1_ENST00000541799.1_Missense_Mutation_p.K148N|ZBP1_ENST00000343535.4_Missense_Mutation_p.K148N|ZBP1_ENST00000538947.1_5'Flank|ZBP1_ENST00000395822.3_Missense_Mutation_p.K73N|ZBP1_ENST00000340462.4_Missense_Mutation_p.K125N	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	148					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)	p.K148N(1)		large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			GGTGCCTGCTCTTCATCCTGT	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											246.0	195.0	212.0					20																	56190001		2203	4300	6503	55623407	SO:0001583	missense	81030			AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.444G>C	20.37:g.56190001C>G	ENSP00000360215:p.Lys148Asn	Unknown		x	x	x	55623407	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	11.51	1.661248	0.29515	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535;ENST00000541799	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	3.39	-5.32	0.02722	Winged helix-turn-helix transcription repressor DNA-binding (1);Double-stranded RNA-specific adenosine deaminase (DRADA) (1);	1.361350	0.04816	N	0.436027	T	0.41811	0.1175	N	0.14661	0.345	0.09310	N	1	P;P;P;P	0.51791	0.782;0.948;0.948;0.948	B;P;P;P	0.51918	0.308;0.589;0.684;0.589	T	0.48433	-0.9036	10	0.72032	D	0.01	-6.4876	6.4629	0.21966	0.0:0.2936:0.1393:0.5671	.	148;148;73;148	F5GYT1;A2RRL9;A2A2F7;Q9H171	.;.;.;ZBP1_HUMAN	N	148;73;125;148;148;148	ENSP00000360215:K148N;ENSP00000379167:K73N;ENSP00000344954:K125N;ENSP00000340584:K148N;ENSP00000440552:K148N	ENSP00000344954:K125N	K	-	3	2	ZBP1	55623407	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-1.140000	0.03210	-1.273000	0.02424	-0.812000	0.03155	AAG		0.567	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776		Missense_Mutation
ITGB2	3689	broad.mit.edu	37	21	46311819	46311819	+	Silent	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr21:46311819C>T	ENST00000397850.2	-	12	1769	c.1317G>A	c.(1315-1317)gtG>gtA	p.V439V	ITGB2_ENST00000397854.3_Silent_p.V382V|ITGB2_ENST00000302347.5_Silent_p.V439V|ITGB2_ENST00000397857.1_Silent_p.V439V|ITGB2_ENST00000355153.4_Silent_p.V439V|ITGB2_ENST00000397852.1_Silent_p.V439V			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	439					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.V439V(1)		breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GAAGAACCTGCACGGTCACTA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	21											95.0	79.0	85.0					21																	46311819		2202	4300	6502	45136247	SO:0001819	synonymous_variant	3689			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1317G>A	21.37:g.46311819C>T		Unknown		x	x	x	45136247	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	ENST00000397850.2	37	CCDS13716.1	SNP	25	Broad																																																																																				0.622	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211		Silent
GGTLC2	91227	broad.mit.edu	37	22	22989329	22989329	+	Silent	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr22:22989329A>T	ENST00000480559.1	+	2	282	c.282A>T	c.(280-282)tcA>tcT	p.S94S	POM121L1P_ENST00000402027.1_RNA|GGTLC2_ENST00000448514.1_Silent_p.S94S	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	94					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)	p.S94S(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		TGCCCCCCTCACCTGCCAATT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	22											105.0	112.0	109.0					22																	22989329		2203	4298	6501	21319329	SO:0001819	synonymous_variant	91227			X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.282A>T	22.37:g.22989329A>T		Unknown		x	x	x	21319329	A1A516|A2VCM9|Q5NV76|Q6ISH0	Silent	SNP	ENST00000480559.1	37	CCDS13802.2	SNP	6	Broad																																																																																				0.617	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321662.1	NM_199127		Silent
CCDC157	550631	broad.mit.edu	37	22	30762086	30762086	+	Missense_Mutation	SNP	G	G	A	rs374803463		TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr22:30762086G>A	ENST00000405659.1	+	3	806	c.97G>A	c.(97-99)Ggg>Agg	p.G33R	CCDC157_ENST00000399824.2_Missense_Mutation_p.G33R|CCDC157_ENST00000338306.3_Missense_Mutation_p.G33R			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	33								p.G33R(1)|p.G33W(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						CTCCCGCGCCGGGCCTGTGCG	0.662																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	22											62.0	70.0	68.0					22																	30762086		692	1591	2283	29092086	SO:0001583	missense	550631			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.97G>A	22.37:g.30762086G>A	ENSP00000385357:p.Gly33Arg	Unknown		x	x	x	29092086	Q0VD76|Q9BYA4	Missense_Mutation	SNP	ENST00000405659.1	37	CCDS33632.2	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243768	0.79912	.	.	ENSG00000187860	ENST00000399824;ENST00000405659;ENST00000338306;ENST00000445005;ENST00000430839	T;T;T;T;T	0.56941	0.43;1.38;1.38;1.04;1.03	5.25	5.25	0.73442	.	.	.	.	.	T	0.70011	0.3175	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72074	-0.4400	9	0.72032	D	0.01	-35.3655	17.3819	0.87407	0.0:0.0:1.0:0.0	.	33	Q569K6	CC157_HUMAN	R	33	ENSP00000382720:G33R;ENSP00000385357:G33R;ENSP00000343087:G33R;ENSP00000387491:G33R;ENSP00000401837:G33R	ENSP00000343087:G33R	G	+	1	0	CCDC157	29092086	1.000000	0.71417	0.946000	0.38457	0.359000	0.29487	9.043000	0.93799	2.613000	0.88420	0.455000	0.32223	GGG		0.662	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1	NM_001017437		Missense_Mutation
SETD2	29072	broad.mit.edu	37	3	47098746	47098746	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr3:47098746A>T	ENST00000409792.3	-	15	6570	c.6528T>A	c.(6526-6528)taT>taA	p.Y2176*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2176	Low charge region.|Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.Y2176*(1)|p.Y1673*(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGGGATCCACATAGGCCTGCA	0.542			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Nonsense(2)	ovary(2)	3											151.0	133.0	139.0					3																	47098746		2203	4300	6503	47073750	SO:0001587	stop_gained	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6528T>A	3.37:g.47098746A>T	ENSP00000386759:p.Tyr2176*	Unknown		x	x	x	47073750	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	45	11.991448	0.99625	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.25	0.276	0.15663	.	0.000000	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7366	0.40392	0.5494:0.0:0.4506:0.0	.	.	.	.	X	2176	.	ENSP00000386759:Y2176X	Y	-	3	2	SETD2	47073750	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	2.124000	0.42006	-0.025000	0.13918	-0.250000	0.11733	TAT		0.542	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		Nonsense_Mutation
COL7A1	1294	broad.mit.edu	37	3	48625776	48625776	+	Silent	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr3:48625776C>T	ENST00000328333.8	-	20	2756	c.2649G>A	c.(2647-2649)ctG>ctA	p.L883L	COL7A1_ENST00000454817.1_Silent_p.L883L	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	883	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L883L(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGCGCAGCCTCAGCGAGTGCT	0.672																																																1	Substitution - coding silent(1)	ovary(1)	3											23.0	26.0	25.0					3																	48625776		2203	4297	6500	48600780	SO:0001819	synonymous_variant	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2649G>A	3.37:g.48625776C>T		Unknown		x	x	x	48600780	Q14054|Q16507	Silent	SNP	ENST00000328333.8	37	CCDS2773.1	SNP	29	Broad																																																																																				0.672	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		Silent
PODXL2	50512	broad.mit.edu	37	3	127379886	127379886	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr3:127379886G>A	ENST00000342480.6	+	3	1054	c.1015G>A	c.(1015-1017)Gga>Aga	p.G339R		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	339					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)	p.G339R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						ACTGGCCCCTGGAGACATGGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											73.0	60.0	65.0					3																	127379886		2203	4300	6503	128862576	SO:0001583	missense	50512			AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.1015G>A	3.37:g.127379886G>A	ENSP00000345359:p.Gly339Arg	Unknown		x	x	x	128862576	Q6UVY4|Q8WUV6	Missense_Mutation	SNP	ENST00000342480.6	37	CCDS3044.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.630379	0.00813	.	.	ENSG00000114631	ENST00000342480	T	0.20598	2.06	4.95	-1.4	0.08968	.	1.900910	0.02330	N	0.073875	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24083	-1.0170	10	0.14252	T	0.57	1.1657	7.2716	0.26260	0.4657:0.244:0.2903:0.0	.	339	Q9NZ53	PDXL2_HUMAN	R	339	ENSP00000345359:G339R	ENSP00000345359:G339R	G	+	1	0	PODXL2	128862576	0.000000	0.05858	0.003000	0.11579	0.016000	0.09150	-0.330000	0.07925	-0.035000	0.13691	-1.530000	0.00923	GGA		0.567	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720		Missense_Mutation
GPR149	344758	broad.mit.edu	37	3	154056059	154056059	+	Splice_Site	SNP	C	C	T	rs199967865		TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr3:154056059C>T	ENST00000389740.2	-	4	1724	c.1625G>A	c.(1624-1626)cGt>cAt	p.R542H		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	542					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R542H(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			ATAACCGGAACGCTGGGGACA	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		19095	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											76.0	77.0	77.0					3																	154056059		1876	4103	5979	155538753	SO:0001630	splice_region_variant	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1624-1G>A	3.37:g.154056059C>T		Unknown		x	x	x	155538753		Missense_Mutation	SNP	ENST00000389740.2	37	CCDS43162.1	SNP	19	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	24.3	4.519500	0.85495	.	.	ENSG00000174948	ENST00000389740	.	.	.	5.77	4.89	0.63831	.	0.063289	0.64402	D	0.000006	T	0.74230	0.3689	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.76462	-0.2950	9	0.87932	D	0	-13.5998	15.0929	0.72211	0.0:0.9311:0.0:0.0689	.	542	Q86SP6	GP149_HUMAN	H	542	.	ENSP00000374390:R542H	R	-	2	0	GPR149	155538753	1.000000	0.71417	0.981000	0.43875	0.825000	0.46686	5.746000	0.68681	2.726000	0.93360	0.655000	0.94253	CGT		0.413	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	Missense_Mutation	Missense_Mutation
PEX5L	51555	broad.mit.edu	37	3	179527398	179527398	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr3:179527398T>C	ENST00000467460.1	-	12	1543	c.1213A>G	c.(1213-1215)Act>Gct	p.T405A	PEX5L_ENST00000464614.1_Missense_Mutation_p.T297A|PEX5L_ENST00000472994.1_Missense_Mutation_p.T346A|PEX5L_ENST00000465751.1_Missense_Mutation_p.T381A|PEX5L_ENST00000485199.1_Missense_Mutation_p.T370A|PEX5L_ENST00000263962.8_Missense_Mutation_p.T403A|PEX5L_ENST00000468741.1_Missense_Mutation_p.T213A|PEX5L_ENST00000392649.3_Missense_Mutation_p.T297A|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000476138.1_Missense_Mutation_p.T362A	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	405					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)	p.T405A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CCAGTGTTAGTATAACTCACA	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											104.0	99.0	100.0					3																	179527398		2203	4300	6503	181010092	SO:0001583	missense	51555			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1213A>G	3.37:g.179527398T>C	ENSP00000419975:p.Thr405Ala	Unknown		x	x	x	181010092	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	27.0	4.786640	0.90367	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	T;T;T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.88588	0.6477	M	0.80508	2.5	0.80722	D	1	D;D;D;D;D;D	0.76494	0.988;0.988;0.996;0.999;0.997;0.998	D;D;P;D;D;D	0.78314	0.941;0.941;0.785;0.991;0.987;0.98	D	0.89522	0.3779	10	0.62326	D	0.03	-20.5811	16.5885	0.84745	0.0:0.0:0.0:1.0	.	346;381;297;403;370;405	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	A	405;403;370;403;297;213;362;293;346;297;381	ENSP00000419975:T405A;ENSP00000263962:T403A;ENSP00000418440:T370A;ENSP00000376420:T297A;ENSP00000418665:T213A;ENSP00000420555:T362A;ENSP00000418054:T346A;ENSP00000417270:T297A;ENSP00000419348:T381A	ENSP00000263962:T403A	T	-	1	0	PEX5L	181010092	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.831000	0.86748	2.317000	0.78254	0.460000	0.39030	ACT		0.393	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559		Missense_Mutation
ECE2	9718	broad.mit.edu	37	3	184007250	184007250	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr3:184007250G>A	ENST00000402825.3	+	12	1754	c.1754G>A	c.(1753-1755)cGg>cAg	p.R585Q	ECE2_ENST00000357474.5_Missense_Mutation_p.R513Q|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000404464.3_Missense_Mutation_p.R467Q|ECE2_ENST00000359140.4_Missense_Mutation_p.R438Q	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	585	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.R438Q(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGCGAAATCCGGACCGCATTT	0.622											OREG0015946	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	3											46.0	42.0	43.0					3																	184007250		2203	4300	6503	185489944	SO:0001583	missense	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1754G>A	3.37:g.184007250G>A	ENSP00000384223:p.Arg585Gln	Unknown	1988	x	x	x	185489944	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943354	0.92593	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81	5.03	5.03	0.67393	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80854	0.4703	L	0.47716	1.5	0.58432	D	0.999994	D;D;D;P;D;D;D	0.65815	0.973;0.99;0.99;0.945;0.988;0.988;0.995	P;P;P;P;P;P;D	0.63283	0.703;0.85;0.85;0.526;0.706;0.706;0.913	T	0.79293	-0.1863	10	0.38643	T	0.18	-29.072	17.1028	0.86654	0.0:0.0:1.0:0.0	.	187;438;456;467;513;438;585	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	Q	585;438;467;513;459	ENSP00000384223:R585Q;ENSP00000352052:R438Q;ENSP00000385846:R467Q;ENSP00000350066:R513Q;ENSP00000398444:R459Q	ENSP00000350066:R513Q	R	+	2	0	ECE2	185489944	0.015000	0.18098	0.959000	0.39883	0.960000	0.62799	1.836000	0.39191	2.631000	0.89168	0.549000	0.68633	CGG		0.622	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693		Missense_Mutation
PCDHB12	56124	broad.mit.edu	37	5	140589987	140589987	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr5:140589987T>G	ENST00000239450.2	+	1	1697	c.1508T>G	c.(1507-1509)cTg>cGg	p.L503R	PCDHB12_ENST00000541609.1_Missense_Mutation_p.L166R	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L503R(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGCCTCCCTGGTCTCCATC	0.667																																																1	Substitution - Missense(1)	ovary(1)	5											83.0	85.0	85.0					5																	140589987		2203	4298	6501	140570171	SO:0001583	missense	56124			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1508T>G	5.37:g.140589987T>G	ENSP00000239450:p.Leu503Arg	Unknown		x	x	x	140570171	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	13.71	2.317088	0.40996	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.51574	0.7;0.7	3.41	-0.17	0.13335	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.58850	0.2151	L	0.53729	1.69	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47947	-0.9077	9	0.87932	D	0	.	8.1236	0.30986	0.5349:0.0:0.0:0.4651	.	503	Q9Y5F1	PCDBC_HUMAN	R	166;503;123	ENSP00000440199:L166R;ENSP00000239450:L503R	ENSP00000239450:L503R	L	+	2	0	PCDHB12	140570171	0.000000	0.05858	0.005000	0.12908	0.913000	0.54294	0.444000	0.21661	0.310000	0.22990	0.397000	0.26171	CTG		0.667	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		Missense_Mutation
ABLIM3	22885	broad.mit.edu	37	5	148627434	148627434	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr5:148627434C>A	ENST00000506113.1	+	17	2123	c.1641C>A	c.(1639-1641)agC>agA	p.S547R	ABLIM3_ENST00000517451.1_Missense_Mutation_p.S33R|ABLIM3_ENST00000356541.3_Missense_Mutation_p.S436R|AC012613.2_ENST00000523176.1_RNA|RP11-331K21.1_ENST00000522685.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.S452R|ABLIM3_ENST00000309868.7_Missense_Mutation_p.S547R|ABLIM3_ENST00000508983.1_Missense_Mutation_p.S514R|ABLIM3_ENST00000504238.1_Missense_Mutation_p.S436R			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	547					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.S547R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCCCGGAGCTCCACCAGCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	5											30.0	32.0	32.0					5																	148627434		2203	4300	6503	148607627	SO:0001583	missense	22885			AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1641C>A	5.37:g.148627434C>A	ENSP00000425394:p.Ser547Arg	Unknown		x	x	x	148607627	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	CCDS4294.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561578	0.45590	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983;ENST00000517451;ENST00000536903	T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.62	2.88	0.33553	.	0.099520	0.64402	N	0.000002	T	0.33323	0.0859	N	0.03154	-0.405	0.33569	D	0.598356	P;D;D;D	0.71674	0.589;0.998;0.998;0.975	B;D;D;P	0.79108	0.361;0.992;0.988;0.575	T	0.44636	-0.9315	10	0.39692	T	0.17	.	4.8967	0.13753	0.1385:0.5817:0.0:0.2798	.	33;452;436;547	O94929-4;O94929-3;O94929-2;O94929	.;.;.;ABLM3_HUMAN	R	452;436;547;547;436;514;33;32	ENSP00000315841:S452R;ENSP00000348938:S436R;ENSP00000310309:S547R;ENSP00000425394:S547R;ENSP00000421183:S436R;ENSP00000420855:S514R;ENSP00000430150:S33R	ENSP00000310309:S547R	S	+	3	2	ABLIM3	148607627	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	1.523000	0.35932	0.326000	0.23384	-1.131000	0.01979	AGC		0.607	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945		Missense_Mutation
OR2W1	26692	broad.mit.edu	37	6	29012589	29012589	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr6:29012589G>T	ENST00000377175.1	-	1	428	c.364C>A	c.(364-366)Cgt>Agt	p.R122S		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122G(1)|p.R122S(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GCTGTAAAACGATCATAGGAC	0.398																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	6											101.0	82.0	89.0					6																	29012589		1511	2709	4220	29120568	SO:0001583	missense	26692			AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.364C>A	6.37:g.29012589G>T	ENSP00000366380:p.Arg122Ser	Unknown		x	x	x	29120568	B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	ENST00000377175.1	37	CCDS4656.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452302	0.63290	.	.	ENSG00000204704	ENST00000377175	T	0.77620	-1.11	4.79	4.79	0.61399	GPCR, rhodopsin-like superfamily (1);	0.131262	0.35407	N	0.003240	D	0.85146	0.5630	H	0.98646	4.29	0.42680	D	0.993549	P	0.44139	0.827	B	0.42386	0.386	D	0.90935	0.4793	10	0.87932	D	0	.	16.3937	0.83548	0.0:0.0:1.0:0.0	.	122	Q9Y3N9	OR2W1_HUMAN	S	122	ENSP00000366380:R122S	ENSP00000366380:R122S	R	-	1	0	OR2W1	29120568	1.000000	0.71417	0.978000	0.43139	0.849000	0.48306	4.000000	0.57039	2.175000	0.68902	0.591000	0.81541	CGT		0.398	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076053.2			Missense_Mutation
MED23	9439	broad.mit.edu	37	6	131908848	131908848	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr6:131908848C>T	ENST00000368068.3	-	29	4257	c.4078G>A	c.(4078-4080)Gtg>Atg	p.V1360M	MED23_ENST00000479213.1_5'UTR|MED23_ENST00000368058.1_Missense_Mutation_p.V1366M|MED23_ENST00000368060.3_Splice_Site|MED23_ENST00000403834.3_Missense_Mutation_p.V1366M|MED23_ENST00000545957.1_Missense_Mutation_p.V1001M|MED23_ENST00000354577.4_Splice_Site	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	1360					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.V1360M(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		GACACGGGCACCTGATTAGAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	6											133.0	113.0	120.0					6																	131908848		2203	4300	6503	131950541	SO:0001583	missense	9439			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.4078G>A	6.37:g.131908848C>T	ENSP00000357047:p.Val1360Met	Unknown		x	x	x	131950541	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	SNP	18	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.670324|4.670324	0.88348|0.88348	.|.	.|.	ENSG00000112282|ENSG00000112282	ENST00000368060|ENST00000368068;ENST00000403834;ENST00000368058;ENST00000545957	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.290587	.|0.37669	.|N	.|0.001984	.|T	.|0.51669	.|0.1688	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|P	.|0.36733	.|0.567	.|B	.|0.37387	.|0.248	.|T	.|0.56092	.|-0.8036	.|8	.|0.49607	.|T	.|0.09	.|-5.1399	20.0609|20.0609	0.97674|0.97674	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1360	.|Q9ULK4	.|MED23_HUMAN	.|M	-1|1360;1366;1366;1001	.|.	.|ENSP00000357037:V1366M	.|V	-|-	.|1	.|0	MED23|MED23	131950541|131950541	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.955000|0.955000	0.61496|0.61496	5.720000|5.720000	0.68470|0.68470	2.755000|2.755000	0.94549|0.94549	0.655000|0.655000	0.94253|0.94253	.|GTG		0.468	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1			Missense_Mutation
TAAR8	83551	broad.mit.edu	37	6	132873948	132873948	+	Silent	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr6:132873948C>T	ENST00000275200.1	+	1	117	c.117C>T	c.(115-117)agC>agT	p.S39S		NM_053278.1	NP_444508.1	Q969N4	TAAR8_HUMAN	trace amine associated receptor 8	39					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.S39S(1)		endometrium(3)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)		CGGCGTTTAGCTTTGGGTCTT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	6											178.0	180.0	179.0					6																	132873948		2203	4300	6503	132915641	SO:0001819	synonymous_variant	83551			AF380193	CCDS5154.1	6q23.2	2014-05-14	2005-02-23	2005-02-24	ENSG00000146385	ENSG00000146385		"""GPCR / Class A : Trace amine associated receptors"""	14964	protein-coding gene	gene with protein product		606927	"""trace amine receptor 5"""	GPR102, TRAR5		11574155, 15718104	Standard	NM_053278		Approved	TA5, TAR5	uc011ecj.2	Q969N4	OTTHUMG00000015586	ENST00000275200.1:c.117C>T	6.37:g.132873948C>T		Unknown		x	x	x	132915641	Q5VUQ0	Silent	SNP	ENST00000275200.1	37	CCDS5154.1	SNP	28	Broad																																																																																				0.443	TAAR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042262.1	NM_053278		Silent
RSPH3	83861	broad.mit.edu	37	6	159401923	159401923	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr6:159401923C>T	ENST00000252655.1	-	6	1357	c.1168G>A	c.(1168-1170)Gag>Aag	p.E390K	RSPH3_ENST00000367069.2_Missense_Mutation_p.E248K|RSPH3_ENST00000297262.3_Missense_Mutation_p.E294K|RSPH3_ENST00000449822.1_Missense_Mutation_p.E152K	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	390								p.E390K(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		TGTGATGTCTCGTTGTGCTTG	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											250.0	199.0	216.0					6																	159401923		2203	4300	6503	159321911	SO:0001583	missense	83861			AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.1168G>A	6.37:g.159401923C>T	ENSP00000252655:p.Glu390Lys	Unknown		x	x	x	159321911	Q96LQ5|Q96LX2|Q9BX75	Missense_Mutation	SNP	ENST00000252655.1	37	CCDS5260.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103879	0.76983	.	.	ENSG00000130363	ENST00000367069;ENST00000449822;ENST00000252655;ENST00000297262	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.41949	0.1181	M	0.81614	2.55	0.51767	D	0.99993	D;D	0.89917	0.999;1.0	D;D	0.72982	0.972;0.979	T	0.17592	-1.0364	10	0.39692	T	0.17	-34.8515	18.2981	0.90154	0.0:1.0:0.0:0.0	.	294;390	Q86UC2-2;Q86UC2	.;RSPH3_HUMAN	K	248;152;390;294	ENSP00000356036:E248K;ENSP00000393195:E152K;ENSP00000252655:E390K;ENSP00000297262:E294K	ENSP00000252655:E390K	E	-	1	0	RSPH3	159321911	1.000000	0.71417	0.001000	0.08648	0.063000	0.16089	7.148000	0.77389	2.660000	0.90430	0.467000	0.42956	GAG		0.502	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924		Missense_Mutation
CRHR2	1395	broad.mit.edu	37	7	30695301	30695301	+	Silent	SNP	C	C	T	rs376936813		TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr7:30695301C>T	ENST00000471646.1	-	10	1365	c.948G>A	c.(946-948)ctG>ctA	p.L316L	CRHR2_ENST00000341843.4_Silent_p.L302L|CRHR2_ENST00000506074.2_Silent_p.L316L|CRHR2_ENST00000348438.4_Silent_p.L343L	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	316					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)	p.L316L(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCAGGAGGGGCAGGAGCACCA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	7											148.0	144.0	145.0					7																	30695301		2203	4300	6503	30661826	SO:0001819	synonymous_variant	1395				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.948G>A	7.37:g.30695301C>T		Unknown		x	x	x	30661826	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Silent	SNP	ENST00000471646.1	37	CCDS5429.1	SNP	25	Broad																																																																																				0.617	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3			Silent
MOGAT3	346606	broad.mit.edu	37	7	100839237	100839237	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr7:100839237G>T	ENST00000223114.4	-	7	1182	c.1016C>A	c.(1015-1017)aCc>aAc	p.T339N	MOGAT3_ENST00000440203.2_3'UTR|MOGAT3_ENST00000379423.3_Missense_Mutation_p.H271Q	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	339					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.T339N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					CTAGATGAAGGTGAGGCAGGT	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											72.0	71.0	72.0					7																	100839237		2203	4300	6503	100625957	SO:0001583	missense	346606			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.1016C>A	7.37:g.100839237G>T	ENSP00000223114:p.Thr339Asn	Unknown		x	x	x	100625957	Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	CCDS5714.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.11|17.11	3.304409|3.304409	0.60305|0.60305	.|.	.|.	ENSG00000106384|ENSG00000106384	ENST00000379423|ENST00000223114	T|T	0.29142|0.13778	1.58|2.56	5.03|5.03	2.07|2.07	0.26955|0.26955	.|.	.|0.728518	.|0.13675	.|N	.|0.370610	T|T	0.10165|0.10165	0.0249|0.0249	L|L	0.27975|0.27975	0.815|0.815	0.18873|0.18873	N|N	0.999985|0.999985	P|P	0.41102|0.43231	0.738|0.801	B|P	0.38562|0.45829	0.276|0.494	T|T	0.19353|0.19353	-1.0308|-1.0308	9|10	0.29301|0.20046	T|T	0.29|0.44	.|.	4.7954|4.7954	0.13270|0.13270	0.1957:0.1785:0.6258:0.0|0.1957:0.1785:0.6258:0.0	.|.	271|339	Q86VF5-2|Q86VF5	.|MOGT3_HUMAN	Q|N	271|339	ENSP00000368734:H271Q|ENSP00000223114:T339N	ENSP00000368734:H271Q|ENSP00000223114:T339N	H|T	-|-	3|2	2|0	MOGAT3|MOGAT3	100625957|100625957	0.001000|0.001000	0.12720|0.12720	0.918000|0.918000	0.36340|0.36340	0.022000|0.022000	0.10575|0.10575	0.208000|0.208000	0.17415|0.17415	1.130000|1.130000	0.42092|0.42092	0.644000|0.644000	0.83932|0.83932	CAC|ACC		0.592	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		Missense_Mutation
CCDC136	64753	broad.mit.edu	37	7	128445926	128445926	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr7:128445926C>T	ENST00000297788.4	+	7	1427	c.1060C>T	c.(1060-1062)Cgg>Tgg	p.R354W	CCDC136_ENST00000378685.4_Missense_Mutation_p.R392W|CCDC136_ENST00000464832.1_Missense_Mutation_p.R404W|CCDC136_ENST00000487361.1_Missense_Mutation_p.R354W	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	354						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R354W(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						TGAGGTGCTTCGGTTTCAGAC	0.607																																																1	Substitution - Missense(1)	ovary(1)	7																																								128233162	SO:0001583	missense	64753				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1060C>T	7.37:g.128445926C>T	ENSP00000297788:p.Arg354Trp	Unknown		x	x	x	128233162	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241073	0.79912	.	.	ENSG00000128596	ENST00000378685;ENST00000464832;ENST00000487361;ENST00000297788;ENST00000397697;ENST00000320524	T;T;T;T	0.51817	0.7;0.69;1.37;0.88	5.32	5.32	0.75619	.	0.176277	0.45867	D	0.000333	T	0.65923	0.2738	M	0.71581	2.175	0.51482	D	0.99992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	T	0.68614	-0.5362	10	0.72032	D	0.01	-26.2818	11.5641	0.50794	0.1784:0.8215:0.0:0.0	.	354;354;392	C9JE17;Q96JN2;Q96JN2-3	.;CC136_HUMAN;.	W	392;404;354;354;354;354	ENSP00000367956:R392W;ENSP00000419515:R404W;ENSP00000420509:R354W;ENSP00000297788:R354W	ENSP00000297788:R354W	R	+	1	2	CCDC136	128233162	0.840000	0.29493	0.995000	0.50966	0.990000	0.78478	1.531000	0.36018	2.504000	0.84457	0.655000	0.94253	CGG		0.607	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742		Missense_Mutation
ATG9B	285973	broad.mit.edu	37	7	150718288	150718288	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr7:150718288A>T	ENST00000377974.2	-	5	1025	c.950T>A	c.(949-951)cTg>cAg	p.L317Q	ATG9B_ENST00000444312.1_Missense_Mutation_p.C55S|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605952.1_Missense_Mutation_p.L317Q|ATG9B_ENST00000605938.1_Missense_Mutation_p.L317Q			Q674R7	ATG9B_HUMAN	autophagy related 9B	317					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)		p.L317Q(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGGATGTGCAGGGCCTCCCT	0.617																																																1	Substitution - Missense(1)	ovary(1)	7											55.0	65.0	62.0					7																	150718288		1962	4161	6123	150349221	SO:0001583	missense	285973			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.950T>A	7.37:g.150718288A>T	ENSP00000475005:p.Leu317Gln	Unknown		x	x	x	150349221	A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	ENST00000377974.2	37		SNP	7	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.69|16.69	3.194050|3.194050	0.58017|0.58017	.|.	.|.	ENSG00000248602|ENSG00000248602	ENST00000444312|ENST00000377974;ENST00000397266;ENST00000545613	.|.	.|.	.|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|0.155169	.|0.44483	.|D	.|0.000449	T|T	0.78566|0.78566	0.4303|0.4303	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.84727|0.84727	0.0743|0.0743	4|7	0.49607|0.87932	T|D	0.09|0	-11.7261|-11.7261	13.0516|13.0516	0.58958|0.58958	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|317	.|Q674R7	.|ATG9B_HUMAN	S|Q	55|317	.|.	ENSP00000441766:C55S|ENSP00000444232:L317Q	C|L	-|-	1|2	0|0	AC010973.1|AC010973.1	150349221|150349221	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	9.263000|9.263000	0.95617|0.95617	1.963000|1.963000	0.57068|0.57068	0.533000|0.533000	0.62120|0.62120	TGC|CTG		0.617	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681		Missense_Mutation
BMP1	649	broad.mit.edu	37	8	22064471	22064471	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr8:22064471A>T	ENST00000306385.5	+	17	3008	c.2338A>T	c.(2338-2340)Acc>Tcc	p.T780S	BMP1_ENST00000354870.5_3'UTR	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	780	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.T780S(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CATCTCCAGCACCCCCGGGCA	0.637																																																1	Substitution - Missense(1)	ovary(1)	8											75.0	58.0	64.0					8																	22064471		2203	4300	6503	22120416	SO:0001583	missense	649				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2338A>T	8.37:g.22064471A>T	ENSP00000305714:p.Thr780Ser	Unknown		x	x	x	22120416	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	37	CCDS6026.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	28.4	4.914489	0.92178	.	.	ENSG00000168487	ENST00000306385	T	0.27256	1.68	4.19	4.19	0.49359	CUB (5);	0.000000	0.39687	U	0.001296	T	0.40791	0.1131	L	0.49455	1.56	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.11179	-1.0598	10	0.21014	T	0.42	.	12.3802	0.55303	1.0:0.0:0.0:0.0	.	780	P13497	BMP1_HUMAN	S	780	ENSP00000305714:T780S	ENSP00000305714:T780S	T	+	1	0	BMP1	22120416	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.163000	0.77524	1.752000	0.51891	0.379000	0.24179	ACC		0.637	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132		Missense_Mutation
ZFHX4	79776	broad.mit.edu	37	8	77618158	77618158	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr8:77618158G>T	ENST00000521891.2	+	2	2283	c.1835G>T	c.(1834-1836)gGc>gTc	p.G612V	ZFHX4_ENST00000050961.6_Missense_Mutation_p.G612V|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G612V|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G612V|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G612V(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCGGGCAGTGGCATCGAGTGT	0.567										HNSCC(33;0.089)																																						1	Substitution - Missense(1)	ovary(1)	8											78.0	84.0	82.0					8																	77618158		2086	4209	6295	77780713	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1835G>T	8.37:g.77618158G>T	ENSP00000430497:p.Gly612Val	Unknown		x	x	x	77780713	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707075	0.68615	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55052	0.57;0.59;0.56;0.54	5.54	5.54	0.83059	.	0.000000	0.45361	U	0.000367	T	0.71307	0.3324	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.973;0.988;0.988;1.0	T	0.71984	-0.4427	10	0.87932	D	0	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	612;612;612;612	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	V	612	ENSP00000430497:G612V;ENSP00000399605:G612V;ENSP00000050961:G612V;ENSP00000430848:G612V	ENSP00000050961:G612V	G	+	2	0	ZFHX4	77780713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.249000	0.95470	2.884000	0.98904	0.655000	0.94253	GGC		0.567	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Missense_Mutation
MTBP	27085	broad.mit.edu	37	8	121531006	121531006	+	Silent	SNP	T	T	C			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr8:121531006T>C	ENST00000305949.1	+	20	2604	c.2559T>C	c.(2557-2559)tgT>tgC	p.C853C		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	853	Interaction with MDM2. {ECO:0000250}.				cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)		p.C853C(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			CTCATGAATGTTTCACTGCAT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	8											147.0	136.0	139.0					8																	121531006		2203	4300	6503	121600187	SO:0001819	synonymous_variant	27085				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.2559T>C	8.37:g.121531006T>C		Unknown		x	x	x	121600187	B4DUR5|Q9HA89	Silent	SNP	ENST00000305949.1	37	CCDS6333.1	SNP	60	Broad																																																																																				0.358	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045		Silent
SMC5	23137	broad.mit.edu	37	9	72897445	72897445	+	Silent	SNP	A	A	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr9:72897445A>T	ENST00000361138.5	+	7	985	c.927A>T	c.(925-927)cgA>cgT	p.R309R		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	309					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.R309R(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TAACATGTCGAATTGAAGAAA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	9											90.0	88.0	89.0					9																	72897445		2203	4300	6503	72087265	SO:0001819	synonymous_variant	23137			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.927A>T	9.37:g.72897445A>T		Unknown		x	x	x	72087265	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	ENST00000361138.5	37	CCDS6632.1	SNP	9	Broad																																																																																				0.358	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110		Silent
TTF1	7270	broad.mit.edu	37	9	135263597	135263597	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr9:135263597C>A	ENST00000334270.2	-	8	2280	c.2241G>T	c.(2239-2241)aaG>aaT	p.K747N		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	747					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.K747N(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TAGTCATCCTCTTGGTTAGAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	9											86.0	80.0	82.0					9																	135263597		2203	4300	6503	134253418	SO:0001583	missense	7270			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.2241G>T	9.37:g.135263597C>A	ENSP00000333920:p.Lys747Asn	Unknown		x	x	x	134253418	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	CCDS6948.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445411	0.43429	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.11604	2.76	5.9	2.95	0.34219	SANT domain, DNA binding (1);Homeodomain-related (1);	0.156867	0.42172	D	0.000747	T	0.09024	0.0223	L	0.47716	1.5	0.29463	N	0.857607	P	0.38020	0.615	B	0.36186	0.219	T	0.14559	-1.0468	10	0.27082	T	0.32	.	7.2667	0.26234	0.0:0.7197:0.0:0.2803	.	747	Q15361	TTF1_HUMAN	N	747	ENSP00000333920:K747N	ENSP00000245588:K747N	K	-	3	2	TTF1	134253418	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.653000	0.24902	0.337000	0.23665	0.650000	0.86243	AAG		0.358	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344		Missense_Mutation
FAM47A	158724	broad.mit.edu	37	X	34148347	34148347	+	Silent	SNP	C	C	T			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chrX:34148347C>T	ENST00000346193.3	-	1	2100	c.2049G>A	c.(2047-2049)tcG>tcA	p.S683S		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	683								p.S683S(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TATAAGAATTCGATGGCGTGT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	X											82.0	80.0	81.0					X																	34148347		2202	4300	6502	34058268	SO:0001819	synonymous_variant	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2049G>A	X.37:g.34148347C>T		Unknown		x	x	x	34058268	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1	SNP	31	Broad																																																																																				0.443	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		Silent
PAPPA2	60676	broad.mit.edu	37	1	176760585	176760594	+	Frame_Shift_Del	DEL	GTGGAGTACA	GTGGAGTACA	-			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr1:176760585_176760594delGTGGAGTACA	ENST00000367662.3	+	19	6151_6160	c.4987_4996delGTGGAGTACA	c.(4987-4998)gtggagtacaaafs	p.VEYK1663fs		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1663	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E1664D(1)|p.V1663fs*17(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GCTGAATTCTGTGGAGTACAAATGTGAACA	0.414																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	1																																								175027217	SO:0001589	frameshift_variant	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4987_4996delGTGGAGTACA	1.37:g.176760585_176760594delGTGGAGTACA	ENSP00000356634:p.Val1663fs	Unknown		Capture	Illumina GAIIx	Phase_I	175027208	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Frame_Shift_Del	DEL	ENST00000367662.3	37	CCDS41438.1	DEL	48	Broad																																																																																				0.414	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			Frame_Shift_Del
ETFDH	2110	broad.mit.edu	37	4	159627795	159627804	+	Frame_Shift_Del	DEL	CGGCTCAAGC	CGGCTCAAGC	-			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr4:159627795_159627804delCGGCTCAAGC	ENST00000511912.1	+	12	1815_1824	c.1483_1492delCGGCTCAAGC	c.(1483-1494)cggctcaagccafs	p.RLKP495fs	ETFDH_ENST00000307738.5_Frame_Shift_Del_p.RLKP448fs	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	495					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)	p.R495L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		TGACTTTGAACGGCTCAAGCCAGCCAAGGA	0.371																																																1	Substitution - Missense(1)	lung(1)	4																																								159847254	SO:0001589	frameshift_variant	2110			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.1483_1492delCGGCTCAAGC	4.37:g.159627795_159627804delCGGCTCAAGC	ENSP00000426638:p.Arg495fs	Unknown		Capture	Illumina GAIIx	Phase_I	159847245	B4E3R9|J3KND9|Q7Z347	Frame_Shift_Del	DEL	ENST00000511912.1	37	CCDS3800.1	DEL	19	Broad																																																																																				0.371	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365718.2			Frame_Shift_Del
PCDHGC3	5098	broad.mit.edu	37	5	140855822	140855830	+	In_Frame_Del	DEL	GTGGGCAAC	GTGGGCAAC	-			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr5:140855822_140855830delGTGGGCAAC	ENST00000308177.3	+	1	243_251	c.139_147delGTGGGCAAC	c.(139-147)gtgggcaacdel	p.VGN47del	PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	47	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G48A(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTTTCGCTGTGGGCAACGTGGTCGCGA	0.565																																																2	Substitution - Missense(2)	large_intestine(2)	5																																								140836014	SO:0001651	inframe_deletion	5098			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.139_147delGTGGGCAAC	5.37:g.140855822_140855830delGTGGGCAAC	ENSP00000312070:p.Val47_Asn49del	Unknown		Capture	Illumina GAIIx	Phase_I	140836006	O60622|Q08192|Q9Y5C4	In_Frame_Del	DEL	ENST00000308177.3	37	CCDS4261.1	DEL	48	Broad																																																																																				0.565	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588		In_Frame_Del
TRIM27	5987	broad.mit.edu	37	6	28872365	28872365	+	Frame_Shift_Del	DEL	A	A	-			TCGA-24-2290-01	TCGA-24-2290-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2290-01	TCGA-24-2290-10	g.chr6:28872365delA	ENST00000377199.3	-	8	1380	c.1024delT	c.(1024-1026)tacfs	p.Y342fs	TRIM27_ENST00000377194.3_Frame_Shift_Del_p.Y342fs	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	342	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y342fs*34(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TGTTGGAGGTAACTGTACCGC	0.552			T	RET	papillary thyroid																																		Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	1	Deletion - Frameshift(1)	ovary(1)	6											52.0	55.0	54.0					6																	28872365		1510	2709	4219	28980344	SO:0001589	frameshift_variant	5987			Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.1024delT	6.37:g.28872365delA	ENSP00000366404:p.Tyr342fs	Unknown		Capture	Illumina GAIIx	Phase_I	28980344	A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Frame_Shift_Del	DEL	ENST00000377199.3	37	CCDS4654.1	DEL	13	Broad																																																																																				0.552	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950		Frame_Shift_Del
