#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZBTB17	7709	broad.mit.edu	37	1	16269158	16269158	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:16269158G>C	ENST00000375743.4	-	14	2136	c.1904C>G	c.(1903-1905)aCc>aGc	p.T635S	ZBTB17_ENST00000375733.2_Missense_Mutation_p.T635S|ZBTB17_ENST00000537142.1_Missense_Mutation_p.T553S	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	635					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T635S(1)		breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGTGCACGGTCTTCACGTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	67.0	72.0					1																	16269158		2203	4300	6503	16141745	SO:0001583	missense	7709			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.1904C>G	1.37:g.16269158G>C	ENSP00000364895:p.Thr635Ser	Unknown		x	x	x	16141745	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	ENST00000375743.4	37	CCDS165.1	SNP	44	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	20.3|20.3|20.3	3.967452|3.967452|3.967452	0.74131|0.74131|0.74131	.|.|.	.|.|.	ENSG00000116809|ENSG00000116809|ENSG00000116809	ENST00000440560|ENST00000444358|ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142;ENST00000375729	.|.|T;T;T	.|.|0.01767	.|.|4.65;4.65;4.65	5.52|5.52|5.52	4.6|4.6|4.6	0.57074|0.57074|0.57074	.|.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.04998|0.04998|0.04998	0.0134|0.0134|0.0134	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D	.|.|0.71674	.|.|0.998;0.997;0.976	.|.|D;D;P	.|.|0.76071	.|.|0.987;0.922;0.541	T|T|T	0.58103|0.58103|0.58103	-0.7695|-0.7695|-0.7695	5|5|10	.|.|0.41790	.|.|T	.|.|0.15	.|.|.	14.6086|14.6086|14.6086	0.68498|0.68498|0.68498	0.0713:0.0:0.9287:0.0|0.0713:0.0:0.9287:0.0|0.0713:0.0:0.9287:0.0	.|.|.	.|.|635;553;635	.|.|Q13105-2;F5H411;Q13105	.|.|.;.;ZBT17_HUMAN	E|A|S	34|192|635;635;554;553;191	.|.|ENSP00000364895:T635S;ENSP00000364885:T635S;ENSP00000438529:T553S	.|.|ENSP00000364881:T191S	D|P|T	-|-|-	3|1|2	2|0|0	ZBTB17|ZBTB17|ZBTB17	16141745|16141745|16141745	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.955000|0.955000|0.955000	0.39395|0.39395|0.39395	0.789000|0.789000|0.789000	0.44602|0.44602|0.44602	4.411000|4.411000|4.411000	0.59781|0.59781|0.59781	2.579000|2.579000|2.579000	0.87056|0.87056|0.87056	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	GAC|CCG|ACC		0.602	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	NM_003443		Missense_Mutation
HTR6	3362	broad.mit.edu	37	1	20005622	20005622	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:20005622C>T	ENST00000289753.1	+	3	1551	c.1084C>T	c.(1084-1086)Ccc>Tcc	p.P362S		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	362					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)	p.P362S(1)		endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	CGGCCCCCGGCCCGGCCTTAG	0.731																																					Esophageal Squamous(168;1879 2619 6848 21062)											1	Substitution - Missense(1)	ovary(1)	1											13.0	16.0	15.0					1																	20005622		2193	4287	6480	19878209	SO:0001583	missense	3362			L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.1084C>T	1.37:g.20005622C>T	ENSP00000289753:p.Pro362Ser	Unknown		x	x	x	19878209	Q13640|Q5TGZ1	Missense_Mutation	SNP	ENST00000289753.1	37	CCDS197.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	5.352	0.250250	0.10130	.	.	ENSG00000158748	ENST00000289753	T	0.54279	0.58	5.39	4.42	0.53409	.	0.097455	0.39083	N	0.001467	T	0.32346	0.0826	N	0.14661	0.345	0.09310	N	0.999996	P	0.35077	0.483	B	0.27887	0.084	T	0.15464	-1.0436	9	.	.	.	.	15.5997	0.76613	0.0:0.8079:0.192:0.0	.	362	P50406	5HT6R_HUMAN	S	362	ENSP00000289753:P362S	.	P	+	1	0	HTR6	19878209	0.852000	0.29690	0.974000	0.42286	0.100000	0.18952	3.783000	0.55409	2.698000	0.92095	0.561000	0.74099	CCC		0.731	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007704.1	NM_000871		Missense_Mutation
USP48	84196	broad.mit.edu	37	1	22016487	22016487	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:22016487C>A	ENST00000308271.9	-	24	3637	c.2989G>T	c.(2989-2991)Gaa>Taa	p.E997*	USP48_ENST00000529637.1_Nonsense_Mutation_p.E1009*|USP48_ENST00000400301.1_Nonsense_Mutation_p.E945*|USP48_ENST00000374732.3_Nonsense_Mutation_p.E483*	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	997	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATGACAGATTCAGGAATGACG	0.393																																																0			1											93.0	89.0	90.0					1																	22016487		2203	4300	6503	21889074	SO:0001587	stop_gained	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2989G>T	1.37:g.22016487C>A	ENSP00000309262:p.Glu997*	Unknown		x	x	x	21889074	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Nonsense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	41	8.680176	0.98912	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	18.2065	0.89857	0.0:1.0:0.0:0.0	.	.	.	.	X	945;997;483;1009	.	ENSP00000309262:E997X	E	-	1	0	USP48	21889074	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	6.990000	0.76225	2.650000	0.89964	0.655000	0.94253	GAA		0.393	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		Nonsense_Mutation
CYP4A11	1579	broad.mit.edu	37	1	47401260	47401260	+	Silent	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:47401260G>A	ENST00000310638.4	-	5	601	c.570C>T	c.(568-570)tcC>tcT	p.S190S	CYP4A11_ENST00000371905.1_Silent_p.S190S|CYP4A11_ENST00000462347.1_Silent_p.S190S|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000457840.2_Silent_p.S86S|CYP4A11_ENST00000371904.4_Silent_p.S190S	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	190					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.S190S(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	GGGTCATCAAGGAGACGTGCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											107.0	88.0	95.0					1																	47401260		2203	4300	6503	47173847	SO:0001819	synonymous_variant	1579			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.570C>T	1.37:g.47401260G>A		Unknown		x	x	x	47173847	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Silent	SNP	ENST00000310638.4	37	CCDS543.1	SNP	35	Broad																																																																																				0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778		Silent
VAV3	10451	broad.mit.edu	37	1	108507379	108507379	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:108507379C>G	ENST00000370056.4	-	1	387	c.113G>C	c.(112-114)cGc>cCc	p.R38P	VAV3-AS1_ENST00000438318.1_RNA|VAV3_ENST00000371846.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.R38P	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	38	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.R38P(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GACTCCATCGCGGAGGGTCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	57.0	60.0					1																	108507379		2203	4300	6503	108308902	SO:0001583	missense	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.113G>C	1.37:g.108507379C>G	ENSP00000359073:p.Arg38Pro	Unknown		x	x	x	108308902	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	SNP	27	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.533533|4.533533	0.85812|0.85812	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000490388|ENST00000370056;ENST00000527011	.|T;T	.|0.61980	.|0.06;0.06	4.92|4.92	4.01|4.01	0.46588|0.46588	.|Calponin homology domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80292|0.80292	0.4596|0.4596	H|H	0.95402|0.95402	3.665|3.665	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.991;0.999	D|D	0.85452|0.85452	0.1161|0.1161	5|10	.|0.87932	.|D	.|0	.|.	11.7714|11.7714	0.51960|0.51960	0.0:0.9132:0.0:0.0868|0.0:0.9132:0.0:0.0868	.|.	.|38;38;38	.|B7ZLR1;E9PQ97;Q9UKW4	.|.;.;VAV3_HUMAN	P|P	33|38	.|ENSP00000359073:R38P;ENSP00000432540:R38P	.|ENSP00000359073:R38P	A|R	-|-	1|2	0|0	VAV3|VAV3	108308902|108308902	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.321000|7.321000	0.79088|0.79088	1.097000|1.097000	0.41459|0.41459	0.306000|0.306000	0.20318|0.20318	GCG|CGC		0.622	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		Missense_Mutation
SHE	126669	broad.mit.edu	37	1	154471696	154471696	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:154471696A>G	ENST00000304760.2	-	2	696	c.610T>C	c.(610-612)Tat>Cat	p.Y204H	TDRD10_ENST00000368482.4_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	204								p.Y204H(1)		breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGGTCAGCATAGTCTTCTAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											141.0	116.0	125.0					1																	154471696		2203	4300	6503	152738320	SO:0001583	missense	126669			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.610T>C	1.37:g.154471696A>G	ENSP00000307369:p.Tyr204His	Unknown		x	x	x	152738320	Q8TEQ5	Missense_Mutation	SNP	ENST00000304760.2	37	CCDS30877.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	24.3	4.521342	0.85600	.	.	ENSG00000169291	ENST00000304760	T	0.30981	1.51	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.49966	0.1588	M	0.82193	2.58	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.57075	-0.7873	10	0.59425	D	0.04	-29.6243	13.7207	0.62725	1.0:0.0:0.0:0.0	.	204	Q5VZ18	SHE_HUMAN	H	204	ENSP00000307369:Y204H	ENSP00000307369:Y204H	Y	-	1	0	SHE	152738320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.530000	0.90606	2.099000	0.63709	0.533000	0.62120	TAT		0.443	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087910.2	NM_001010846		Missense_Mutation
FLAD1	80308	broad.mit.edu	37	1	154960906	154960906	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:154960906C>A	ENST00000292180.3	+	2	1020	c.698C>A	c.(697-699)aCa>aAa	p.T233K	FLAD1_ENST00000315144.10_Missense_Mutation_p.T136K|FLAD1_ENST00000368432.1_Missense_Mutation_p.T136K|FLAD1_ENST00000487371.1_3'UTR|FLAD1_ENST00000295530.2_5'UTR|FLAD1_ENST00000368428.1_5'Flank|FLAD1_ENST00000405236.2_Missense_Mutation_p.T134K|FLAD1_ENST00000368431.3_Missense_Mutation_p.T134K|FLAD1_ENST00000368433.1_Missense_Mutation_p.T233K	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	233					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)	p.T233K(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CATTATGGCACAGATCCTTGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	66.0	67.0					1																	154960906		2203	4300	6503	153227530	SO:0001583	missense	80308				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.698C>A	1.37:g.154960906C>A	ENSP00000292180:p.Thr233Lys	Unknown		x	x	x	153227530	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	10.66	1.411583	0.25465	.	.	ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000368431;ENST00000292180;ENST00000405236	.	.	.	5.81	3.85	0.44370	Molybdopterin binding (4);	0.208574	0.48767	D	0.000164	T	0.27419	0.0673	L	0.41027	1.25	0.45837	D	0.998709	P;P	0.35944	0.529;0.488	B;B	0.39068	0.289;0.157	T	0.09335	-1.0679	9	0.32370	T	0.25	-6.4547	8.1602	0.31194	0.0:0.7234:0.1322:0.1443	.	233;134	Q8NFF5;Q8NFF5-4	FAD1_HUMAN;.	K	233;136;136;134;233;134	.	ENSP00000292180:T233K	T	+	2	0	FLAD1	153227530	0.002000	0.14202	0.999000	0.59377	0.820000	0.46376	0.468000	0.22051	1.477000	0.48234	0.462000	0.41574	ACA		0.587	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207		Missense_Mutation
CD55	1604	broad.mit.edu	37	1	207495738	207495738	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:207495738C>A	ENST00000367064.3	+	2	370	c.112C>A	c.(112-114)Ctt>Att	p.L38I	CD55_ENST00000367065.5_Missense_Mutation_p.L38I|CD55_ENST00000367067.4_Missense_Mutation_p.L38I|CD55_ENST00000314754.8_Missense_Mutation_p.L38I|CD55_ENST00000391921.4_Missense_Mutation_p.L38I|CD55_ENST00000391920.4_Missense_Mutation_p.L38I|CD55_ENST00000367062.4_Missense_Mutation_p.L38I|CD55_ENST00000367063.2_Missense_Mutation_p.L38I	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	38	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)	p.L38I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	TGACTGTGGCCTTCCCCCAGA	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	104.0	103.0					1																	207495738		2203	4300	6503	205562361	SO:0001583	missense	1604			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.112C>A	1.37:g.207495738C>A	ENSP00000356031:p.Leu38Ile	Unknown		x	x	x	205562361	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	ENST00000367064.3	37	CCDS31006.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	8.835	0.940771	0.18281	.	.	ENSG00000196352	ENST00000367064;ENST00000367063;ENST00000391921;ENST00000367067;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	T;T;T;T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	5.44	-1.88	0.07713	Complement control module (2);Sushi/SCR/CCP (3);	1.626250	0.03402	N	0.203510	T	0.58538	0.2129	N	0.25890	0.77	0.09310	N	1	D;P;B;P;B	0.69078	0.997;0.784;0.003;0.56;0.002	P;B;B;B;B	0.62740	0.906;0.413;0.029;0.413;0.048	T	0.51268	-0.8727	10	0.25106	T	0.35	.	0.6997	0.00905	0.2929:0.2616:0.2608:0.1847	.	38;38;38;38;38	B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.;.;.;DAF_HUMAN;.	I	38	ENSP00000356031:L38I;ENSP00000356030:L38I;ENSP00000375788:L38I;ENSP00000356034:L38I;ENSP00000316333:L38I;ENSP00000356032:L38I;ENSP00000375787:L38I;ENSP00000356029:L38I	ENSP00000316333:L38I	L	+	1	0	CD55	205562361	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.760000	0.04756	-0.026000	0.13895	-0.965000	0.02619	CTT		0.463	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574		Missense_Mutation
OBSCN	84033	broad.mit.edu	37	1	228402113	228402113	+	Silent	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:228402113G>T	ENST00000422127.1	+	4	1541	c.1497G>T	c.(1495-1497)acG>acT	p.T499T	OBSCN_ENST00000284548.11_Silent_p.T499T|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Silent_p.T499T|C1orf145_ENST00000295012.5_5'Flank|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	499	Ig-like 5.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.T499T(2)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACTGCCAGACGTCCACCCAGT	0.652																																																2	Substitution - coding silent(2)	ovary(2)	1											60.0	72.0	68.0					1																	228402113		2155	4228	6383	226468736	SO:0001819	synonymous_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.1497G>T	1.37:g.228402113G>T		Unknown		x	x	x	226468736	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	SNP	40	Broad																																																																																				0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		Silent
CYP26C1	340665	broad.mit.edu	37	10	94828165	94828166	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr10:94828165_94828166GC>AT	ENST00000285949.5	+	6	1280_1281	c.1280_1281GC>AT	c.(1279-1281)gGC>gAT	p.G427D		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	427					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.G427D(1)		central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				CCTCCCGAAGGCTTCGATCCAG	0.678																																																1	Substitution - Missense(1)	ovary(1)	10																																								94818156	SO:0001583	missense	340665				CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	Exception_encountered	10.37:g.94828165_94828166delinsAT	ENSP00000285949:p.Gly427Asp	Unknown		x	x	x	94818155	Q5VXH6	Missense_Mutation	DNP	ENST00000285949.5	37	CCDS7425.1	DNP	42	Broad																																																																																				0.678	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374		Missense_Mutation
DCHS1	8642	broad.mit.edu	37	11	6646656	6646656	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:6646656G>T	ENST00000299441.3	-	19	7330	c.6919C>A	c.(6919-6921)Ccc>Acc	p.P2307T		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2307	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2307T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACAGCACGGGTCCTGAGTCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	11											142.0	123.0	129.0					11																	6646656		2201	4296	6497	6603232	SO:0001583	missense	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6919C>A	11.37:g.6646656G>T	ENSP00000299441:p.Pro2307Thr	Unknown		x	x	x	6603232	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903547	0.72754	.	.	ENSG00000166341	ENST00000299441	T	0.54479	0.57	4.93	4.93	0.64822	Cadherin (4);Cadherin-like (1);	0.000000	0.42548	D	0.000699	T	0.67496	0.2899	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.64419	-0.6412	10	0.34782	T	0.22	.	16.9038	0.86120	0.0:0.0:1.0:0.0	.	2307	Q96JQ0	PCD16_HUMAN	T	2307	ENSP00000299441:P2307T	ENSP00000299441:P2307T	P	-	1	0	DCHS1	6603232	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.147000	0.94646	2.561000	0.86390	0.655000	0.94253	CCC		0.562	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		Missense_Mutation
METTL15	196074	broad.mit.edu	37	11	28135029	28135029	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:28135029G>T	ENST00000407364.3	+	3	500	c.148G>T	c.(148-150)Gat>Tat	p.D50Y	METTL15_ENST00000379199.2_Missense_Mutation_p.D50Y|METTL15_ENST00000342303.5_Missense_Mutation_p.D50Y|METTL15_ENST00000406787.3_Missense_Mutation_p.D50Y|METTL15_ENST00000403099.1_Missense_Mutation_p.D50Y|METTL15_ENST00000303459.6_Missense_Mutation_p.D50Y			A6NJ78	MET15_HUMAN	methyltransferase like 15	50							methyltransferase activity (GO:0008168)	p.D50Y(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						GGAGCAAACAGATCAAACTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											52.0	59.0	57.0					11																	28135029		2202	4299	6501	28091605	SO:0001583	missense	196074			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.148G>T	11.37:g.28135029G>T	ENSP00000384369:p.Asp50Tyr	Unknown		x	x	x	28091605	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Missense_Mutation	SNP	ENST00000407364.3	37	CCDS44559.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	3.329	-0.137051	0.06711	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000403099;ENST00000407364;ENST00000379199;ENST00000303459	T;T;T;T;T;T	0.46063	1.43;1.46;0.88;1.88;0.88;1.46	5.68	0.285	0.15705	.	1.560150	0.03265	N	0.183849	T	0.28466	0.0704	N	0.16478	0.41	0.09310	N	1	B;B;B	0.10296	0.0;0.0;0.003	B;B;B	0.08055	0.0;0.001;0.003	T	0.23190	-1.0195	10	0.46703	T	0.11	.	6.4548	0.21924	0.1468:0.0:0.3386:0.5146	.	50;50;50	A6NJ78;A6NJ78-2;A6NJ78-4	MET15_HUMAN;.;.	Y	50	ENSP00000385507:D50Y;ENSP00000342259:D50Y;ENSP00000385860:D50Y;ENSP00000384369:D50Y;ENSP00000368497:D50Y;ENSP00000307251:D50Y	ENSP00000307251:D50Y	D	+	1	0	METTL15	28091605	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-0.901000	0.04093	0.089000	0.17243	-0.230000	0.12252	GAT		0.383	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318135.2	NM_152636		Missense_Mutation
ARFGAP2	84364	broad.mit.edu	37	11	47196804	47196804	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:47196804G>A	ENST00000524782.1	-	4	553	c.325C>T	c.(325-327)Cga>Tga	p.R109*	ARFGAP2_ENST00000419701.2_Nonsense_Mutation_p.R30*|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000319543.6_Intron|ARFGAP2_ENST00000426335.2_Intron	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	109	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.|Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.R109*(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						TGGGCAGCTCGGCTATTATAT	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	11											110.0	113.0	112.0					11																	47196804		2201	4298	6499	47153380	SO:0001587	stop_gained	84364			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.325C>T	11.37:g.47196804G>A	ENSP00000434442:p.Arg109*	Unknown		x	x	x	47153380	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Nonsense_Mutation	SNP	ENST00000524782.1	37	CCDS7926.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819227	0.71028	.	.	ENSG00000149182	ENST00000524782;ENST00000419701;ENST00000525398;ENST00000525314;ENST00000528444;ENST00000530596	.	.	.	5.52	5.52	0.82312	.	0.060746	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.0328	19.4741	0.94979	0.0:0.0:1.0:0.0	.	.	.	.	X	109;30;109;109;109;102	.	ENSP00000389264:R30X	R	-	1	2	ARFGAP2	47153380	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.612000	0.36889	2.595000	0.87683	0.655000	0.94253	CGA		0.567	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389		Nonsense_Mutation
GDPD5	81544	broad.mit.edu	37	11	75153484	75153484	+	Missense_Mutation	SNP	C	C	T	rs375711308		TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:75153484C>T	ENST00000336898.3	-	12	1928	c.1091G>A	c.(1090-1092)cGg>cAg	p.R364Q	GDPD5_ENST00000529721.1_Missense_Mutation_p.R364Q|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000526177.1_Missense_Mutation_p.R226Q|GDPD5_ENST00000533805.1_Missense_Mutation_p.R119Q|GDPD5_ENST00000376282.3_Missense_Mutation_p.R245Q|GDPD5_ENST00000533784.1_Missense_Mutation_p.R245Q	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	364	GP-PDE.				cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)	p.R364Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						GGGGTGCTCCCGGGGCGGGTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	11							GLN/ARG	0,4400		0,0,2200	30.0	29.0	30.0		1091	3.6	0.6	11		30	1,8583	1.2+/-3.3	0,1,4291	no	missense	GDPD5	NM_030792.6	43	0,1,6491	TT,TC,CC		0.0116,0.0,0.0077	benign	364/606	75153484	1,12983	2200	4292	6492	74831132	SO:0001583	missense	81544			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1091G>A	11.37:g.75153484C>T	ENSP00000337972:p.Arg364Gln	Unknown		x	x	x	74831132	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	ENST00000336898.3	37	CCDS8238.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	9.099	1.003548	0.19121	0.0	1.16E-4	ENSG00000158555	ENST00000526177;ENST00000533784;ENST00000529721;ENST00000336898;ENST00000533805;ENST00000376282	T;T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8;2.8	5.54	3.62	0.41486	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.349613	0.30260	N	0.010039	T	0.07324	0.0185	L	0.31420	0.93	0.20074	N	0.999934	D;P	0.60160	0.987;0.949	B;B	0.42851	0.4;0.301	T	0.24548	-1.0157	10	0.13108	T	0.6	-33.8769	8.517	0.33253	0.0:0.7524:0.0:0.2476	.	245;364	Q8WTR4-2;Q8WTR4	.;GDPD5_HUMAN	Q	226;245;364;364;119;245	ENSP00000434050:R226Q;ENSP00000437049:R245Q;ENSP00000433214:R364Q;ENSP00000337972:R364Q;ENSP00000435196:R119Q;ENSP00000365459:R245Q	ENSP00000337972:R364Q	R	-	2	0	GDPD5	74831132	0.000000	0.05858	0.617000	0.29091	0.779000	0.44077	0.583000	0.23849	1.311000	0.45024	0.450000	0.29827	CGG		0.647	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792		Missense_Mutation
MYO7A	4647	broad.mit.edu	37	11	76900433	76900433	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:76900433C>A	ENST00000409709.3	+	28	3820	c.3548C>A	c.(3547-3549)cCc>cAc	p.P1183H	MYO7A_ENST00000409619.2_Missense_Mutation_p.P1172H|MYO7A_ENST00000458637.2_Missense_Mutation_p.P1183H	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1183	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ACCCACAACCCCTCCAAGAGC	0.627																																																0			11											68.0	80.0	76.0					11																	76900433		2073	4174	6247	76578081	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3548C>A	11.37:g.76900433C>A	ENSP00000386331:p.Pro1183His	Unknown		x	x	x	76578081	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	.	20.8	4.053814	0.75960	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.43	5.43	0.79202	MyTH4 domain (3);	0.000000	0.85682	D	0.000000	D	0.96762	0.8943	M	0.81341	2.54	0.80722	D	1	D;B;D	0.89917	0.997;0.081;1.0	D;B;D	0.78314	0.964;0.053;0.991	D	0.96203	0.9147	10	0.44086	T	0.13	.	19.2615	0.93970	0.0:1.0:0.0:0.0	.	1172;1183;1183	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	H	1183;1183;1172;394;1182;1152;1059;364	ENSP00000386331:P1183H;ENSP00000392185:P1183H;ENSP00000386635:P1172H;ENSP00000417017:P364H	ENSP00000345075:P1059H	P	+	2	0	MYO7A	76578081	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.762000	0.68809	2.546000	0.85860	0.643000	0.83706	CCC		0.627	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		Missense_Mutation
FLI1	2313	broad.mit.edu	37	11	128680705	128680705	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:128680705A>G	ENST00000527786.2	+	9	1670	c.1181A>G	c.(1180-1182)cAc>cGc	p.H394R	FLI1_ENST00000534087.2_Missense_Mutation_p.H361R|FLI1_ENST00000281428.8_Missense_Mutation_p.H328R|FLI1_ENST00000344954.6_Missense_Mutation_p.H361R|FLI1_ENST00000525560.1_Missense_Mutation_p.H201R	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	394					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H394R(1)	EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		TACCATGCCCACCAGCAGAAG	0.567			T	EWSR1	Ewing sarcoma																																		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	1	Substitution - Missense(1)	ovary(1)	11											102.0	108.0	106.0					11																	128680705		2140	4232	6372	128185915	SO:0001583	missense	2313			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.1181A>G	11.37:g.128680705A>G	ENSP00000433488:p.His394Arg	Unknown		x	x	x	128185915	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	37	CCDS44768.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	16.81	3.226404	0.58668	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.34	5.34	0.76211	.	0.144445	0.64402	D	0.000006	T	0.72495	0.3467	M	0.79258	2.445	0.80722	D	1	D;P;D	0.71674	0.998;0.938;0.99	D;P;D	0.70487	0.969;0.614;0.948	T	0.76547	-0.2919	10	0.72032	D	0.01	.	15.4829	0.75542	1.0:0.0:0.0:0.0	.	394;201;328	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	R	201;361;394;361;328	ENSP00000437124:H201R;ENSP00000339627:H361R;ENSP00000399985:H394R;ENSP00000432950:H361R;ENSP00000281428:H328R	ENSP00000281428:H328R	H	+	2	0	FLI1	128185915	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	9.081000	0.94049	2.241000	0.73720	0.528000	0.53228	CAC		0.567	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017		Missense_Mutation
NCAPD3	23310	broad.mit.edu	37	11	134090513	134090513	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr11:134090513A>T	ENST00000534548.2	-	2	236	c.172T>A	c.(172-174)Tat>Aat	p.Y58N		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	58					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.Y58N(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AGGCTTTCATAGAGTTTTGTG	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											203.0	175.0	184.0					11																	134090513		2201	4297	6498	133595723	SO:0001583	missense	23310			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.172T>A	11.37:g.134090513A>T	ENSP00000433681:p.Tyr58Asn	Unknown		x	x	x	133595723	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	10.92	1.487956	0.26686	.	.	ENSG00000151503	ENST00000534548;ENST00000525485	T	0.24538	1.85	5.56	1.84	0.25277	.	0.290655	0.39909	N	0.001229	T	0.24470	0.0593	L	0.56769	1.78	0.53688	D	0.999973	P	0.48089	0.905	B	0.44108	0.441	T	0.02238	-1.1190	10	0.72032	D	0.01	-8.552	5.3644	0.16105	0.6516:0.137:0.2115:0.0	.	58	P42695	CNDD3_HUMAN	N	58	ENSP00000433681:Y58N	ENSP00000436037:Y58N	Y	-	1	0	NCAPD3	133595723	0.935000	0.31712	0.508000	0.27688	0.274000	0.26718	1.879000	0.39618	0.058000	0.16222	0.533000	0.62120	TAT		0.408	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		Missense_Mutation
CD9	928	broad.mit.edu	37	12	6309730	6309730	+	Splice_Site	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr12:6309730G>T	ENST00000382518.1	+	2	501	c.65G>T	c.(64-66)tGg>tTg	p.W22L	CD9_ENST00000382515.2_5'Flank|CD9_ENST00000009180.4_Splice_Site_p.W22L			P21926	CD9_HUMAN	CD9 molecule	22					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)		p.W22L(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						TTCATCTTCTGGGTGAGTGAG	0.652																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	75.0	79.0					12																	6309730		2203	4300	6503	6179991	SO:0001630	splice_region_variant	928			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.66+1G>T	12.37:g.6309730G>T		Unknown		x	x	x	6179991	D3DUQ9|Q5J7W6|Q96ES4	Missense_Mutation	SNP	ENST00000382518.1	37	CCDS8540.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025188	0.54683	.	.	ENSG00000010278	ENST00000382518;ENST00000536586;ENST00000382519;ENST00000425469;ENST00000009180	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	4.21	3.3	0.37823	.	0.298550	0.40302	N	0.001139	D	0.83422	0.5251	M	0.77712	2.385	0.80722	D	1	P;D;B	0.63880	0.568;0.993;0.016	P;P;B	0.58130	0.464;0.833;0.076	D	0.83431	0.0038	10	0.59425	D	0.04	.	9.0899	0.36603	0.0:0.0:0.781:0.219	.	22;22;22	B4DK09;B4DL91;P21926	.;.;CD9_HUMAN	L	22	ENSP00000371958:W22L;ENSP00000440985:W22L;ENSP00000371959:W22L;ENSP00000009180:W22L	ENSP00000009180:W22L	W	+	2	0	CD9	6179991	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.636000	0.67848	0.955000	0.37878	0.544000	0.68410	TGG		0.652	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103348.1		Missense_Mutation	Missense_Mutation
LPAR5	57121	broad.mit.edu	37	12	6730295	6730295	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr12:6730295G>T	ENST00000329858.4	-	2	876	c.120C>A	c.(118-120)aaC>aaA	p.N40K	LPAR5_ENST00000540335.1_5'UTR|LPAR5_ENST00000431922.1_Missense_Mutation_p.N40K	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N40K(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						GGGCTAGCGCGTTGAGGGGGA	0.637																																					NSCLC(74;891 2312 37538)											1	Substitution - Missense(1)	ovary(1)	12											84.0	75.0	78.0					12																	6730295		2203	4300	6503	6600556	SO:0001583	missense	57121			AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.120C>A	12.37:g.6730295G>T	ENSP00000327875:p.Asn40Lys	Unknown		x	x	x	6600556		Missense_Mutation	SNP	ENST00000329858.4	37	CCDS8553.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486808	0.44249	.	.	ENSG00000184574	ENST00000329858;ENST00000431922;ENST00000435659	D;D	0.96619	-4.07;-4.07	5.16	-0.1	0.13621	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	D	0.98232	0.9415	H	0.96080	3.765	0.38636	D	0.951503	D	0.89917	1.0	D	0.91635	0.999	D	0.97277	0.9915	10	0.87932	D	0	.	8.1756	0.31281	0.6643:0.0:0.3357:0.0	.	40	Q9H1C0	LPAR5_HUMAN	K	40	ENSP00000327875:N40K;ENSP00000393098:N40K	ENSP00000327875:N40K	N	-	3	2	LPAR5	6600556	0.067000	0.21026	0.931000	0.37212	0.155000	0.21991	0.426000	0.21363	0.074000	0.16767	-0.291000	0.09656	AAC		0.637	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400699.1	NM_020400		Missense_Mutation
ESPL1	9700	broad.mit.edu	37	12	53676072	53676072	+	Silent	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr12:53676072C>T	ENST00000257934.4	+	14	2735	c.2644C>T	c.(2644-2646)Ctg>Ttg	p.L882L	ESPL1_ENST00000552462.1_Silent_p.L882L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	882					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.L882L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CTCTCTGCTGCTGTCTGTGCT	0.592																																					Colon(53;1069 1201 2587 5382)											1	Substitution - coding silent(1)	ovary(1)	12											174.0	140.0	151.0					12																	53676072		2203	4300	6503	51962339	SO:0001819	synonymous_variant	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.2644C>T	12.37:g.53676072C>T		Unknown		x	x	x	51962339		Silent	SNP	ENST00000257934.4	37	CCDS8852.1	SNP	28	Broad																																																																																				0.592	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291		Silent
ITGA7	3679	broad.mit.edu	37	12	56092571	56092571	+	Silent	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr12:56092571G>A	ENST00000555728.1	-	7	1081	c.1053C>T	c.(1051-1053)ccC>ccT	p.P351P	ITGA7_ENST00000257879.6_Silent_p.P307P|ITGA7_ENST00000394230.2_Silent_p.P311P|ITGA7_ENST00000553804.1_Silent_p.P311P|ITGA7_ENST00000347027.6_Silent_p.P307P|ITGA7_ENST00000394229.2_Silent_p.P307P|ITGA7_ENST00000257880.7_Silent_p.P351P|ITGA7_ENST00000452168.2_Silent_p.P214P			Q13683	ITA7_HUMAN	integrin, alpha 7	351					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.P307P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCATAACCTCGGGCACCAGGC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	12											64.0	52.0	56.0					12																	56092571		2203	4300	6503	54378838	SO:0001819	synonymous_variant	3679				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.1053C>T	12.37:g.56092571G>A		Unknown		x	x	x	54378838	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Silent	SNP	ENST00000555728.1	37		SNP	39	Broad																																																																																				0.642	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206		Silent
GNPTAB	79158	broad.mit.edu	37	12	102155355	102155355	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr12:102155355C>T	ENST00000299314.7	-	14	3164	c.2902G>A	c.(2902-2904)Gaa>Aaa	p.E968K		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	968					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TCTTGCAGTTCTTGCATAACA	0.378																																																0			12											114.0	103.0	107.0					12																	102155355		2203	4300	6503	100679486	SO:0001583	missense	79158			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.2902G>A	12.37:g.102155355C>T	ENSP00000299314:p.Glu968Lys	Unknown		x	x	x	100679486	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	37	CCDS9088.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954757	0.92726	.	.	ENSG00000111670	ENST00000299314	D	0.92249	-3.0	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.95755	0.8619	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94781	0.7953	10	0.46703	T	0.11	-32.6824	20.1865	0.98220	0.0:1.0:0.0:0.0	.	968	Q3T906	GNPTA_HUMAN	K	968	ENSP00000299314:E968K	ENSP00000299314:E968K	E	-	1	0	GNPTAB	100679486	1.000000	0.71417	0.993000	0.49108	0.853000	0.48598	7.487000	0.81328	2.775000	0.95449	0.655000	0.94253	GAA		0.378	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1			Missense_Mutation
DRAM1	55332	broad.mit.edu	37	12	102315002	102315002	+	Silent	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr12:102315002C>A	ENST00000258534.8	+	7	1120	c.681C>A	c.(679-681)acC>acA	p.T227T	RP11-512N21.3_ENST00000551918.1_RNA|DRAM1_ENST00000544152.1_Silent_p.T117T	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	227					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.T121T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						AGAGTGTCACCCTAAGGATAT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	12											122.0	115.0	117.0					12																	102315002		1846	4092	5938	100839133	SO:0001819	synonymous_variant	55332			BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.681C>A	12.37:g.102315002C>A		Unknown		x	x	x	100839133	B7Z4T0|Q7L3E3|Q9NUN1	Silent	SNP	ENST00000258534.8	37	CCDS41823.1	SNP	22	Broad																																																																																				0.383	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409195.1	NM_018370		Silent
ALG11	440138	broad.mit.edu	37	13	52593264	52593264	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr13:52593264G>C	ENST00000521508.1	+	2	265	c.260G>C	c.(259-261)aGa>aCa	p.R87T	ALG11_ENST00000523764.1_Intron	NM_001004127.2	NP_001004127.2	Q2TAA5	ALG11_HUMAN	ALG11, alpha-1,2-mannosyltransferase	87					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GDP-Man:Man3GlcNAc2-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0004377)	p.R87T(1)		endometrium(1)|large_intestine(6)|lung(4)|ovary(2)	13		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.44e-08)		TGTGCTTTAAGAGCCCTGCAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	13											59.0	56.0	57.0					13																	52593264		2203	4300	6503	51491265	SO:0001583	missense	440138			AK025456	CCDS31977.1	13q14.3	2013-02-22	2013-02-22		ENSG00000253710	ENSG00000253710	2.4.1.131	"""Glycosyltransferase group 1 domain containing"""	32456	protein-coding gene	gene with protein product	"""GDP-Man:Man(3)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"""	613666	"""asparagine-linked glycosylation 11 homolog (S. cerevisiae, alpha-1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)"""			20080937	Standard	NM_001004127		Approved	KIAA0266		Q2TAA5	OTTHUMG00000016959	ENST00000521508.1:c.260G>C	13.37:g.52593264G>C	ENSP00000430236:p.Arg87Thr	Unknown		x	x	x	51491265	A5PLP3|B4DKW9|Q5TAN9|Q6DKI6|Q96FI7	Missense_Mutation	SNP	ENST00000521508.1	37	CCDS31977.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164892	0.57476	.	.	ENSG00000253710	ENST00000521508	T	0.80653	-1.4	5.65	4.81	0.61882	.	0.000000	0.85682	U	0.000000	D	0.86502	0.5948	M	0.91406	3.205	0.80722	D	1	P	0.52577	0.954	P	0.46299	0.511	D	0.89348	0.3659	10	0.72032	D	0.01	.	14.4288	0.67236	0.0709:0.0:0.9291:0.0	.	87	Q2TAA5	ALG11_HUMAN	T	87	ENSP00000430236:R87T	ENSP00000430236:R87T	R	+	2	0	ALG11	51491265	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.412000	0.80091	1.395000	0.46643	0.579000	0.79373	AGA		0.323	ALG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045050.1	NM_001004127		Missense_Mutation
PCDH9	5101	broad.mit.edu	37	13	67799663	67799663	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr13:67799663G>T	ENST00000377865.2	-	1	3044	c.2910C>A	c.(2908-2910)gaC>gaA	p.D970E	PCDH9_ENST00000377861.3_Missense_Mutation_p.D970E|PCDH9_ENST00000544246.1_Missense_Mutation_p.D970E|PCDH9_ENST00000328454.5_Missense_Mutation_p.D970E|PCDH9_ENST00000456367.1_Missense_Mutation_p.D970E			Q9HC56	PCDH9_HUMAN	protocadherin 9	970					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D970E(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CAAAGGTGTTGTCCAAAGGGA	0.483																																																1	Substitution - Missense(1)	ovary(1)	13											145.0	142.0	143.0					13																	67799663		2203	4300	6503	66697664	SO:0001583	missense	5101			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2910C>A	13.37:g.67799663G>T	ENSP00000367096:p.Asp970Glu	Unknown		x	x	x	66697664	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745389	0.49151	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.63	5.63	0.86233	Protocadherin (1);	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	M	0.62723	1.935	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.51164	-0.8740	10	0.46703	T	0.11	.	19.6647	0.95889	0.0:0.0:1.0:0.0	.	970;970;970;970	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	E	970	ENSP00000442186:D970E;ENSP00000367096:D970E;ENSP00000401699:D970E;ENSP00000332060:D970E;ENSP00000367092:D970E	ENSP00000332060:D970E	D	-	3	2	PCDH9	66697664	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.268000	0.78473	2.651000	0.90000	0.655000	0.94253	GAC		0.483	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487		Missense_Mutation
RPGRIP1	57096	broad.mit.edu	37	14	21819340	21819340	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:21819340A>G	ENST00000400017.2	+	24	3826	c.3826A>G	c.(3826-3828)Att>Gtt	p.I1276V	RPGRIP1_ENST00000206660.6_Missense_Mutation_p.I1276V|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.I933V|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.I1238V|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.I635V|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.I602V	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	1276	Interaction with RPGR. {ECO:0000269|PubMed:24981858}.				eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.I892V(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CCTCCATGCTATTTACAAGGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	14											70.0	62.0	64.0					14																	21819340		1869	4111	5980	20889180	SO:0001583	missense	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.3826A>G	14.37:g.21819340A>G	ENSP00000382895:p.Ile1276Val	Unknown		x	x	x	20889180	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.448864	0.01080	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	4.6	2.23	0.28157	.	0.150821	0.43260	N	0.000587	T	0.56485	0.1988	N	0.25647	0.755	0.23616	N	0.997281	B;B;B;B;B;P	0.35192	0.02;0.02;0.02;0.384;0.081;0.489	B;B;B;B;B;B	0.41374	0.061;0.061;0.036;0.355;0.061;0.044	T	0.51639	-0.8680	10	0.02654	T	1	-4.0455	6.2773	0.20987	0.705:0.0:0.295:0.0	.	659;635;751;602;892;1276	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	V	933;1238;1276;1276;602;751;635	ENSP00000450445:I933V;ENSP00000451219:I1238V;ENSP00000382895:I1276V;ENSP00000206660:I1276V;ENSP00000372391:I602V;ENSP00000451262:I751V;ENSP00000309721:I635V	ENSP00000206660:I1276V	I	+	1	0	RPGRIP1	20889180	0.983000	0.35010	0.535000	0.28026	0.958000	0.62258	1.314000	0.33597	0.299000	0.22661	0.456000	0.33151	ATT		0.413	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		Missense_Mutation
AKAP6	9472	broad.mit.edu	37	14	33291441	33291441	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:33291441A>C	ENST00000280979.4	+	13	4592	c.4422A>C	c.(4420-4422)caA>caC	p.Q1474H	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1474					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.Q1474H(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CATACCTCCAAGGCTCAAAAC	0.353																																					Melanoma(49;821 1200 7288 13647 42351)											1	Substitution - Missense(1)	ovary(1)	14											75.0	73.0	74.0					14																	33291441		2203	4300	6503	32361192	SO:0001583	missense	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4422A>C	14.37:g.33291441A>C	ENSP00000280979:p.Gln1474His	Unknown		x	x	x	32361192	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	13.57	2.276089	0.40294	.	.	ENSG00000151320	ENST00000280979	T	0.08984	3.03	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000002	T	0.24314	0.0589	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.00662	-1.1621	10	0.87932	D	0	-9.713	9.2882	0.37771	0.9186:0.0:0.0814:0.0	.	1474	Q13023	AKAP6_HUMAN	H	1474	ENSP00000280979:Q1474H	ENSP00000280979:Q1474H	Q	+	3	2	AKAP6	32361192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.449000	0.52950	2.033000	0.60031	0.460000	0.39030	CAA		0.353	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		Missense_Mutation
SRP54	6729	broad.mit.edu	37	14	35492183	35492183	+	Silent	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:35492183A>G	ENST00000556994.1	+	15	1621	c.1224A>G	c.(1222-1224)agA>agG	p.R408R	SRP54_ENST00000555557.1_Silent_p.R344R|SRP54_ENST00000216774.6_Silent_p.R408R|SRP54_ENST00000546080.1_Silent_p.R359R			P61011	SRP54_HUMAN	signal recognition particle 54kDa	408	M-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)	p.R408R(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		GAGTAGCAAGAGGATCGGGTG	0.393																																																1	Substitution - coding silent(1)	ovary(1)	14											107.0	99.0	102.0					14																	35492183		2203	4300	6503	34561934	SO:0001819	synonymous_variant	6729			X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.1224A>G	14.37:g.35492183A>G		Unknown		x	x	x	34561934	B2R759|B4DUW6|P13624	Silent	SNP	ENST00000556994.1	37	CCDS9652.1	SNP	11	Broad																																																																																				0.393	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276643.2	NM_003136		Silent
FUT8	2530	broad.mit.edu	37	14	66136172	66136172	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:66136172C>T	ENST00000360689.5	+	7	2536	c.809C>T	c.(808-810)tCt>tTt	p.S270F	FUT8_ENST00000417683.1_Silent_p.I5I|FUT8_ENST00000557164.1_Missense_Mutation_p.S107F|FUT8_ENST00000554765.1_3'UTR|FUT8_ENST00000358307.2_Missense_Mutation_p.S141F|FUT8_ENST00000394586.2_Missense_Mutation_p.S270F|FUT8_ENST00000394585.1_Missense_Mutation_p.S270F	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	270	GT23. {ECO:0000255|PROSITE- ProRule:PRU00992}.				cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)	p.S270F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		ACAGACAGATCTGGCATCTCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	14											142.0	126.0	131.0					14																	66136172		2203	4300	6503	65205925	SO:0001583	missense	2530			AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.809C>T	14.37:g.66136172C>T	ENSP00000353910:p.Ser270Phe	Unknown		x	x	x	65205925	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Missense_Mutation	SNP	ENST00000360689.5	37	CCDS9775.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568524	0.65651	.	.	ENSG00000033170	ENST00000360689;ENST00000394586;ENST00000557164;ENST00000394585;ENST00000358307	D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5	5.85	4.96	0.65561	.	0.220665	0.48767	D	0.000173	D	0.86159	0.5866	L	0.49350	1.555	0.54753	D	0.999985	P;B	0.41131	0.739;0.002	B;B	0.38562	0.276;0.004	D	0.86926	0.2070	10	0.72032	D	0.01	-4.4709	14.1048	0.65080	0.1516:0.8484:0.0:0.0	.	141;270	G3XAD2;Q9BYC5	.;FUT8_HUMAN	F	270;270;107;270;141	ENSP00000353910:S270F;ENSP00000378087:S270F;ENSP00000452433:S107F;ENSP00000378086:S270F;ENSP00000351057:S141F	ENSP00000345865:S270F	S	+	2	0	FUT8	65205925	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.077000	0.71275	1.446000	0.47643	0.655000	0.94253	TCT		0.468	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286406.1	NM_004480		Missense_Mutation
TRIP11	9321	broad.mit.edu	37	14	92471206	92471206	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:92471206C>A	ENST00000267622.4	-	11	3487	c.3114G>T	c.(3112-3114)aaG>aaT	p.K1038N		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1038					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.K1038N(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		AAGATATATTCTTTTCATTTA	0.318			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	1	Substitution - Missense(1)	ovary(1)	14											46.0	49.0	48.0					14																	92471206		2202	4297	6499	91540959	SO:0001583	missense	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3114G>T	14.37:g.92471206C>A	ENSP00000267622:p.Lys1038Asn	Unknown		x	x	x	91540959	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.28|18.28	3.590207|3.590207	0.66105|0.66105	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000554357|ENST00000267622;ENST00000542257	.|T	.|0.09073	.|3.02	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.21103	.|0.0508	L|L	0.34521|0.34521	1.04|1.04	0.49687|0.49687	D|D	0.999811|0.999811	.|D;D	.|0.76494	.|0.997;0.999	.|D;D	.|0.72982	.|0.94;0.979	.|T	.|0.00518	.|-1.1693	.|10	.|0.40728	.|T	.|0.16	.|.	19.8688|19.8688	0.96842|0.96842	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|774;1038	.|F5H1Z0;Q15643	.|.;TRIPB_HUMAN	X|N	754|1038;774	.|ENSP00000267622:K1038N	.|ENSP00000267622:K1038N	E|K	-|-	1|3	0|2	TRIP11|TRIP11	91540959|91540959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	2.700000|2.700000	0.47085|0.47085	2.695000|2.695000	0.91970|0.91970	0.558000|0.558000	0.71614|0.71614	GAA|AAG		0.318	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1			Missense_Mutation
ADSSL1	122622	broad.mit.edu	37	14	105207464	105207464	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:105207464A>G	ENST00000330877.2	+	8	762	c.677A>G	c.(676-678)gAg>gGg	p.E226G	ADSSL1_ENST00000332972.5_Missense_Mutation_p.E269G	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1									p.E269G(1)		central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		GGCTTTGCTGAGCGGATCAGA	0.612																																																1	Substitution - Missense(1)	ovary(1)	14											82.0	77.0	79.0					14																	105207464		2203	4300	6503	104278509	SO:0001583	missense	122622			AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.677A>G	14.37:g.105207464A>G	ENSP00000331260:p.Glu226Gly	Unknown		x	x	x	104278509		Missense_Mutation	SNP	ENST00000330877.2	37	CCDS9990.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	22.7	4.324677	0.81580	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.48522	0.81;0.81	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.72078	0.3416	H	0.95260	3.645	0.80722	D	1	D;D	0.56521	0.964;0.976	P;P	0.54060	0.714;0.741	T	0.82335	-0.0508	10	0.87932	D	0	-3.8547	14.9241	0.70862	1.0:0.0:0.0:0.0	.	269;226	Q8N142-2;Q8N142	.;PURA1_HUMAN	G	226;269	ENSP00000331260:E226G;ENSP00000333019:E269G	ENSP00000331260:E226G	E	+	2	0	ADSSL1	104278509	1.000000	0.71417	0.365000	0.25901	0.634000	0.38068	9.191000	0.94940	1.937000	0.56155	0.533000	0.62120	GAG		0.612	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1			Missense_Mutation
PACS2	23241	broad.mit.edu	37	14	105814830	105814830	+	Splice_Site	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr14:105814830G>T	ENST00000325438.8	+	2	624	c.120G>T	c.(118-120)agG>agT	p.R40S	PACS2_ENST00000547217.1_Splice_Site_p.R40S|PACS2_ENST00000458164.2_Splice_Site_p.R40S|PACS2_ENST00000447393.1_Splice_Site_p.R40S|PACS2_ENST00000430725.2_5'UTR			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	40					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)		p.R40S(1)		endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		TGCCTCACAGGTTGTGCAGCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	14											146.0	114.0	125.0					14																	105814830		2202	4299	6501	104885875	SO:0001630	splice_region_variant	23241			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.120-1G>T	14.37:g.105814830G>T		Unknown		x	x	x	104885875	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695578	0.48202	.	.	ENSG00000179364	ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217	T;T;T;T	0.55052	0.56;0.54;0.57;0.8	4.06	3.16	0.36331	.	0.000000	0.85682	U	0.000000	T	0.67850	0.2937	M	0.83312	2.635	0.80722	D	1	P;D;P	0.59767	0.826;0.986;0.598	P;P;B	0.59487	0.633;0.858;0.111	T	0.70846	-0.4761	9	.	.	.	.	10.7087	0.45971	0.0969:0.0:0.9031:0.0	.	40;40;40	E9PB38;Q86VP3-2;Q86VP3	.;.;PACS2_HUMAN	S	40	ENSP00000321834:R40S;ENSP00000399732:R40S;ENSP00000393559:R40S;ENSP00000449525:R40S	.	R	+	3	2	PACS2	104885875	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	4.369000	0.59511	1.047000	0.40274	-0.310000	0.09108	AGG		0.637	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355	Missense_Mutation	Missense_Mutation
PLA2G4F	255189	broad.mit.edu	37	15	42442884	42442884	+	Silent	SNP	G	G	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr15:42442884G>C	ENST00000382396.4	-	8	779	c.693C>G	c.(691-693)ccC>ccG	p.P231P	PLA2G4F_ENST00000397272.3_Silent_p.P231P			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	231					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)	p.P231P(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		AGGTAAAGGTGGGTGGGAGGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	15											55.0	52.0	53.0					15																	42442884		2203	4299	6502	40230176	SO:0001819	synonymous_variant	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.693C>G	15.37:g.42442884G>C		Unknown		x	x	x	40230176	Q6ZMC8	Silent	SNP	ENST00000382396.4	37	CCDS32204.1	SNP	47	Broad																																																																																				0.637	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600		Silent
ADCY9	115	broad.mit.edu	37	16	4164975	4164975	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr16:4164975C>A	ENST00000294016.3	-	2	1007	c.469G>T	c.(469-471)Gtg>Ttg	p.V157L		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	157					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.V157L(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AAGAAGCCCACACACACCAGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	16											87.0	88.0	88.0					16																	4164975		2197	4300	6497	4104976	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.469G>T	16.37:g.4164975C>A	ENSP00000294016:p.Val157Leu	Unknown		x	x	x	4104976	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	2.385	-0.341098	0.05243	.	.	ENSG00000162104	ENST00000294016	T	0.69685	-0.42	5.71	5.71	0.89125	.	0.443546	0.22210	N	0.063117	T	0.45418	0.1341	N	0.08118	0	0.27733	N	0.944743	B	0.02656	0.0	B	0.01281	0.0	T	0.15983	-1.0418	10	0.13470	T	0.59	.	14.7312	0.69383	0.0:0.7356:0.2644:0.0	.	157	O60503	ADCY9_HUMAN	L	157	ENSP00000294016:V157L	ENSP00000294016:V157L	V	-	1	0	ADCY9	4104976	1.000000	0.71417	0.989000	0.46669	0.863000	0.49368	1.582000	0.36568	2.713000	0.92767	0.555000	0.69702	GTG		0.602	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			Missense_Mutation
MYH13	8735	broad.mit.edu	37	17	10223673	10223673	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:10223673C>A	ENST00000418404.3	-	24	3415	c.3252G>T	c.(3250-3252)ttG>ttT	p.L1084F	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.L1084F|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1084					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.L1084F(3)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TCTACTTTTTCAATTTCTCTT	0.383																																																3	Substitution - Missense(3)	endometrium(2)|ovary(1)	17											77.0	74.0	75.0					17																	10223673		1854	4090	5944	10164398	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3252G>T	17.37:g.10223673C>A	ENSP00000404570:p.Leu1084Phe	Unknown		x	x	x	10164398	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	7.544	0.661317	0.14645	.	.	ENSG00000006788	ENST00000252172	D	0.81499	-1.5	3.68	1.66	0.24008	Myosin tail (1);	.	.	.	.	T	0.82181	0.4981	M	0.91768	3.24	0.39889	D	0.973741	B	0.12630	0.006	B	0.25614	0.062	T	0.78339	-0.2242	9	0.72032	D	0.01	.	6.289	0.21049	0.1475:0.671:0.0:0.1815	.	1084	Q9UKX3	MYH13_HUMAN	F	1084	ENSP00000252172:L1084F	ENSP00000252172:L1084F	L	-	3	2	MYH13	10164398	0.002000	0.14202	0.915000	0.36163	0.456000	0.32438	-1.307000	0.02733	0.333000	0.23563	-0.868000	0.02995	TTG		0.383	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		Missense_Mutation
BLMH	642	broad.mit.edu	37	17	28612458	28612458	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:28612458C>G	ENST00000261714.6	-	6	767	c.593G>C	c.(592-594)aGt>aCt	p.S198T	BLMH_ENST00000394819.3_Missense_Mutation_p.S111T|RNU6-1267P_ENST00000410747.1_RNA|BLMH_ENST00000582669.1_5'UTR	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	198					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.S198T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	GGTTGCTCCACTGTGTACCAG	0.423																																					Pancreas(127;628 1772 12912 33293 36203)											1	Substitution - Missense(1)	ovary(1)	17											155.0	140.0	145.0					17																	28612458		2203	4300	6503	25636584	SO:0001583	missense	642			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.593G>C	17.37:g.28612458C>G	ENSP00000261714:p.Ser198Thr	Unknown		x	x	x	25636584	B2R796|Q53F86|Q9UER9	Missense_Mutation	SNP	ENST00000261714.6	37	CCDS32604.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789982	0.50102	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	T;T	0.42900	0.96;0.96	5.83	5.83	0.93111	.	0.072064	0.85682	D	0.000000	T	0.33904	0.0879	L	0.41236	1.265	0.38623	D	0.95119	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.14144	-1.0483	10	0.35671	T	0.21	-17.9855	11.2832	0.49208	0.1404:0.724:0.1356:0.0	.	111;198	E7EMN3;Q13867	.;BLMH_HUMAN	T	198;111	ENSP00000261714:S198T;ENSP00000378296:S111T	ENSP00000261714:S198T	S	-	2	0	BLMH	25636584	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.591000	0.46163	2.775000	0.95449	0.650000	0.86243	AGT		0.423	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1	NM_000386		Missense_Mutation
FNDC8	54752	broad.mit.edu	37	17	33448915	33448915	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:33448915A>T	ENST00000158009.5	+	1	318	c.203A>T	c.(202-204)aAc>aTc	p.N68I	RAD51L3-RFFL_ENST00000593039.1_5'Flank|RAD51D_ENST00000357906.3_5'Flank|RAD51D_ENST00000345365.6_5'Flank|RAD51D_ENST00000394589.4_5'Flank|RAD51D_ENST00000360276.3_5'Flank|RAD51D_ENST00000460118.2_5'Flank|RAD51D_ENST00000590380.1_5'Flank|RAD51D_ENST00000335858.7_5'Flank|RAD51D_ENST00000590016.1_5'Flank	NM_017559.2	NP_060029.1	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	68						nucleus (GO:0005634)		p.N68I(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	11		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		GATACCATCAACCTACTGTAA	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											92.0	85.0	88.0					17																	33448915		2203	4300	6503	30473028	SO:0001583	missense	54752			BC024002	CCDS11290.1	17q12	2013-02-11			ENSG00000073598	ENSG00000073598		"""Fibronectin type III domain containing"""	25286	protein-coding gene	gene with protein product						12477932	Standard	XM_005257993		Approved	DKFZp434H2215	uc002hix.3	Q8TC99	OTTHUMG00000132932	ENST00000158009.5:c.203A>T	17.37:g.33448915A>T	ENSP00000158009:p.Asn68Ile	Unknown		x	x	x	30473028	B2R9G6|Q9UFC2	Missense_Mutation	SNP	ENST00000158009.5	37	CCDS11290.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	11.23	1.578193	0.28180	.	.	ENSG00000073598	ENST00000158009	T	0.34275	1.37	4.68	1.21	0.21127	.	0.508491	0.18377	N	0.143072	T	0.17789	0.0427	N	0.19112	0.55	0.09310	N	1	P	0.35982	0.531	B	0.30646	0.118	T	0.13361	-1.0512	10	0.87932	D	0	-0.3621	3.9761	0.09475	0.6268:0.1816:0.1916:0.0	.	68	Q8TC99	FNDC8_HUMAN	I	68	ENSP00000158009:N68I	ENSP00000158009:N68I	N	+	2	0	FNDC8	30473028	0.000000	0.05858	0.001000	0.08648	0.157000	0.22087	0.061000	0.14366	0.066000	0.16515	0.454000	0.30748	AAC		0.498	FNDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256459.2	NM_017559		Missense_Mutation
JMJD6	23210	broad.mit.edu	37	17	74722536	74722536	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:74722536G>T	ENST00000397625.4	-	1	136	c.22C>A	c.(22-24)Cgc>Agc	p.R8S	JMJD6_ENST00000585429.1_Missense_Mutation_p.R8S|METTL23_ENST00000588783.1_5'Flank|METTL23_ENST00000589977.1_5'Flank|METTL23_ENST00000591571.1_5'Flank|METTL23_ENST00000341249.6_5'Flank|JMJD6_ENST00000445478.2_Missense_Mutation_p.R8S|METTL23_ENST00000590964.1_5'Flank|METTL23_ENST00000586738.1_5'Flank|METTL23_ENST00000586752.1_5'Flank|METTL23_ENST00000588302.1_5'Flank|METTL23_ENST00000586200.1_5'Flank|METTL23_ENST00000588822.1_5'Flank	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6	8					cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.R8S(1)		endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						TCGCGGATGCGCTTCTTGCTC	0.667																																																1	Substitution - Missense(1)	ovary(1)	17											33.0	38.0	36.0					17																	74722536		2037	4188	6225	72234131	SO:0001583	missense	23210			AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.22C>A	17.37:g.74722536G>T	ENSP00000380750:p.Arg8Ser	Unknown		x	x	x	72234131	B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Missense_Mutation	SNP	ENST00000397625.4	37	CCDS42384.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191095	0.58017	.	.	ENSG00000070495	ENST00000445478;ENST00000344991;ENST00000397625	.	.	.	4.67	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.74981	0.3788	M	0.87900	2.915	0.80722	D	1	D;D;D	0.69078	0.975;0.997;0.973	P;P;P	0.52856	0.622;0.638;0.711	T	0.81147	-0.1065	9	0.72032	D	0.01	0.0	14.0607	0.64797	0.0:0.0:0.8481:0.1519	.	8;8;8	B2WTI3;Q6NYC1;Q6NYC1-3	.;JMJD6_HUMAN;.	S	8	.	ENSP00000302916:R8S	R	-	1	0	JMJD6	72234131	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	2.527000	0.45615	1.141000	0.42275	0.491000	0.48974	CGC		0.667	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403211.1	NM_015167		Missense_Mutation
DNAH17	8632	broad.mit.edu	37	17	76523069	76523069	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:76523069C>G	ENST00000585328.1	-	23	3632	c.3508G>C	c.(3508-3510)Gag>Cag	p.E1170Q	DNAH17_ENST00000389840.5_Missense_Mutation_p.E1173Q	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1173	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E1170Q(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCCCAGTGCTCCGGCAGCTCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											26.0	26.0	26.0					17																	76523069		2016	4154	6170	74034664	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.3508G>C	17.37:g.76523069C>G	ENSP00000465516:p.Glu1170Gln	Unknown		x	x	x	74034664	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223541	0.58668	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.24723	1.84	4.45	4.45	0.53987	.	.	.	.	.	T	0.53158	0.1779	M	0.86502	2.82	0.46954	D	0.999269	.	.	.	.	.	.	T	0.58836	-0.7566	7	0.38643	T	0.18	.	17.2758	0.87114	0.0:1.0:0.0:0.0	.	.	.	.	Q	1170;1173	ENSP00000374490:E1173Q	ENSP00000300671:E1170Q	E	-	1	0	DNAH17	74034664	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.629000	0.67798	2.311000	0.77944	0.561000	0.74099	GAG		0.522	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		Missense_Mutation
USP36	57602	broad.mit.edu	37	17	76799703	76799703	+	Silent	SNP	G	G	A	rs201663556		TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:76799703G>A	ENST00000542802.3	-	16	3017	c.2574C>T	c.(2572-2574)agC>agT	p.S858S	USP36_ENST00000312010.6_Silent_p.S858S|USP36_ENST00000449938.2_Silent_p.S463S			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	858					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.S858S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CCTGCAGGGCGCTGGCAGCTG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	17						G		0,4406		0,0,2203	36.0	33.0	34.0		2574	-3.1	0.0	17		34	1,8599		0,1,4299	no	coding-synonymous	USP36	NM_025090.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		858/1124	76799703	1,13005	2203	4300	6503	74311298	SO:0001819	synonymous_variant	57602			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.2574C>T	17.37:g.76799703G>A		Unknown		x	x	x	74311298	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	CCDS32755.1	SNP	38	Broad																																																																																				0.662	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090		Silent
PCYT2	5833	broad.mit.edu	37	17	79864371	79864372	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:79864371_79864372GG>TT	ENST00000538936.2	-	8	835_836	c.727_728CC>AA	c.(727-729)CCc>AAc	p.P243N	PCYT2_ENST00000571105.1_Missense_Mutation_p.P243N|PCYT2_ENST00000570391.1_Missense_Mutation_p.P211N|PCYT2_ENST00000570388.1_Missense_Mutation_p.P165N|PCYT2_ENST00000331285.3_Missense_Mutation_p.P165N|PCYT2_ENST00000538721.2_Missense_Mutation_p.P261N	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	243					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)	p.P243N(1)		breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	GATGATGTAGGGCCTCTCTGCC	0.619																																																1	Substitution - Missense(1)	ovary(1)	17																																								77457664	SO:0001583	missense	5833			D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.727_728delinsTT	17.37:g.79864371_79864372delinsTT	ENSP00000439245:p.Pro243Asn	Unknown		x	x	x	77457663	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	DNP	ENST00000538936.2	37	CCDS11791.1	DNP	43	Broad																																																																																				0.619	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861		Missense_Mutation
FN3KRP	79672	broad.mit.edu	37	17	80676927	80676927	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr17:80676927T>A	ENST00000269373.6	+	2	360	c.287T>A	c.(286-288)cTg>cAg	p.L96Q	RP11-388C12.1_ENST00000574471.1_lincRNA|FN3KRP_ENST00000535965.1_Missense_Mutation_p.L46Q	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	96							kinase activity (GO:0016301)	p.L96Q(1)		breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			ATGAGGCATCTGAGCAGGTGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	95.0	96.0					17																	80676927		2203	4300	6503	78270216	SO:0001583	missense	79672			AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.287T>A	17.37:g.80676927T>A	ENSP00000269373:p.Leu96Gln	Unknown		x	x	x	78270216	Q969F4|Q9H0U7	Missense_Mutation	SNP	ENST00000269373.6	37	CCDS11817.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	17.14	3.314011	0.60414	.	.	ENSG00000141560	ENST00000269373;ENST00000535965	T;T	0.60920	0.15;0.15	5.73	5.73	0.89815	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70675	0.3251	L	0.52759	1.655	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.69232	-0.5199	10	0.38643	T	0.18	-22.6186	16.0183	0.80460	0.0:0.0:0.0:1.0	.	96	Q9HA64	KT3K_HUMAN	Q	96;46	ENSP00000269373:L96Q;ENSP00000444994:L46Q	ENSP00000269373:L96Q	L	+	2	0	FN3KRP	78270216	0.972000	0.33761	0.987000	0.45799	0.049000	0.14656	7.658000	0.83755	2.187000	0.69744	0.533000	0.62120	CTG		0.537	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1	NM_024619		Missense_Mutation
CPLX4	339302	broad.mit.edu	37	18	56980001	56980001	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr18:56980001C>A	ENST00000299721.3	-	2	357	c.171G>T	c.(169-171)atG>atT	p.M57I	CPLX4_ENST00000587244.1_Missense_Mutation_p.M57I	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	57					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)		p.M57I(1)		autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				CATCTCTTTCCATCCTAAAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	18											80.0	74.0	76.0					18																	56980001		2203	4300	6503	55130981	SO:0001583	missense	339302			AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.171G>T	18.37:g.56980001C>A	ENSP00000299721:p.Met57Ile	Unknown		x	x	x	55130981	F1T0L6	Missense_Mutation	SNP	ENST00000299721.3	37	CCDS11973.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385508	0.42308	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.1	4.19	0.49359	.	0.035664	0.85682	N	0.000000	T	0.54208	0.1844	L	0.52905	1.665	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48864	-0.8997	9	0.16420	T	0.52	-16.451	12.7179	0.57125	0.0:0.9157:0.0:0.0843	.	57	Q7Z7G2	CPLX4_HUMAN	I	57	.	ENSP00000299721:M57I	M	-	3	0	CPLX4	55130981	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.567000	0.53813	1.202000	0.43218	0.563000	0.77884	ATG		0.453	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256127.1	NM_181654		Missense_Mutation
SALL3	27164	broad.mit.edu	37	18	76753216	76753216	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr18:76753216C>A	ENST00000537592.2	+	2	1225	c.1225C>A	c.(1225-1227)Ccc>Acc	p.P409T	SALL3_ENST00000575389.2_Missense_Mutation_p.P409T|SALL3_ENST00000536229.3_Missense_Mutation_p.P276T	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	409					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P409T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGTGTTCGAGCCCAAAGCCAG	0.662																																																1	Substitution - Missense(1)	ovary(1)	18											24.0	18.0	20.0					18																	76753216		2202	4297	6499	74854204	SO:0001583	missense	27164			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1225C>A	18.37:g.76753216C>A	ENSP00000441823:p.Pro409Thr	Unknown		x	x	x	74854204	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	9.564	1.119216	0.20877	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.10960	2.82	4.54	4.54	0.55810	.	0.112226	0.39274	N	0.001403	T	0.07234	0.0183	N	0.20986	0.625	0.37048	D	0.897479	B;B	0.14438	0.003;0.01	B;B	0.11329	0.006;0.005	T	0.22034	-1.0228	10	0.10377	T	0.69	-37.9065	12.5803	0.56388	0.1659:0.8341:0.0:0.0	.	141;409	F5GXY4;Q9BXA9	.;SALL3_HUMAN	T	409;409;141	ENSP00000441823:P409T	ENSP00000299466:P409T	P	+	1	0	SALL3	74854204	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.047000	0.57383	2.352000	0.79861	0.460000	0.39030	CCC		0.662	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999		Missense_Mutation
MAST1	22983	broad.mit.edu	37	19	12949413	12949413	+	Silent	SNP	T	T	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr19:12949413T>C	ENST00000251472.4	+	1	66	c.27T>C	c.(25-27)ctT>ctC	p.L9L	MAST1_ENST00000591495.1_Intron	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1									p.L9L(1)		NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GGACCGCGCTTTCTAATTTCT	0.692																																																1	Substitution - coding silent(1)	ovary(1)	19											52.0	43.0	46.0					19																	12949413		2203	4299	6502	12810413	SO:0001819	synonymous_variant	22983			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.27T>C	19.37:g.12949413T>C		Unknown		x	x	x	12810413		Silent	SNP	ENST00000251472.4	37	CCDS32921.1	SNP	64	Broad																																																																																				0.692	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975		Silent
CPAMD8	27151	broad.mit.edu	37	19	17108035	17108035	+	Silent	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr19:17108035C>A	ENST00000443236.1	-	11	1153	c.1122G>T	c.(1120-1122)ggG>ggT	p.G374G	CPAMD8_ENST00000388925.4_Silent_p.G327G	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	327						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G374G(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCTGCTGGCTCCCGTCCACAC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	19											28.0	29.0	28.0					19																	17108035		1910	4077	5987	16969035	SO:0001819	synonymous_variant	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1122G>T	19.37:g.17108035C>A		Unknown		x	x	x	16969035	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	1.456	-0.563815	0.03939	.	.	ENSG00000160111	ENST00000443236	.	.	.	3.0	-1.25	0.09405	.	0.703445	0.12215	N	0.488942	T	0.55130	0.1901	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56226	-0.8014	6	0.56958	D	0.05	.	4.7002	0.12823	0.1284:0.4172:0.3637:0.0907	.	.	.	.	V	385	.	ENSP00000402505:G385V	G	-	2	0	CPAMD8	16969035	0.978000	0.34361	0.735000	0.30896	0.168000	0.22595	0.037000	0.13840	0.001000	0.14605	-0.320000	0.08662	GGA		0.642	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		Silent
KIAA1683	80726	broad.mit.edu	37	19	18377290	18377290	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr19:18377290A>G	ENST00000600328.3	-	3	1253	c.1060T>C	c.(1060-1062)Tat>Cat	p.Y354H	KIAA1683_ENST00000600359.3_Missense_Mutation_p.Y308H|KIAA1683_ENST00000392413.4_Missense_Mutation_p.Y354H			Q9H0B3	K1683_HUMAN	KIAA1683	354	Thr-rich.					mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.Y354H(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GACGCTGGATATGTCTGTGGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											85.0	76.0	79.0					19																	18377290		2203	4300	6503	18238290	SO:0001583	missense	80726			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.1060T>C	19.37:g.18377290A>G	ENSP00000470780:p.Tyr354His	Unknown		x	x	x	18238290	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	2.866	-0.235018	0.05983	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000358422	T;T;T	0.03635	3.93;3.94;3.86	3.45	-0.336	0.12658	.	1.914000	0.03454	N	0.211169	T	0.04770	0.0129	L	0.49126	1.545	0.09310	N	1	P;B	0.50943	0.94;0.028	B;B	0.41571	0.36;0.011	T	0.45804	-0.9236	10	0.20046	T	0.44	.	6.4595	0.21948	0.4936:0.0:0.5064:0.0	.	354;354	E9PDE0;Q9H0B3	.;K1683_HUMAN	H	354;354;308;353	ENSP00000376213:Y354H;ENSP00000352774:Y354H;ENSP00000404501:Y308H	ENSP00000351198:Y353H	Y	-	1	0	KIAA1683	18238290	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.416000	0.07097	0.009000	0.14813	-0.456000	0.05471	TAT		0.557	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3			Missense_Mutation
KLK7	5650	broad.mit.edu	37	19	51480944	51480944	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr19:51480944C>T	ENST00000391807.1	-	6	711	c.610G>A	c.(610-612)Gac>Aac	p.D204N	KLK7_ENST00000336317.4_Missense_Mutation_p.D91N|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000595820.1_Missense_Mutation_p.D204N|KLK7_ENST00000597707.1_Missense_Mutation_p.D132N	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	204	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D204N(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		CCCCCTGAGTCACCCTAGAGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	64.0	65.0					19																	51480944		2203	4300	6503	56172756	SO:0001583	missense	5650			L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.610G>A	19.37:g.51480944C>T	ENSP00000375683:p.Asp204Asn	Unknown		x	x	x	56172756	A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	37	CCDS12812.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	25.3	4.625049	0.87560	.	.	ENSG00000169035	ENST00000304045;ENST00000391807;ENST00000336317	D;D	0.94457	-3.43;-3.43	4.9	4.9	0.64082	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.35407	U	0.003239	D	0.97636	0.9225	M	0.90595	3.13	0.46185	D	0.998914	D	0.89917	1.0	D	0.91635	0.999	D	0.98391	1.0563	10	0.72032	D	0.01	.	16.019	0.80468	0.0:1.0:0.0:0.0	.	204	P49862	KLK7_HUMAN	N	204;204;91	ENSP00000375683:D204N;ENSP00000337540:D91N	ENSP00000304791:D204N	D	-	1	0	KLK7	56172756	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	6.215000	0.72206	2.466000	0.83321	0.448000	0.29417	GAC		0.512	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046		Missense_Mutation
PRKCG	5582	broad.mit.edu	37	19	54394975	54394975	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr19:54394975G>A	ENST00000263431.3	+	6	859	c.577G>A	c.(577-579)Gat>Aat	p.D193N	PRKCG_ENST00000540413.1_Missense_Mutation_p.D193N|PRKCG_ENST00000542049.1_Missense_Mutation_p.D80N|PRKCG_ENST00000536044.1_Missense_Mutation_p.D193N	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	193	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.D193N(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TGGTCTCTCTGATCCCTATGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											148.0	133.0	138.0					19																	54394975		2203	4300	6503	59086787	SO:0001583	missense	5582			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.577G>A	19.37:g.54394975G>A	ENSP00000263431:p.Asp193Asn	Unknown		x	x	x	59086787	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.149161	0.94645	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000542049	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.25	5.25	0.73442	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.74966	0.3786	M	0.83012	2.62	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.988;0.996;0.99;0.98	D;P;D;P;D	0.87578	0.998;0.84;0.972;0.901;0.925	T	0.77879	-0.2423	9	0.59425	D	0.04	.	16.7114	0.85386	0.0:0.0:1.0:0.0	.	80;193;193;193;193	B7Z8Q0;F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;.;KPCG_HUMAN	N	193;193;193;80	ENSP00000440541:D193N;ENSP00000443493:D193N;ENSP00000263431:D193N;ENSP00000438090:D80N	ENSP00000263431:D193N	D	+	1	0	PRKCG	59086787	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.141000	0.94612	2.628000	0.89032	0.561000	0.74099	GAT		0.537	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739		Missense_Mutation
ZNF581	51545	broad.mit.edu	37	19	56156074	56156074	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr19:56156074C>A	ENST00000587252.1	+	2	410	c.137C>A	c.(136-138)tCt>tAt	p.S46Y	ZNF581_ENST00000588537.1_Missense_Mutation_p.S46Y|ZNF581_ENST00000270451.5_Missense_Mutation_p.S46Y			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	46					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S46Y(1)		large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CAGGCTTCATCTCCTCCAAGG	0.617																																																1	Substitution - Missense(1)	ovary(1)	19											44.0	40.0	41.0					19																	56156074		2203	4300	6503	60847886	SO:0001583	missense	51545			AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.137C>A	19.37:g.56156074C>A	ENSP00000466047:p.Ser46Tyr	Unknown		x	x	x	60847886	B2RDM6	Missense_Mutation	SNP	ENST00000587252.1	37	CCDS12932.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286290	0.23478	.	.	ENSG00000171425	ENST00000270451	T	0.12255	2.7	3.31	2.15	0.27550	.	.	.	.	.	T	0.06962	0.0177	N	0.14661	0.345	0.21290	N	0.999739	P	0.38922	0.651	B	0.31751	0.135	T	0.22556	-1.0213	9	0.87932	D	0	.	7.1529	0.25620	0.2666:0.7334:0.0:0.0	.	46	Q9P0T4	ZN581_HUMAN	Y	46	ENSP00000270451:S46Y	ENSP00000270451:S46Y	S	+	2	0	ZNF581	60847886	0.000000	0.05858	0.007000	0.13788	0.525000	0.34531	0.900000	0.28431	1.883000	0.54544	0.462000	0.41574	TCT		0.617	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453430.1	NM_016535		Missense_Mutation
SCN9A	6335	broad.mit.edu	37	2	167094661	167094661	+	Silent	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:167094661A>G	ENST00000409435.1	-	19	3743	c.3744T>C	c.(3742-3744)taT>taC	p.Y1248Y	SCN9A_ENST00000375387.4_Silent_p.Y1249Y|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Silent_p.Y1237Y|SCN9A_ENST00000303354.6_Silent_p.Y1249Y			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1248					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.Y1237Y(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTTATAACCATATGCTATCC	0.328																																																1	Substitution - coding silent(1)	ovary(1)	2											52.0	54.0	53.0					2																	167094661		2180	4293	6473	166802907	SO:0001819	synonymous_variant	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3744T>C	2.37:g.167094661A>G		Unknown		x	x	x	166802907	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	37	CCDS46441.1	SNP	8	Broad																																																																																				0.328	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		Silent
CHRNA1	1134	broad.mit.edu	37	2	175618310	175618310	+	Silent	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:175618310G>A	ENST00000261007.5	-	7	840	c.774C>T	c.(772-774)taC>taT	p.Y258Y	CHRNA1_ENST00000348749.5_Silent_p.Y233Y|CHRNA1_ENST00000409323.1_Silent_p.Y233Y|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409219.1_Silent_p.Y233Y|CHRNA1_ENST00000409542.1_Silent_p.Y151Y	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	258					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.Y258Y(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TGACGATGAAGTAGAGGGGCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	2											226.0	202.0	210.0					2																	175618310		2203	4300	6503	175326556	SO:0001819	synonymous_variant	1134			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.774C>T	2.37:g.175618310G>A		Unknown		x	x	x	175326556	B4DRV6|D3DPE8	Silent	SNP	ENST00000261007.5	37	CCDS33331.1	SNP	36	Broad																																																																																				0.582	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			Silent
PMS1	5378	broad.mit.edu	37	2	190728639	190728639	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:190728639C>G	ENST00000441310.2	+	10	2260	c.2027C>G	c.(2026-2028)cCa>cGa	p.P676R	PMS1_ENST00000418224.3_Missense_Mutation_p.P500R|PMS1_ENST00000432292.3_Missense_Mutation_p.P500R|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000409823.3_Missense_Mutation_p.P637R|PMS1_ENST00000447232.2_Intron	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	676					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)	p.P676L(1)|p.P676R(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TCTAATCAACCAAAACTTGAT	0.333			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	2	Substitution - Missense(2)	ovary(1)|lung(1)	2											82.0	88.0	86.0					2																	190728639		2203	4300	6503	190436884	SO:0001583	missense	5378				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2027C>G	2.37:g.190728639C>G	ENSP00000406490:p.Pro676Arg	Unknown		x	x	x	190436884	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	37	CCDS2302.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101377	0.56183	.	.	ENSG00000064933	ENST00000392338;ENST00000441310;ENST00000418224;ENST00000409823;ENST00000432292;ENST00000424307;ENST00000452382	T;T;T;T;D;T	0.86865	1.9;1.9;1.9;1.9;-2.18;1.97	5.45	5.45	0.79879	.	0.156057	0.64402	D	0.000020	D	0.87924	0.6300	M	0.65975	2.015	0.37679	D	0.923411	D;P;D;D	0.62365	0.991;0.932;0.981;0.991	P;P;P;P	0.49922	0.626;0.469;0.598;0.626	D	0.86387	0.1733	10	0.21014	T	0.42	-14.5228	13.6008	0.62018	0.247:0.753:0.0:0.0	.	676;637;637;676	Q4VAL4;Q5FBZ9;Q5FBZ3;P54277	.;.;.;PMS1_HUMAN	R	500;676;500;637;500;615;64	ENSP00000406490:P676R;ENSP00000404492:P500R;ENSP00000387125:P637R;ENSP00000398378:P500R;ENSP00000389938:P615R;ENSP00000396232:P64R	ENSP00000376149:P500R	P	+	2	0	PMS1	190436884	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.343000	0.59348	2.852000	0.98041	0.644000	0.83932	CCA		0.333	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2			Missense_Mutation
INO80D	54891	broad.mit.edu	37	2	206869178	206869178	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:206869178T>C	ENST00000403263.1	-	11	3402	c.2998A>G	c.(2998-3000)Ata>Gta	p.I1000V		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	0					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.I895V(1)		NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						GGAGGGGCTATAGAGCTGTGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											44.0	46.0	45.0					2																	206869178		2020	4193	6213	206577423	SO:0001583	missense	54891				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.2998A>G	2.37:g.206869178T>C	ENSP00000384198:p.Ile1000Val	Unknown		x	x	x	206577423	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	ENST00000403263.1	37	CCDS46500.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	14.07	2.424986	0.43020	.	.	ENSG00000114933	ENST00000403263	T	0.32753	1.44	5.51	5.51	0.81932	.	.	.	.	.	T	0.20740	0.0499	N	0.14661	0.345	0.43122	D	0.994845	B	0.32245	0.361	B	0.30105	0.111	T	0.06935	-1.0799	9	0.45353	T	0.12	.	15.628	0.76878	0.0:0.0:0.0:1.0	.	1000	Q53TQ3-2	.	V	1000	ENSP00000384198:I1000V	ENSP00000384198:I1000V	I	-	1	0	INO80D	206577423	1.000000	0.71417	0.895000	0.35142	0.914000	0.54420	5.779000	0.68948	2.081000	0.62600	0.533000	0.62120	ATA		0.547	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759		Missense_Mutation
INO80D	54891	broad.mit.edu	37	2	206927647	206927647	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:206927647C>T	ENST00000403263.1	-	3	498	c.94G>A	c.(94-96)Ggc>Agc	p.G32S		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	32					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.G32S(1)		NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						AAGGCGTAGCCGTTGAGTCGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											84.0	81.0	82.0					2																	206927647		2093	4232	6325	206635892	SO:0001583	missense	54891				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.94G>A	2.37:g.206927647C>T	ENSP00000384198:p.Gly32Ser	Unknown		x	x	x	206635892	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	ENST00000403263.1	37	CCDS46500.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.712200	0.96830	.	.	ENSG00000114933	ENST00000403263;ENST00000233270;ENST00000414320	T	0.42513	0.97	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000004	T	0.63355	0.2504	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62525	-0.6836	10	0.72032	D	0.01	.	20.2602	0.98440	0.0:1.0:0.0:0.0	.	32	Q53TQ3-2	.	S	32	ENSP00000384198:G32S	ENSP00000233270:G32S	G	-	1	0	INO80D	206635892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.861000	0.98227	0.655000	0.94253	GGC		0.493	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759		Missense_Mutation
TRIP12	9320	broad.mit.edu	37	2	230683210	230683210	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:230683210A>T	ENST00000283943.5	-	8	1503	c.1325T>A	c.(1324-1326)cTa>cAa	p.L442Q	TRIP12_ENST00000389044.4_Missense_Mutation_p.L490Q|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Missense_Mutation_p.L145Q	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	442					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.L442Q(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCCTTGTAGTAGCTGCTGGGC	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	103.0	103.0					2																	230683210		2203	4300	6503	230391454	SO:0001583	missense	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1325T>A	2.37:g.230683210A>T	ENSP00000283943:p.Leu442Gln	Unknown		x	x	x	230391454	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563202	0.86335	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.52754	0.65;0.65;0.65	5.73	5.73	0.89815	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73140	0.3549	M	0.87269	2.87	0.80722	D	1	D;D;D;D	0.71674	0.998;0.995;0.995;0.995	D;D;D;D	0.81914	0.995;0.986;0.986;0.986	T	0.78720	-0.2094	10	0.87932	D	0	.	16.0185	0.80460	1.0:0.0:0.0:0.0	.	448;145;490;442	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	Q	442;145;490	ENSP00000283943:L442Q;ENSP00000373697:L145Q;ENSP00000373696:L490Q	ENSP00000283943:L442Q	L	-	2	0	TRIP12	230391454	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.187000	0.94912	2.190000	0.69967	0.454000	0.30748	CTA		0.378	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238		Missense_Mutation
TRAF3IP1	26146	broad.mit.edu	37	2	239306171	239306171	+	Silent	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:239306171C>T	ENST00000373327.4	+	16	1983	c.1761C>T	c.(1759-1761)cgC>cgT	p.R587R	TRAF3IP1_ENST00000391994.2_Silent_p.R587R|TRAF3IP1_ENST00000391993.3_Silent_p.R521R	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	587	DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.R587R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		AGAAGCTCCGCACGTCCATCC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	2											109.0	103.0	105.0					2																	239306171		2203	4300	6503	238970910	SO:0001819	synonymous_variant	26146			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.1761C>T	2.37:g.239306171C>T		Unknown		x	x	x	238970910	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Silent	SNP	ENST00000373327.4	37	CCDS33415.1	SNP	25	Broad																																																																																				0.527	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650		Silent
SNED1	25992	broad.mit.edu	37	2	241988519	241988519	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:241988519T>C	ENST00000310397.8	+	11	1585	c.1585T>C	c.(1585-1587)Tgc>Cgc	p.C529R	AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000342631.6_Missense_Mutation_p.C529R|SNED1_ENST00000405547.3_Missense_Mutation_p.C529R|SNED1_ENST00000401884.1_Missense_Mutation_p.C529R|SNED1_ENST00000469006.1_3'UTR	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	529	Follistatin-like 2.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C529R(1)		NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GAGCTACCTCTGCGTCTGCCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	2											22.0	28.0	26.0					2																	241988519		2062	4187	6249	241637192	SO:0001583	missense	25992			AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1585T>C	2.37:g.241988519T>C	ENSP00000308893:p.Cys529Arg	Unknown		x	x	x	241637192	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	SNP	55	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.96|19.96	3.923428|3.923428	0.73213|0.73213	.|.	.|.	ENSG00000162804|ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631|ENST00000401644	D;D;D;D|D	0.84442|0.94138	-1.77;-1.85;-1.85;-1.79|-3.36	5.09|5.09	5.09|5.09	0.68999|0.68999	Follistatin-like, N-terminal (1);|.	0.000000|.	0.64402|.	D|.	0.000016|.	D|D	0.96642|0.96642	0.8904|0.8904	M|M	0.92077|0.92077	3.27|3.27	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.96210|0.96210	0.9152|0.9152	10|7	0.87932|0.24483	D|T	0|0.36	.|.	14.5708|14.5708	0.68210|0.68210	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	529|.	Q8TER0|.	SNED1_HUMAN|.	R|P	529|225	ENSP00000384871:C529R;ENSP00000386007:C529R;ENSP00000308893:C529R;ENSP00000342992:C529R|ENSP00000384789:L225P	ENSP00000308893:C529R|ENSP00000384789:L225P	C|L	+|+	1|2	0|0	SNED1|SNED1	241637192|241637192	1.000000|1.000000	0.71417|0.71417	0.913000|0.913000	0.36048|0.36048	0.801000|0.801000	0.45260|0.45260	6.344000|6.344000	0.72991|0.72991	1.919000|1.919000	0.55581|0.55581	0.460000|0.460000	0.39030|0.39030	TGC|CTG		0.622	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482		Missense_Mutation
MTERF4	130916	broad.mit.edu	37	2	242035472	242035472	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr2:242035472C>G	ENST00000391980.2	-	4	1145	c.1087G>C	c.(1087-1089)Gag>Cag	p.E363Q	MTERFD2_ENST00000495694.1_Intron|MTERFD2_ENST00000464344.2_Intron|MTERFD2_ENST00000406593.1_Missense_Mutation_p.E175Q	NM_182501.3	NP_872307.2	Q7Z6M4	MTEF4_HUMAN		363					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	rRNA binding (GO:0019843)	p.E363Q(1)		endometrium(3)|large_intestine(6)|lung(5)|ovary(1)|skin(2)|urinary_tract(3)	20		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		tcgtcgtcctcatcatcgtca	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											350.0	239.0	277.0					2																	242035472		2203	4300	6503	241684145	SO:0001583	missense	130916																														ENST00000391980.2:c.1087G>C	2.37:g.242035472C>G	ENSP00000375840:p.Glu363Gln	Unknown		x	x	x	241684145	A8K6K0|Q9P0E0	Missense_Mutation	SNP	ENST00000391980.2	37	CCDS2544.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269794	0.23221	.	.	ENSG00000122085	ENST00000391980;ENST00000406593	T;T	0.02498	4.27;4.27	2.08	2.08	0.27032	.	.	.	.	.	T	0.03915	0.0110	N	0.08118	0	0.80722	D	1	D	0.63046	0.992	P	0.57911	0.829	T	0.58713	-0.7588	9	0.87932	D	0	.	11.3286	0.49463	0.0:1.0:0.0:0.0	.	363	Q7Z6M4	MTER2_HUMAN	Q	363;175	ENSP00000375840:E363Q;ENSP00000384998:E175Q	ENSP00000241527:E363Q	E	-	1	0	MTERFD2	241684145	0.000000	0.05858	0.019000	0.16419	0.028000	0.11728	0.130000	0.15850	1.073000	0.40885	0.585000	0.79938	GAG		0.507	MTERFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323798.4			Missense_Mutation
CPXM1	56265	broad.mit.edu	37	20	2778886	2778886	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr20:2778886G>A	ENST00000380605.2	-	4	566	c.502C>T	c.(502-504)Cag>Tag	p.Q168*		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	168	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.Q168*(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCGGCGTCCTGCTCCTCAGCA	0.607																																																1	Substitution - Nonsense(1)	ovary(1)	20											66.0	64.0	65.0					20																	2778886		2203	4300	6503	2726886	SO:0001587	stop_gained	56265			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.502C>T	20.37:g.2778886G>A	ENSP00000369979:p.Gln168*	Unknown		x	x	x	2726886	Q6P4G8|Q6UW65|Q9NUB5	Nonsense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138028	0.77775	.	.	ENSG00000088882	ENST00000380605	.	.	.	4.41	3.41	0.39046	.	0.294026	0.31922	N	0.006844	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-10.1737	6.7184	0.23316	0.0:0.2059:0.6082:0.1859	.	.	.	.	X	168	.	ENSP00000369979:Q168X	Q	-	1	0	CPXM1	2726886	0.008000	0.16893	0.922000	0.36590	0.723000	0.41478	0.339000	0.19875	2.295000	0.77249	0.563000	0.77884	CAG		0.607	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		Nonsense_Mutation
TSHZ2	128553	broad.mit.edu	37	20	51872506	51872506	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr20:51872506A>G	ENST00000371497.5	+	2	3396	c.2509A>G	c.(2509-2511)Act>Gct	p.T837A	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.T834A|TSHZ2_ENST00000603338.2_Missense_Mutation_p.T834A	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	837					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T837A(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TGAAGTCTCAACTTTGCATAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	20											54.0	56.0	55.0					20																	51872506		2203	4300	6503	51305913	SO:0001583	missense	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2509A>G	20.37:g.51872506A>G	ENSP00000360552:p.Thr837Ala	Unknown		x	x	x	51305913	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	10.06	1.246700	0.22796	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.13538	2.58;2.58	5.52	5.52	0.82312	Homeodomain-like (1);	0.109197	0.64402	D	0.000006	T	0.09069	0.0224	N	0.08118	0	0.50313	D	0.999867	B	0.21753	0.06	B	0.17098	0.017	T	0.16808	-1.0390	10	0.62326	D	0.03	-2.8981	15.657	0.77144	1.0:0.0:0.0:0.0	.	837	Q9NRE2	TSH2_HUMAN	A	837;834;363	ENSP00000360552:T837A;ENSP00000333114:T834A	ENSP00000333114:T834A	T	+	1	0	TSHZ2	51305913	1.000000	0.71417	0.084000	0.20598	0.805000	0.45488	4.452000	0.60054	2.096000	0.63516	0.523000	0.50628	ACT		0.537	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		Missense_Mutation
TAF4	6874	broad.mit.edu	37	20	60573230	60573230	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr20:60573230C>T	ENST00000252996.4	-	13	2931	c.2932G>A	c.(2932-2934)Gat>Aat	p.D978N		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	978					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TGTTCTGGATCTTCTTGTCTT	0.418																																																0			20											167.0	136.0	147.0					20																	60573230		2203	4300	6503	60006625	SO:0001583	missense	6874			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2932G>A	20.37:g.60573230C>T	ENSP00000252996:p.Asp978Asn	Unknown		x	x	x	60006625	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.251569	0.95305	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.57107	0.48;0.42	5.66	5.66	0.87406	Transcription initiation factor TFIID component TAF4 (1);	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	M	0.64567	1.98	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73316	-0.4021	10	0.72032	D	0.01	-11.3172	19.732	0.96186	0.0:1.0:0.0:0.0	.	978	O00268	TAF4_HUMAN	N	978;842	ENSP00000252996:D978N;ENSP00000399091:D842N	ENSP00000252996:D978N	D	-	1	0	TAF4	60006625	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.247000	0.78257	2.668000	0.90789	0.591000	0.81541	GAT		0.418	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		Missense_Mutation
TRPM2	7226	broad.mit.edu	37	21	45858975	45858975	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr21:45858975T>C	ENST00000397928.1	+	30	4638	c.4193T>C	c.(4192-4194)cTa>cCa	p.L1398P	TRPM2_ENST00000300481.9_Missense_Mutation_p.L1344P|TRPM2_ENST00000397932.2_Missense_Mutation_p.L1448P|snoZ6_ENST00000581669.1_RNA|TRPM2_ENST00000300482.5_Missense_Mutation_p.L1398P|TRPM2_ENST00000498430.1_3'UTR|snoZ6_ENST00000583496.1_RNA	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1398	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.L1398P(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GGGGAGATGCTACCTCGGAAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	21											80.0	63.0	69.0					21																	45858975		2203	4300	6503	44683403	SO:0001583	missense	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.4193T>C	21.37:g.45858975T>C	ENSP00000381023:p.Leu1398Pro	Unknown		x	x	x	44683403	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	15.17	2.752728	0.49362	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932;ENST00000540347	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	4.2	4.2	0.49525	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.000000	0.53938	D	0.000047	T	0.09512	0.0234	N	0.21194	0.64	0.80722	D	1	B;B;B;B	0.30741	0.047;0.293;0.131;0.293	B;B;B;B	0.25759	0.021;0.063;0.057;0.057	T	0.12915	-1.0529	10	0.87932	D	0	-6.6677	11.0705	0.47999	0.0:0.0:0.0:1.0	.	79;1448;1184;1398	B4DVI8;E9PGK7;Q5KTC1;O94759	.;.;.;TRPM2_HUMAN	P	1398;1398;1344;1448;142	ENSP00000300482:L1398P;ENSP00000381023:L1398P;ENSP00000300481:L1344P;ENSP00000381026:L1448P	ENSP00000300481:L1344P	L	+	2	0	TRPM2	44683403	1.000000	0.71417	0.928000	0.36995	0.329000	0.28539	4.333000	0.59285	1.681000	0.50988	0.260000	0.18958	CTA		0.627	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		Missense_Mutation
MKL1	57591	broad.mit.edu	37	22	40814890	40814890	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr22:40814890G>C	ENST00000355630.3	-	12	2142	c.1552C>G	c.(1552-1554)Cta>Gta	p.L518V	MKL1_ENST00000396617.3_Missense_Mutation_p.L518V|MKL1_ENST00000407029.1_Missense_Mutation_p.L518V|MKL1_ENST00000402042.1_Missense_Mutation_p.L468V	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	518					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.L518V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CGCCCCTCTAGCTCCGCCCGC	0.687			T	RBM15	acute megakaryocytic leukemia																																		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Substitution - Missense(1)	ovary(1)	22											27.0	32.0	30.0					22																	40814890		2202	4295	6497	39144836	SO:0001583	missense	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1552C>G	22.37:g.40814890G>C	ENSP00000347847:p.Leu518Val	Unknown		x	x	x	39144836	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698288	0.30142	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.48836	0.82;0.83;0.8;0.82	4.89	1.54	0.23209	.	0.587161	0.15779	N	0.245019	T	0.37348	0.1000	L	0.61036	1.89	0.30433	N	0.777008	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.28713	-1.0035	10	0.27082	T	0.32	-0.9724	3.3232	0.07058	0.0862:0.2629:0.4435:0.2073	.	468;518;518	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	V	518;518;468;518	ENSP00000347847:L518V;ENSP00000379861:L518V;ENSP00000385584:L468V;ENSP00000385835:L518V	ENSP00000347847:L518V	L	-	1	2	MKL1	39144836	0.047000	0.20315	0.977000	0.42913	0.904000	0.53231	0.397000	0.20883	0.233000	0.21120	0.591000	0.81541	CTA		0.687	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831		Missense_Mutation
MOBP	4336	broad.mit.edu	37	3	39543701	39543701	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr3:39543701T>G	ENST00000420739.1	+	3	365	c.141T>G	c.(139-141)tgT>tgG	p.C47W	MOBP_ENST00000415443.1_Missense_Mutation_p.C47W|MOBP_ENST00000354668.4_Missense_Mutation_p.C47W|MOBP_ENST00000396228.1_Missense_Mutation_p.C47W|MOBP_ENST00000447324.1_Missense_Mutation_p.C47W|MOBP_ENST00000311042.6_Missense_Mutation_p.C47W|MOBP_ENST00000383754.3_Missense_Mutation_p.C47W|MOBP_ENST00000428261.1_Missense_Mutation_p.C47W|MOBP_ENST00000441980.2_Missense_Mutation_p.C47W			Q13875	MOBP_HUMAN	myelin-associated oligodendrocyte basic protein	47					intracellular protein transport (GO:0006886)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)		p.C47W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)		ACAGCATCTGTAAGAGCGGCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											67.0	69.0	69.0					3																	39543701		2203	4300	6503	39518705	SO:0001583	missense	4336			D28113	CCDS2687.1, CCDS63598.1, CCDS2688.1	3p21.33	2004-03-02			ENSG00000168314	ENSG00000168314			7189	protein-coding gene	gene with protein product		600948				7989345	Standard	NM_001278322		Approved		uc031ryw.1	Q13875	OTTHUMG00000131347	ENST00000420739.1:c.141T>G	3.37:g.39543701T>G	ENSP00000400491:p.Cys47Trp	Unknown		x	x	x	39518705	A8K2C2|G5E945|Q13874|Q6DHZ6|Q8TBJ1	Missense_Mutation	SNP	ENST00000420739.1	37		SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347081	0.24426	.	.	ENSG00000168314	ENST00000451925;ENST00000354668;ENST00000428261;ENST00000420739;ENST00000415443;ENST00000447324;ENST00000383754;ENST00000436143;ENST00000441980;ENST00000311042;ENST00000396228	D;D;D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	3.95	-4.87	0.03123	.	0.000000	0.85682	D	0.000000	D	0.92958	0.7759	.	.	.	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.995;0.997;0.997	D	0.91681	0.5358	9	0.87932	D	0	-17.5155	13.9483	0.64099	0.0:0.7349:0.0:0.2651	.	47;47;47	Q13875;G5E945;Q13875-3	MOBP_HUMAN;.;.	W	47;47;47;47;47;47;47;58;47;47;47	ENSP00000346695:C47W;ENSP00000401312:C47W;ENSP00000400491:C47W;ENSP00000388148:C47W;ENSP00000409730:C47W;ENSP00000373261:C47W;ENSP00000388827:C47W;ENSP00000312293:C47W;ENSP00000379530:C47W	ENSP00000312293:C47W	C	+	3	2	MOBP	39518705	0.998000	0.40836	0.018000	0.16275	0.827000	0.46813	0.409000	0.21082	-1.053000	0.03218	-0.924000	0.02725	TGT		0.557	MOBP-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000343711.1	NM_006501, NM_182934, NM_182935		Missense_Mutation
COL6A6	131873	broad.mit.edu	37	3	130282099	130282099	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr3:130282099C>A	ENST00000358511.6	+	2	283	c.252C>A	c.(250-252)ttC>ttA	p.F84L	COL6A6_ENST00000453409.2_Missense_Mutation_p.F84L	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	84	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.F84L(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TGAGCACCTTCAAAGGCAGGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	66.0	67.0					3																	130282099		1889	4104	5993	131764789	SO:0001583	missense	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.252C>A	3.37:g.130282099C>A	ENSP00000351310:p.Phe84Leu	Unknown		x	x	x	131764789	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701148	0.68501	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.84070	-1.8;-1.8	5.36	4.48	0.54585	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000005	D	0.85873	0.5798	M	0.67625	2.065	0.19300	N	0.999977	D	0.61697	0.99	P	0.59487	0.858	T	0.76666	-0.2875	10	0.36615	T	0.2	.	7.0418	0.25025	0.0:0.7055:0.0:0.2945	.	84	A6NMZ7	CO6A6_HUMAN	L	84	ENSP00000351310:F84L;ENSP00000399236:F84L	ENSP00000351310:F84L	F	+	3	2	COL6A6	131764789	0.977000	0.34250	0.913000	0.36048	0.852000	0.48524	1.436000	0.34980	1.391000	0.46566	0.561000	0.74099	TTC		0.522	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		Missense_Mutation
EPHB3	2049	broad.mit.edu	37	3	184298234	184298234	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr3:184298234G>C	ENST00000330394.2	+	12	2669	c.2217G>C	c.(2215-2217)ttG>ttC	p.L739F	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	739	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)	p.L739F(1)		breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TGGGCATGTTGCGGGGCATTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											142.0	130.0	134.0					3																	184298234		2203	4300	6503	185780928	SO:0001583	missense	2049			X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.2217G>C	3.37:g.184298234G>C	ENSP00000332118:p.Leu739Phe	Unknown		x	x	x	185780928	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	37	CCDS3268.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	15.22	2.770341	0.49680	.	.	ENSG00000182580	ENST00000330394	T	0.62941	-0.01	3.93	1.02	0.19986	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.63165	0.2488	L	0.45422	1.42	0.80722	D	1	D	0.64830	0.994	P	0.62014	0.897	T	0.61564	-0.7037	10	0.87932	D	0	.	4.9854	0.14187	0.2762:0.1558:0.5681:0.0	.	739	P54753	EPHB3_HUMAN	F	739	ENSP00000332118:L739F	ENSP00000332118:L739F	L	+	3	2	EPHB3	185780928	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.097000	0.30988	0.387000	0.25024	0.501000	0.49751	TTG		0.592	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443		Missense_Mutation
LMLN	89782	broad.mit.edu	37	3	197687130	197687130	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr3:197687130G>T	ENST00000330198.4	+	1	60	c.38G>T	c.(37-39)tGg>tTg	p.W13L	LMLN_ENST00000420910.2_Missense_Mutation_p.W13L|IQCG_ENST00000480302.1_5'Flank|LMLN_ENST00000482695.1_Start_Codon_SNP_p.M1I|LMLN_ENST00000332636.5_Start_Codon_SNP_p.M1I|IQCG_ENST00000265239.6_5'Flank	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	13					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.W13L(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		GCGGCCGAATGGGGCGGAGGA	0.726																																																1	Substitution - Missense(1)	ovary(1)	3											19.0	24.0	22.0					3																	197687130		2199	4298	6497	199171527	SO:0001583	missense	89782			AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.38G>T	3.37:g.197687130G>T	ENSP00000328829:p.Trp13Leu	Unknown		x	x	x	199171527	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	37	CCDS3332.1	SNP	47	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.755|7.755	0.704124|0.704124	0.15172|0.15172	.|.	.|.	ENSG00000185621|ENSG00000185621	ENST00000482695;ENST00000332636|ENST00000330198;ENST00000420910	T;T|T;T	0.38560|0.39056	1.13;1.15|1.12;1.1	4.22|4.22	1.09|1.09	0.20402|0.20402	.|.	.|1.910140	.|0.02836	.|N	.|0.127341	T|T	0.24353|0.24353	0.0590|0.0590	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B|B;B	0.02656|0.02656	0.0;0.0|0.0;0.0	B;B|B;B	0.01281|0.01281	0.0;0.0|0.0;0.0	T|T	0.16276|0.16276	-1.0408|-1.0408	9|10	0.87932|0.22109	D|T	0|0.4	3.5117|3.5117	7.2322|7.2322	0.26049|0.26049	0.0:0.3883:0.4342:0.1776|0.0:0.3883:0.4342:0.1776	.|.	1;1|13;13	F8WCE5;Q96KR4-2|Q96KR4;F8WB28	.;.|LMLN_HUMAN;.	I|L	1|13	ENSP00000418324:M1I;ENSP00000328611:M1I|ENSP00000328829:W13L;ENSP00000410926:W13L	ENSP00000328611:M1I|ENSP00000328829:W13L	M|W	+|+	3|2	0|0	LMLN|LMLN	199171527|199171527	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.429000|0.429000	0.31625|0.31625	-0.058000|-0.058000	0.11750|0.11750	0.504000|0.504000	0.28082|0.28082	0.456000|0.456000	0.33151|0.33151	ATG|TGG		0.726	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029		Missense_Mutation
ELMOD2	255520	broad.mit.edu	37	4	141446607	141446607	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr4:141446607T>A	ENST00000323570.3	+	2	157	c.25T>A	c.(25-27)Ttc>Atc	p.F9I	ELMOD2_ENST00000511887.2_Missense_Mutation_p.F9I	NM_153702.3	NP_714913.1	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	9					defense response to virus (GO:0051607)|phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)|regulation of defense response to virus (GO:0050688)	cytoskeleton (GO:0005856)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.F9I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7	all_hematologic(180;0.162)					GTGGGAGTTCTTCTATGGGCA	0.343																																																1	Substitution - Missense(1)	ovary(1)	4											121.0	127.0	125.0					4																	141446607		2203	4300	6503	141666057	SO:0001583	missense	255520			BX648349	CCDS3752.1	4q31.1	2006-10-24	2006-01-20		ENSG00000179387	ENSG00000179387			28111	protein-coding gene	gene with protein product		610196	"""ELMO domain containing 2"""			16773575	Standard	NM_153702		Approved	MGC10084	uc003iik.3	Q8IZ81	OTTHUMG00000133417	ENST00000323570.3:c.25T>A	4.37:g.141446607T>A	ENSP00000326342:p.Phe9Ile	Unknown		x	x	x	141666057	B2R712|D3DNZ0	Missense_Mutation	SNP	ENST00000323570.3	37	CCDS3752.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	15.32	2.797715	0.50208	.	.	ENSG00000179387	ENST00000323570;ENST00000507667;ENST00000502397	.	.	.	5.0	3.87	0.44632	.	0.270973	0.38720	N	0.001585	T	0.34077	0.0885	L	0.31294	0.92	0.44234	D	0.997072	B	0.30406	0.278	B	0.21360	0.034	T	0.16928	-1.0386	9	0.32370	T	0.25	-3.5057	8.0472	0.30555	0.0:0.1345:0.0:0.8655	.	9	Q8IZ81	ELMD2_HUMAN	I	9	.	ENSP00000326342:F9I	F	+	1	0	ELMOD2	141666057	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.357000	0.34090	1.876000	0.54355	0.459000	0.35465	TTC		0.343	ELMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257277.2	NM_153702		Missense_Mutation
RXFP3	51289	broad.mit.edu	37	5	33937399	33937399	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr5:33937399C>T	ENST00000330120.3	+	1	909	c.554C>T	c.(553-555)gCc>gTc	p.A185V		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	185					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.A185V(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						CATTCGGTGGCCTCGGCTCTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	5											67.0	66.0	67.0					5																	33937399		2203	4300	6503	33973156	SO:0001583	missense	51289			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.554C>T	5.37:g.33937399C>T	ENSP00000328708:p.Ala185Val	Unknown		x	x	x	33973156	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481728	0.44147	.	.	ENSG00000182631	ENST00000330120	T	0.19806	2.12	5.54	4.67	0.58626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.17323	0.0416	N	0.04335	-0.225	0.54753	D	0.999981	P	0.50710	0.938	P	0.55303	0.773	T	0.08146	-1.0736	10	0.08179	T	0.78	-22.5746	16.4096	0.83703	0.0:0.8683:0.1317:0.0	.	185	Q9NSD7	RL3R1_HUMAN	V	185	ENSP00000328708:A185V	ENSP00000328708:A185V	A	+	2	0	RXFP3	33973156	1.000000	0.71417	0.989000	0.46669	0.471000	0.32888	4.917000	0.63369	1.319000	0.45190	-0.176000	0.13171	GCC		0.632	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568		Missense_Mutation
ZNF608	57507	broad.mit.edu	37	5	124080050	124080050	+	Silent	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr5:124080050C>T	ENST00000306315.5	-	1	1068	c.633G>A	c.(631-633)agG>agA	p.R211R	ZNF608_ENST00000504926.1_Intron	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	211							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCTTGTCCTTCCTGGATTTCC	0.627																																																0			5											53.0	53.0	53.0					5																	124080050		2203	4299	6502	124107949	SO:0001819	synonymous_variant	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.633G>A	5.37:g.124080050C>T		Unknown		x	x	x	124107949	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Silent	SNP	ENST00000306315.5	37	CCDS34219.1	SNP	30	Broad																																																																																				0.627	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		Silent
FAM65B	9750	broad.mit.edu	37	6	24869353	24869353	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr6:24869353T>A	ENST00000259698.4	-	6	558	c.383A>T	c.(382-384)tAc>tTc	p.Y128F	FAM65B_ENST00000540914.1_Missense_Mutation_p.Y128F|FAM65B_ENST00000510784.2_Missense_Mutation_p.Y162F|FAM65B_ENST00000538035.1_Missense_Mutation_p.Y157F|FAM65B_ENST00000378023.4_Missense_Mutation_p.Y128F	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	128					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)		p.Y128F(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GCGTCTCATGTATCTTTCAAT	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											87.0	77.0	80.0					6																	24869353		1813	4070	5883	24977332	SO:0001583	missense	9750			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.383A>T	6.37:g.24869353T>A	ENSP00000259698:p.Tyr128Phe	Unknown		x	x	x	24977332	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	18.92	3.724954	0.68959	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.02787	4.16;4.16;4.16;4.16;4.16	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.04048	0.0113	L	0.35414	1.06	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.85130	0.997;0.996;0.997;0.997	T	0.61811	-0.6986	10	0.12430	T	0.62	-23.2924	16.5724	0.84622	0.0:0.0:0.0:1.0	.	162;157;128;128	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	F	128;157;128;128;162	ENSP00000259698:Y128F;ENSP00000441138:Y157F;ENSP00000367262:Y128F;ENSP00000438425:Y128F;ENSP00000441305:Y162F	ENSP00000259698:Y128F	Y	-	2	0	FAM65B	24977332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.972000	0.49256	2.313000	0.78055	0.455000	0.32223	TAC		0.328	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			Missense_Mutation
MAS1L	116511	broad.mit.edu	37	6	29454674	29454674	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr6:29454674C>T	ENST00000377127.3	-	1	1064	c.1006G>A	c.(1006-1008)Gcg>Acg	p.A336T		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	336					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A336T(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						TCTGCTAACGCCCGTTGGAGA	0.493																																					NSCLC(153;755 1987 3859 11251 32945)											1	Substitution - Missense(1)	ovary(1)	6											136.0	138.0	137.0					6																	29454674		2203	4300	6503	29562653	SO:0001583	missense	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.1006G>A	6.37:g.29454674C>T	ENSP00000366331:p.Ala336Thr	Unknown		x	x	x	29562653	Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	37	CCDS4661.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653485	0.29425	.	.	ENSG00000204687	ENST00000377127	T	0.37235	1.21	2.23	1.3	0.21679	.	.	.	.	.	T	0.26629	0.0651	M	0.69185	2.1	0.09310	N	1	P	0.36378	0.55	P	0.45639	0.488	T	0.25779	-1.0122	9	0.62326	D	0.03	.	8.557	0.33487	0.0:0.7588:0.2412:0.0	.	336	P35410	MAS1L_HUMAN	T	336	ENSP00000366331:A336T	ENSP00000366331:A336T	A	-	1	0	MAS1L	29562653	0.006000	0.16342	0.001000	0.08648	0.002000	0.02628	1.472000	0.35376	0.281000	0.22233	0.501000	0.49751	GCG		0.493	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967		Missense_Mutation
GNL1	2794	broad.mit.edu	37	6	30514020	30514020	+	Silent	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr6:30514020G>A	ENST00000376621.3	-	12	2623	c.1653C>T	c.(1651-1653)gaC>gaT	p.D551D		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	551	Asp/Glu-rich (highly acidic).				cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.D551D(1)		cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						cctcctcctcgtcACCTGCTG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	6											48.0	35.0	39.0					6																	30514020		2201	4297	6498	30621999	SO:0001819	synonymous_variant	2794				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1653C>T	6.37:g.30514020G>A		Unknown		x	x	x	30621999	B0S838|Q96CT5	Silent	SNP	ENST00000376621.3	37	CCDS4680.1	SNP	40	Broad																																																																																				0.607	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2			Silent
KLHL31	401265	broad.mit.edu	37	6	53518999	53518999	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr6:53518999G>A	ENST00000407079.1	-	1	1071	c.1072C>T	c.(1072-1074)Cag>Tag	p.Q358*	KLHL31_ENST00000370905.3_Nonsense_Mutation_p.Q358*			Q9H511	KLH31_HUMAN	kelch-like family member 31	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.Q358*(1)		autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					GCCACACACTGATTAAAACTT	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	6											114.0	109.0	111.0					6																	53518999		2203	4300	6503	53626958	SO:0001587	stop_gained	401265				CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1072C>T	6.37:g.53518999G>A	ENSP00000384644:p.Gln358*	Unknown		x	x	x	53626958	A6N9J2|B2RP49	Nonsense_Mutation	SNP	ENST00000407079.1	37	CCDS34478.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.629582	0.96671	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	18.8839	0.92367	0.0:0.0:1.0:0.0	.	.	.	.	X	358	.	ENSP00000359942:Q358X	Q	-	1	0	KLHL31	53626958	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.467000	0.83353	0.561000	0.74099	CAG		0.458	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760		Nonsense_Mutation
ABCB5	340273	broad.mit.edu	37	7	20685403	20685403	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr7:20685403G>A	ENST00000404938.2	+	8	1355	c.703G>A	c.(703-705)Gaa>Aaa	p.E235K	ABCB5_ENST00000406935.1_5'Flank|ABCB5_ENST00000258738.6_5'Flank|ABCB5_ENST00000443026.2_5'Flank	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	235	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GACCAGTAAGGAATTAAGTGC	0.408																																																0			7											133.0	123.0	126.0					7																	20685403		1568	3582	5150	20651928	SO:0001583	missense	340273			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.703G>A	7.37:g.20685403G>A	ENSP00000384881:p.Glu235Lys	Unknown		x	x	x	20651928	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.086460	0.94100	.	.	ENSG00000004846	ENST00000404938	D	0.90197	-2.63	4.79	4.79	0.61399	.	.	.	.	.	D	0.95714	0.8606	M	0.90483	3.12	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.94199	0.7448	9	0.29301	T	0.29	.	16.1533	0.81636	0.0:0.0:1.0:0.0	.	235	A7BKA4	.	K	235	ENSP00000384881:E235K	ENSP00000384881:E235K	E	+	1	0	ABCB5	20651928	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	8.836000	0.92105	2.941000	0.99782	0.655000	0.94253	GAA		0.408	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		Missense_Mutation
PIK3CG	5294	broad.mit.edu	37	7	106513376	106513376	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr7:106513376T>A	ENST00000359195.3	+	4	2590	c.2280T>A	c.(2278-2280)agT>agA	p.S760R	PIK3CG_ENST00000440650.2_Missense_Mutation_p.S760R|PIK3CG_ENST00000496166.1_Missense_Mutation_p.S760R	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	760					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S760R(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						ATGACGTCAGTTCCCAAGGTA	0.408																																																1	Substitution - Missense(1)	ovary(1)	7											91.0	88.0	89.0					7																	106513376		2203	4300	6503	106300612	SO:0001583	missense	5294				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.2280T>A	7.37:g.106513376T>A	ENSP00000352121:p.Ser760Arg	Unknown		x	x	x	106300612	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	13.74	2.328738	0.41197	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000473541;ENST00000359195	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.92	-0.216	0.13153	Protein kinase-like domain (1);	.	.	.	.	T	0.64136	0.2571	N	0.22421	0.69	0.38485	D	0.947836	B	0.06786	0.001	B	0.10450	0.005	T	0.51060	-0.8753	9	0.15499	T	0.54	-23.1633	10.3477	0.43916	0.0:0.3168:0.0:0.6832	.	760	P48736	PK3CG_HUMAN	R	760;760;33;760	ENSP00000392258:S760R;ENSP00000419260:S760R;ENSP00000417623:S33R;ENSP00000352121:S760R	ENSP00000352121:S760R	S	+	3	2	PIK3CG	106300612	0.102000	0.21896	1.000000	0.80357	0.862000	0.49288	-0.518000	0.06267	0.160000	0.19432	0.533000	0.62120	AGT		0.408	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			Missense_Mutation
C7orf60	154743	broad.mit.edu	37	7	112461967	112461967	+	Silent	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr7:112461967C>T	ENST00000297145.4	-	5	1215	c.1050G>A	c.(1048-1050)gaG>gaA	p.E350E	C7orf60_ENST00000485446.1_5'Flank	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	350							rRNA (adenine) methyltransferase activity (GO:0016433)	p.E350E(1)		breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						TAGAATATTCCTCATCTTCTA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	7											47.0	46.0	46.0					7																	112461967		1833	4082	5915	112249203	SO:0001819	synonymous_variant	154743				CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.1050G>A	7.37:g.112461967C>T		Unknown		x	x	x	112249203	Q8N3D0|Q96MV7	Silent	SNP	ENST00000297145.4	37	CCDS43634.1	SNP	24	Broad																																																																																				0.373	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338923.1	NM_152556		Silent
ARF5	381	broad.mit.edu	37	7	127230153	127230153	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr7:127230153G>T	ENST00000000233.5	+	4	446	c.292G>T	c.(292-294)Gag>Tag	p.E98*	GCC1_ENST00000497650.1_Intron	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	98					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.E98*(1)		cervix(2)|kidney(1)|lung(10)|ovary(1)	14						TAATGACCGGGAGCGGGTCCA	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	7											121.0	126.0	124.0					7																	127230153		2203	4300	6503	127017389	SO:0001587	stop_gained	381				CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.292G>T	7.37:g.127230153G>T	ENSP00000000233:p.Glu98*	Unknown		x	x	x	127017389	P26437	Nonsense_Mutation	SNP	ENST00000000233.5	37	CCDS34745.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.166692	0.97343	.	.	ENSG00000004059	ENST00000000233;ENST00000415666	.	.	.	5.31	5.31	0.75309	.	0.050830	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.0796	16.4691	0.84095	0.0:0.0:1.0:0.0	.	.	.	.	X	98	.	ENSP00000000233:E98X	E	+	1	0	ARF5	127017389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.744000	0.98853	2.485000	0.83878	0.484000	0.47621	GAG		0.552	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059567.2	NM_001662		Nonsense_Mutation
OPN1SW	611	broad.mit.edu	37	7	128415779	128415779	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr7:128415779A>C	ENST00000249389.2	-	1	65	c.66T>G	c.(64-66)gaT>gaG	p.D22E		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	22					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						ACTGAGGCCCATCCCACGGCC	0.522																																																0			7											77.0	82.0	81.0					7																	128415779		2203	4300	6503	128203015	SO:0001583	missense	611			U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.66T>G	7.37:g.128415779A>C	ENSP00000249389:p.Asp22Glu	Unknown		x	x	x	128203015	Q13877	Missense_Mutation	SNP	ENST00000249389.2	37	CCDS5806.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	8.768	0.925148	0.18056	.	.	ENSG00000128617	ENST00000249389	T	0.36340	1.26	4.87	-0.277	0.12898	.	0.224697	0.44285	D	0.000468	T	0.26048	0.0635	L	0.31752	0.955	0.39875	D	0.97356	P	0.48503	0.911	P	0.50617	0.646	T	0.33879	-0.9851	10	0.02654	T	1	.	8.6036	0.33760	0.6603:0.0:0.3397:0.0	.	22	P03999	OPSB_HUMAN	E	22	ENSP00000249389:D22E	ENSP00000249389:D22E	D	-	3	2	OPN1SW	128203015	0.925000	0.31364	0.999000	0.59377	0.922000	0.55478	0.055000	0.14229	0.055000	0.16094	0.379000	0.24179	GAT		0.522	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350655.1	NM_001708		Missense_Mutation
SLC18A1	6570	broad.mit.edu	37	8	20038460	20038460	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr8:20038460G>C	ENST00000276373.5	-	2	282	c.16C>G	c.(16-18)Ctg>Gtg	p.L6V	SLC18A1_ENST00000437980.1_Missense_Mutation_p.L6V|SLC18A1_ENST00000381608.4_Missense_Mutation_p.L6V|SLC18A1_ENST00000440926.1_Missense_Mutation_p.L6V|SLC18A1_ENST00000265808.7_Missense_Mutation_p.L6V|SLC18A1_ENST00000519026.1_Missense_Mutation_p.L6V	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	6					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)	p.L6V(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	GGAGCATCCAGAATGGTCCGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	8											53.0	44.0	47.0					8																	20038460		2200	4297	6497	20082740	SO:0001583	missense	6570				CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.16C>G	8.37:g.20038460G>C	ENSP00000276373:p.Leu6Val	Unknown		x	x	x	20082740	E9PDJ5|Q9BRE4	Missense_Mutation	SNP	ENST00000276373.5	37	CCDS6013.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570254	0.28003	.	.	ENSG00000036565	ENST00000265808;ENST00000276373;ENST00000440926;ENST00000437980;ENST00000519026;ENST00000381608;ENST00000522513	T;T;T;T;T;T;T	0.04275	3.96;3.96;3.96;3.94;3.96;3.94;3.66	5.71	0.111	0.14619	.	1.125910	0.06582	N	0.750533	T	0.03695	0.0105	L	0.38838	1.175	0.09310	N	1	B;B;B	0.25563	0.129;0.104;0.104	B;B;B	0.20955	0.032;0.022;0.022	T	0.47497	-0.9113	10	0.21540	T	0.41	-0.6217	1.5335	0.02540	0.4208:0.1378:0.3025:0.139	.	6;6;6	E9PB33;E9PDJ5;P54219	.;.;VMAT1_HUMAN	V	6	ENSP00000265808:L6V;ENSP00000276373:L6V;ENSP00000387549:L6V;ENSP00000413361:L6V;ENSP00000429664:L6V;ENSP00000371021:L6V;ENSP00000428999:L6V	ENSP00000265808:L6V	L	-	1	2	SLC18A1	20082740	0.001000	0.12720	0.000000	0.03702	0.018000	0.09664	0.317000	0.19487	0.254000	0.21573	0.655000	0.94253	CTG		0.602	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1			Missense_Mutation
TMEM70	54968	broad.mit.edu	37	8	74893720	74893720	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr8:74893720C>T	ENST00000312184.5	+	3	720	c.647C>T	c.(646-648)aCa>aTa	p.T216I	Y_RNA_ENST00000365350.1_RNA	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	216					mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)		p.T216I(1)		breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			TATGCTAAAACAAAATCACTG	0.343																																																1	Substitution - Missense(1)	ovary(1)	8											103.0	99.0	100.0					8																	74893720		2203	4300	6503	75056274	SO:0001583	missense	54968			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.647C>T	8.37:g.74893720C>T	ENSP00000312599:p.Thr216Ile	Unknown		x	x	x	75056274	E9PDY9|Q9NWY5	Missense_Mutation	SNP	ENST00000312184.5	37	CCDS6215.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400130	0.62177	.	.	ENSG00000175606	ENST00000312184	T	0.64991	-0.13	5.38	4.49	0.54785	.	0.336035	0.31392	N	0.007735	T	0.69922	0.3165	L	0.60455	1.87	0.35739	D	0.818551	D	0.55800	0.973	P	0.57846	0.828	T	0.78147	-0.2317	10	0.59425	D	0.04	-4.3983	11.1443	0.48422	0.1442:0.7171:0.1388:0.0	.	216	Q9BUB7	TMM70_HUMAN	I	216	ENSP00000312599:T216I	ENSP00000312599:T216I	T	+	2	0	TMEM70	75056274	0.898000	0.30612	1.000000	0.80357	0.805000	0.45488	1.660000	0.37397	1.466000	0.48025	0.655000	0.94253	ACA		0.343	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379028.1	NM_017866		Missense_Mutation
COL22A1	169044	broad.mit.edu	37	8	139606337	139606337	+	Missense_Mutation	SNP	C	C	T	rs200298766		TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr8:139606337C>T	ENST00000303045.6	-	63	4984	c.4538G>A	c.(4537-4539)cGg>cAg	p.R1513Q	COL22A1_ENST00000435777.1_Missense_Mutation_p.R1493Q|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1513	Collagen-like 15.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R1513Q(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGGCCGGCCCGGCCTGGAAG	0.662										HNSCC(7;0.00092)																																						1	Substitution - Missense(1)	ovary(1)	8																																								139675519	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4538G>A	8.37:g.139606337C>T	ENSP00000303153:p.Arg1513Gln	Unknown		x	x	x	139675519	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573540	0.65765	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93906	-3.31;-3.31	5.92	4.14	0.48551	.	0.138852	0.30930	N	0.008598	D	0.88108	0.6348	N	0.16368	0.405	0.19945	N	0.999945	P;B	0.37083	0.581;0.175	B;B	0.43950	0.437;0.02	T	0.77504	-0.2563	10	0.13470	T	0.59	.	12.0321	0.53403	0.0:0.8609:0.0:0.1391	.	1493;1513	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	Q	1513;1493;1206	ENSP00000303153:R1513Q;ENSP00000387655:R1493Q	ENSP00000303153:R1513Q	R	-	2	0	COL22A1	139675519	0.955000	0.32602	0.476000	0.27291	0.817000	0.46193	3.106000	0.50322	0.861000	0.35504	0.650000	0.86243	CGG		0.662	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Missense_Mutation
AK3	50808	broad.mit.edu	37	9	4722564	4722564	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr9:4722564C>G	ENST00000381809.3	-	2	443	c.213G>C	c.(211-213)atG>atC	p.M71I	AK3_ENST00000447596.4_Intron|AK3_ENST00000359883.2_Start_Codon_SNP_p.M1I	NM_016282.3	NP_057366.2	P27144	KAD4_HUMAN	adenylate kinase 3	69					ADP biosynthetic process (GO:0006172)|AMP metabolic process (GO:0046033)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|GTP metabolic process (GO:0046039)|liver development (GO:0001889)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|response to drug (GO:0042493)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside triphosphate adenylate kinase activity (GO:0046899)	p.M71I(1)		large_intestine(2)|lung(1)|ovary(2)	5	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)	Adefovir Dipivoxil(DB00718)|Tenofovir(DB00300)	CCAGCCGAGTCATGACATCAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	9											97.0	88.0	91.0					9																	4722564		2203	4300	6503	4712564	SO:0001583	missense	50808			BC013771	CCDS6455.1, CCDS56561.1, CCDS56562.1	9p24.1	2010-09-29	2004-06-11	2005-04-07	ENSG00000147853	ENSG00000147853			17376	protein-coding gene	gene with protein product		609290	"""adenylate kinase 6"", ""adenylate kinase 3 like 1"""	AK6, AK3L1		8288, 182062	Standard	NM_001199852		Approved	AKL3L1	uc003ziq.2	Q9UIJ7	OTTHUMG00000019472	ENST00000381809.3:c.213G>C	9.37:g.4722564C>G	ENSP00000371230:p.Met71Ile	Unknown		x	x	x	4712564	B2R927|D3DQ62|Q6IBH4|Q6NXQ5|Q8IUU9	Missense_Mutation	SNP	ENST00000381809.3	37	CCDS6455.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	8.903	0.956812	0.18507	.	.	ENSG00000147853	ENST00000381809;ENST00000359883;ENST00000474822	T;T	0.79247	-0.85;-1.25	5.51	5.51	0.81932	.	0.100669	0.85682	D	0.000000	T	0.56156	0.1966	N	0.03050	-0.425	0.80722	D	1	B	0.23249	0.082	B	0.30029	0.11	T	0.56147	-0.8027	10	0.09338	T	0.73	-23.797	14.9577	0.71131	0.0:0.8575:0.1425:0.0	.	71	Q9UIJ7	KAD3_HUMAN	I	71;1;1	ENSP00000371230:M71I;ENSP00000352948:M1I	ENSP00000352948:M1I	M	-	3	0	AK3	4712564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.580000	0.36547	2.599000	0.87857	0.591000	0.81541	ATG		0.458	AK3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051585.1	NM_016282		Missense_Mutation
FOXD4L3	286380	broad.mit.edu	37	9	70918851	70918851	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr9:70918851A>T	ENST00000342833.2	+	1	1576	c.984A>T	c.(982-984)agA>agT	p.R328S		NM_199135.4	NP_954586.4	Q6VB84	FX4L3_HUMAN	forkhead box D4-like 3	328						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R328S(1)		ovary(1)	1				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CAGCATTGAGAGTATTATGCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	9											32.0	43.0	39.0					9																	70918851		2176	4266	6442	70108671	SO:0001583	missense	286380			AY344642	CCDS43833.1	9q13	2008-05-13				ENSG00000187559			18523	protein-coding gene	gene with protein product		611086				12421752	Standard	NM_199135		Approved	OTTHUMG00000019959, FOXD6	uc004agm.1	Q6VB84	OTTHUMG00000019959	ENST00000342833.2:c.984A>T	9.37:g.70918851A>T	ENSP00000341961:p.Arg328Ser	Unknown		x	x	x	70108671	Q5JTX9	Missense_Mutation	SNP	ENST00000342833.2	37	CCDS43833.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	.	15.66	2.899605	0.52227	.	.	ENSG00000187559	ENST00000342833	D	0.94537	-3.45	4.04	4.04	0.47022	.	0.890743	0.08834	U	0.886884	D	0.88687	0.6504	N	0.14661	0.345	0.24173	N	0.995619	P	0.47762	0.9	B	0.39419	0.299	T	0.81138	-0.1069	10	0.87932	D	0	.	11.2103	0.48795	1.0:0.0:0.0:0.0	.	328	Q6VB84	FX4L3_HUMAN	S	328	ENSP00000341961:R328S	ENSP00000341961:R328S	R	+	3	2	FOXD4L3	70108671	0.398000	0.25279	1.000000	0.80357	0.814000	0.46013	4.652000	0.61454	1.592000	0.50018	0.374000	0.22700	AGA		0.627	FOXD4L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052539.2	NM_199358		Missense_Mutation
PRUNE2	158471	broad.mit.edu	37	9	79324786	79324786	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr9:79324786C>A	ENST00000376718.3	-	8	2527	c.2404G>T	c.(2404-2406)Gca>Tca	p.A802S	PRUNE2_ENST00000428286.1_Missense_Mutation_p.A443S	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	802					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.A802S(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TTACCAAATGCACTCCAGGCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	9											42.0	39.0	40.0					9																	79324786		1568	3582	5150	78514606	SO:0001583	missense	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2404G>T	9.37:g.79324786C>A	ENSP00000365908:p.Ala802Ser	Unknown		x	x	x	78514606	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	SNP	25	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.128|9.128	1.010604|1.010604	0.19277|0.19277	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.23348|.	1.91;1.91|.	5.71|5.71	4.71|4.71	0.59529|0.59529	.|.	0.281919|.	0.25660|.	N|.	0.029159|.	T|T	0.44222|0.44222	0.1283|0.1283	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P|.	0.49090|.	0.919|.	B|.	0.42692|.	0.395|.	T|T	0.23261|0.23261	-1.0193|-1.0193	10|5	0.66056|.	D|.	0.02|.	-12.2181|-12.2181	7.3227|7.3227	0.26536|0.26536	0.0:0.7961:0.0:0.2039|0.0:0.7961:0.0:0.2039	.|.	802|.	Q8WUY3|.	PRUN2_HUMAN|.	S|F	802;443;801|123	ENSP00000365908:A802S;ENSP00000397425:A443S|.	ENSP00000365908:A802S|.	A|C	-|-	1|2	0|0	PRUNE2|PRUNE2	78514606|78514606	0.710000|0.710000	0.27896|0.27896	1.000000|1.000000	0.80357|0.80357	0.074000|0.074000	0.17049|0.17049	1.925000|1.925000	0.40074|0.40074	2.699000|2.699000	0.92147|0.92147	0.462000|0.462000	0.41574|0.41574	GCA|TGC		0.522	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		Missense_Mutation
MYOM3	127294	broad.mit.edu	37	1	24435077	24435078	+	Frame_Shift_Ins	INS	-	-	G	rs532144295		TCGA-24-2298-01	TCGA-24-2298-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-24-2298-01	TCGA-24-2298-11	g.chr1:24435077_24435078insG	ENST00000374434.3	-	2	211_212	c.49_50insC	c.(49-51)cagfs	p.Q17fs	MYOM3_ENST00000329601.7_Frame_Shift_Ins_p.Q17fs|MYOM3_ENST00000330966.7_Frame_Shift_Ins_p.Q17fs|MYOM3_ENST00000475306.1_5'Flank	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	17						M band (GO:0031430)	protein homodimerization activity (GO:0042803)	p.Q17fs*43(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CTCCATGGCCTGGGGGGGCCGG	0.668																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								24307665	SO:0001589	frameshift_variant	127294			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.50dupC	1.37:g.24435084_24435084dupG	ENSP00000363557:p.Gln17fs	Unknown		Capture	Illumina GAIIx	Phase_I	24307664	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Frame_Shift_Ins	INS	ENST00000374434.3	37	CCDS41281.1	INS	55	Broad																																																																																				0.668	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372		Frame_Shift_Ins
