#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
UBR4	23352	broad.mit.edu	37	1	19420498	19420498	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:19420498C>A	ENST00000375254.3	-	95	13909	c.13882G>T	c.(13882-13884)Gtg>Ttg	p.V4628L	UBR4_ENST00000375226.2_Missense_Mutation_p.V4604L|UBR4_ENST00000429347.2_Missense_Mutation_p.V151L|UBR4_ENST00000467272.2_5'UTR|UBR4_ENST00000375267.2_Missense_Mutation_p.V4628L|UBR4_ENST00000375224.1_Missense_Mutation_p.V335L|UBR4_ENST00000543981.1_Missense_Mutation_p.V292L|UBR4_ENST00000375217.2_Missense_Mutation_p.V4621L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4628					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V4628L(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ATTTTCTCCACCTCTCCAAAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	88.0	91.0					1																	19420498		2203	4300	6503	19293085	SO:0001583	missense	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.13882G>T	1.37:g.19420498C>A	ENSP00000364403:p.Val4628Leu	Unknown		x	x	x	19293085	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300379	0.40694	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375224;ENST00000429347;ENST00000543981	T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.87	-0.291	0.12843	.	0.410858	0.25961	N	0.027186	T	0.16769	0.0403	L	0.34521	1.04	0.33846	D	0.632032	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.06092	-1.0846	10	0.35671	T	0.21	.	3.0866	0.06279	0.1675:0.1991:0.4998:0.1337	.	292;151;4628;4604	B4DYV5;B4DPF6;Q5T4S7;Q5T4S7-3	.;.;UBR4_HUMAN;.	L	4628;4628;4621;4604;335;151;292	ENSP00000364403:V4628L;ENSP00000364416:V4628L;ENSP00000364365:V4621L;ENSP00000364374:V4604L;ENSP00000364372:V335L;ENSP00000394173:V151L;ENSP00000444070:V292L	ENSP00000364365:V4621L	V	-	1	0	UBR4	19293085	0.481000	0.25941	0.991000	0.47740	0.985000	0.73830	0.207000	0.17395	0.056000	0.16144	0.591000	0.81541	GTG		0.463	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		Missense_Mutation
SRRM1	10250	broad.mit.edu	37	1	24989267	24989267	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:24989267C>T	ENST00000323848.9	+	12	1915	c.1600C>T	c.(1600-1602)Cga>Tga	p.R534*	SRRM1_ENST00000447431.2_Nonsense_Mutation_p.R532*|SRRM1_ENST00000537199.1_3'UTR|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Nonsense_Mutation_p.R529*	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	534	Arg-rich.|Necessary for speckles and matrix localization.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R534*(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TCCATCACCACGAAAGCGCCA	0.473																																					Ovarian(68;897 1494 3282 17478)											1	Substitution - Nonsense(1)	ovary(1)	1											107.0	98.0	101.0					1																	24989267		2203	4300	6503	24861854	SO:0001587	stop_gained	10250			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1600C>T	1.37:g.24989267C>T	ENSP00000326261:p.Arg534*	Unknown		x	x	x	24861854	O60585|Q5VVN4	Nonsense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.324184	0.98759	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	.	.	.	5.41	2.34	0.29019	.	0.000000	0.48767	D	0.000164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.1198	14.4016	0.67050	0.3869:0.6131:0.0:0.0	.	.	.	.	X	534;532;529	.	ENSP00000326261:R534X	R	+	1	2	SRRM1	24861854	0.999000	0.42202	0.999000	0.59377	0.986000	0.74619	2.237000	0.43061	0.277000	0.22141	-0.182000	0.12963	CGA		0.473	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839		Nonsense_Mutation
TMEM200B	399474	broad.mit.edu	37	1	29447620	29447620	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:29447620T>A	ENST00000420504.2	-	2	878	c.721A>T	c.(721-723)Act>Tct	p.T241S	TMEM200B_ENST00000521452.1_Missense_Mutation_p.T241S	NM_001171868.1	NP_001165339.1	Q69YZ2	T200B_HUMAN	transmembrane protein 200B	241						integral component of membrane (GO:0016021)		p.T241S(1)		ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.00765)|Lung NSC(340;0.0153)|all_lung(284;0.0173)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;7.32e-08)|COAD - Colon adenocarcinoma(152;4.92e-06)|STAD - Stomach adenocarcinoma(196;0.00618)|BRCA - Breast invasive adenocarcinoma(304;0.0501)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.126)		ACATGGCCAGTCTGCGTCCGT	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											30.0	33.0	32.0					1																	29447620		2203	4300	6503	29320207	SO:0001583	missense	399474				CCDS30658.1	1p35	2007-12-18			ENSG00000253304	ENSG00000253304			33785	protein-coding gene	gene with protein product						15722956	Standard	NM_001003682		Approved	TTMB	uc001brn.2	Q69YZ2	OTTHUMG00000003658	ENST00000420504.2:c.721A>T	1.37:g.29447620T>A	ENSP00000428544:p.Thr241Ser	Unknown		x	x	x	29320207	Q6P2G8|Q6P2Q5	Missense_Mutation	SNP	ENST00000420504.2	37	CCDS30658.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	7.218	0.596710	0.13875	.	.	ENSG00000253304	ENST00000521452;ENST00000420504	.	.	.	4.15	-1.71	0.08133	.	1.013390	0.07945	U	0.979933	T	0.11623	0.0283	N	0.03608	-0.345	0.23716	N	0.997037	B	0.06786	0.001	B	0.04013	0.001	T	0.30031	-0.9992	9	0.07175	T	0.84	.	2.8141	0.05451	0.1303:0.0827:0.2673:0.5197	.	241	Q69YZ2	T200B_HUMAN	S	241	.	ENSP00000428544:T241S	T	-	1	0	TMEM200B	29320207	0.928000	0.31464	0.998000	0.56505	0.976000	0.68499	-0.199000	0.09491	-0.073000	0.12842	0.533000	0.62120	ACT		0.637	TMEM200B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010377.2	NM_001003682		Missense_Mutation
THRAP3	9967	broad.mit.edu	37	1	36758206	36758206	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:36758206C>A	ENST00000354618.5	+	7	2150	c.1926C>A	c.(1924-1926)caC>caA	p.H642Q	THRAP3_ENST00000466743.1_3'UTR|THRAP3_ENST00000469141.2_Missense_Mutation_p.H642Q	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	642	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.H642Q(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CAGAGCATCACTTTGGGTCCT	0.478			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	1	Substitution - Missense(1)	ovary(1)	1											188.0	190.0	189.0					1																	36758206		2203	4300	6503	36530793	SO:0001583	missense	9967			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1926C>A	1.37:g.36758206C>A	ENSP00000346634:p.His642Gln	Unknown		x	x	x	36530793	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	37	CCDS405.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742243	0.69418	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.16324	2.35;2.35	5.22	4.29	0.51040	.	0.132701	0.52532	D	0.000074	T	0.35624	0.0938	M	0.68952	2.095	0.58432	D	0.999992	D	0.71674	0.998	D	0.69479	0.964	T	0.04708	-1.0932	10	0.72032	D	0.01	-6.0117	10.2489	0.43358	0.0:0.8434:0.0:0.1566	.	642	Q9Y2W1	TR150_HUMAN	Q	642	ENSP00000346634:H642Q;ENSP00000433825:H642Q	ENSP00000346634:H642Q	H	+	3	2	THRAP3	36530793	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.700000	0.25601	2.608000	0.88229	0.555000	0.69702	CAC		0.478	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119		Missense_Mutation
MTF2	22823	broad.mit.edu	37	1	93580643	93580643	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:93580643A>C	ENST00000370298.4	+	5	770	c.481A>C	c.(481-483)Aag>Cag	p.K161Q	MTF2_ENST00000545708.1_Missense_Mutation_p.K59Q|MTF2_ENST00000370303.4_Missense_Mutation_p.K161Q|MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000540243.1_Missense_Mutation_p.K59Q	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	161					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.K161Q(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		AACAACAACAAAGGTATATTT	0.353																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	84.0	85.0					1																	93580643		2203	4300	6503	93353231	SO:0001583	missense	22823			AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.481A>C	1.37:g.93580643A>C	ENSP00000359321:p.Lys161Gln	Unknown		x	x	x	93353231	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	ENST00000370298.4	37	CCDS742.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	20.6	4.011006	0.75046	.	.	ENSG00000143033	ENST00000545708;ENST00000540243;ENST00000370298;ENST00000537953;ENST00000370303	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.35	5.35	0.76521	Zinc finger, FYVE/PHD-type (1);	0.044063	0.85682	D	0.000000	D	0.92831	0.7720	M	0.78637	2.42	0.80722	D	1	D;P	0.76494	0.999;0.757	D;B	0.73380	0.98;0.418	D	0.92890	0.6330	10	0.46703	T	0.11	-7.0074	15.3456	0.74334	1.0:0.0:0.0:0.0	.	161;161	B1AKT6;Q9Y483	.;MTF2_HUMAN	Q	59;59;161;59;161	ENSP00000444962:K59Q;ENSP00000443295:K59Q;ENSP00000359321:K161Q;ENSP00000359326:K161Q	ENSP00000359321:K161Q	K	+	1	0	MTF2	93353231	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	5.691000	0.68249	2.023000	0.59567	0.533000	0.62120	AAG		0.353	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358		Missense_Mutation
COL11A1	1301	broad.mit.edu	37	1	103404627	103404627	+	Silent	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:103404627C>T	ENST00000370096.3	-	44	3714	c.3402G>A	c.(3400-3402)ccG>ccA	p.P1134P	COL11A1_ENST00000358392.2_Silent_p.P1146P|COL11A1_ENST00000353414.4_Silent_p.P1095P|COL11A1_ENST00000512756.1_Silent_p.P1018P	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1134	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.P1146P(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTTTTTGTCCCGGCTCACCAA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	1											142.0	144.0	143.0					1																	103404627		2203	4300	6503	103177215	SO:0001819	synonymous_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3402G>A	1.37:g.103404627C>T		Unknown		x	x	x	103177215	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1	SNP	23	Broad																																																																																				0.338	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		Silent
CELSR2	1952	broad.mit.edu	37	1	109794172	109794172	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:109794172G>C	ENST00000271332.3	+	1	1532	c.1471G>C	c.(1471-1473)Gtg>Ctg	p.V491L		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	491	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.V491L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CTCTGGCTTGGTGACAGTACA	0.567																																					NSCLC(158;1285 2011 34800 34852 42084)											1	Substitution - Missense(1)	ovary(1)	1											171.0	153.0	159.0					1																	109794172		2203	4300	6503	109595695	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1471G>C	1.37:g.109794172G>C	ENSP00000271332:p.Val491Leu	Unknown		x	x	x	109595695	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	N	12.70	2.017886	0.35606	.	.	ENSG00000143126	ENST00000271332	T	0.64803	-0.12	4.82	4.82	0.62117	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70448	0.3225	M	0.65677	2.01	0.53005	D	0.999966	P	0.51147	0.942	D	0.64687	0.928	T	0.66019	-0.6027	9	0.28530	T	0.3	.	18.1629	0.89716	0.0:0.0:1.0:0.0	.	491	Q9HCU4	CELR2_HUMAN	L	491	ENSP00000271332:V491L	ENSP00000271332:V491L	V	+	1	0	CELSR2	109595695	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.601000	0.98297	2.543000	0.85770	0.555000	0.69702	GTG		0.567	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		Missense_Mutation
INSRR	3645	broad.mit.edu	37	1	156818728	156818728	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:156818728A>C	ENST00000368195.3	-	7	1952	c.1556T>G	c.(1555-1557)gTg>gGg	p.V519G	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	519	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTTGTAGTACACGATGAAGCT	0.672																																																0			1											14.0	14.0	14.0					1																	156818728		2194	4297	6491	155085352	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1556T>G	1.37:g.156818728A>C	ENSP00000357178:p.Val519Gly	Unknown		x	x	x	155085352	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	25.8	4.673025	0.88445	.	.	ENSG00000027644	ENST00000368195	T	0.75821	-0.97	4.61	4.61	0.57282	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.41938	D	0.000788	T	0.81650	0.4867	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	D	0.84824	0.0798	9	0.87932	D	0	.	12.9758	0.58537	1.0:0.0:0.0:0.0	.	519	P14616	INSRR_HUMAN	G	519	ENSP00000357178:V519G	ENSP00000357178:V519G	V	-	2	0	INSRR	155085352	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.045000	0.93812	1.945000	0.56424	0.459000	0.35465	GTG		0.672	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		Missense_Mutation
CACNA1E	777	broad.mit.edu	37	1	181764036	181764036	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:181764036T>C	ENST00000367573.2	+	46	6064	c.6064T>C	c.(6064-6066)Tcc>Ccc	p.S2022P	CACNA1E_ENST00000526775.1_Missense_Mutation_p.S1960P|CACNA1E_ENST00000360108.3_Missense_Mutation_p.S2003P|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S1979P|CACNA1E_ENST00000367567.4_Missense_Mutation_p.S1586P|CACNA1E_ENST00000358338.5_Missense_Mutation_p.S1911P|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S1973P	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2022					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.S1979P(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACGTTCATTTTCCACTATTCG	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	74.0	75.0					1																	181764036		1904	4133	6037	180030659	SO:0001583	missense	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6064T>C	1.37:g.181764036T>C	ENSP00000356545:p.Ser2022Pro	Unknown		x	x	x	180030659	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	28.0	4.880059	0.91740	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.99226	-5.42;-5.39;-5.31;-5.39;-5.59;-5.31;-5.32	5.91	5.91	0.95273	.	0.607102	0.18764	N	0.131787	D	0.99099	0.9690	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.988;0.994	D	0.99871	1.1096	10	0.87932	D	0	.	16.0098	0.80391	0.0:0.0:0.0:1.0	.	1960;1979	Q15878-2;Q15878-3	.;.	P	1979;1960;1973;1911;1586;2003;2022	ENSP00000356542:S1979P;ENSP00000434814:S1960P;ENSP00000350183:S1973P;ENSP00000351101:S1911P;ENSP00000356539:S1586P;ENSP00000353222:S2003P;ENSP00000356545:S2022P	ENSP00000350183:S1973P	S	+	1	0	CACNA1E	180030659	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.999000	0.76283	2.254000	0.74563	0.533000	0.62120	TCC		0.463	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		Missense_Mutation
RABIF	5877	broad.mit.edu	37	1	202858175	202858175	+	Silent	SNP	G	G	T	rs375439968		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:202858175G>T	ENST00000367262.3	-	1	88	c.52C>A	c.(52-54)Cgg>Agg	p.R18R		NM_002871.4	NP_002862.2	P47224	MSS4_HUMAN	RAB interacting factor	18					membrane fusion (GO:0061025)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|zinc ion binding (GO:0008270)	p.R18R(1)		large_intestine(1)|lung(2)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(75;0.166)			ACCGCCTTCCGGTTTCGGCCC	0.682																																																1	Substitution - coding silent(1)	ovary(1)	1						G		1,4405		0,1,2202	31.0	30.0	30.0		52	2.6	1.0	1		30	2,8596		0,2,4297	no	coding-synonymous	RABIF	NM_002871.3		0,3,6499	TT,TG,GG		0.0233,0.0227,0.0231		18/124	202858175	3,13001	2203	4299	6502	201124798	SO:0001819	synonymous_variant	5877			S78873	CCDS1428.1	1q32.1	2008-05-14			ENSG00000183155	ENSG00000183155			9797	protein-coding gene	gene with protein product		603417		RASGRF3		9441742, 7619808	Standard	NM_002871		Approved	mss4	uc001gyl.3	P47224	OTTHUMG00000041400	ENST00000367262.3:c.52C>A	1.37:g.202858175G>T		Unknown		x	x	x	201124798	B2R4P4|Q92992	Silent	SNP	ENST00000367262.3	37	CCDS1428.1	SNP	39	Broad																																																																																				0.682	RABIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099183.1			Silent
C1orf95	375057	broad.mit.edu	37	1	226784601	226784601	+	Missense_Mutation	SNP	C	C	G	rs563902383		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:226784601C>G	ENST00000366788.3	+	2	406	c.301C>G	c.(301-303)Ctc>Gtc	p.L101V	C1orf95_ENST00000366789.4_Missense_Mutation_p.L101V	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	101						integral component of membrane (GO:0016021)		p.L101V(1)		large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		TGCAGCAGCCCTCATCCAAAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											164.0	141.0	149.0					1																	226784601		2203	4300	6503	224851224	SO:0001583	missense	375057			AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.301C>G	1.37:g.226784601C>G	ENSP00000355752:p.Leu101Val	Unknown		x	x	x	224851224	A6NGL2	Missense_Mutation	SNP	ENST00000366788.3	37	CCDS31044.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967367	0.34754	.	.	ENSG00000203685	ENST00000366788;ENST00000366789	.	.	.	5.68	5.68	0.88126	.	0.248844	0.33813	N	0.004535	T	0.40347	0.1113	N	0.04203	-0.255	0.40848	D	0.983729	B	0.19331	0.035	B	0.16289	0.015	T	0.34527	-0.9825	9	0.59425	D	0.04	-0.2382	19.3828	0.94543	0.0:1.0:0.0:0.0	.	101	Q69YW2	CA095_HUMAN	V	101	.	ENSP00000355752:L101V	L	+	1	0	C1orf95	224851224	0.983000	0.35010	1.000000	0.80357	0.927000	0.56198	2.480000	0.45206	2.669000	0.90835	0.561000	0.74099	CTC		0.587	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091634.1	NM_001003665		Missense_Mutation
OR11L1	391189	broad.mit.edu	37	1	248005089	248005089	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr1:248005089A>T	ENST00000355784.2	-	1	165	c.110T>A	c.(109-111)cTg>cAg	p.L37Q		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	37						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L37Q(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TATAATGGTCAGGCAGTAGAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	62.0	65.0					1																	248005089		2203	4300	6503	246071712	SO:0001583	missense	391189			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.110T>A	1.37:g.248005089A>T	ENSP00000348033:p.Leu37Gln	Unknown		x	x	x	246071712		Missense_Mutation	SNP	ENST00000355784.2	37	CCDS31098.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	9.254	1.041600	0.19669	.	.	ENSG00000197591	ENST00000355784	T	0.00453	7.33	4.2	4.2	0.49525	.	0.000000	0.32578	U	0.005916	T	0.01287	0.0042	M	0.92507	3.315	0.09310	N	1	D	0.76494	0.999	D	0.67231	0.95	T	0.26360	-1.0105	10	0.72032	D	0.01	.	6.7874	0.23682	0.8198:0.0:0.1802:0.0	.	37	Q8NGX0	O11L1_HUMAN	Q	37	ENSP00000348033:L37Q	ENSP00000348033:L37Q	L	-	2	0	OR11L1	246071712	0.013000	0.17824	0.073000	0.20177	0.048000	0.14542	2.693000	0.47027	1.889000	0.54706	0.443000	0.29094	CTG		0.493	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959		Missense_Mutation
FAM21A	387680	broad.mit.edu	37	10	51889204	51889204	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr10:51889204G>A	ENST00000282633.5	+	29	3158	c.3113G>A	c.(3112-3114)cGt>cAt	p.R1038H	FAM21A_ENST00000399339.2_Missense_Mutation_p.R950H|FAM21A_ENST00000314664.7_Missense_Mutation_p.R976H|FAM21A_ENST00000351071.6_Missense_Mutation_p.R1017H	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	1038					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.R1038H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						AGAGGGAAGCGTAGACCGCAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	10											43.0	34.0	37.0					10																	51889204		1522	3040	4562	51559210	SO:0001583	missense	55747			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.3113G>A	10.37:g.51889204G>A	ENSP00000282633:p.Arg1038His	Unknown		x	x	x	51559210	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	37	CCDS41527.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	19.03	3.747754	0.69533	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.78381	0.4274	M	0.80847	2.515	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.998;1.0;0.998	T	0.81669	-0.0828	9	0.87932	D	0	-8.7047	12.3184	0.54971	0.0:0.0:1.0:0.0	.	976;1017;950;1038;932	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	H	1017;976;932;1038;950	.	ENSP00000282633:R1038H	R	+	2	0	FAM21A	51559210	1.000000	0.71417	0.999000	0.59377	0.509000	0.34042	8.505000	0.90515	2.011000	0.59026	0.184000	0.17185	CGT		0.522	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751		Missense_Mutation
LCOR	84458	broad.mit.edu	37	10	98715146	98715146	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr10:98715146C>T	ENST00000371097.4	+	8	1315	c.769C>T	c.(769-771)Caa>Taa	p.Q257*	LCOR_ENST00000356016.3_Nonsense_Mutation_p.Q257*|LCOR_ENST00000498444.1_Intron|LCOR_ENST00000371103.3_Nonsense_Mutation_p.Q257*|LCOR_ENST00000540664.1_Nonsense_Mutation_p.Q257*			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	257					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		AAAGATACCACAAGTTCGAGG	0.428																																																0			10											82.0	83.0	83.0					10																	98715146		2203	4300	6503	98705136	SO:0001587	stop_gained	84458				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.769C>T	10.37:g.98715146C>T	ENSP00000360138:p.Gln257*	Unknown		x	x	x	98705136	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Nonsense_Mutation	SNP	ENST00000371097.4	37	CCDS7451.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	38	7.280076	0.98182	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-2.9509	19.1864	0.93645	0.0:1.0:0.0:0.0	.	.	.	.	X	257	.	ENSP00000348298:Q257X	Q	+	1	0	LCOR	98705136	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.606000	0.88127	0.650000	0.86243	CAA		0.428	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2			Nonsense_Mutation
OR4C12	283093	broad.mit.edu	37	11	50003470	50003470	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:50003470T>G	ENST00000335238.4	-	1	601	c.568A>C	c.(568-570)Act>Cct	p.T190P		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T190P(1)		NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						AGGGTATGAGTGTCTATGCAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	102.0	102.0					11																	50003470		2201	4296	6497	49960046	SO:0001583	missense	283093			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.568A>C	11.37:g.50003470T>G	ENSP00000334418:p.Thr190Pro	Unknown		x	x	x	49960046	B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	37	CCDS31496.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	.	14.29	2.491060	0.44249	.	.	ENSG00000221954	ENST00000335238	T	0.00245	8.45	2.98	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	U	0.000593	T	0.00524	0.0017	M	0.83223	2.63	0.31050	N	0.715351	D	0.76494	0.999	D	0.80764	0.994	T	0.20306	-1.0279	10	0.87932	D	0	.	9.5014	0.39019	0.0:0.0:0.0:1.0	.	190	Q96R67	OR4CC_HUMAN	P	190	ENSP00000334418:T190P	ENSP00000334418:T190P	T	-	1	0	OR4C12	49960046	0.988000	0.35896	0.841000	0.33234	0.563000	0.35712	2.813000	0.48002	1.387000	0.46486	0.325000	0.21440	ACT		0.413	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270		Missense_Mutation
OR5M3	219482	broad.mit.edu	37	11	56237479	56237479	+	Silent	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:56237479G>A	ENST00000312240.2	-	1	535	c.495C>T	c.(493-495)taC>taT	p.Y165Y		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y165Y(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TTCCACAGAAGTACAAGCCGT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	11											108.0	98.0	101.0					11																	56237479		2201	4295	6496	55994055	SO:0001819	synonymous_variant	219482			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.495C>T	11.37:g.56237479G>A		Unknown		x	x	x	55994055	B2RNM7|Q6IEW4|Q96RC0	Silent	SNP	ENST00000312240.2	37	CCDS31532.1	SNP	36	Broad																																																																																				0.398	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		Silent
RIN1	9610	broad.mit.edu	37	11	66100843	66100843	+	Silent	SNP	G	G	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:66100843G>C	ENST00000311320.4	-	9	1887	c.1761C>G	c.(1759-1761)gcC>gcG	p.A587A	RIN1_ENST00000424433.2_Silent_p.A482A|RIN1_ENST00000530056.1_Silent_p.A421A|RIN1_ENST00000524804.1_5'UTR|RP11-867G23.12_ENST00000526655.1_RNA	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	587	Ras and 14-3-3 protein binding region.|VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.A587A(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CACTCAGCAGGGCCAGGCTGG	0.697																																																1	Substitution - coding silent(1)	ovary(1)	11											23.0	29.0	27.0					11																	66100843		2200	4294	6494	65857419	SO:0001819	synonymous_variant	9610			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.1761C>G	11.37:g.66100843G>C		Unknown		x	x	x	65857419	O15010|Q00427|Q96CC8	Silent	SNP	ENST00000311320.4	37	CCDS31614.1	SNP	43	Broad																																																																																				0.697	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2	NM_004292		Silent
TCIRG1	10312	broad.mit.edu	37	11	67812501	67812501	+	Missense_Mutation	SNP	G	G	T	rs369983011		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:67812501G>T	ENST00000265686.3	+	10	1205	c.1097G>T	c.(1096-1098)cGc>cTc	p.R366L	TCIRG1_ENST00000532635.1_Missense_Mutation_p.R150L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	366					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.R366L(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CGCACCAACCGCTTCACGGCC	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											101.0	87.0	91.0					11																	67812501		2200	4294	6494	67569077	SO:0001583	missense	10312			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1097G>T	11.37:g.67812501G>T	ENSP00000265686:p.Arg366Leu	Unknown		x	x	x	67569077	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558733	0.65538	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.86297	-2.1;-2.1	4.07	4.07	0.47477	.	0.382752	0.27618	N	0.018573	D	0.82944	0.5147	M	0.61703	1.905	0.31310	N	0.687256	B	0.16166	0.016	B	0.17433	0.018	T	0.81306	-0.0992	10	0.87932	D	0	-22.3153	6.0956	0.20019	0.2085:0.0:0.7915:0.0	.	366	Q13488	VPP3_HUMAN	L	366;150	ENSP00000265686:R366L;ENSP00000434407:R150L	ENSP00000265686:R366L	R	+	2	0	TCIRG1	67569077	0.997000	0.39634	1.000000	0.80357	0.600000	0.36913	2.361000	0.44160	2.119000	0.64992	0.462000	0.41574	CGC		0.667	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019		Missense_Mutation
MAML2	84441	broad.mit.edu	37	11	95825192	95825192	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:95825192G>T	ENST00000524717.1	-	2	3287	c.2003C>A	c.(2002-2004)tCt>tAt	p.S668Y		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	668					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				ggcaggctgagaagatggttg	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0			11											52.0	53.0	53.0					11																	95825192		2195	4290	6485	95464840	SO:0001583	missense	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.2003C>A	11.37:g.95825192G>T	ENSP00000434552:p.Ser668Tyr	Unknown		x	x	x	95464840	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	37	CCDS44714.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	11.90	1.776842	0.31411	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.49139	0.79;0.79	5.44	3.53	0.40419	.	0.989823	0.08212	N	0.980541	T	0.38321	0.1036	L	0.36672	1.1	0.09310	N	1	B	0.19583	0.037	B	0.16722	0.016	T	0.32188	-0.9916	10	0.51188	T	0.08	-0.7671	6.7301	0.23379	0.0903:0.0:0.7343:0.1755	.	668	Q8IZL2	MAML2_HUMAN	Y	668	ENSP00000434552:S668Y;ENSP00000412394:S668Y	ENSP00000412394:S668Y	S	-	2	0	MAML2	95464840	0.917000	0.31117	0.000000	0.03702	0.004000	0.04260	4.485000	0.60279	0.625000	0.30304	-0.136000	0.14681	TCT		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1			Missense_Mutation
CASP5	838	broad.mit.edu	37	11	104877810	104877810	+	Splice_Site	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:104877810G>A	ENST00000260315.3	-	3	432	c.433C>T	c.(433-435)Cct>Tct	p.P145S	CASP5_ENST00000393141.2_Splice_Site_p.P158S|CASP5_ENST00000444749.2_Splice_Site_p.P87S|CASP5_ENST00000526056.1_Splice_Site_p.P158S|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000393139.2_Splice_Site_p.H112Y|CASP5_ENST00000418434.1_Intron			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	145	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.P129S(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GCAACCTTACGTTTTACACTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											175.0	176.0	176.0					11																	104877810		2201	4299	6500	104383020	SO:0001630	splice_region_variant	838				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.433+1C>T	11.37:g.104877810G>A		Unknown		x	x	x	104383020	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	CCDS8328.2	SNP	40	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	3.302|3.302	-0.142763|-0.142763	0.06669|0.06669	.|.	.|.	ENSG00000137757|ENSG00000137757	ENST00000393139|ENST00000393141;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000456094	T|T;T;T;T;T	0.23348|0.09817	1.91|4.71;4.72;4.6;4.71;2.94	3.71|3.71	0.818|0.818	0.18778|0.18778	.|DEATH-like (1);Caspase Recruitment (1);	.|0.436210	.|0.23629	.|N	.|0.046151	T|T	0.02688|0.02688	0.0081|0.0081	N|N	0.02011|0.02011	-0.69|-0.69	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.12630	.|0.003;0.005;0.006	.|B;B;B	.|0.09377	.|0.001;0.004;0.003	T|T	0.41360|0.41360	-0.9513|-0.9513	6|9	.|.	.|.	.|.	.|.	2.4859|2.4859	0.04598|0.04598	0.1901:0.5059:0.1966:0.1074|0.1901:0.5059:0.1966:0.1074	.|.	.|87;145;158	.|P51878-2;P51878;P51878-5	.|.;CASP5_HUMAN;.	Y|S	112|158;145;87;158;129	ENSP00000376847:H112Y|ENSP00000376849:P158S;ENSP00000260315:P145S;ENSP00000388365:P87S;ENSP00000436877:P158S;ENSP00000415241:P129S	.|.	H|P	-|-	1|1	0|0	CASP5|CASP5	104383020|104383020	0.773000|0.773000	0.28580|0.28580	0.247000|0.247000	0.24249|0.24249	0.000000|0.000000	0.00434|0.00434	0.075000|0.075000	0.14686|0.14686	0.196000|0.196000	0.20367|0.20367	-2.495000|-2.495000	0.00193|0.00193	CAT|CCT		0.393	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	Missense_Mutation	Missense_Mutation
DPAGT1	1798	broad.mit.edu	37	11	118971415	118971415	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:118971415A>G	ENST00000409993.2	-	5	1972	c.421T>C	c.(421-423)Ttc>Ctc	p.F141L	DPAGT1_ENST00000354202.4_Missense_Mutation_p.F141L|DPAGT1_ENST00000432443.2_Missense_Mutation_p.F34L|DPAGT1_ENST00000445653.1_5'UTR			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	141					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)	p.F141L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AAGTTGGTGAAATAGACCATG	0.552											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											75.0	60.0	65.0					11																	118971415		2200	4295	6495	118476625	SO:0001583	missense	1798			Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.421T>C	11.37:g.118971415A>G	ENSP00000386597:p.Phe141Leu	Unknown	1492	x	x	x	118476625	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	37	CCDS8411.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	22.6	4.311182	0.81358	.	.	ENSG00000172269	ENST00000409993;ENST00000354202;ENST00000432443	D;D;D	0.91894	-2.93;-2.93;-2.93	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.87617	0.6222	L	0.28556	0.865	0.80722	D	1	B;B	0.15141	0.011;0.012	B;B	0.21360	0.034;0.034	D	0.83611	0.0134	10	0.41790	T	0.15	-25.9921	14.8174	0.70045	1.0:0.0:0.0:0.0	.	34;141	E7EW40;Q9H3H5	.;GPT_HUMAN	L	141;141;34	ENSP00000386597:F141L;ENSP00000346142:F141L;ENSP00000404036:F34L	ENSP00000346142:F141L	F	-	1	0	DPAGT1	118476625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.090000	0.63153	0.460000	0.39030	TTC		0.552	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382		Missense_Mutation
CBL	867	broad.mit.edu	37	11	119148471	119148471	+	Silent	SNP	T	T	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr11:119148471T>C	ENST00000264033.4	+	7	1388	c.1012T>C	c.(1012-1014)Ttg>Ctg	p.L338L		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	338	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L338L(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		TTACAGCTATTTGTTTCCTGA	0.403			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																														"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	1	Substitution - coding silent(1)	ovary(1)	11											88.0	84.0	85.0					11																	119148471		2199	4295	6494	118653681	SO:0001819	synonymous_variant	867	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1012T>C	11.37:g.119148471T>C		Unknown		x	x	x	118653681	A3KMP8	Silent	SNP	ENST00000264033.4	37	CCDS8418.1	SNP	64	Broad																																																																																				0.403	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188		Silent
EPS8	2059	broad.mit.edu	37	12	15818705	15818705	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr12:15818705C>G	ENST00000281172.5	-	8	1157	c.721G>C	c.(721-723)Gcc>Ccc	p.A241P	EPS8_ENST00000543612.1_Missense_Mutation_p.A241P|EPS8_ENST00000543523.1_Missense_Mutation_p.A241P	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	241					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)	p.A241P(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CCTTGGTCGGCTGCCCATGCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	12											44.0	46.0	45.0					12																	15818705		2203	4300	6503	15709972	SO:0001583	missense	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.721G>C	12.37:g.15818705C>G	ENSP00000281172:p.Ala241Pro	Unknown		x	x	x	15709972	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	ENST00000281172.5	37	CCDS31753.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058574	0.36277	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000543223	T;T;T	0.06687	3.27;3.27;3.27	5.62	3.62	0.41486	.	0.404576	0.27181	N	0.020553	T	0.09818	0.0241	L	0.34521	1.04	0.80722	D	1	D	0.54047	0.964	P	0.50791	0.65	T	0.33137	-0.9880	10	0.19590	T	0.45	-10.8651	10.1683	0.42893	0.375:0.5025:0.1225:0.0	.	241	Q12929	EPS8_HUMAN	P	241	ENSP00000441867:A241P;ENSP00000281172:A241P;ENSP00000442388:A241P	ENSP00000281172:A241P	A	-	1	0	EPS8	15709972	0.928000	0.31464	1.000000	0.80357	0.987000	0.75469	1.069000	0.30641	1.303000	0.44873	0.591000	0.81541	GCC		0.522	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1			Missense_Mutation
KIF21A	55605	broad.mit.edu	37	12	39734074	39734074	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr12:39734074G>A	ENST00000361418.5	-	16	2218	c.2203C>T	c.(2203-2205)Ctt>Ttt	p.L735F	KIF21A_ENST00000395670.3_Missense_Mutation_p.L735F|KIF21A_ENST00000544797.2_Missense_Mutation_p.L722F|KIF21A_ENST00000361961.3_Missense_Mutation_p.L722F|KIF21A_ENST00000541463.2_Missense_Mutation_p.L722F			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	735					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L722F(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				GCTGCTTGAAGTCTCTGCAGT	0.358																																																1	Substitution - Missense(1)	ovary(1)	12											122.0	106.0	111.0					12																	39734074		2203	4297	6500	38020341	SO:0001583	missense	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2203C>T	12.37:g.39734074G>A	ENSP00000354878:p.Leu735Phe	Unknown		x	x	x	38020341	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	CCDS53776.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286887	0.80803	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463	T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13	5.22	4.33	0.51752	.	0.000000	0.47852	D	0.000214	T	0.44932	0.1317	M	0.72894	2.215	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.997;0.986;0.997;0.999	T	0.41342	-0.9514	10	0.52906	T	0.07	.	13.7255	0.62756	0.0741:0.0:0.9259:0.0	.	722;722;735;722;735	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3	.;.;KI21A_HUMAN;.;.	F	722;735;735;722;735;722	ENSP00000354851:L722F;ENSP00000379029:L735F;ENSP00000445606:L722F;ENSP00000354878:L735F;ENSP00000438075:L722F	ENSP00000344501:L735F	L	-	1	0	KIF21A	38020341	1.000000	0.71417	0.970000	0.41538	0.977000	0.68977	6.449000	0.73473	1.204000	0.43247	0.655000	0.94253	CTT		0.358	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641		Missense_Mutation
HEATR4	399671	broad.mit.edu	37	14	73958608	73958608	+	Intron	SNP	T	T	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr14:73958608T>C	ENST00000553558.1	-	17	3166				HEATR4_ENST00000334988.2_Intron|C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000560393.1_Intron	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		GGCTGCTCCCTGCGTCTCCTC	0.637																																																0			14											14.0	15.0	15.0					14																	73958608		1951	4130	6081	73028361	SO:0001627	intron_variant	79697			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2844+1161A>G	14.37:g.73958608T>C		Unknown		x	x	x	73028361	B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	CCDS9815.2	SNP	55	Broad																																																																																				0.637	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309		Missense_Mutation
CCDC88C	440193	broad.mit.edu	37	14	91776274	91776275	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr14:91776274_91776275CA>TG	ENST00000389857.6	-	16	2878_2879	c.2792_2793TG>CA	c.(2791-2793)cTG>cCA	p.L931P		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	931					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.L931P(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GTTCCTGGCTCAGCTTGTCCAG	0.594																																																1	Substitution - Missense(1)	ovary(1)	14																																								90846028	SO:0001583	missense	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2792_2793delinsTG	14.37:g.91776274_91776275delinsTG	ENSP00000374507:p.Leu931Pro	Unknown		x	x	x	90846027	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	DNP	ENST00000389857.6	37	CCDS45151.1	DNP	29	Broad																																																																																				0.594	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		Missense_Mutation
KIAA1024	23251	broad.mit.edu	37	15	79749909	79749909	+	Missense_Mutation	SNP	G	G	A	rs147416682	byFrequency	TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr15:79749909G>A	ENST00000305428.3	+	2	1495	c.1420G>A	c.(1420-1422)Gtg>Atg	p.V474M		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	474						integral component of membrane (GO:0016021)		p.V474M(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CACCAGTAGCGTGGGCACCCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	15						G	MET/VAL	1,4391	2.1+/-5.4	0,1,2195	69.0	63.0	65.0		1420	5.2	1.0	15	dbSNP_134	65	2,8584	2.2+/-6.3	0,2,4291	yes	missense	KIAA1024	NM_015206.2	21	0,3,6486	AA,AG,GG		0.0233,0.0228,0.0231	probably-damaging	474/917	79749909	3,12975	2196	4293	6489	77536964	SO:0001583	missense	23251			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1420G>A	15.37:g.79749909G>A	ENSP00000307461:p.Val474Met	Unknown		x	x	x	77536964	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858006	0.51376	2.28E-4	2.33E-4	ENSG00000169330	ENST00000305428	T	0.36878	1.23	5.24	5.24	0.73138	.	0.202473	0.43260	D	0.000595	T	0.59865	0.2225	M	0.67953	2.075	0.58432	D	0.999998	D	0.89917	1.0	D	0.76575	0.988	T	0.58612	-0.7606	9	.	.	.	.	18.8071	0.92041	0.0:0.0:1.0:0.0	.	474	Q9UPX6	K1024_HUMAN	M	474	ENSP00000307461:V474M	.	V	+	1	0	KIAA1024	77536964	1.000000	0.71417	0.992000	0.48379	0.193000	0.23685	6.858000	0.75461	2.440000	0.82611	0.491000	0.48974	GTG		0.537	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206		Missense_Mutation
SRRM2	23524	broad.mit.edu	37	16	2806458	2806458	+	Silent	SNP	T	T	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr16:2806458T>G	ENST00000301740.8	+	2	642	c.93T>G	c.(91-93)ggT>ggG	p.G31G		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	31					mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.G31G(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GCCGCCGGGGTGAGCGGCCTG	0.701																																																1	Substitution - coding silent(1)	ovary(1)	16																																								2746459	SO:0001819	synonymous_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.93T>G	16.37:g.2806458T>G		Unknown		x	x	x	2746459	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1	SNP	59	Broad																																																																																				0.701	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			Silent
DNAJA3	9093	broad.mit.edu	37	16	4493163	4493163	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr16:4493163C>T	ENST00000262375.6	+	6	1006	c.929C>T	c.(928-930)gCa>gTa	p.A310V	DNAJA3_ENST00000431375.2_Missense_Mutation_p.A157V|DNAJA3_ENST00000355296.4_Missense_Mutation_p.A310V	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	310					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)	p.A310V(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						CCTGTGCCTGCAGGTGGGTGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	16											64.0	53.0	56.0					16																	4493163		2197	4300	6497	4433164	SO:0001583	missense	9093			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.929C>T	16.37:g.4493163C>T	ENSP00000262375:p.Ala310Val	Unknown		x	x	x	4433164	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	ENST00000262375.6	37	CCDS10515.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.469121	0.96274	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.68181	-0.31;-0.3;0.65	5.6	5.6	0.85130	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	D	0.87826	0.6275	H	0.95437	3.67	0.80722	D	1	B;D;D	0.89917	0.041;1.0;1.0	B;D;D	0.83275	0.038;0.996;0.983	D	0.90536	0.4499	10	0.66056	D	0.02	-17.5732	18.9718	0.92718	0.0:1.0:0.0:0.0	.	157;310;310	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	V	310;310;157	ENSP00000262375:A310V;ENSP00000347445:A310V;ENSP00000393970:A157V	ENSP00000262375:A310V	A	+	2	0	DNAJA3	4433164	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.761000	0.85260	2.795000	0.96236	0.643000	0.83706	GCA		0.622	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1			Missense_Mutation
CLEC16A	23274	broad.mit.edu	37	16	11272427	11272427	+	Missense_Mutation	SNP	C	C	A	rs201102608		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr16:11272427C>A	ENST00000409790.1	+	24	3272	c.3042C>A	c.(3040-3042)gaC>gaA	p.D1014E	CLEC16A_ENST00000381822.2_Missense_Mutation_p.D101E	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.D1014E(1)|p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCCCAGTTGACCCCCACAGCC	0.697																																																2	Substitution - Missense(1)|Whole gene deletion(1)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	16											27.0	33.0	31.0					16																	11272427		2116	4224	6340	11179928	SO:0001583	missense	23274			AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.3042C>A	16.37:g.11272427C>A	ENSP00000387122:p.Asp1014Glu	Unknown		x	x	x	11179928		Missense_Mutation	SNP	ENST00000409790.1	37	CCDS45409.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	18.01	3.526928	0.64860	.	.	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000381822	T	0.53857	0.6	4.87	1.82	0.25136	.	0.049619	0.85682	D	0.000000	T	0.53465	0.1798	L	0.27053	0.805	0.30222	N	0.796761	D;B	0.67145	0.996;0.162	D;B	0.77557	0.99;0.042	T	0.52358	-0.8586	10	0.59425	D	0.04	-26.2881	6.833	0.23921	0.0:0.5884:0.0:0.4116	.	101;1014	Q2KHT3-3;Q2KHT3	.;CL16A_HUMAN	E	1014;1014;101	ENSP00000387122:D1014E	ENSP00000371244:D101E	D	+	3	2	CLEC16A	11179928	1.000000	0.71417	0.952000	0.39060	0.826000	0.46750	0.504000	0.22626	0.198000	0.20407	0.655000	0.94253	GAC		0.697	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		Missense_Mutation
FOXF1	2294	broad.mit.edu	37	16	86546531	86546531	+	Splice_Site	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr16:86546531G>A	ENST00000262426.4	+	2	1023	c.980G>A	c.(979-981)gGc>gAc	p.G327D		NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	327					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						CGCCTTGCAGGCATCCCGCGG	0.627																																																0			16											72.0	68.0	69.0					16																	86546531		2198	4300	6498	85104032	SO:0001630	splice_region_variant	2294			U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.980-1G>A	16.37:g.86546531G>A		Unknown		x	x	x	85104032	B2RAF4|Q5FWE5	Missense_Mutation	SNP	ENST00000262426.4	37	CCDS10957.2	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656354	0.88056	.	.	ENSG00000103241	ENST00000262426	D	0.98947	-5.26	4.88	3.85	0.44370	.	0.214566	0.38959	N	0.001504	D	0.98588	0.9528	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97940	1.0325	9	.	.	.	.	13.3179	0.60417	0.0:0.0:0.8414:0.1586	.	327	Q12946	FOXF1_HUMAN	D	327	ENSP00000262426:G327D	.	G	+	2	0	FOXF1	85104032	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	6.090000	0.71397	2.392000	0.81423	0.655000	0.94253	GGC		0.627	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	NM_001451	Missense_Mutation	Missense_Mutation
FOXF1	2294	broad.mit.edu	37	16	86546533	86546535	+	Missense_Mutation	TNP	ATC	ATC	TGT			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr16:86546533_86546535ATC>TGT	ENST00000262426.4	+	2	1025_1027	c.982_984ATC>TGT	c.(982-984)ATC>TGT	p.I328C		NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	328					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)	p.I303L(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						CCTTGCAGGCATCCCGCGGTATC	0.631																																																1	Substitution - Missense(1)	ovary(1)	16																																								85104036	SO:0001583	missense	2294			U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.982_984ATC>TGT	16.37:g.86546533ATC>TGT	ENSP00000262426:p.Ile328Cys	Unknown		x	x	x	85104034	B2RAF4|Q5FWE5	Missense_Mutation	TNP	ENST00000262426.4	37	CCDS10957.2	TNP	8	Broad																																																																																				0.631	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	NM_001451		Missense_Mutation
ACLY	47	broad.mit.edu	37	17	40070126	40070126	+	Start_Codon_SNP	SNP	T	T	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr17:40070126T>A	ENST00000352035.2	-	2	131	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	ACLY_ENST00000353196.1_Start_Codon_SNP_p.M1L|ACLY_ENST00000393896.2_Start_Codon_SNP_p.M1L|ACLY_ENST00000590151.1_Start_Codon_SNP_p.M1L|ACLY_ENST00000537919.1_Start_Codon_SNP_p.M1L	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.M1L(1)	NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TTGGCCGACATGGCTGCAGAG	0.557																																					Colon(64;807 1396 15971 30971)											1	Substitution - Missense(1)	ovary(1)	17											143.0	129.0	134.0					17																	40070126		2203	4300	6503	37323652	SO:0001582	initiator_codon_variant	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.1A>T	17.37:g.40070126T>A	ENSP00000253792:p.Met1Leu	Unknown		x	x	x	37323652	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	37	CCDS11412.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855271	0.91355	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.93366	-1.71;-1.69;-3.21;-1.69	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.96700	0.8923	.	.	.	0.80722	D	1	B;P;P;D;P	0.71674	0.167;0.734;0.734;0.998;0.734	B;P;P;D;P	0.80764	0.354;0.651;0.651;0.994;0.651	D	0.97379	0.9981	9	0.87932	D	0	.	15.5109	0.75782	0.0:0.0:0.0:1.0	.	1;55;55;1;1	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	L	1;55;1;1;1	ENSP00000253792:M1L;ENSP00000345398:M1L;ENSP00000445349:M1L;ENSP00000377474:M1L	ENSP00000253792:M1L	M	-	1	0	ACLY	37323652	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.782000	0.85680	2.122000	0.65172	0.460000	0.39030	ATG		0.557	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	Missense_Mutation	Missense_Mutation
STAT5A	6776	broad.mit.edu	37	17	40460263	40460263	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr17:40460263C>G	ENST00000345506.4	+	17	2616	c.1974C>G	c.(1972-1974)gaC>gaG	p.D658E	STAT5A_ENST00000452307.2_Missense_Mutation_p.D655E|STAT5A_ENST00000587646.1_Missense_Mutation_p.D146E|STAT5A_ENST00000590949.1_Missense_Mutation_p.D658E|STAT5A_ENST00000588868.1_Missense_Mutation_p.D627E|STAT5A_ENST00000546010.2_Missense_Mutation_p.D628E	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	658	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.D658E(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CCCTGGCTGACCGGCTGGGGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	17											73.0	66.0	68.0					17																	40460263		2203	4300	6503	37713789	SO:0001583	missense	6776			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1974C>G	17.37:g.40460263C>G	ENSP00000341208:p.Asp658Glu	Unknown		x	x	x	37713789	Q1KLZ6	Missense_Mutation	SNP	ENST00000345506.4	37	CCDS11424.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015753	0.75161	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.96716	-4.1;-4.1;-4.1	5.06	3.05	0.35203	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.96673	0.8914	L	0.53617	1.68	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.988;0.999;1.0;0.977;0.988	D;D;D;D;D	0.97110	0.958;1.0;0.995;0.951;0.933	D	0.95642	0.8699	10	0.54805	T	0.06	-45.3913	8.7536	0.34633	0.0:0.7673:0.0:0.2327	.	658;655;628;629;658	A8K6I5;Q8WWS9;Q1KLZ6;Q59GY7;P42229	.;.;.;.;STA5A_HUMAN	E	658;628;629;655	ENSP00000341208:D658E;ENSP00000443107:D628E;ENSP00000400320:D655E	ENSP00000341208:D658E	D	+	3	2	STAT5A	37713789	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.342000	0.33919	1.144000	0.42321	0.561000	0.74099	GAC		0.547	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152		Missense_Mutation
PRR11	55771	broad.mit.edu	37	17	57278973	57278973	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr17:57278973G>A	ENST00000262293.4	+	10	1376	c.1064G>A	c.(1063-1065)aGc>aAc	p.S355N	CTD-2510F5.6_ENST00000577660.1_Intron|CTD-2510F5.4_ENST00000577678.1_RNA	NM_018304.3	NP_060774.2	Q96HE9	PRR11_HUMAN	proline rich 11	355						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.S355N(1)		breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|pancreas(1)	16	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TCTACAAGCAGCTTTGATGAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	94.0	96.0					17																	57278973		2203	4300	6503	54633755	SO:0001583	missense	55771				CCDS11614.1	17q23.2	2005-12-13				ENSG00000068489			25619	protein-coding gene	gene with protein product		615920				11799066	Standard	NM_018304		Approved	FLJ11029	uc002ixf.2	Q96HE9		ENST00000262293.4:c.1064G>A	17.37:g.57278973G>A	ENSP00000262293:p.Ser355Asn	Unknown		x	x	x	54633755	Q9NUZ7|Q9NXE9	Missense_Mutation	SNP	ENST00000262293.4	37	CCDS11614.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316336	0.40996	.	.	ENSG00000068489	ENST00000262293	.	.	.	5.58	1.34	0.21922	.	0.309163	0.32161	N	0.006481	T	0.44393	0.1291	L	0.35723	1.085	0.36286	D	0.856077	B	0.13594	0.008	B	0.12156	0.007	T	0.41556	-0.9502	9	0.54805	T	0.06	-0.276	9.9481	0.41623	0.2788:0.0:0.7212:0.0	.	355	Q96HE9	PRR11_HUMAN	N	355	.	ENSP00000262293:S355N	S	+	2	0	PRR11	54633755	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.312000	0.43726	0.044000	0.15775	-0.258000	0.10820	AGC		0.408	PRR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445949.1	NM_018304		Missense_Mutation
BRIP1	83990	broad.mit.edu	37	17	59853910	59853910	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr17:59853910G>A	ENST00000259008.2	-	14	2216	c.1949C>T	c.(1948-1950)aCc>aTc	p.T650I	BRIP1_ENST00000583837.1_5'UTR|BRIP1_ENST00000577598.1_Missense_Mutation_p.T650I	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	650					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T650I(1)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						TGACCCAATGGTACCAACCCA	0.388			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	1	Substitution - Missense(1)	ovary(1)	17											112.0	111.0	111.0					17																	59853910		2203	4300	6503	57208692	SO:0001583	missense	83990			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1949C>T	17.37:g.59853910G>A	ENSP00000259008:p.Thr650Ile	Unknown		x	x	x	57208692	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	CCDS11631.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689852	0.88735	.	.	ENSG00000136492	ENST00000259008	T	0.74737	-0.87	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.80788	0.4690	L	0.35593	1.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.78265	-0.2271	9	.	.	.	-9.7187	18.8092	0.92052	0.0:0.0:1.0:0.0	.	650;650	C9JGZ0;Q9BX63	.;FANCJ_HUMAN	I	650	ENSP00000259008:T650I	.	T	-	2	0	BRIP1	57208692	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.850000	0.92190	2.683000	0.91414	0.655000	0.94253	ACC		0.388	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043		Missense_Mutation
ACE	1636	broad.mit.edu	37	17	61560912	61560912	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr17:61560912T>A	ENST00000290866.4	+	10	1603	c.1579T>A	c.(1579-1581)Tac>Aac	p.Y527N	ACE_ENST00000577647.1_5'Flank|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000413513.3_5'Flank|ACE_ENST00000584529.1_3'UTR|ACE_ENST00000421982.2_5'Flank|ACE_ENST00000538928.1_3'UTR|ACE_ENST00000428043.1_Missense_Mutation_p.Y527N|ACE_ENST00000490216.2_5'Flank	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	527	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.Y527N(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TGTGACACCATACATCAGGTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	108.0	111.0					17																	61560912		2203	4300	6503	58914644	SO:0001583	missense	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1579T>A	17.37:g.61560912T>A	ENSP00000290866:p.Tyr527Asn	Unknown		x	x	x	58914644	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	20.2	3.946237	0.73672	.	.	ENSG00000159640	ENST00000290866;ENST00000428043	T;T	0.59502	0.26;0.26	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.82360	0.5020	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86894	0.2050	10	0.87932	D	0	-29.2158	10.7458	0.46179	0.0:0.0766:0.0:0.9234	.	527;527	P12821-2;P12821	.;ACE_HUMAN	N	527	ENSP00000290866:Y527N;ENSP00000397593:Y527N	ENSP00000290866:Y527N	Y	+	1	0	ACE	58914644	1.000000	0.71417	0.979000	0.43373	0.815000	0.46073	5.422000	0.66453	2.056000	0.61249	0.374000	0.22700	TAC		0.522	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			Missense_Mutation
MUC16	94025	broad.mit.edu	37	19	9018494	9018494	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr19:9018494G>T	ENST00000397910.4	-	24	37883	c.37680C>A	c.(37678-37680)gaC>gaA	p.D12560E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12562	SEA 4. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGCGATGCATGTCCTCCTCAT	0.537																																																0			19											234.0	200.0	211.0					19																	9018494		2009	4189	6198	8879494	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37680C>A	19.37:g.9018494G>T	ENSP00000381008:p.Asp12560Glu	Unknown		x	x	x	8879494	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	.	5.444	0.267050	0.10294	.	.	ENSG00000181143	ENST00000397910	T	0.55588	0.51	2.01	-1.47	0.08772	.	.	.	.	.	T	0.55986	0.1955	M	0.84326	2.69	.	.	.	D	0.64830	0.994	P	0.48598	0.583	T	0.60682	-0.7215	8	0.87932	D	0	.	5.1154	0.14831	0.4775:0.0:0.5225:0.0	.	12560	B5ME49	.	E	12560	ENSP00000381008:D12560E	ENSP00000381008:D12560E	D	-	3	2	MUC16	8879494	0.012000	0.17670	0.003000	0.11579	0.150000	0.21749	-0.538000	0.06120	-0.304000	0.08843	0.195000	0.17529	GAC		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
C19orf57	79173	broad.mit.edu	37	19	14000722	14000722	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr19:14000722C>G	ENST00000586783.1	-	5	946	c.947G>C	c.(946-948)aGc>aCc	p.S316T	C19orf57_ENST00000591586.1_Intron|C19orf57_ENST00000454313.1_Missense_Mutation_p.S316T|C19orf57_ENST00000346736.2_Missense_Mutation_p.S316T			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	316					multicellular organismal development (GO:0007275)			p.S316T(1)		breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			ACCCATCCTGCTGGGGGTCTG	0.662																																																1	Substitution - Missense(1)	ovary(1)	19											19.0	21.0	20.0					19																	14000722		2203	4296	6499	13861722	SO:0001583	missense	79173			BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.947G>C	19.37:g.14000722C>G	ENSP00000465822:p.Ser316Thr	Unknown		x	x	x	13861722	Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	37		SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102399	0.37145	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.52295	0.67;0.67	3.45	1.19	0.21007	.	0.442058	0.16670	N	0.204396	T	0.31575	0.0801	L	0.29908	0.895	0.09310	N	1	B;D	0.55172	0.376;0.97	B;P	0.45506	0.071;0.483	T	0.10474	-1.0628	10	0.33141	T	0.24	-1.3288	3.322	0.07053	0.2728:0.5828:0.0:0.1444	.	316;316	Q0VDD7-2;Q0VDD7	.;CS057_HUMAN	T	316	ENSP00000404382:S316T;ENSP00000254336:S316T	ENSP00000254336:S316T	S	-	2	0	C19orf57	13861722	0.000000	0.05858	0.001000	0.08648	0.389000	0.30415	-0.222000	0.09190	0.699000	0.31761	0.313000	0.20887	AGC		0.662	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323		Missense_Mutation
ZNF91	7644	broad.mit.edu	37	19	23545420	23545420	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr19:23545420G>T	ENST00000300619.7	-	4	566	c.361C>A	c.(361-363)Cag>Aag	p.Q121K	ZNF91_ENST00000397082.2_Missense_Mutation_p.Q89K|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	121					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Q121K(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTTCTTAACTGTAAATTCTCA	0.358																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	69.0	68.0					19																	23545420		2122	4266	6388	23337260	SO:0001583	missense	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.361C>A	19.37:g.23545420G>T	ENSP00000300619:p.Gln121Lys	Unknown		x	x	x	23337260	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.219526	0.00286	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.05319	3.55;3.46	0.987	-1.05	0.10036	.	.	.	.	.	T	0.10078	0.0247	M	0.80982	2.52	0.09310	N	1	B;P	0.43352	0.232;0.804	B;P	0.46510	0.07;0.519	T	0.28776	-1.0033	9	0.15499	T	0.54	.	3.3973	0.07311	0.0:0.0:0.5482:0.4518	.	89;121	Q05481-2;Q05481	.;ZNF91_HUMAN	K	121;89	ENSP00000300619:Q121K;ENSP00000380272:Q89K	ENSP00000300619:Q121K	Q	-	1	0	ZNF91	23337260	0.001000	0.12720	0.007000	0.13788	0.597000	0.36814	-0.381000	0.07417	0.436000	0.26393	0.174000	0.16983	CAG		0.358	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		Missense_Mutation
ZNF285	26974	broad.mit.edu	37	19	44890755	44890755	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr19:44890755C>T	ENST00000330997.4	-	4	1716	c.1652G>A	c.(1651-1653)cGt>cAt	p.R551H	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.R558H|ZNF285_ENST00000544719.2_Missense_Mutation_p.R551H	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R551H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GTATGAATTACGACTGAAGCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	19											129.0	110.0	117.0					19																	44890755		2203	4296	6499	49582595	SO:0001583	missense	26974			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1652G>A	19.37:g.44890755C>T	ENSP00000333595:p.Arg551His	Unknown		x	x	x	49582595	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	14.47	2.544817	0.45280	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.05580	3.42	3.74	-4.14	0.03892	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03564	0.0102	N	0.16233	0.39	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.47724	-0.9095	9	0.15499	T	0.54	.	10.8854	0.46964	0.0:0.2982:0.0:0.7018	.	575;551	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	H	574;551	ENSP00000333595:R551H	ENSP00000333595:R551H	R	-	2	0	ZNF285	49582595	0.001000	0.12720	0.008000	0.14137	0.784000	0.44337	0.878000	0.28126	-0.568000	0.06038	0.454000	0.30748	CGT		0.458	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354		Missense_Mutation
MYBPC2	4606	broad.mit.edu	37	19	50958433	50958433	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr19:50958433G>A	ENST00000357701.5	+	19	2134	c.2083G>A	c.(2083-2085)Gag>Aag	p.E695K		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	695	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.E695K(1)		breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GGTCTTCACAGAGACCACCTA	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											87.0	90.0	89.0					19																	50958433		2017	4186	6203	55650245	SO:0001583	missense	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2083G>A	19.37:g.50958433G>A	ENSP00000350332:p.Glu695Lys	Unknown		x	x	x	55650245	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	15.19	2.760138	0.49468	.	.	ENSG00000086967	ENST00000357701	T	0.58797	0.31	4.07	4.07	0.47477	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.922450	0.04579	U	0.394648	T	0.52256	0.1723	L	0.33137	0.985	0.23449	N	0.997659	B	0.09022	0.002	B	0.15052	0.012	T	0.34725	-0.9817	10	0.23302	T	0.38	.	15.3857	0.74699	0.0:0.0:1.0:0.0	.	695	Q14324	MYPC2_HUMAN	K	695	ENSP00000350332:E695K	ENSP00000350332:E695K	E	+	1	0	MYBPC2	55650245	1.000000	0.71417	0.936000	0.37596	0.653000	0.38743	4.309000	0.59135	1.996000	0.58369	0.461000	0.40582	GAG		0.547	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533		Missense_Mutation
KCNH7	90134	broad.mit.edu	37	2	163279946	163279946	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr2:163279946T>C	ENST00000332142.5	-	9	2153	c.2054A>G	c.(2053-2055)gAg>gGg	p.E685G	KCNH7_ENST00000328032.4_Missense_Mutation_p.E678G	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	685					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.E685G(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GCGAATGAACTCTTTTACTCG	0.443																																					GBM(196;1492 2208 17507 24132 45496)											1	Substitution - Missense(1)	ovary(1)	2											241.0	224.0	229.0					2																	163279946		2203	4300	6503	162988192	SO:0001583	missense	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2054A>G	2.37:g.163279946T>C	ENSP00000331727:p.Glu685Gly	Unknown		x	x	x	162988192	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	29.3	4.997727	0.93227	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.96830	-4.14;-4.14	5.95	5.95	0.96441	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.98400	0.9468	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.96	D	0.99445	1.0939	10	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	678;685	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	G	685;678	ENSP00000331727:E685G;ENSP00000333781:E678G	ENSP00000333781:E678G	E	-	2	0	KCNH7	162988192	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	GAG		0.443	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		Missense_Mutation
GRB14	2888	broad.mit.edu	37	2	165476321	165476321	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr2:165476321T>A	ENST00000263915.3	-	2	738	c.200A>T	c.(199-201)aAg>aTg	p.K67M		NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	67					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.K67M(1)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						AAGATCTTTCTTTTTTCTCCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											134.0	138.0	137.0					2																	165476321		2203	4300	6503	165184567	SO:0001583	missense	2888				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.200A>T	2.37:g.165476321T>A	ENSP00000263915:p.Lys67Met	Unknown		x	x	x	165184567	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	CCDS2222.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904754	0.33628	.	.	ENSG00000115290	ENST00000263915;ENST00000446413;ENST00000424693	T;T;T	0.46819	1.87;1.45;0.86	5.31	2.87	0.33458	.	0.301451	0.28515	N	0.015075	T	0.31071	0.0785	N	0.22421	0.69	0.80722	D	1	B	0.13145	0.007	B	0.17979	0.02	T	0.07139	-1.0788	10	0.56958	D	0.05	-0.5728	7.1349	0.25523	0.1457:0.0:0.1527:0.7016	.	67	Q14449	GRB14_HUMAN	M	67;22;9	ENSP00000263915:K67M;ENSP00000416786:K22M;ENSP00000401702:K9M	ENSP00000263915:K67M	K	-	2	0	GRB14	165184567	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.359000	0.44142	0.305000	0.22832	0.533000	0.62120	AAG		0.368	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2			Missense_Mutation
SCN1A	6323	broad.mit.edu	37	2	166892744	166892744	+	Silent	SNP	T	T	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr2:166892744T>A	ENST00000303395.4	-	16	3242	c.3243A>T	c.(3241-3243)ggA>ggT	p.G1081G	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Silent_p.G1081G|SCN1A_ENST00000409050.1_Silent_p.G1053G|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Silent_p.G1070G			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1081					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.G1070G(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACTTGTAGTTCCATTTACAT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	2											173.0	163.0	167.0					2																	166892744		2203	4300	6503	166600990	SO:0001819	synonymous_variant	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3243A>T	2.37:g.166892744T>A		Unknown		x	x	x	166600990	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1	SNP	62	Broad																																																																																				0.348	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		Silent
TTN	7273	broad.mit.edu	37	2	179429213	179429213	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr2:179429213G>A	ENST00000591111.1	-	276	76947	c.76723C>T	c.(76723-76725)Cgc>Tgc	p.R25575C	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R24648C|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R27216C|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R18276C|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R18343C|TTN_ENST00000460472.2_Missense_Mutation_p.R18151C|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25575	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R18151C(2)|p.R24646C(2)|p.R18343C(1)|p.R18276C(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATCCAGCGGCCATCAGGT	0.368																																																6	Substitution - Missense(6)	large_intestine(4)|ovary(2)	2											71.0	67.0	68.0					2																	179429213		1864	4107	5971	179137459	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76723C>T	2.37:g.179429213G>A	ENSP00000465570:p.Arg25575Cys	Unknown		x	x	x	179137459	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213698	0.39102	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	6.16	5.28	0.74379	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74928	0.3781	M	0.80422	2.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.79546	-0.1759	9	0.87932	D	0	.	17.1823	0.86858	0.0:0.0:0.8731:0.1269	.	18151;18276;18343;25575	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	24648;18151;18343;18276;18149	ENSP00000343764:R24648C;ENSP00000434586:R18151C;ENSP00000340554:R18343C;ENSP00000352154:R18276C	ENSP00000340554:R18343C	R	-	1	0	TTN	179137459	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.807000	0.99171	1.597000	0.50072	0.650000	0.86243	CGC		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
SP140	11262	broad.mit.edu	37	2	231149125	231149125	+	Splice_Site	SNP	T	T	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr2:231149125T>C	ENST00000392045.3	+	16	1677	c.1563T>C	c.(1561-1563)aaT>aaC	p.N521N	SP140_ENST00000350136.5_Splice_Site_p.N390N|SP140_ENST00000343805.6_Splice_Site_p.N461N|SP140_ENST00000417495.3_Splice_Site_p.N407N|SP140_ENST00000486687.2_Splice_Site_p.N445N|SP140_ENST00000420434.3_Splice_Site_p.N494N	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	521					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.N521N(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GCCAACAAAATGGTAAGCAGG	0.433																																																1	Substitution - coding silent(1)	ovary(1)	2											103.0	116.0	112.0					2																	231149125		1906	4117	6023	230857369	SO:0001630	splice_region_variant	11262			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1564+1T>C	2.37:g.231149125T>C		Unknown		x	x	x	230857369	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	CCDS42831.1	SNP	51	Broad																																																																																				0.433	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	Silent	Silent
CSRP2BP	57325	broad.mit.edu	37	20	18165251	18165251	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr20:18165251G>C	ENST00000435364.3	+	9	2331	c.1990G>C	c.(1990-1992)Gac>Cac	p.D664H	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.D536H|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.D663H	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	664	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.D664H(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TTTAGGCATTGACCTGTCTGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	20											196.0	173.0	181.0					20																	18165251		2203	4300	6503	18113251	SO:0001583	missense	57325			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1990G>C	20.37:g.18165251G>C	ENSP00000392318:p.Asp664His	Unknown		x	x	x	18113251	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	27.8	4.864412	0.91511	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.69	5.69	0.88448	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.986	T	0.75880	-0.3161	10	0.87932	D	0	-13.8356	19.8165	0.96571	0.0:0.0:1.0:0.0	.	536;664	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	H	664;663;664;536	ENSP00000278816:D664H;ENSP00000366909:D663H;ENSP00000392318:D664H;ENSP00000425909:D536H	ENSP00000278816:D664H	D	+	1	0	CSRP2BP	18113251	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.750000	0.98875	2.683000	0.91414	0.655000	0.94253	GAC		0.408	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536		Missense_Mutation
NCOA3	8202	broad.mit.edu	37	20	46265173	46265173	+	Silent	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr20:46265173G>A	ENST00000371998.3	+	12	2234	c.2043G>A	c.(2041-2043)aaG>aaA	p.K681K	NCOA3_ENST00000371997.3_Silent_p.K691K|NCOA3_ENST00000341724.6_Silent_p.K691K|NCOA3_ENST00000372004.3_Silent_p.K681K			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	681					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TACAAGAGAAGCACCGGATTT	0.478																																																0			20											82.0	80.0	80.0					20																	46265173		2203	4300	6503	45698580	SO:0001819	synonymous_variant	8202			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.2043G>A	20.37:g.46265173G>A		Unknown		x	x	x	45698580	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1	SNP	34	Broad																																																																																				0.478	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534		Silent
BCAS4	55653	broad.mit.edu	37	20	49493134	49493134	+	3'UTR	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr20:49493134C>T	ENST00000358791.5	+	0	798				BCAS4_ENST00000262591.5_Missense_Mutation_p.R156W|BCAS4_ENST00000609336.1_3'UTR|BCAS4_ENST00000371608.2_Missense_Mutation_p.R201W	NM_017843.3	NP_060313.3	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4							cytoplasm (GO:0005737)		p.R201W(1)		large_intestine(2)|lung(2)|pancreas(1)|upper_aerodigestive_tract(1)	6						CACCTGCCCTCGGCCTTTGTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	20											63.0	65.0	64.0					20																	49493134		2203	4300	6503	48926541	SO:0001624	3_prime_UTR_variant	55653			AK000502	CCDS13432.2, CCDS33487.1	20q13	2008-07-03			ENSG00000124243	ENSG00000124243			14367	protein-coding gene	gene with protein product		607471				12378525	Standard	NM_001010974		Approved	FLJ20495, CNOL	uc002xvq.3	Q8TDM0	OTTHUMG00000032735	ENST00000358791.5:c.*62C>T	20.37:g.49493134C>T		Unknown		x	x	x	48926541	Q5TD52|Q5TD53|Q5TD54|Q5U5K7|Q5XKE8|Q8IXI7|Q8NEZ6|Q8TDL9|Q9NX13|Q9Y511	Missense_Mutation	SNP	ENST00000358791.5	37	CCDS33487.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939856	0.34189	.	.	ENSG00000124243	ENST00000262591;ENST00000371608	T;T	0.56103	0.48;0.56	3.19	-5.05	0.02955	.	.	.	.	.	T	0.29256	0.0728	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.20940	-1.0260	9	0.72032	D	0.01	.	1.1729	0.01829	0.4422:0.2493:0.1316:0.1768	.	201	Q8TDM0-3	.	W	156;201	ENSP00000262591:R156W;ENSP00000360669:R201W	ENSP00000262591:R156W	R	+	1	2	BCAS4	48926541	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-1.520000	0.02241	-1.140000	0.02877	0.491000	0.48974	CGG		0.547	BCAS4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079700.1	NM_017843		Missense_Mutation
FAM217B	63939	broad.mit.edu	37	20	58519845	58519845	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr20:58519845A>T	ENST00000358293.3	+	5	1262	c.847A>T	c.(847-849)Agg>Tgg	p.R283W	FAM217B_ENST00000360816.3_Missense_Mutation_p.R283W|FAM217B_ENST00000469084.1_3'UTR	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	283								p.R283W(1)									TTGTTCTCAGAGGCAAACCCT	0.453																																																1	Substitution - Missense(1)	ovary(1)	20											63.0	64.0	63.0					20																	58519845		2203	4300	6503	57953240	SO:0001583	missense	63939			AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.847A>T	20.37:g.58519845A>T	ENSP00000351040:p.Arg283Trp	Unknown		x	x	x	57953240	B3KWH1|Q9NTA3	Missense_Mutation	SNP	ENST00000358293.3	37	CCDS13484.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296389	0.40594	.	.	ENSG00000196227	ENST00000358293;ENST00000360816	T;T	0.27402	1.67;1.67	5.44	2.0	0.26442	.	0.517494	0.17639	N	0.167085	T	0.23886	0.0578	N	0.14661	0.345	0.21020	N	0.999802	D	0.55800	0.973	P	0.52424	0.698	T	0.06356	-1.0831	10	0.87932	D	0	-10.4411	5.5494	0.17081	0.648:0.1353:0.2167:0.0	.	283	Q9NTX9	CT177_HUMAN	W	283	ENSP00000351040:R283W;ENSP00000354056:R283W	ENSP00000351040:R283W	R	+	1	2	C20orf177	57953240	0.985000	0.35326	0.194000	0.23346	0.391000	0.30476	1.215000	0.32431	0.368000	0.24481	0.533000	0.62120	AGG		0.453	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268139.1	NM_022106		Missense_Mutation
USP25	29761	broad.mit.edu	37	21	17250186	17250186	+	Silent	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr21:17250186C>T	ENST00000285679.6	+	23	3240	c.2871C>T	c.(2869-2871)atC>atT	p.I957I	USP25_ENST00000400183.2_Silent_p.I1027I|USP25_ENST00000285681.2_Silent_p.I989I|USP25_ENST00000351097.5_Silent_p.I352I	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	957					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.I957I(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GTTTGATTATCATGAATGAGT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	21											118.0	119.0	118.0					21																	17250186		2203	4300	6503	16172057	SO:0001819	synonymous_variant	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2871C>T	21.37:g.17250186C>T		Unknown		x	x	x	16172057	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	37	CCDS33515.1	SNP	29	Broad																																																																																				0.348	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			Silent
KRTAP24-1	643803	broad.mit.edu	37	21	31655055	31655055	+	Missense_Mutation	SNP	C	C	T	rs371296443		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr21:31655055C>T	ENST00000340345.4	-	1	221	c.196G>A	c.(196-198)Ggt>Agt	p.G66S		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	66						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.G66S(1)		breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						GGTGCTTCACCGTAGGATTCT	0.522																																																1	Substitution - Missense(1)	urinary_tract(1)	21						T	SER/GLY	0,4006		0,0,2003	85.0	87.0	86.0		196	-7.3	0.0	21		86	1,8393		0,1,4196	no	missense	KRTAP24-1	NM_001085455.1	56	0,1,6199	TT,TC,CC		0.0119,0.0,0.0081	benign	66/255	31655055	1,12399	2003	4197	6200	30576926	SO:0001583	missense	643803			AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.196G>A	21.37:g.31655055C>T	ENSP00000339238:p.Gly66Ser	Unknown		x	x	x	30576926	Q1XDX0	Missense_Mutation	SNP	ENST00000340345.4	37	CCDS42915.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	2.008	-0.427815	0.04701	0.0	1.19E-4	ENSG00000188694	ENST00000340345	T	0.03242	4.0	4.96	-7.28	0.01456	.	1.400260	0.04281	N	0.343962	T	0.02610	0.0079	L	0.34521	1.04	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.46105	-0.9215	10	0.07644	T	0.81	0.5175	7.5227	0.27637	0.3032:0.4527:0.0:0.2442	.	66	Q3LI83	KR241_HUMAN	S	66	ENSP00000339238:G66S	ENSP00000339238:G66S	G	-	1	0	KRTAP24-1	30576926	0.000000	0.05858	0.013000	0.15412	0.156000	0.22039	-1.370000	0.02575	-1.556000	0.01695	-3.211000	0.00053	GGT		0.522	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455		Missense_Mutation
WDR4	10785	broad.mit.edu	37	21	44272425	44272425	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr21:44272425C>A	ENST00000398208.2	-	10	1044	c.985G>T	c.(985-987)Gag>Tag	p.E329*	WDR4_ENST00000492742.1_5'UTR|WDR4_ENST00000330317.2_Nonsense_Mutation_p.E329*	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4									p.E329*(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		ACGGTGCTCTCAGGAACAGAC	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	21											81.0	64.0	70.0					21																	44272425		2203	4300	6503	43145494	SO:0001587	stop_gained	10785			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.985G>T	21.37:g.44272425C>A	ENSP00000381266:p.Glu329*	Unknown		x	x	x	43145494		Nonsense_Mutation	SNP	ENST00000398208.2	37	CCDS13691.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	20.2	3.958413	0.74016	.	.	ENSG00000160193	ENST00000330317;ENST00000398208	.	.	.	4.12	3.23	0.37069	.	0.338061	0.30347	N	0.009833	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-9.796	7.0712	0.25179	0.0:0.8791:0.0:0.1209	.	.	.	.	X	329	.	ENSP00000328671:E329X	E	-	1	0	WDR4	43145494	0.877000	0.30153	0.328000	0.25416	0.026000	0.11368	1.891000	0.39738	2.303000	0.77524	0.655000	0.94253	GAG		0.572	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195479.1			Nonsense_Mutation
NF2	4771	broad.mit.edu	37	22	30054240	30054240	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr22:30054240A>G	ENST00000338641.4	+	7	1103	c.662A>G	c.(661-663)tAc>tGc	p.Y221C	NF2_ENST00000334961.7_Missense_Mutation_p.Y138C|NF2_ENST00000361452.4_Missense_Mutation_p.Y180C|NF2_ENST00000413209.2_Intron|NF2_ENST00000347330.5_Intron|NF2_ENST00000353887.4_Missense_Mutation_p.Y138C|NF2_ENST00000397789.3_Missense_Mutation_p.Y221C|NF2_ENST00000361166.4_Missense_Mutation_p.Y221C|NF2_ENST00000403999.3_Missense_Mutation_p.Y221C|NF2_ENST00000403435.1_Missense_Mutation_p.Y221C|NF2_ENST00000361676.4_Missense_Mutation_p.Y179C	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	221	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.N220fs*29(1)|p.E215fs*4(1)|p.Y221C(1)|p.L208fs*26(1)|p.Y207fs*27(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GGTGTGAACTACTTTGCAATC	0.473			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																													yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	8	Deletion - Frameshift(4)|Unknown(3)|Substitution - Missense(1)	soft_tissue(3)|large_intestine(1)|meninges(1)|central_nervous_system(1)|stomach(1)|ovary(1)	22											198.0	153.0	168.0					22																	30054240		2203	4300	6503	28384240	SO:0001583	missense	4771	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.662A>G	22.37:g.30054240A>G	ENSP00000344666:p.Tyr221Cys	Unknown		x	x	x	28384240	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation	SNP	ENST00000338641.4	37	CCDS13861.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	17.03	3.283539	0.59867	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	T;T;T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	5.75	5.75	0.90469	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);Pleckstrin homology-type (1);FERM conserved site (1);	0.058272	0.64402	D	0.000001	D	0.92067	0.7486	M	0.93106	3.38	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.993;0.999;0.997;0.993;0.995;0.995	D	0.93862	0.7154	9	.	.	.	.	16.0537	0.80779	1.0:0.0:0.0:0.0	.	180;221;221;179;138;221	P35240-5;P35240;P35240-2;P35240-6;P35240-4;P35240-3	.;MERL_HUMAN;.;.;.;.	C	221;221;180;221;221;138;138;221;179;221	ENSP00000344666:Y221C;ENSP00000384029:Y221C;ENSP00000354897:Y180C;ENSP00000384797:Y221C;ENSP00000335652:Y138C;ENSP00000340626:Y138C;ENSP00000380891:Y221C;ENSP00000355183:Y179C;ENSP00000354529:Y221C	.	Y	+	2	0	NF2	28384240	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	9.248000	0.95456	2.181000	0.69327	0.460000	0.39030	TAC		0.473	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268		Missense_Mutation
MYH9	4627	broad.mit.edu	37	22	36716853	36716853	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr22:36716853C>G	ENST00000216181.5	-	8	1088	c.858G>C	c.(856-858)gaG>gaC	p.E286D		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	286	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.E286D(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCTTCAGGTGCTCTCCAGCCC	0.517			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - Missense(1)	ovary(1)	22											69.0	64.0	66.0					22																	36716853		2203	4300	6503	35046799	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.858G>C	22.37:g.36716853C>G	ENSP00000216181:p.Glu286Asp	Unknown		x	x	x	35046799	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076749	0.36662	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.87571	-2.27	5.13	0.019	0.14119	Myosin head, motor domain (2);	0.052099	0.85682	D	0.000000	T	0.71022	0.3291	N	0.11131	0.1	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58657	-0.7598	10	0.41790	T	0.15	.	8.3831	0.32483	0.0:0.4827:0.0:0.5173	.	286	P35579	MYH9_HUMAN	D	150;286	ENSP00000216181:E286D	ENSP00000216181:E286D	E	-	3	2	MYH9	35046799	0.096000	0.21769	0.996000	0.52242	0.967000	0.64934	-0.578000	0.05841	0.259000	0.21709	-0.218000	0.12543	GAG		0.517	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		Missense_Mutation
SUSD5	26032	broad.mit.edu	37	3	33195086	33195086	+	Silent	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr3:33195086G>A	ENST00000309558.3	-	5	1455	c.1038C>T	c.(1036-1038)ccC>ccT	p.P346P		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	346					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						ATGGCCCCGAGGGACCATCAG	0.527																																																0			3											71.0	73.0	72.0					3																	33195086		2069	4205	6274	33170090	SO:0001819	synonymous_variant	26032			AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.1038C>T	3.37:g.33195086G>A		Unknown		x	x	x	33170090		Silent	SNP	ENST00000309558.3	37	CCDS46787.1	SNP	35	Broad																																																																																				0.527	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054		Silent
SPATA18	132671	broad.mit.edu	37	4	52938302	52938302	+	Silent	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr4:52938302G>A	ENST00000295213.4	+	6	1112	c.738G>A	c.(736-738)gaG>gaA	p.E246E	SPATA18_ENST00000506829.1_3'UTR|SPATA18_ENST00000419395.2_Silent_p.E214E	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	246					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.E246E(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TGTCTGCTGAGAAAAGTGCAC	0.453																																																1	Substitution - coding silent(1)	ovary(1)	4											79.0	75.0	76.0					4																	52938302		2203	4300	6503	52633059	SO:0001819	synonymous_variant	132671			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.738G>A	4.37:g.52938302G>A		Unknown		x	x	x	52633059	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Silent	SNP	ENST00000295213.4	37	CCDS3489.1	SNP	33	Broad																																																																																				0.453	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263		Silent
PCDHGA1	56114	broad.mit.edu	37	5	140711356	140711356	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr5:140711356A>C	ENST00000517417.1	+	1	1105	c.1105A>C	c.(1105-1107)Atc>Ctc	p.I369L	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.I369L|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	369	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATTGCTCTTATCAGTGTGCA	0.403																																																0			5											51.0	49.0	49.0					5																	140711356		2203	4300	6503	140691540	SO:0001583	missense	56114			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1105A>C	5.37:g.140711356A>C	ENSP00000431083:p.Ile369Leu	Unknown		x	x	x	140691540	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	0.754	-0.771902	0.02951	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.01685	4.69;4.69	3.99	1.36	0.22044	Cadherin (4);Cadherin-like (1);	0.322567	0.22132	U	0.064171	T	0.00906	0.0030	N	0.13003	0.285	0.19300	N	0.999973	B;B	0.06786	0.001;0.001	B;B	0.13407	0.005;0.009	T	0.47699	-0.9097	10	0.09084	T	0.74	.	0.706	0.00916	0.4145:0.2305:0.2047:0.1503	.	369;369	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	L	369	ENSP00000431083:I369L;ENSP00000367345:I369L	ENSP00000367345:I369L	I	+	1	0	PCDHGA1	140691540	0.000000	0.05858	1.000000	0.80357	0.744000	0.42396	-0.664000	0.05292	0.701000	0.31803	0.528000	0.53228	ATC		0.403	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		Missense_Mutation
PCDHGA7	56108	broad.mit.edu	37	5	140764690	140764690	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr5:140764690G>T	ENST00000518325.1	+	1	2224	c.2224G>T	c.(2224-2226)Ggc>Tgc	p.G742C	PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	742					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACTTTGTGGGCATGGACGG	0.627																																																0			5											63.0	69.0	67.0					5																	140764690		2203	4300	6503	140744874	SO:0001583	missense	56108			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2224G>T	5.37:g.140764690G>T	ENSP00000430024:p.Gly742Cys	Unknown		x	x	x	140744874	B2RN87|Q9Y5D0	Missense_Mutation	SNP	ENST00000518325.1	37	CCDS54927.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	.	19.50	3.839878	0.71488	.	.	ENSG00000253537	ENST00000518325	T	0.50813	0.73	4.73	4.73	0.59995	.	.	.	.	.	T	0.75287	0.3829	H	0.95004	3.61	0.30985	N	0.722105	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.78743	-0.2085	9	0.56958	D	0.05	.	11.2697	0.49131	0.0854:0.0:0.9146:0.0	.	742;742	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	C	742	ENSP00000430024:G742C	ENSP00000430024:G742C	G	+	1	0	PCDHGA7	140744874	0.060000	0.20803	0.617000	0.29091	0.001000	0.01503	1.676000	0.37565	2.331000	0.79229	0.563000	0.77884	GGC		0.627	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920		Missense_Mutation
PCDHGB7	56099	broad.mit.edu	37	5	140798637	140798637	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr5:140798637T>G	ENST00000398594.2	+	1	1211	c.1211T>G	c.(1210-1212)cTa>cGa	p.L404R	PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	404	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L404R(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTACAAGCTAGTAACAGAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	5											43.0	46.0	45.0					5																	140798637		2016	4161	6177	140778821	SO:0001583	missense	56099			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1211T>G	5.37:g.140798637T>G	ENSP00000381594:p.Leu404Arg	Unknown		x	x	x	140778821	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	t	15.69	2.907950	0.52333	.	.	ENSG00000254122	ENST00000398594	T	0.62639	0.01	5.31	5.31	0.75309	Cadherin (4);Cadherin-like (1);	0.000000	0.26855	U	0.022149	D	0.87989	0.6317	H	0.99182	4.46	0.19575	N	0.999968	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.84563	0.0651	10	0.87932	D	0	.	15.4222	0.75022	0.0:0.0:0.0:1.0	.	404;404	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	R	404	ENSP00000381594:L404R	ENSP00000381594:L404R	L	+	2	0	PCDHGB7	140778821	0.926000	0.31397	0.627000	0.29227	0.994000	0.84299	6.087000	0.71362	2.234000	0.73211	0.459000	0.35465	CTA		0.493	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		Missense_Mutation
SLC35B2	347734	broad.mit.edu	37	6	44223050	44223050	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr6:44223050G>C	ENST00000393812.3	-	4	835	c.692C>G	c.(691-693)tCt>tGt	p.S231C	SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000393810.1_3'UTR|SLC35B2_ENST00000537814.1_Missense_Mutation_p.S98C|SLC35B2_ENST00000538577.1_Missense_Mutation_p.S138C|MIR4647_ENST00000583964.1_RNA	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	231					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)	p.S231C(1)		breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCTGCGCCGAGACACAAGCTT	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											88.0	86.0	87.0					6																	44223050		2203	4300	6503	44331028	SO:0001583	missense	347734			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.692C>G	6.37:g.44223050G>C	ENSP00000377401:p.Ser231Cys	Unknown		x	x	x	44331028	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	ENST00000393812.3	37	CCDS34462.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	27.7	4.855373	0.91355	.	.	ENSG00000157593	ENST00000393812;ENST00000537814;ENST00000538577;ENST00000341553	T;T;T	0.69306	-0.39;-0.39;-0.39	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.82586	0.5069	M	0.88512	2.96	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.96;0.992	T	0.82446	-0.0453	10	0.40728	T	0.16	-13.2163	19.5037	0.95106	0.0:0.0:1.0:0.0	.	138;231	F5H7Y9;Q8TB61	.;S35B2_HUMAN	C	231;98;138;231	ENSP00000377401:S231C;ENSP00000440340:S98C;ENSP00000443845:S138C	ENSP00000342455:S231C	S	-	2	0	SLC35B2	44331028	1.000000	0.71417	0.960000	0.40013	0.981000	0.71138	9.848000	0.99507	2.624000	0.88883	0.550000	0.68814	TCT		0.577	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2			Missense_Mutation
LMBRD1	55788	broad.mit.edu	37	6	70500195	70500195	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr6:70500195G>A	ENST00000370577.3	-	2	468	c.239C>T	c.(238-240)aCa>aTa	p.T80I	LMBRD1_ENST00000370570.1_Missense_Mutation_p.T7I	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	80					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.T80I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TACCTTAAATGTACCATTTTG	0.308																																																1	Substitution - Missense(1)	ovary(1)	6											55.0	58.0	57.0					6																	70500195		2202	4299	6501	70556916	SO:0001583	missense	55788			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.239C>T	6.37:g.70500195G>A	ENSP00000359609:p.Thr80Ile	Unknown		x	x	x	70556916	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	CCDS4969.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874905	0.91664	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.18016	2.24;2.24	5.93	5.93	0.95920	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.19927	0.0479	M	0.62723	1.935	0.80722	D	1	D	0.54397	0.966	P	0.46629	0.522	T	0.00950	-1.1503	10	0.59425	D	0.04	-14.2749	20.3368	0.98748	0.0:0.0:1.0:0.0	.	80	Q9NUN5	LMBD1_HUMAN	I	80;7	ENSP00000359609:T80I;ENSP00000359602:T7I	ENSP00000359602:T7I	T	-	2	0	LMBRD1	70556916	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.430000	0.97488	2.805000	0.96524	0.655000	0.94253	ACA		0.308	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368		Missense_Mutation
EGFR	1956	broad.mit.edu	37	7	55210083	55210083	+	Silent	SNP	T	T	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr7:55210083T>C	ENST00000275493.2	+	2	370	c.193T>C	c.(193-195)Ttg>Ctg	p.L65L	EGFR_ENST00000454757.2_Silent_p.L12L|EGFR_ENST00000342916.3_Silent_p.L65L|EGFR_ENST00000455089.1_Silent_p.L65L|EGFR_ENST00000442591.1_Silent_p.L65L|EGFR_ENST00000420316.2_Silent_p.L65L|EGFR_ENST00000344576.2_Silent_p.L65L	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	65			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CCTTGGGAATTTGGAAATTAC	0.403		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0			7											171.0	165.0	167.0					7																	55210083		2203	4300	6503	55177577	SO:0001819	synonymous_variant	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.193T>C	7.37:g.55210083T>C		Unknown		x	x	x	55177577	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	37	CCDS5514.1	SNP	64	Broad																																																																																				0.403	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		Silent
DUSP26	78986	broad.mit.edu	37	8	33449611	33449611	+	Silent	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr8:33449611G>T	ENST00000256261.4	-	4	1073	c.556C>A	c.(556-558)Cga>Aga	p.R186R	DUSP26_ENST00000523956.1_Silent_p.R186R	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	186	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		ATGATGCCTCGGTGGTCTTTG	0.637																																																0			8											102.0	91.0	95.0					8																	33449611		2203	4300	6503	33569153	SO:0001819	synonymous_variant	78986			AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.556C>A	8.37:g.33449611G>T		Unknown		x	x	x	33569153	D3DSV8|Q9BTW0	Silent	SNP	ENST00000256261.4	37	CCDS6092.1	SNP	39	Broad																																																																																				0.637	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025		Silent
PXDNL	137902	broad.mit.edu	37	8	52387592	52387592	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr8:52387592A>G	ENST00000356297.4	-	7	734	c.634T>C	c.(634-636)Tat>Cat	p.Y212H	PXDNL_ENST00000543296.1_Missense_Mutation_p.Y212H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	212	LRRCT.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.Y212H(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CTCCTGGGATATTCGCAGGTA	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											56.0	57.0	56.0					8																	52387592		1918	4134	6052	52550145	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.634T>C	8.37:g.52387592A>G	ENSP00000348645:p.Tyr212His	Unknown		x	x	x	52550145	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	8.037	0.763019	0.15914	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.52295	0.67;0.67	4.63	-1.85	0.07784	Cysteine-rich flanking region, C-terminal (1);	.	.	.	.	T	0.34279	0.0892	L	0.42632	1.34	0.09310	N	0.999996	B	0.16166	0.016	B	0.15870	0.014	T	0.28138	-1.0053	9	0.20519	T	0.43	.	8.8909	0.35432	0.6106:0.0:0.3894:0.0	.	212	A1KZ92	PXDNL_HUMAN	H	212	ENSP00000348645:Y212H;ENSP00000444865:Y212H	ENSP00000348645:Y212H	Y	-	1	0	PXDNL	52550145	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.312000	0.08113	-0.356000	0.08187	-0.263000	0.10527	TAT		0.502	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		Missense_Mutation
EPPK1	83481	broad.mit.edu	37	8	144942482	144942482	+	Missense_Mutation	SNP	C	C	G	rs111830312		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr8:144942482C>G	ENST00000525985.1	-	2	5011	c.4940G>C	c.(4939-4941)cGc>cCc	p.R1647P				P58107	EPIPL_HUMAN	epiplakin 1	1647						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.R1647P(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTGACGGCGCGCTCGGCCGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	8											68.0	79.0	75.0					8																	144942482		2025	4161	6186	145014470	SO:0001583	missense	83481			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.4940G>C	8.37:g.144942482C>G	ENSP00000436337:p.Arg1647Pro	Unknown		x	x	x	145014470	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	12.37	1.919009	0.33908	.	.	ENSG00000227184	ENST00000525985	T	0.69435	-0.4	4.48	2.5	0.30297	.	.	.	.	.	T	0.77638	0.4160	M	0.73217	2.22	0.24928	N	0.991934	D	0.89917	1.0	D	0.76071	0.987	T	0.63937	-0.6524	9	0.72032	D	0.01	.	8.0384	0.30506	0.0:0.7795:0.0:0.2205	.	1647	E9PPU0	.	P	1647	ENSP00000436337:R1647P	ENSP00000436337:R1647P	R	-	2	0	EPPK1	145014470	0.480000	0.25933	0.858000	0.33744	0.012000	0.07955	1.478000	0.35442	1.098000	0.41479	0.591000	0.81541	CGC		0.622	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		Missense_Mutation
KDM4C	23081	broad.mit.edu	37	9	7049128	7049128	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr9:7049128A>T	ENST00000381309.3	+	17	2917	c.2352A>T	c.(2350-2352)gaA>gaT	p.E784D	KDM4C_ENST00000428870.2_Missense_Mutation_p.E471D|KDM4C_ENST00000535193.1_Missense_Mutation_p.E806D|KDM4C_ENST00000543771.1_Missense_Mutation_p.E784D|KDM4C_ENST00000442236.2_Missense_Mutation_p.E529D|KDM4C_ENST00000381306.3_Missense_Mutation_p.E784D|KDM4C_ENST00000536108.1_Intron	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	784					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)	p.E784D(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						CGGTCCCAGAAGTTCGATTCA	0.423																																																1	Substitution - Missense(1)	ovary(1)	9											100.0	100.0	100.0					9																	7049128		2203	4300	6503	7039128	SO:0001583	missense	23081			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2352A>T	9.37:g.7049128A>T	ENSP00000370710:p.Glu784Asp	Unknown		x	x	x	7039128	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480797	0.84747	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000428870;ENST00000420847	T;T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37;2.37	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.46541	0.1398	M	0.83483	2.645	0.48632	D	0.999688	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.994;0.996;0.999;0.999;0.998	T	0.45308	-0.9270	10	0.46703	T	0.11	-2.2458	16.3948	0.83586	1.0:0.0:0.0:0.0	.	529;784;806;784;784	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	D	806;784;784;784;529;471;128	ENSP00000442382:E806D;ENSP00000445427:E784D;ENSP00000370710:E784D;ENSP00000370707:E784D;ENSP00000409353:E529D;ENSP00000405739:E471D;ENSP00000400127:E128D	ENSP00000370707:E784D	E	+	3	2	KDM4C	7039128	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.718000	0.68455	2.326000	0.78906	0.533000	0.62120	GAA		0.423	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061		Missense_Mutation
FREM1	158326	broad.mit.edu	37	9	14842569	14842569	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr9:14842569C>G	ENST00000380880.3	-	9	2266	c.1483G>C	c.(1483-1485)Gtg>Ctg	p.V495L	FREM1_ENST00000380881.4_Missense_Mutation_p.V496L|FREM1_ENST00000422223.2_Missense_Mutation_p.V495L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	495					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.V496L(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CGGAAGACCACGAAGTCTTTG	0.517																																																1	Substitution - Missense(1)	ovary(1)	9											123.0	126.0	125.0					9																	14842569		2042	4192	6234	14832569	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1483G>C	9.37:g.14842569C>G	ENSP00000370262:p.Val495Leu	Unknown		x	x	x	14832569	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	13.53	2.263432	0.39995	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.42131	0.98;0.98;0.98	5.63	2.76	0.32466	.	0.122894	0.56097	D	0.000034	T	0.23846	0.0577	L	0.31664	0.95	0.39404	D	0.966635	P	0.38711	0.643	B	0.37989	0.262	T	0.06770	-1.0808	10	0.09843	T	0.71	-13.2093	5.4312	0.16454	0.0:0.5833:0.1427:0.274	.	495	Q5H8C1	FREM1_HUMAN	L	496;495;495	ENSP00000370263:V496L;ENSP00000412940:V495L;ENSP00000370262:V495L	ENSP00000370257:V498L	V	-	1	0	FREM1	14832569	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	1.080000	0.30779	0.847000	0.35167	0.655000	0.94253	GTG		0.517	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		Missense_Mutation
PTCH1	5727	broad.mit.edu	37	9	98209442	98209442	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr9:98209442G>T	ENST00000331920.6	-	23	4395	c.4096C>A	c.(4096-4098)Cag>Aag	p.Q1366K	PTCH1_ENST00000418258.1_Missense_Mutation_p.Q1215K|PTCH1_ENST00000421141.1_Missense_Mutation_p.Q1215K|PTCH1_ENST00000375274.2_Missense_Mutation_p.Q1365K|PTCH1_ENST00000430669.2_Missense_Mutation_p.Q1300K|PTCH1_ENST00000429896.2_Missense_Mutation_p.Q1215K|PTCH1_ENST00000437951.1_Missense_Mutation_p.Q1300K	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1366					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.C1365*(1)|p.Q1366K(1)|p.Q1365K(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GTGATGGGCTGGCAGTAGCCG	0.716																																																3	Substitution - Missense(2)|Substitution - Nonsense(1)	ovary(3)	9											26.0	30.0	29.0					9																	98209442		2158	4228	6386	97249263	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.4096C>A	9.37:g.98209442G>T	ENSP00000332353:p.Gln1366Lys	Unknown		x	x	x	97249263	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970297	0.92919	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000375284;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.90900	-2.74;-2.72;-2.71;-2.71;-2.72;-2.71;-2.75	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.94483	0.8224	M	0.62723	1.935	0.80722	D	1	P;D;D	0.58268	0.954;0.982;0.969	D;D;D	0.70227	0.954;0.968;0.93	D	0.94537	0.7741	10	0.62326	D	0.03	-19.2798	18.7592	0.91843	0.0:0.0:1.0:0.0	.	1300;1365;1366	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	K	1366;1300;1215;1215;1300;158;1215;1365	ENSP00000332353:Q1366K;ENSP00000389744:Q1300K;ENSP00000399981:Q1215K;ENSP00000396135:Q1215K;ENSP00000410287:Q1300K;ENSP00000414823:Q1215K;ENSP00000364423:Q1365K	ENSP00000332353:Q1366K	Q	-	1	0	PTCH1	97249263	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.634000	0.83273	2.659000	0.90383	0.655000	0.94253	CAG		0.716	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		Missense_Mutation
PPP1R26	9858	broad.mit.edu	37	9	138376530	138376530	+	Silent	SNP	G	G	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr9:138376530G>T	ENST00000356818.2	+	4	723	c.174G>T	c.(172-174)ggG>ggT	p.G58G	PPP1R26_ENST00000605286.1_Silent_p.G58G|PPP1R26_ENST00000605660.1_Silent_p.G58G|PPP1R26_ENST00000401470.3_Silent_p.G58G|PPP1R26_ENST00000604351.1_Silent_p.G58G|PPP1R26_ENST00000602993.1_Intron	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	58					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.G58G(1)									AGCGCGACGGGGCTGCTCGGG	0.701																																																1	Substitution - coding silent(1)	ovary(1)	9											27.0	34.0	31.0					9																	138376530		2203	4293	6496	137516351	SO:0001819	synonymous_variant	9858			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.174G>T	9.37:g.138376530G>T		Unknown		x	x	x	137516351	Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	ENST00000356818.2	37	CCDS6988.1	SNP	43	Broad																																																																																				0.701	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811		Silent
SUPT20HL2	170067	broad.mit.edu	37	X	24329671	24329671	+	IGR	SNP	A	A	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chrX:24329671A>T								AC096509.1 (24877 upstream) : AC004552.1 (37254 downstream)														p.L631M(1)									CTGCACCCCAAAACCTGGGCT	0.627																																																1	Substitution - Missense(1)	ovary(1)	X											15.0	15.0	15.0					X																	24329671		1567	3578	5145	24239592	SO:0001628	intergenic_variant	170067																															X.37:g.24329671A>T		Unknown		x	x	x	24239592		Missense_Mutation	SNP		37		SNP	1	Broad																																																																																			0	0.627									Missense_Mutation
ZXDB	158586	broad.mit.edu	37	X	57619643	57619643	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chrX:57619643G>A	ENST00000374888.1	+	1	1375	c.1162G>A	c.(1162-1164)Gaa>Aaa	p.E388K		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	388	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.E388K(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CAGCCACTTCGAACCGGAGAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											84.0	76.0	79.0					X																	57619643		2203	4300	6503	57636368	SO:0001583	missense	158586			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1162G>A	X.37:g.57619643G>A	ENSP00000364023:p.Glu388Lys	Unknown		x	x	x	57636368	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	.	19.60	3.857826	0.71834	.	.	ENSG00000198455	ENST00000374888	T	0.28069	1.63	3.44	2.57	0.30868	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.26340	0.0643	N	0.11789	0.175	0.80722	D	1	D	0.76494	0.999	P	0.56434	0.798	T	0.04386	-1.0955	10	0.54805	T	0.06	.	8.0046	0.30317	0.1296:0.0:0.8704:0.0	.	388	P98169	ZXDB_HUMAN	K	388	ENSP00000364023:E388K	ENSP00000364023:E388K	E	+	1	0	ZXDB	57636368	1.000000	0.71417	0.581000	0.28614	0.898000	0.52572	5.705000	0.68355	0.640000	0.30582	0.483000	0.47432	GAA		0.557	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157		Missense_Mutation
BRWD3	254065	broad.mit.edu	37	X	79945493	79945493	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chrX:79945493A>C	ENST00000373275.4	-	32	3917	c.3701T>G	c.(3700-3702)gTa>gGa	p.V1234G	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1234					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.V1234G(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GACATCAGTTACAATTTTAGC	0.323																																																1	Substitution - Missense(1)	ovary(1)	X											86.0	73.0	78.0					X																	79945493		2203	4300	6503	79832149	SO:0001583	missense	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3701T>G	X.37:g.79945493A>C	ENSP00000362372:p.Val1234Gly	Unknown		x	x	x	79832149	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	20.6	4.017879	0.75275	.	.	ENSG00000165288	ENST00000373275	T	0.19938	2.11	4.44	4.44	0.53790	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.46678	0.1405	M	0.79926	2.475	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.49615	-0.8921	9	.	.	.	-11.3827	13.1253	0.59351	1.0:0.0:0.0:0.0	.	1234	Q6RI45	BRWD3_HUMAN	G	1234	ENSP00000362372:V1234G	.	V	-	2	0	BRWD3	79832149	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.705000	0.91357	1.738000	0.51689	0.481000	0.45027	GTA		0.323	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		Missense_Mutation
AFF2	2334	broad.mit.edu	37	X	148037364	148037364	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chrX:148037364C>T	ENST00000370460.2	+	11	2268	c.1789C>T	c.(1789-1791)Cgt>Tgt	p.R597C	AFF2_ENST00000342251.3_Missense_Mutation_p.R564C|AFF2_ENST00000286437.5_Missense_Mutation_p.R238C|AFF2_ENST00000370457.5_Missense_Mutation_p.R564C	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	597					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.R597C(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GGAGAAAGCCCGTCCACGGCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	X											98.0	102.0	100.0					X																	148037364		2203	4300	6503	147845064	SO:0001583	missense	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1789C>T	X.37:g.148037364C>T	ENSP00000359489:p.Arg597Cys	Unknown		x	x	x	147845064	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745398	0.30955	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.5	4.63	0.57726	.	0.064020	0.64402	D	0.000009	T	0.75744	0.3891	M	0.77313	2.365	0.40671	D	0.982211	D;D;D;D;D;D	0.59767	0.986;0.983;0.983;0.983;0.983;0.986	P;P;P;P;P;P	0.54401	0.664;0.534;0.534;0.534;0.636;0.751	T	0.78440	-0.2203	10	0.54805	T	0.06	.	12.0857	0.53695	0.4932:0.5068:0.0:0.0	.	238;562;564;558;587;597	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	C	597;564;564;238	ENSP00000359489:R597C;ENSP00000359486:R564C;ENSP00000345459:R564C;ENSP00000286437:R238C	ENSP00000286437:R238C	R	+	1	0	AFF2	147845064	1.000000	0.71417	0.802000	0.32245	0.001000	0.01503	4.345000	0.59360	1.071000	0.40834	-0.290000	0.09829	CGT		0.468	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		Missense_Mutation
KBTBD7	84078	broad.mit.edu	37	13	41768107	41768111	+	Frame_Shift_Del	DEL	AAGTA	AAGTA	-			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr13:41768107_41768111delAAGTA	ENST00000379483.3	-	1	591_595	c.283_287delTACTT	c.(283-288)tacttcfs	p.YF95fs		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	95	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.Y95fs*42(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		CATGCTCTTGAAGTAGGGACACGCA	0.605																																																1	Deletion - Frameshift(1)	ovary(1)	13																																								40666111	SO:0001589	frameshift_variant	84078			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.283_287delTACTT	13.37:g.41768107_41768111delAAGTA	ENSP00000368797:p.Tyr95fs	Unknown		Capture	Illumina GAIIx	Phase_I	40666107	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Frame_Shift_Del	DEL	ENST00000379483.3	37	CCDS9377.1	DEL	9	Broad																																																																																				0.605	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138		Frame_Shift_Del
TP53	7157	broad.mit.edu	37	17	7578475	7578475	+	Frame_Shift_Del	DEL	G	G	-	rs137852790|rs137852791|rs587782705		TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr17:7578475delG	ENST00000269305.4	-	5	644	c.455delC	c.(454-456)ccgfs	p.P153fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.P153fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P153fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P153fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	153	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in a sporadic cancer; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in a sporadic cancer; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P152L(66)|p.P152R(8)|p.0?(8)|p.T150fs*16(6)|p.?(5)|p.P153fs*28(5)|p.P152fs*18(5)|p.P152fs*14(5)|p.P152Q(4)|p.P59L(2)|p.P20L(2)|p.P153fs*16(1)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P59R(1)|p.P20R(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P152fs*27(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.T18fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGTGCCGGGCGGGGGTGTGGA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	132	Substitution - Missense(84)|Deletion - Frameshift(25)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)	large_intestine(22)|central_nervous_system(18)|upper_aerodigestive_tract(15)|oesophagus(10)|skin(9)|haematopoietic_and_lymphoid_tissue(8)|ovary(8)|prostate(8)|urinary_tract(7)|stomach(6)|bone(5)|breast(4)|lung(3)|liver(3)|vulva(2)|soft_tissue(2)|thyroid(1)|adrenal_gland(1)	17	GRCh37	CM941327	TP53	M							51.0	52.0	52.0					17																	7578475		2203	4300	6503	7519200	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.455delC	17.37:g.7578475delG	ENSP00000269305:p.Pro153fs	Unknown		Capture	Illumina GAIIx	Phase_I	7519200	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	39	Broad																																																																																				0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
POTEE	445582	broad.mit.edu	37	2	131976026	131976027	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-24-2293-01	TCGA-24-2293-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2293-01	TCGA-24-2293-10	g.chr2:131976026_131976027delAT	ENST00000356920.5	+	1	145_146	c.51_52delAT	c.(49-54)ccatttfs	p.F18fs	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Frame_Shift_Del_p.F18fs|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	18					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.F18fs*107(1)									TGAAGAAGCCATTTGGTCTCAG	0.554																																																1	Deletion - Frameshift(1)	ovary(1)	2																																								131692497	SO:0001589	frameshift_variant	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.51_52delAT	2.37:g.131976026_131976027delAT	ENSP00000439189:p.Phe18fs	Unknown		Capture	Illumina GAIIx	Phase_I	131692496	Q6S8J4|Q6S8J5|Q6S8J8	Frame_Shift_Del	DEL	ENST00000356920.5	37	CCDS46414.1	DEL	8	Broad																																																																																				0.554	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		Frame_Shift_Del
