#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACY1	95	hgsc.bcm.edu	37	3	52020493	52020494	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-25-1317-01	TCGA-25-1317-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr3:52020493_52020494insTG	ENST00000404366.2	+	7	645_646	c.499_500insTG	c.(499-501)ctgfs	p.L167fs	ACY1_ENST00000458031.2_Frame_Shift_Ins_p.L257fs|ACY1_ENST00000476854.1_Frame_Shift_Ins_p.L167fs|ACY1_ENST00000494103.1_Intron|ACY1_ENST00000476351.1_Frame_Shift_Ins_p.L132fs|ABHD14A-ACY1_ENST00000463937.1_Frame_Shift_Ins_p.L268fs	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	167					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.R168fs*1(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	GTTCCACGCCCTGAGGGCAGGC	0.619																																																1	Insertion - Frameshift(1)	ovary(1)	3																																								51995534	SO:0001589	frameshift_variant	95			L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.500_501dupTG	3.37:g.52020494_52020495dupTG	ENSP00000384296:p.Leu167fs	Somatic		Capture	SOLID	Phase_IV	51995533	C9J6I6|C9J9D8|C9JWD4	Frame_Shift_Ins	INS	ENST00000404366.2	37	CCDS2844.1	INS	24	Baylor																																																																																				0.619	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666		Frame_Shift_Ins
AMBRA1	55626	hgsc.bcm.edu	37	11	46439541	46439541	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr11:46439541G>C	ENST00000458649.2	-	15	3456	c.3038C>G	c.(3037-3039)tCt>tGt	p.S1013C	AMBRA1_ENST00000533727.1_Missense_Mutation_p.S894C|AMBRA1_ENST00000528950.1_Missense_Mutation_p.S984C|AMBRA1_ENST00000314845.3_Missense_Mutation_p.S923C|AMBRA1_ENST00000298834.3_Missense_Mutation_p.S953C|AMBRA1_ENST00000426438.1_Missense_Mutation_p.S984C|AMBRA1_ENST00000534300.1_Missense_Mutation_p.S953C			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1013					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)		p.S923C(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CCAACGGGCAGAGTTGATACT	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	101.0	103.0					11																	46439541		2201	4299	6500	46396117	SO:0001583	missense	55626			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3038C>G	11.37:g.46439541G>C	ENSP00000415327:p.Ser1013Cys	Somatic		Capture	SOLID	Phase_IV	46396117	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37		SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017077	0.93404	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.06608	3.28;3.28;3.28;3.28;3.28;3.28;3.28	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.14141	0.0342	N	0.12182	0.205	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.993;0.998;0.998;0.997;0.997;0.997	T	0.22906	-1.0203	10	0.87932	D	0	.	19.9478	0.97189	0.0:0.0:1.0:0.0	.	1013;984;953;894;1016;923	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	C	923;894;953;984;953;1013;2;984	ENSP00000318313:S923C;ENSP00000433372:S894C;ENSP00000431926:S953C;ENSP00000410899:S984C;ENSP00000298834:S953C;ENSP00000415327:S1013C;ENSP00000433945:S984C	ENSP00000298834:S953C	S	-	2	0	AMBRA1	46396117	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.827000	0.99397	2.712000	0.92718	0.591000	0.81541	TCT		0.522	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749		Missense_Mutation
ANKRD24	170961	hgsc.bcm.edu	37	19	4210079	4210079	+	Frame_Shift_Del	DEL	C	C	-			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr19:4210079delC	ENST00000600132.1	+	12	1171	c.895delC	c.(895-897)cagfs	p.Q299fs	ANKRD24_ENST00000262970.5_Frame_Shift_Del_p.Q389fs|ANKRD24_ENST00000318934.4_Frame_Shift_Del_p.Q299fs|ANKRD24_ENST00000595096.1_3'UTR|RN7SL84P_ENST00000578969.1_RNA	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	299								p.Q389fs*29(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CCATGGAAAGCAGGGGGCCCC	0.662																																																1	Deletion - Frameshift(1)	ovary(1)	19											18.0	22.0	21.0					19																	4210079		1842	4080	5922	4161079	SO:0001589	frameshift_variant	170961			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.895delC	19.37:g.4210079delC	ENSP00000471252:p.Gln299fs	Somatic		Capture	SOLID	Phase_IV	4161079	O75268|O95781	Frame_Shift_Del	DEL	ENST00000600132.1	37	CCDS45925.1	DEL	25	Baylor																																																																																				0.662	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000		Frame_Shift_Del
ASB12	142689	hgsc.bcm.edu	37	X	63444290	63444290	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chrX:63444290C>A	ENST00000396130.2	-	2	854	c.855G>T	c.(853-855)caG>caT	p.Q285H	ASB12_ENST00000362002.2_Missense_Mutation_p.Q294H|MTMR8_ENST00000453546.1_Missense_Mutation_p.Q669H			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	285	SOCS box.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						GCTGGCCAGCCTGGCACAAGG	0.498																																																2	Whole gene deletion(2)	ovary(1)|large_intestine(1)	X											113.0	89.0	97.0					X																	63444290		2203	4300	6503	63361015	SO:0001583	missense	142689			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.855G>T	X.37:g.63444290C>A	ENSP00000379435:p.Gln285His	Somatic		Capture	SOLID	Phase_IV	63361015	J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	ENST00000396130.2	37		SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.666	0.123808	0.08931	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.42513	0.97;0.97;0.97	3.73	-0.148	0.13424	SOCS protein, C-terminal (2);	1.171480	0.05876	N	0.625650	T	0.30293	0.0760	L	0.41824	1.3	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20207	-1.0282	10	0.15952	T	0.53	-18.6199	5.5109	0.16880	0.0:0.5667:0.1495:0.2839	.	669;285	B4DQL0;Q8WXK4	.;ASB12_HUMAN	H	294;285;262;669	ENSP00000355195:Q294H;ENSP00000379435:Q285H;ENSP00000394003:Q669H	ENSP00000354626:Q262H	Q	-	3	2	ASB12;MTMR8	63361015	0.000000	0.05858	0.002000	0.10522	0.234000	0.25298	-0.156000	0.10100	-0.172000	0.10779	-0.297000	0.09499	CAG		0.498	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				Missense_Mutation
ATP4A	495	hgsc.bcm.edu	37	19	36046068	36046068	+	Splice_Site	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr19:36046068C>T	ENST00000262623.3	-	15	2354	c.2326G>A	c.(2326-2328)Ggt>Agt	p.G776S		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	776					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TGGCTCGGACCCTGCTCCACG	0.617																																																0			19											89.0	77.0	81.0					19																	36046068		2203	4300	6503	40737908	SO:0001630	splice_region_variant	495				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2326+1G>A	19.37:g.36046068C>T		Somatic		Capture	SOLID	Phase_IV	40737908	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267887	0.80469	.	.	ENSG00000105675	ENST00000262623	D	0.97772	-4.53	4.78	4.78	0.61160	ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000001	D	0.98947	0.9642	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99410	1.0930	9	.	.	.	.	15.3439	0.74320	0.0:1.0:0.0:0.0	.	776	P20648	ATP4A_HUMAN	S	776	ENSP00000262623:G776S	.	G	-	1	0	ATP4A	40737908	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	7.627000	0.83176	2.489000	0.83994	0.555000	0.69702	GGT		0.617	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	Missense_Mutation	Missense_Mutation
C2CD3	26005	hgsc.bcm.edu	37	11	73789396	73789396	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr11:73789396T>G	ENST00000334126.7	-	23	4593	c.4367A>C	c.(4366-4368)gAa>gCa	p.E1456A	C2CD3_ENST00000313663.7_Missense_Mutation_p.E1456A			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1456					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.E1456A(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GTTTACAGATTCCTTAGGCTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	91.0	93.0					11																	73789396		2200	4293	6493	73467044	SO:0001583	missense	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4367A>C	11.37:g.73789396T>G	ENSP00000334379:p.Glu1456Ala	Somatic		Capture	SOLID	Phase_IV	73467044	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.811	-0.751927	0.03041	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.14516	2.9;2.91;2.5	5.35	4.18	0.49190	.	0.342003	0.30704	N	0.009051	T	0.07773	0.0195	L	0.47716	1.5	0.09310	N	0.999991	P	0.42871	0.792	B	0.35039	0.194	T	0.15065	-1.0450	10	0.07030	T	0.85	-16.0428	4.2844	0.10848	0.3383:0.0992:0.0:0.5626	.	1456	Q4AC94-1	.	A	1456;1456;1437;264	ENSP00000334379:E1456A;ENSP00000323339:E1456A;ENSP00000388750:E264A	ENSP00000323339:E1456A	E	-	2	0	C2CD3	73467044	0.082000	0.21442	0.998000	0.56505	0.120000	0.20174	2.935000	0.48963	2.025000	0.59659	0.528000	0.53228	GAA		0.453	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		Missense_Mutation
CAMK4	814	hgsc.bcm.edu	37	5	110819911	110819911	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr5:110819911C>T	ENST00000282356.4	+	11	1567	c.1169C>T	c.(1168-1170)gCa>gTa	p.A390V	CAMK4_ENST00000512890.1_3'UTR|CAMK4_ENST00000512453.1_Missense_Mutation_p.A390V	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	390					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.A390V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		GTTAAGGGGGCACAGGCTGAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	5											63.0	67.0	66.0					5																	110819911		2202	4300	6502	110847810	SO:0001583	missense	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.1169C>T	5.37:g.110819911C>T	ENSP00000282356:p.Ala390Val	Somatic		Capture	SOLID	Phase_IV	110847810	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272374	0.59649	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.68479	-0.33;-0.33	5.45	1.46	0.22682	.	1.465370	0.04666	N	0.409859	T	0.50154	0.1599	N	0.14661	0.345	0.09310	N	1	B	0.26935	0.164	B	0.22601	0.04	T	0.39820	-0.9595	10	0.45353	T	0.12	.	8.251	0.31717	0.4485:0.4059:0.1456:0.0	.	390	Q16566	KCC4_HUMAN	V	390	ENSP00000422634:A390V;ENSP00000282356:A390V	ENSP00000282356:A390V	A	+	2	0	CAMK4	110847810	0.000000	0.05858	0.001000	0.08648	0.531000	0.34715	-0.046000	0.11983	-0.024000	0.13941	0.467000	0.42956	GCA		0.512	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		Missense_Mutation
CAPN12	147968	hgsc.bcm.edu	37	19	39234612	39234612	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr19:39234612G>A	ENST00000328867.4	-	1	502	c.194C>T	c.(193-195)cCg>cTg	p.P65L	CAPN12_ENST00000601953.1_Intron	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	65	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.P65L(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CTCCGAGTCCGGCCCCAGCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											73.0	58.0	63.0					19																	39234612		2203	4300	6503	43926452	SO:0001583	missense	147968			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.194C>T	19.37:g.39234612G>A	ENSP00000331636:p.Pro65Leu	Somatic		Capture	SOLID	Phase_IV	43926452		Missense_Mutation	SNP	ENST00000328867.4	37	CCDS12519.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	g	15.95	2.984990	0.53934	.	.	ENSG00000182472	ENST00000328867	T	0.52057	0.68	4.74	3.71	0.42584	Peptidase C2, calpain, catalytic domain (3);	0.205245	0.32753	N	0.005696	T	0.69735	0.3144	M	0.88640	2.97	0.58432	D	0.999991	D	0.89917	1.0	D	0.71414	0.973	T	0.74682	-0.3583	10	0.87932	D	0	.	10.3601	0.43989	0.0963:0.0:0.9037:0.0	.	65	Q6ZSI9	CAN12_HUMAN	L	65	ENSP00000331636:P65L	ENSP00000331636:P65L	P	-	2	0	CAPN12	43926452	1.000000	0.71417	0.422000	0.26621	0.308000	0.27856	3.498000	0.53302	1.234000	0.43709	0.457000	0.33378	CCG		0.622	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1			Missense_Mutation
CDH24	64403	hgsc.bcm.edu	37	14	23518878	23518878	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr14:23518878G>C	ENST00000267383.5	-	10	1761	c.1669C>G	c.(1669-1671)Cct>Gct	p.P557A	CDH24_ENST00000487137.2_Missense_Mutation_p.P519A|CDH24_ENST00000485922.1_5'UTR|CDH24_ENST00000554034.1_Missense_Mutation_p.P519A|CDH24_ENST00000397359.3_Missense_Mutation_p.P557A			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	557	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)	p.P519A(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		GGGCCCAGAGGACCTTGAAAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	14											85.0	74.0	77.0					14																	23518878		2203	4300	6503	22588718	SO:0001583	missense	64403			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1669C>G	14.37:g.23518878G>C	ENSP00000267383:p.Pro557Ala	Somatic		Capture	SOLID	Phase_IV	22588718	D3DS44|Q86UP1|Q9NT84	Missense_Mutation	SNP	ENST00000267383.5	37	CCDS9585.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.219	1.032786	0.19590	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000554034;ENST00000267383	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	4.7	4.7	0.59300	Cadherin (2);Cadherin-like (1);	0.302777	0.30658	N	0.009148	T	0.30634	0.0771	N	0.22421	0.69	0.25237	N	0.989785	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.05435	-1.0885	10	0.54805	T	0.06	.	12.2657	0.54676	0.0:0.0:0.8294:0.1706	.	519;557	Q86UP0-2;Q86UP0	.;CAD24_HUMAN	A	557;519;519;557	ENSP00000380517:P557A;ENSP00000434821:P519A;ENSP00000452493:P519A;ENSP00000267383:P557A	ENSP00000267383:P557A	P	-	1	0	CDH24	22588718	0.009000	0.17119	0.992000	0.48379	0.939000	0.58152	0.689000	0.25437	2.448000	0.82819	0.555000	0.69702	CCT		0.562	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257241.2	NM_022478		Missense_Mutation
CHD6	84181	hgsc.bcm.edu	37	20	40084604	40084604	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr20:40084604T>C	ENST00000373233.3	-	19	3022	c.2845A>G	c.(2845-2847)Aaa>Gaa	p.K949E	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	949	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.K949E(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				ACCTCCATTTTTGAGAGCTGC	0.448																																																1	Substitution - Missense(1)	ovary(1)	20											159.0	152.0	154.0					20																	40084604		2203	4300	6503	39518018	SO:0001583	missense	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.2845A>G	20.37:g.40084604T>C	ENSP00000362330:p.Lys949Glu	Somatic		Capture	SOLID	Phase_IV	39518018	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.5	4.744203	0.89663	.	.	ENSG00000124177	ENST00000373233	D	0.85013	-1.93	5.73	5.73	0.89815	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000008	D	0.89959	0.6866	L	0.48642	1.525	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90913	0.4777	10	0.87932	D	0	-23.021	16.3123	0.82883	0.0:0.0:0.0:1.0	.	949	Q8TD26	CHD6_HUMAN	E	949	ENSP00000362330:K949E	ENSP00000362330:K949E	K	-	1	0	CHD6	39518018	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.027000	0.88791	2.308000	0.77769	0.533000	0.62120	AAA		0.448	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			Missense_Mutation
CHRNB1	1140	hgsc.bcm.edu	37	17	7358671	7358671	+	Silent	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr17:7358671G>A	ENST00000306071.2	+	9	1180	c.1113G>A	c.(1111-1113)ccG>ccA	p.P371P	CHRNB1_ENST00000536404.2_Silent_p.P299P|CHRNB1_ENST00000576360.1_Silent_p.P250P|CHRNB1_ENST00000575379.1_5'Flank	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	371					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)	p.P371P(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	ACCTGATGCCGGAGCCCCCTC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	17											99.0	104.0	102.0					17																	7358671		2203	4300	6503	7299395	SO:0001819	synonymous_variant	1140			X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.1113G>A	17.37:g.7358671G>A		Somatic		Capture	SOLID	Phase_IV	7299395	B7Z5H1|Q8IZ46|Q96FB8	Silent	SNP	ENST00000306071.2	37	CCDS11106.1	SNP	39	Baylor																																																																																				0.537	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3			Silent
DIP2A	23181	hgsc.bcm.edu	37	21	47961767	47961767	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr21:47961767C>T	ENST00000417564.2	+	18	2156	c.2135C>T	c.(2134-2136)tCa>tTa	p.S712L	DIP2A_ENST00000466639.1_Missense_Mutation_p.S669L|DIP2A_ENST00000427143.2_Missense_Mutation_p.S648L|DIP2A_ENST00000435722.3_Missense_Mutation_p.S712L|DIP2A_ENST00000318711.7_Missense_Mutation_p.S713L|DIP2A_ENST00000400274.1_Missense_Mutation_p.S708L|DIP2A_ENST00000457905.3_Missense_Mutation_p.S712L			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	712					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GAAAAGTTGTCAGTCCTTACT	0.478																																																0			21											119.0	125.0	123.0					21																	47961767		1991	4181	6172	46786195	SO:0001583	missense	23181			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2135C>T	21.37:g.47961767C>T	ENSP00000392066:p.Ser712Leu	Somatic		Capture	SOLID	Phase_IV	46786195	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230143	0.79688	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.39	5.39	0.77823	AMP-dependent synthetase/ligase (1);	0.142232	0.48767	D	0.000177	T	0.54870	0.1885	L	0.56769	1.78	0.80722	D	1	B;B;P;B;B;B;B	0.36010	0.096;0.015;0.532;0.281;0.048;0.128;0.038	B;B;B;P;B;B;B	0.47705	0.261;0.025;0.329;0.555;0.349;0.197;0.051	T	0.55412	-0.8145	10	0.56958	D	0.05	-6.0843	18.1496	0.89671	0.0:1.0:0.0:0.0	.	713;648;669;648;712;712;712	E9PER1;E7EMA5;Q14689-3;B4E0F0;Q14689;Q14689-4;Q14689-2	.;.;.;.;DIP2A_HUMAN;.;.	L	708;648;713;669;712;669;712;712	ENSP00000383133:S708L;ENSP00000400528:S648L;ENSP00000323633:S713L;ENSP00000393434:S712L;ENSP00000430249:S669L;ENSP00000415089:S712L;ENSP00000392066:S712L	ENSP00000323633:S713L	S	+	2	0	DIP2A	46786195	1.000000	0.71417	0.595000	0.28798	0.876000	0.50452	7.662000	0.83803	2.530000	0.85305	0.655000	0.94253	TCA		0.478	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		Missense_Mutation
DPF3	8110	hgsc.bcm.edu	37	14	73220034	73220034	+	Missense_Mutation	SNP	C	C	T	rs530932479		TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr14:73220034C>T	ENST00000556509.1	-	3	238	c.239G>A	c.(238-240)cGc>cAc	p.R80H	DPF3_ENST00000546183.1_Missense_Mutation_p.R90H|DPF3_ENST00000541685.1_Missense_Mutation_p.R80H	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	80					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)	p.R79H(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TCTCTTCTTGCGCCAGCAGCG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19610	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14											55.0	55.0	55.0					14																	73220034		1893	4114	6007	72289787	SO:0001583	missense	8110			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.239G>A	14.37:g.73220034C>T	ENSP00000450518:p.Arg80His	Somatic		Capture	SOLID	Phase_IV	72289787	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	37		SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571914	0.86542	.	.	ENSG00000205683	ENST00000540281;ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.93659	-3.26;-0.84;-0.8	5.58	4.69	0.59074	.	.	.	.	.	D	0.96281	0.8787	M	0.81942	2.565	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.991	D	0.96404	0.9299	9	0.87932	D	0	.	11.7928	0.52080	0.0:0.9171:0.0:0.0829	.	90;80;80	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	H	80;80;79;80;90	ENSP00000450518:R80H;ENSP00000441640:R80H;ENSP00000444662:R90H	ENSP00000381791:R135H	R	-	2	0	DPF3	72289787	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.726000	0.68515	1.367000	0.46095	0.561000	0.74099	CGC		0.567	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2			Missense_Mutation
DYNC2H1	79659	hgsc.bcm.edu	37	11	103058111	103058111	+	Missense_Mutation	SNP	A	A	C	rs568202877		TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr11:103058111A>C	ENST00000375735.2	+	43	7080	c.6936A>C	c.(6934-6936)caA>caC	p.Q2312H	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.Q2312H|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2312	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGTCCACTCAAATTGCTACAG	0.413													A|||	1	0.000199681	0.0008	0.0	5008	,	,		18421	0.0		0.0	False		,,,				2504	0.0															0			11											112.0	110.0	111.0					11																	103058111		2029	4198	6227	102563321	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.6936A>C	11.37:g.103058111A>C	ENSP00000364887:p.Gln2312His	Somatic		Capture	SOLID	Phase_IV	102563321	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.974	1.226327	0.22542	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.39787	1.06;1.06	5.12	-5.88	0.02290	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.35335	0.0928	M	0.74647	2.275	0.29773	N	0.834622	B;B	0.10296	0.003;0.003	B;B	0.20577	0.03;0.017	T	0.41928	-0.9481	9	0.15499	T	0.54	.	8.3163	0.32102	0.5342:0.1906:0.2751:0.0	.	2312;2312	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	H	2312	ENSP00000364887:Q2312H;ENSP00000381167:Q2312H	ENSP00000364887:Q2312H	Q	+	3	2	DYNC2H1	102563321	0.180000	0.23148	0.004000	0.12327	0.523000	0.34469	-0.453000	0.06778	-1.016000	0.03371	-0.250000	0.11733	CAA		0.413	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		Missense_Mutation
DYX1C1	161582	hgsc.bcm.edu	37	15	55722919	55722919	+	Silent	SNP	A	A	T			TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr15:55722919A>T	ENST00000321149.3	-	10	1579	c.1212T>A	c.(1210-1212)atT>atA	p.I404I	DYX1C1_ENST00000457155.2_Nonsense_Mutation_p.L369*|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000380679.1_Intron|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000348518.3_Nonsense_Mutation_p.L369*	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	404					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)	p.I404I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		TCTCAGCATCAATTTGTACAA	0.284																																																1	Substitution - coding silent(1)	ovary(1)	15											126.0	126.0	126.0					15																	55722919		2192	4290	6482	53510211	SO:0001819	synonymous_variant	161582				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.1212T>A	15.37:g.55722919A>T		Somatic		Capture	SOLID	Phase_IV	53510211	Q6P5Y9|Q8N1S6	Nonsense_Mutation	SNP	ENST00000321149.3	37	CCDS10154.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.9	4.074039	0.76415	.	.	ENSG00000256061	ENST00000457155;ENST00000348518	.	.	.	5.6	-2.2	0.06994	.	.	.	.	.	.	.	.	.	.	.	0.26427	N	0.975997	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	4.6396	0.12541	0.324:0.0:0.335:0.341	.	.	.	.	X	369	.	ENSP00000299561:L369X	L	-	2	0	DYX1C1	53510211	0.494000	0.26043	0.994000	0.49952	0.948000	0.59901	0.024000	0.13555	-0.212000	0.10109	0.456000	0.33151	TTG		0.284	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1	NM_130810		Nonsense_Mutation
E2F7	144455	hgsc.bcm.edu	37	12	77444416	77444416	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr12:77444416T>G	ENST00000322886.7	-	4	713	c.478A>C	c.(478-480)Agt>Cgt	p.S160R	E2F7_ENST00000416496.2_Missense_Mutation_p.S160R	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	160					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S160R(1)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AAGGGATAACTTGGATAGCGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	12											201.0	184.0	190.0					12																	77444416		2203	4300	6503	75968547	SO:0001583	missense	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.478A>C	12.37:g.77444416T>G	ENSP00000323246:p.Ser160Arg	Somatic		Capture	SOLID	Phase_IV	75968547	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	CCDS9016.1	SNP	56	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.39|17.39	3.377181|3.377181	0.61735|0.61735	.|.	.|.	ENSG00000165891|ENSG00000165891	ENST00000551058|ENST00000322886;ENST00000416496;ENST00000550669	.|T;T;T	.|0.17528	.|2.53;2.27;2.28	5.95|5.95	5.95|5.95	0.96441|0.96441	.|Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	.|0.075950	.|0.85682	.|D	.|0.000000	T|T	0.25938|0.25938	0.0632|0.0632	N|N	0.17278|0.17278	0.47|0.47	0.50813|0.50813	D|D	0.99989|0.99989	.|D;D	.|0.69078	.|0.996;0.997	.|P;D	.|0.66497	.|0.907;0.944	T|T	0.05484|0.05484	-1.0882|-1.0882	5|10	.|0.54805	.|T	.|0.06	-18.0679|-18.0679	15.6048|15.6048	0.76658|0.76658	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|160;160	.|F8VSE7;Q96AV8	.|.;E2F7_HUMAN	H|R	37|160	.|ENSP00000323246:S160R;ENSP00000393639:S160R;ENSP00000448245:S160R	.|ENSP00000323246:S160R	Q|S	-|-	3|1	2|0	E2F7|E2F7	75968547|75968547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.715000|5.715000	0.68430|0.68430	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	CAA|AGT		0.443	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		Missense_Mutation
EXTL3	2137	hgsc.bcm.edu	37	8	28575717	28575717	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr8:28575717C>A	ENST00000220562.4	+	3	3043	c.2141C>A	c.(2140-2142)cCc>cAc	p.P714H	EXTL3_ENST00000523149.1_Missense_Mutation_p.P330H|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	714					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		ATTGGCGTCCCCATCATGGTA	0.468																																																0			8											92.0	91.0	91.0					8																	28575717		2203	4300	6503	28631636	SO:0001583	missense	2137			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2141C>A	8.37:g.28575717C>A	ENSP00000220562:p.Pro714His	Somatic		Capture	SOLID	Phase_IV	28631636	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774476	0.70107	.	.	ENSG00000012232	ENST00000523149;ENST00000220562	T;T	0.79352	-1.26;-1.26	5.91	5.91	0.95273	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.89392	0.6702	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89374	0.3677	10	0.66056	D	0.02	-27.4425	20.2946	0.98546	0.0:1.0:0.0:0.0	.	714	O43909	EXTL3_HUMAN	H	330;714	ENSP00000428691:P330H;ENSP00000220562:P714H	ENSP00000220562:P714H	P	+	2	0	EXTL3	28631636	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.818000	0.86416	2.804000	0.96469	0.462000	0.41574	CCC		0.468	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		Missense_Mutation
FAM151B	167555	hgsc.bcm.edu	37	5	79815645	79815645	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr5:79815645T>G	ENST00000282226.4	+	4	606	c.451T>G	c.(451-453)Tta>Gta	p.L151V	FAM151B_ENST00000511718.1_3'UTR	NM_205548.2	NP_991111.2	Q6UXP7	F151B_HUMAN	family with sequence similarity 151, member B	151								p.L151V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	7		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		AAAACCATTTTTAGACACCGT	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											146.0	138.0	141.0					5																	79815645		2203	4300	6503	79851401	SO:0001583	missense	167555				CCDS4051.1	5q14.1	2007-12-18	2007-12-18		ENSG00000152380	ENSG00000152380			33716	protein-coding gene	gene with protein product							Standard	NM_205548		Approved	UNQ9217	uc003kgv.2	Q6UXP7	OTTHUMG00000131303	ENST00000282226.4:c.451T>G	5.37:g.79815645T>G	ENSP00000282226:p.Leu151Val	Somatic		Capture	SOLID	Phase_IV	79851401	A2RRE4	Missense_Mutation	SNP	ENST00000282226.4	37	CCDS4051.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741550	0.49151	.	.	ENSG00000152380	ENST00000282226	T	0.12879	2.64	5.76	0.525	0.17072	.	0.285900	0.40222	N	0.001143	T	0.12902	0.0313	M	0.64080	1.96	0.40974	D	0.984728	P	0.34699	0.464	B	0.32090	0.14	T	0.06972	-1.0797	10	0.46703	T	0.11	-7.6742	8.7199	0.34434	0.4211:0.473:0.0:0.1058	.	151	Q6UXP7	F151B_HUMAN	V	151	ENSP00000282226:L151V	ENSP00000282226:L151V	L	+	1	2	FAM151B	79851401	0.996000	0.38824	0.988000	0.46212	0.902000	0.53008	0.447000	0.21710	0.077000	0.16863	-0.367000	0.07326	TTA		0.403	FAM151B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254072.1	NM_205548		Missense_Mutation
FMNL3	91010	hgsc.bcm.edu	37	12	50047597	50047597	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr12:50047597C>T	ENST00000293590.5	-	12	1365	c.1132G>A	c.(1132-1134)Gtg>Atg	p.V378M	FMNL3_ENST00000352151.5_Missense_Mutation_p.V327M|FMNL3_ENST00000335154.5_Missense_Mutation_p.V378M|FMNL3_ENST00000550488.1_Missense_Mutation_p.V378M			Q8IVF7	FMNL3_HUMAN	formin-like 3	378	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)	p.V378M(1)		breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						ACATCAAACACGTTGTCCAGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											177.0	178.0	178.0					12																	50047597		2022	4183	6205	48333864	SO:0001583	missense	91010			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.1132G>A	12.37:g.50047597C>T	ENSP00000293590:p.Val378Met	Somatic		Capture	SOLID	Phase_IV	48333864	B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	ENST00000293590.5	37		SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009247	0.75046	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89491	0.6730	L	0.58354	1.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	D	0.85660	0.1288	10	0.25751	T	0.34	.	19.3176	0.94223	0.0:1.0:0.0:0.0	.	327;378	Q8IVF7-2;Q8IVF7-3	.;.	M	378;378;327;378	ENSP00000335655:V378M;ENSP00000447479:V378M;ENSP00000344311:V327M;ENSP00000293590:V378M	ENSP00000293590:V378M	V	-	1	0	FMNL3	48333864	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GTG		0.532	FMNL3-201	KNOWN	basic	protein_coding	protein_coding		NM_175736		Missense_Mutation
GCN1L1	10985	hgsc.bcm.edu	37	12	120621448	120621448	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr12:120621448A>C	ENST00000300648.6	-	5	362	c.350T>G	c.(349-351)tTg>tGg	p.L117W		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	117					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGTCCAGGTCAAGGCCAGCAA	0.557																																																0			12											85.0	91.0	89.0					12																	120621448		2163	4274	6437	119105831	SO:0001583	missense	10985			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.350T>G	12.37:g.120621448A>C	ENSP00000300648:p.Leu117Trp	Somatic		Capture	SOLID	Phase_IV	119105831	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	28.7	4.942019	0.92526	.	.	ENSG00000089154	ENST00000300648	T	0.00717	5.79	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000002	T	0.02494	0.0076	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.66948	-0.5794	10	0.87932	D	0	-2.4088	16.418	0.83748	1.0:0.0:0.0:0.0	.	117	Q92616	GCN1L_HUMAN	W	117	ENSP00000300648:L117W	ENSP00000300648:L117W	L	-	2	0	GCN1L1	119105831	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.778000	0.91785	2.281000	0.76405	0.524000	0.50904	TTG		0.557	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			Missense_Mutation
HHATL	57467	hgsc.bcm.edu	37	3	42734605	42734605	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr3:42734605A>G	ENST00000441594.1	-	11	1615	c.1354T>C	c.(1354-1356)Ttc>Ctc	p.F452L	HHATL_ENST00000310417.5_Missense_Mutation_p.F452L	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	452					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		AGCTCTGTGAATTTGAGGCTG	0.577																																																0			3											143.0	133.0	137.0					3																	42734605		2203	4300	6503	42709609	SO:0001583	missense	57467			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.1354T>C	3.37:g.42734605A>G	ENSP00000405423:p.Phe452Leu	Somatic		Capture	SOLID	Phase_IV	42709609	Q8TBG3|Q9ULP7	Missense_Mutation	SNP	ENST00000441594.1	37	CCDS2704.1	SNP	4	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	13.55|13.55	2.270406|2.270406	0.40194|0.40194	.|.	.|.	ENSG00000010282|ENSG00000010282	ENST00000310417;ENST00000441594|ENST00000426666	T;T|.	0.16743|.	2.32;2.32|.	3.69|3.69	3.69|3.69	0.42338|0.42338	.|.	0.055712|.	0.64402|.	U|.	0.000001|.	T|T	0.56337|0.56337	0.1978|0.1978	L|L	0.43152|0.43152	1.355|1.355	0.58432|0.58432	D|D	0.999994|0.999994	P|.	0.48407|.	0.91|.	B|.	0.39217|.	0.294|.	T|T	0.52555|0.52555	-0.8560|-0.8560	10|5	0.11182|.	T|.	0.66|.	-15.312|-15.312	11.007|11.007	0.47639|0.47639	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	452|.	Q9HCP6|.	HHATL_HUMAN|.	L|T	452|71	ENSP00000310621:F452L;ENSP00000405423:F452L|.	ENSP00000310621:F452L|.	F|I	-|-	1|2	0|0	HHATL|HHATL	42709609|42709609	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.177000|0.177000	0.22998|0.22998	9.163000|9.163000	0.94750|0.94750	1.336000|1.336000	0.45506|0.45506	0.242000|0.242000	0.17961|0.17961	TTC|ATT		0.577	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707		Missense_Mutation
HIST1H3G	8355	hgsc.bcm.edu	37	6	26271323	26271323	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr6:26271323C>A	ENST00000305910.3	-	1	289	c.290G>T	c.(289-291)tGc>tTc	p.C97F	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	97					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.C97F(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						GTAGGCCTCGCAGGCCTCCTG	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											89.0	91.0	90.0					6																	26271323		2203	4300	6503	26379302	SO:0001583	missense	8355			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.290G>T	6.37:g.26271323C>A	ENSP00000439660:p.Cys97Phe	Somatic		Capture	SOLID	Phase_IV	26379302	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000305910.3	37	CCDS4602.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	.	7.720	0.696959	0.15106	.	.	ENSG00000256018	ENST00000305910	T	0.68331	-0.32	4.42	4.42	0.53409	.	.	.	.	.	T	0.74222	0.3688	.	.	.	0.43032	D	0.994607	.	.	.	.	.	.	T	0.79181	-0.1909	6	0.87932	D	0	.	16.4001	0.83637	0.0:1.0:0.0:0.0	.	.	.	.	F	97	ENSP00000439660:C97F	ENSP00000439660:C97F	C	-	2	0	HIST1H3G	26379302	1.000000	0.71417	0.999000	0.59377	0.035000	0.12851	4.740000	0.62087	2.183000	0.69458	0.563000	0.77884	TGC		0.577	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534		Missense_Mutation
KDM8	79831	hgsc.bcm.edu	37	16	27221505	27221505	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr16:27221505G>T	ENST00000286096.4	+	2	234	c.61G>T	c.(61-63)Gcc>Tcc	p.A21S	KDM8_ENST00000380948.2_Missense_Mutation_p.A21S|KDM8_ENST00000441782.2_Missense_Mutation_p.A59S|KDM8_ENST00000568965.1_Missense_Mutation_p.A21S	NM_024773.2	NP_079049.2	Q8N371	KDM8_HUMAN	lysine (K)-specific demethylase 8	21					G2/M transition of mitotic cell cycle (GO:0000086)|histone H3-K36 demethylation (GO:0070544)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (H3-K36 specific) (GO:0051864)|metal ion binding (GO:0046872)	p.A21S(1)									TTTATGGGAGGCCCTCAGGGC	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											51.0	51.0	51.0					16																	27221505		2196	4299	6495	27129006	SO:0001583	missense	79831			AK023860	CCDS10627.1, CCDS45448.1	16p12.1	2012-03-28	2012-03-28	2012-03-28	ENSG00000155666	ENSG00000155666		"""Chromatin-modifying enzymes / K-demethylases"""	25840	protein-coding gene	gene with protein product		611917	"""jumonji domain containing 5"""	JMJD5		20457893	Standard	NM_024773		Approved	FLJ13798	uc010vcn.1	Q8N371	OTTHUMG00000131677	ENST00000286096.4:c.61G>T	16.37:g.27221505G>T	ENSP00000286096:p.Ala21Ser	Somatic		Capture	SOLID	Phase_IV	27129006	B4DLU9|Q6VAK5|Q9H8B1	Missense_Mutation	SNP	ENST00000286096.4	37	CCDS10627.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.94	2.387415	0.42308	.	.	ENSG00000155666	ENST00000380948;ENST00000286096;ENST00000441782	T;T	0.22539	1.99;1.95	5.52	3.56	0.40772	.	5.646350	0.00357	N	0.000022	T	0.22859	0.0552	L	0.54323	1.7	0.21386	N	0.999707	B;B;B	0.33171	0.053;0.4;0.017	B;B;B	0.30855	0.019;0.121;0.006	T	0.23655	-1.0182	10	0.23891	T	0.37	-13.7018	6.8103	0.23801	0.157:0.1446:0.6984:0.0	.	59;21;21	Q8N371-3;Q8N371-2;Q8N371	.;.;KDM8_HUMAN	S	21;21;59	ENSP00000286096:A21S;ENSP00000398410:A59S	ENSP00000286096:A21S	A	+	1	0	JMJD5	27129006	1.000000	0.71417	0.994000	0.49952	0.909000	0.53808	1.754000	0.38369	0.693000	0.31634	0.561000	0.74099	GCC		0.632	KDM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254580.3	NM_024773		Missense_Mutation
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709440	31709440	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr21:31709440G>A	ENST00000382835.2	-	1	572	c.547C>T	c.(547-549)Cca>Tca	p.P183S		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	183						intermediate filament (GO:0005882)		p.P183S(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						AGGAGTTGTGGCTCAGGTGCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	21											89.0	85.0	87.0					21																	31709440		2203	4300	6503	30631311	SO:0001583	missense	643812			AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.547C>T	21.37:g.31709440G>A	ENSP00000372286:p.Pro183Ser	Somatic		Capture	SOLID	Phase_IV	30631311		Missense_Mutation	SNP	ENST00000382835.2	37	CCDS33532.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.922	-0.715497	0.03206	.	.	ENSG00000206107	ENST00000382835	T	0.48201	0.82	4.17	-2.68	0.06041	.	1.019820	0.07859	N	0.965917	T	0.20780	0.0500	N	0.05510	-0.035	0.09310	N	1	B	0.28971	0.229	B	0.31245	0.126	T	0.18053	-1.0349	10	0.19590	T	0.45	0.1452	1.2078	0.01899	0.1777:0.1384:0.2606:0.4233	.	183	Q3LI81	KR271_HUMAN	S	183	ENSP00000372286:P183S	ENSP00000372286:P183S	P	-	1	0	KRTAP27-1	30631311	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.651000	0.05372	-0.545000	0.06224	-0.302000	0.09304	CCA		0.468	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711		Missense_Mutation
LIN9	286826	hgsc.bcm.edu	37	1	226496877	226496878	+	In_Frame_Ins	INS	-	-	TGC			TCGA-25-1317-01	TCGA-25-1317-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr1:226496877_226496878insTGC	ENST00000328205.5	-	1	556_557	c.11_12insGCA	c.(10-12)ggc>ggGCAc	p.4_5insH	LIN9_ENST00000481685.1_In_Frame_Ins_p.4_5insH|LIN9_ENST00000366801.1_5'UTR	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	0	Sufficient for interaction with RB1.				DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)		p.G4_G5insH(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		AAGGCTGCCCGCCGCGGTGCAT	0.673																																					Ovarian(197;1696 2974 11248 14117)											1	Insertion - In frame(1)	ovary(1)	1																																								224563501	SO:0001652	inframe_insertion	286826			AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.11_12insGCA	1.37:g.226496877_226496878insTGC	ENSP00000329102:p.Gly4_Gly5insHis	Somatic		Capture	SOLID	Phase_IV	224563500	Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	In_Frame_Ins	INS	ENST00000328205.5	37	CCDS1553.1	INS	38	Baylor																																																																																				0.673	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091523.2	NM_173083		In_Frame_Ins
MKX	283078	hgsc.bcm.edu	37	10	27964271	27964271	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr10:27964271T>C	ENST00000375790.5	-	7	1378	c.946A>G	c.(946-948)Aat>Gat	p.N316D	MKX_ENST00000419761.1_Missense_Mutation_p.N316D			Q8IYA7	MKX_HUMAN	mohawk homeobox	316					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.N316D(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						TGTGCAAGATTTGTTAAGGCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	10											285.0	248.0	261.0					10																	27964271		2203	4300	6503	28004277	SO:0001583	missense	283078			BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.946A>G	10.37:g.27964271T>C	ENSP00000364946:p.Asn316Asp	Somatic		Capture	SOLID	Phase_IV	28004277	B3KWM5	Missense_Mutation	SNP	ENST00000375790.5	37	CCDS7156.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028578	0.75390	.	.	ENSG00000150051	ENST00000375790;ENST00000419761	T;T	0.18016	2.24;2.24	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.18759	0.0450	L	0.55481	1.735	0.80722	D	1	B	0.33549	0.417	B	0.25884	0.064	T	0.01520	-1.1334	10	0.62326	D	0.03	-32.3208	16.3473	0.83146	0.0:0.0:0.0:1.0	.	316	Q8IYA7	MKX_HUMAN	D	316	ENSP00000364946:N316D;ENSP00000400896:N316D	ENSP00000364946:N316D	N	-	1	0	MKX	28004277	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	7.423000	0.80229	2.320000	0.78422	0.528000	0.53228	AAT		0.463	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047332.3	NM_173576		Missense_Mutation
MOGAT1	116255	hgsc.bcm.edu	37	2	223553194	223553195	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-25-1317-01	TCGA-25-1317-10	AA	AA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr2:223553194_223553195delAA	ENST00000446656.3	+	2	226_227	c.226_227delAA	c.(226-228)aaafs	p.K76fs		NM_058165.2	NP_477513.2	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	76					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.N77fs*8(1)		breast(1)|cervix(1)|endometrium(1)|lung(5)|urinary_tract(1)	9		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		CAGCTGGATCAAAAATTGGACT	0.371																																					Ovarian(93;205 1446 2385 11581 25911)											1	Deletion - Frameshift(1)	ovary(1)	2																																								223261439	SO:0001589	frameshift_variant	116255			AF384163	CCDS46524.1	2q36.2	2006-10-06	2004-05-28	2004-05-28	ENSG00000124003	ENSG00000124003			18210	protein-coding gene	gene with protein product		610268	"""diacylglycerol O-acyltransferase 2 like 1"""	DGAT2L1		14970677	Standard	NM_058165		Approved	DGAT2L, MGAT1	uc010fws.1	Q96PD6	OTTHUMG00000153394	ENST00000446656.3:c.226_227delAA	2.37:g.223553196_223553197delAA	ENSP00000406674:p.Lys76fs	Somatic		Capture	SOLID	Phase_IV	223261438	Q6IEE5	Frame_Shift_Del	DEL	ENST00000446656.3	37	CCDS46524.1	DEL	5	Baylor																																																																																				0.371	MOGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331010.3	NM_058165		Frame_Shift_Del
MUC6	4588	hgsc.bcm.edu	37	11	1016041	1016042	+	Frame_Shift_Ins	INS	-	-	C			TCGA-25-1317-01	TCGA-25-1317-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr11:1016041_1016042insC	ENST00000421673.2	-	31	6809_6810	c.6759_6760insG	c.(6757-6762)aggaccfs	p.T2254fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2254	Ser-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.T2254fs*120(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGGCCGTGGTCCTGGGCGTGG	0.614																																																1	Insertion - Frameshift(1)	ovary(1)	11																																								1006042	SO:0001589	frameshift_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6760dupG	11.37:g.1016043_1016043dupC	ENSP00000406861:p.Thr2254fs	Somatic		Capture	SOLID	Phase_IV	1006041	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Ins	INS	ENST00000421673.2	37	CCDS44513.1	INS	58	Baylor																																																																																				0.614	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		Frame_Shift_Ins
MYO7B	4648	hgsc.bcm.edu	37	2	128393337	128393337	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr2:128393337G>A	ENST00000409816.2	+	42	5815	c.5783G>A	c.(5782-5784)cGg>cAg	p.R1928Q	MYO7B_ENST00000389524.4_Missense_Mutation_p.R1929Q|MYO7B_ENST00000428314.1_Missense_Mutation_p.R1928Q|MYO7B_ENST00000409090.1_Missense_Mutation_p.R781Q|LIMS2_ENST00000494613.1_5'Flank			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1928	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R2172Q(1)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AAGTGTTCGCGGGAGGATGCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											39.0	47.0	44.0					2																	128393337		2138	4231	6369	128109807	SO:0001583	missense	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.5783G>A	2.37:g.128393337G>A	ENSP00000386461:p.Arg1928Gln	Somatic		Capture	SOLID	Phase_IV	128109807	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	g	13.36	2.212878	0.39102	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816;ENST00000409090	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.43	0.246	0.15516	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.270733	0.34484	N	0.003931	T	0.67711	0.2922	M	0.64997	1.995	0.09310	N	1	B;B	0.21071	0.037;0.051	B;B	0.27380	0.079;0.063	T	0.53823	-0.8384	10	0.31617	T	0.26	.	2.5868	0.04832	0.3943:0.1114:0.3805:0.1139	.	843;1928	B0I1T4;Q6PIF6	.;MYO7B_HUMAN	Q	1929;1928;1928;781	ENSP00000374175:R1929Q;ENSP00000415090:R1928Q;ENSP00000386461:R1928Q;ENSP00000386850:R781Q	ENSP00000374175:R1929Q	R	+	2	0	MYO7B	128109807	0.000000	0.05858	0.078000	0.20375	0.779000	0.44077	-0.104000	0.10923	0.020000	0.15106	-0.254000	0.11334	CGG		0.637	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		Missense_Mutation
NBEAL2	23218	hgsc.bcm.edu	37	3	47047699	47047699	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr3:47047699G>T	ENST00000450053.3	+	44	7143	c.6964G>T	c.(6964-6966)Gct>Tct	p.A2322S	NBEAL2_ENST00000292309.5_Missense_Mutation_p.A2138S|NBEAL2_ENST00000383740.2_Missense_Mutation_p.A601S	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2322	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GGAACGGAAGGCTCTGGAGGG	0.602																																																0			3											65.0	76.0	73.0					3																	47047699		2099	4220	6319	47022703	SO:0001583	missense	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.6964G>T	3.37:g.47047699G>T	ENSP00000415034:p.Ala2322Ser	Somatic		Capture	SOLID	Phase_IV	47022703	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	SNP	42	Baylor	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	24.9|24.9|24.9	4.581813|4.581813|4.581813	0.86748|0.86748|0.86748	.|.|.	.|.|.	ENSG00000160796|ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053;ENST00000445550;ENST00000423436|ENST00000443829|ENST00000416683	T;T;T;T|.|.	0.80304|.|.	-1.36;-1.36;-1.36;-1.36|.|.	4.7|4.7|4.7	3.78|3.78|3.78	0.43462|0.43462|0.43462	BEACH domain (4);|.|.	0.053901|.|.	0.64402|.|.	D|.|.	0.000001|.|.	T|T|T	0.61702|0.61702|0.61702	0.2368|0.2368|0.2368	L|L|L	0.55103|0.55103|0.55103	1.725|1.725|1.725	0.58432|0.58432|0.58432	D|D|D	0.999993|0.999993|0.999993	P;P|.|.	0.48503|.|.	0.911;0.82|.|.	P;D|.|.	0.64321|.|.	0.562;0.924|.|.	T|T|T	0.59386|0.59386|0.59386	-0.7464|-0.7464|-0.7464	10|5|5	0.59425|.|.	D|.|.	0.04|.|.	.|.|.	12.2296|12.2296|12.2296	0.54480|0.54480|0.54480	0.0:0.1732:0.8268:0.0|0.0:0.1732:0.8268:0.0|0.0:0.1732:0.8268:0.0	.|.|.	2138;2322|.|.	Q6ZNJ1-2;Q6ZNJ1|.|.	.;NBEL2_HUMAN|.|.	S|V|S	2138;601;2322;265;149|690|1609	ENSP00000292309:A2138S;ENSP00000373246:A601S;ENSP00000415034:A2322S;ENSP00000415063:A149S|.|.	ENSP00000292309:A2138S|.|.	A|G|R	+|+|+	1|2|3	0|0|2	NBEAL2|NBEAL2|NBEAL2	47022703|47022703|47022703	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.907000|0.907000|0.907000	0.53573|0.53573|0.53573	9.169000|9.169000|9.169000	0.94788|0.94788|0.94788	1.132000|1.132000|1.132000	0.42129|0.42129|0.42129	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GCT|GGC|AGG		0.602	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		Missense_Mutation
NMUR2	56923	hgsc.bcm.edu	37	5	151784128	151784128	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr5:151784128T>A	ENST00000255262.3	-	1	712	c.547A>T	c.(547-549)Agc>Tgc	p.S183C	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	183					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CCATGGATGCTGGTGTTGGGC	0.602																																																0			5											110.0	113.0	112.0					5																	151784128		2203	4300	6503	151764321	SO:0001583	missense	56923			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.547A>T	5.37:g.151784128T>A	ENSP00000255262:p.Ser183Cys	Somatic		Capture	SOLID	Phase_IV	151764321	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	CCDS4321.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.87	2.960121	0.53400	.	.	ENSG00000132911	ENST00000255262	T	0.72167	-0.63	5.44	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.128707	0.56097	D	0.000032	T	0.69405	0.3107	M	0.89353	3.025	0.36635	D	0.876529	B	0.22003	0.063	B	0.25759	0.063	T	0.67620	-0.5624	10	0.66056	D	0.02	-15.3874	2.8995	0.05701	0.1944:0.271:0.0:0.5346	.	183	Q9GZQ4	NMUR2_HUMAN	C	183	ENSP00000255262:S183C	ENSP00000255262:S183C	S	-	1	0	NMUR2	151764321	0.996000	0.38824	1.000000	0.80357	0.779000	0.44077	1.486000	0.35530	0.368000	0.24481	-0.481000	0.04817	AGC		0.602	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167		Missense_Mutation
TENM2	57451	hgsc.bcm.edu	37	5	167689432	167689432	+	Frame_Shift_Del	DEL	A	A	-			TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr5:167689432delA	ENST00000518659.1	+	29	7981	c.7942delA	c.(7942-7944)aacfs	p.N2648fs	TENM2_ENST00000519204.1_Frame_Shift_Del_p.N2527fs|TENM2_ENST00000545108.1_Frame_Shift_Del_p.N2647fs|TENM2_ENST00000520394.1_Frame_Shift_Del_p.N2409fs|TENM2_ENST00000403607.2_Frame_Shift_Del_p.N2472fs	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2648					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.N2481fs*2(1)									GAGCGGGGTGAACGTGACCGT	0.597																																																1	Deletion - Frameshift(1)	ovary(1)	5											33.0	37.0	36.0					5																	167689432		2152	4227	6379	167622010	SO:0001589	frameshift_variant	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.7942delA	5.37:g.167689432delA	ENSP00000429430:p.Asn2648fs	Somatic		Capture	SOLID	Phase_IV	167622010	Q9ULU2	Frame_Shift_Del	DEL	ENST00000518659.1	37		DEL	9	Baylor																																																																																				0.597	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		Frame_Shift_Del
OR8B4	283162	hgsc.bcm.edu	37	11	124294128	124294128	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr11:124294128C>A	ENST00000356130.3	-	1	661	c.640G>T	c.(640-642)Gtc>Ttc	p.V214F		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V214F(1)		endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TAAGAGATGACGATGCTTATG	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	75.0	80.0					11																	124294128		2201	4299	6500	123799338	SO:0001583	missense	283162			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.640G>T	11.37:g.124294128C>A	ENSP00000348449:p.Val214Phe	Somatic		Capture	SOLID	Phase_IV	123799338	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	37	CCDS31710.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.495766	0.00010	.	.	ENSG00000198657	ENST00000356130	T	0.00277	8.34	4.14	0.336	0.15958	GPCR, rhodopsin-like superfamily (1);	0.367346	0.23494	N	0.047561	T	0.00073	0.0002	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36407	-0.9749	10	0.02654	T	1	.	5.9376	0.19175	0.2511:0.3054:0.0:0.4435	.	214	Q96RC9	OR8B4_HUMAN	F	214	ENSP00000348449:V214F	ENSP00000348449:V214F	V	-	1	0	OR8B4	123799338	0.000000	0.05858	0.409000	0.26459	0.035000	0.12851	-2.446000	0.01010	0.043000	0.15746	-3.124000	0.00061	GTC		0.483	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196		Missense_Mutation
PGAP1	80055	hgsc.bcm.edu	37	2	197737199	197737199	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr2:197737199A>C	ENST00000354764.4	-	18	1808	c.1694T>G	c.(1693-1695)tTt>tGt	p.F565C	PGAP1_ENST00000409475.1_Missense_Mutation_p.F565C	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	565					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.F565C(3)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GTACATTTTAAATAATGCCAC	0.323																																																3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	2											106.0	104.0	104.0					2																	197737199		2203	4300	6503	197445444	SO:0001583	missense	80055				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1694T>G	2.37:g.197737199A>C	ENSP00000346809:p.Phe565Cys	Somatic		Capture	SOLID	Phase_IV	197445444	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518077	0.44763	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475	.	.	.	5.06	5.06	0.68205	.	0.078689	0.53938	D	0.000060	T	0.36386	0.0965	N	0.08118	0	0.80722	D	1	B;B	0.32507	0.373;0.187	B;B	0.36418	0.224;0.121	T	0.44329	-0.9335	9	0.87932	D	0	-6.0755	13.1918	0.59715	1.0:0.0:0.0:0.0	.	565;565	Q75T13-3;Q75T13	.;PGAP1_HUMAN	C	345;565;565	.	ENSP00000346809:F565C	F	-	2	0	PGAP1	197445444	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	5.462000	0.66707	2.141000	0.66446	0.477000	0.44152	TTT		0.323	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989		Missense_Mutation
PITX2	5308	hgsc.bcm.edu	37	4	111554153	111554153	+	Start_Codon_SNP	SNP	A	A	C	rs75334582		TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr4:111554153A>C	ENST00000354925.2	-	4	1707	c.2T>G	c.(1-3)aTg>aGg	p.M1R	PITX2_ENST00000355080.5_Start_Codon_SNP_p.M1R|PITX2_ENST00000394598.2_Start_Codon_SNP_p.M1R|PITX2_ENST00000394595.3_Start_Codon_SNP_p.M1R	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	1					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GTTGGTCTCCATTCCCCGTTA	0.577																																																0			4											120.0	120.0	120.0					4																	111554153		2203	4300	6503	111773602	SO:0001582	initiator_codon_variant	5308			U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.2T>G	4.37:g.111554153A>C	ENSP00000347004:p.Met1Arg	Somatic		Capture	SOLID	Phase_IV	111773602	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	37	CCDS3692.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.95	3.513262	0.64522	.	.	ENSG00000164093	ENST00000394598;ENST00000355080;ENST00000354925;ENST00000394595;ENST00000511837;ENST00000511990	D;D;D;D;D	0.93906	-3.05;-2.96;-3.05;-3.31;-2.82	5.39	5.39	0.77823	.	.	.	.	.	D	0.95856	0.8651	.	.	.	0.80722	D	1	P;P	0.42518	0.782;0.454	P;B	0.55345	0.774;0.071	D	0.96355	0.9261	8	0.87932	D	0	.	15.4267	0.75059	1.0:0.0:0.0:0.0	.	1;1	Q99697-3;Q99697	.;PITX2_HUMAN	R	1	ENSP00000378097:M1R;ENSP00000347192:M1R;ENSP00000347004:M1R;ENSP00000421454:M1R;ENSP00000424142:M1R	ENSP00000347004:M1R	M	-	2	0	PITX2	111773602	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.974000	0.88039	2.041000	0.60428	0.455000	0.32223	ATG		0.577	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2		Missense_Mutation	Missense_Mutation
PPP2R4	5524	hgsc.bcm.edu	37	9	131891295	131891295	+	Missense_Mutation	SNP	C	C	T	rs200309124		TCGA-25-1317-01	TCGA-25-1317-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr9:131891295C>T	ENST00000337738.1	+	5	620	c.353C>T	c.(352-354)aCg>aTg	p.T118M	PPP2R4_ENST00000393370.2_Missense_Mutation_p.T83M|PPP2R4_ENST00000355007.3_Intron|PPP2R4_ENST00000347048.4_Intron|PPP2R4_ENST00000358994.4_Missense_Mutation_p.T83M|PPP2R4_ENST00000348141.5_Missense_Mutation_p.T89M|PPP2R4_ENST00000357197.4_Missense_Mutation_p.T54M|PPP2R4_ENST00000452489.2_Missense_Mutation_p.T118M	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	118					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)	p.T118M(1)		breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CTTCTCAACACGCTGGACAGG	0.537																																					Colon(158;2158 2504 4450 20433)											1	Substitution - Missense(1)	ovary(1)	9											95.0	80.0	85.0					9																	131891295		2203	4300	6503	130931116	SO:0001583	missense	5524			X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.353C>T	9.37:g.131891295C>T	ENSP00000337448:p.Thr118Met	Somatic		Capture	SOLID	Phase_IV	130931116	A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	ENST00000337738.1	37		SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744957	0.89663	.	.	ENSG00000119383	ENST00000358994;ENST00000455292;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000452489;ENST00000357197;ENST00000445241;ENST00000414331;ENST00000417728;ENST00000453358;ENST00000417504;ENST00000440346	T;T;T;T;T;T;T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.52484	0.1737	M	0.83953	2.67	0.80722	D	1	P;D;D;D	0.69078	0.908;0.982;0.957;0.997	B;P;P;P	0.53912	0.424;0.701;0.49;0.737	T	0.59747	-0.7396	10	0.54805	T	0.06	-16.4698	17.8524	0.88751	0.0:1.0:0.0:0.0	.	54;118;118;83	Q15257-3;B4DZF8;Q15257;Q15257-2	.;.;PTPA_HUMAN;.	M	83;118;83;118;89;118;54;118;46;48;48;106;48	ENSP00000351885:T83M;ENSP00000395499:T118M;ENSP00000377036:T83M;ENSP00000337448:T118M;ENSP00000335200:T89M;ENSP00000394338:T118M;ENSP00000349726:T54M;ENSP00000406997:T118M;ENSP00000399069:T46M;ENSP00000403542:T48M;ENSP00000393092:T48M;ENSP00000400314:T106M;ENSP00000393796:T48M	ENSP00000337448:T118M	T	+	2	0	PPP2R4	130931116	1.000000	0.71417	0.706000	0.30403	0.873000	0.50193	6.017000	0.70805	2.507000	0.84556	0.655000	0.94253	ACG		0.537	PPP2R4-201	KNOWN	basic	protein_coding	protein_coding		NM_021131		Missense_Mutation
PSMC4	5704	hgsc.bcm.edu	37	19	40485749	40485749	+	Silent	SNP	G	G	A	rs11542837		TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr19:40485749G>A	ENST00000157812.2	+	7	897	c.699G>A	c.(697-699)tcG>tcA	p.S233S	PSMC4_ENST00000455878.2_Silent_p.S202S	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	233					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S233S(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCGTGGGCTCGGAGTTTGTAC	0.557																																					Colon(105;1478 1543 4034 6132 38638)											1	Substitution - coding silent(1)	ovary(1)	19						G	,	0,4406		0,0,2203	97.0	103.0	101.0		699,606	-12.1	0.0	19	dbSNP_120	101	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PSMC4	NM_006503.2,NM_153001.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	233/419,202/388	40485749	1,13005	2203	4300	6503	45177589	SO:0001819	synonymous_variant	5704			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.699G>A	19.37:g.40485749G>A		Somatic		Capture	SOLID	Phase_IV	45177589	Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	ENST00000157812.2	37	CCDS12547.1	SNP	39	Baylor																																																																																				0.557	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503		Silent
PTPRC	5788	hgsc.bcm.edu	37	1	198685843	198685847	+	Frame_Shift_Del	DEL	ATCAA	ATCAA	-			TCGA-25-1317-01	TCGA-25-1317-10	ATCAA	ATCAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr1:198685843_198685847delATCAA	ENST00000367376.2	+	13	1489_1493	c.1318_1322delATCAA	c.(1318-1323)atcaaafs	p.IK440fs	PTPRC_ENST00000352140.3_Frame_Shift_Del_p.IK392fs|PTPRC_ENST00000594404.1_Frame_Shift_Del_p.IK279fs|PTPRC_ENST00000442510.2_Frame_Shift_Del_p.IK442fs|PTPRC_ENST00000348564.6_Frame_Shift_Del_p.IK281fs	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	440	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.K441fs*1(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TAAAAACCTGATCAAATATGATTTG	0.307																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								196952470	SO:0001589	frameshift_variant	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1318_1322delATCAA	1.37:g.198685843_198685847delATCAA	ENSP00000356346:p.Ile440fs	Somatic		Capture	SOLID	Phase_IV	196952466	A8K7W6|Q16614|Q9H0Y6	Frame_Shift_Del	DEL	ENST00000367376.2	37		DEL	12	Baylor																																																																																				0.307	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				Frame_Shift_Del
PTPRD	5789	hgsc.bcm.edu	37	9	8471015	8471015	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr9:8471015C>T	ENST00000381196.4	-	28	4027	c.3484G>A	c.(3484-3486)Gat>Aat	p.D1162N	PTPRD_ENST00000397611.3_Missense_Mutation_p.D748N|PTPRD_ENST00000537002.1_Missense_Mutation_p.D748N|PTPRD_ENST00000360074.4_Missense_Mutation_p.D1149N|PTPRD_ENST00000358503.5_Missense_Mutation_p.D1140N|PTPRD_ENST00000355233.5_Missense_Mutation_p.D751N|PTPRD_ENST00000486161.1_Missense_Mutation_p.D751N|PTPRD_ENST00000397617.3_Missense_Mutation_p.D741N|PTPRD_ENST00000540109.1_Missense_Mutation_p.D1162N|PTPRD_ENST00000356435.5_Missense_Mutation_p.D1162N|PTPRD_ENST00000397606.3_Missense_Mutation_p.D741N	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1162					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.D1162N(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCCATTTCATCTGGACTCTCC	0.408										TSP Lung(15;0.13)																																						1	Substitution - Missense(1)	ovary(1)	9											164.0	156.0	158.0					9																	8471015		2203	4300	6503	8461015	SO:0001583	missense	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3484G>A	9.37:g.8471015C>T	ENSP00000370593:p.Asp1162Asn	Somatic		Capture	SOLID	Phase_IV	8461015	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	34	5.380877	0.95945	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.55760	0.51;0.51;0.55;0.6;0.73;0.83;0.6;0.5;0.51;0.73;0.84	5.72	5.72	0.89469	.	0.047899	0.85682	D	0.000000	T	0.71426	0.3338	M	0.65498	2.005	0.80722	D	1	B;B;D;B;P;P;B;D;B	0.63880	0.083;0.421;0.993;0.013;0.712;0.763;0.002;0.96;0.0	B;B;D;B;P;B;B;P;B	0.68192	0.03;0.107;0.956;0.01;0.617;0.361;0.015;0.765;0.0	T	0.69018	-0.5256	9	.	.	.	.	19.4857	0.95027	0.0:1.0:0.0:0.0	.	741;746;751;751;748;748;1149;1162;1162	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	N	1162;1162;1149;1140;751;741;748;748;633;1162;751;741	ENSP00000370593:D1162N;ENSP00000348812:D1162N;ENSP00000353187:D1149N;ENSP00000351293:D1140N;ENSP00000347373:D751N;ENSP00000380741:D741N;ENSP00000380735:D748N;ENSP00000440515:D748N;ENSP00000438164:D1162N;ENSP00000417093:D751N;ENSP00000380731:D741N	.	D	-	1	0	PTPRD	8461015	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.150000	0.77403	2.711000	0.92665	0.655000	0.94253	GAT		0.408	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			Missense_Mutation
SCG5	6447	hgsc.bcm.edu	37	15	32988782	32988782	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr15:32988782T>C	ENST00000300175.4	+	6	721	c.611T>C	c.(610-612)tTt>tCt	p.F204S	SCG5_ENST00000413748.2_Missense_Mutation_p.F203S|SCG5_ENST00000494364.1_Missense_Mutation_p.F185S|SCG5_ENST00000497208.1_Missense_Mutation_p.F186S|SCG5_ENST00000498069.1_3'UTR	NM_001144757.1	NP_001138229.1	P05408	7B2_HUMAN	secretogranin V (7B2 protein)	204					intracellular protein transport (GO:0006886)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|regulation of hormone secretion (GO:0046883)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	enzyme inhibitor activity (GO:0004857)|GTP binding (GO:0005525)|unfolded protein binding (GO:0051082)	p.F204S(1)		lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	6		all_lung(180;7.32e-08)		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)		GTCCCCCATTTTTCAGATGAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	15											91.0	85.0	87.0					15																	32988782		1912	4126	6038	30776074	SO:0001583	missense	6447			Y00757	CCDS45207.1, CCDS45208.1	15q13-q14	2006-03-20	2006-03-20	2006-03-20	ENSG00000166922	ENSG00000166922			10816	protein-coding gene	gene with protein product	"""prohormone convertase chaperone"""	173120	"""secretory granule, neuroendocrine protein 1 (7B2 protein)"""	SGNE1		8162254, 12646671	Standard	NM_003020		Approved	7B2, SgV	uc001zha.2	P05408	OTTHUMG00000159447	ENST00000300175.4:c.611T>C	15.37:g.32988782T>C	ENSP00000300175:p.Phe204Ser	Somatic		Capture	SOLID	Phase_IV	30776074	P01164|Q6FHD0|Q9BS38	Missense_Mutation	SNP	ENST00000300175.4	37	CCDS45207.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940718	0.73557	.	.	ENSG00000166922	ENST00000300175;ENST00000413748;ENST00000494364;ENST00000497208	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.69824	0.3154	M	0.68317	2.08	0.80722	D	1	P;P	0.46512	0.879;0.879	P;P	0.50314	0.637;0.511	T	0.74827	-0.3532	9	0.87932	D	0	.	14.7432	0.69472	0.0:0.0:0.0:1.0	.	204;203	P05408;Q6FHD0	7B2_HUMAN;.	S	204;203;185;186	.	ENSP00000300175:F204S	F	+	2	0	SCG5	30776074	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.549000	0.73900	2.068000	0.61886	0.460000	0.39030	TTT		0.408	SCG5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355438.1	NM_003020		Missense_Mutation
SIGLEC7	27036	hgsc.bcm.edu	37	19	51649123	51649123	+	Silent	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr19:51649123C>T	ENST00000317643.6	+	4	841	c.772C>T	c.(772-774)Ctg>Ttg	p.L258L	SIGLEC7_ENST00000305628.7_Silent_p.L165L|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	258	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		ATCCACAGCTCTGGGGAACAG	0.517																																																0			19											154.0	153.0	153.0					19																	51649123		2203	4300	6503	56340935	SO:0001819	synonymous_variant	27036			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.772C>T	19.37:g.51649123C>T		Somatic		Capture	SOLID	Phase_IV	56340935	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	37	CCDS12826.1	SNP	32	Baylor																																																																																				0.517	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543		Silent
SPATA21	374955	hgsc.bcm.edu	37	1	16736125	16736125	+	Silent	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr1:16736125G>A	ENST00000335496.1	-	6	1040	c.558C>T	c.(556-558)agC>agT	p.S186S	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Silent_p.S163S	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	186							calcium ion binding (GO:0005509)	p.S186S(1)		breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		GGGTTCTCTCGCTGCTCTGGT	0.672																																																1	Substitution - coding silent(1)	ovary(1)	1											25.0	26.0	25.0					1																	16736125		2203	4300	6503	16608712	SO:0001819	synonymous_variant	374955				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.558C>T	1.37:g.16736125G>A		Somatic		Capture	SOLID	Phase_IV	16608712	B9EK40|F5GXP5	Silent	SNP	ENST00000335496.1	37	CCDS172.1	SNP	38	Baylor																																																																																				0.672	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006677.2	NM_198546		Silent
STAG3	10734	hgsc.bcm.edu	37	7	99779729	99779729	+	Silent	SNP	T	T	C			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr7:99779729T>C	ENST00000426455.1	+	3	540	c.133T>C	c.(133-135)Tta>Cta	p.L45L	STAG3_ENST00000394018.2_Silent_p.L45L|STAG3_ENST00000317296.5_Silent_p.L45L	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	45					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.L45L(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGACTCTTTGTTAGCTGATGA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	7											122.0	114.0	117.0					7																	99779729		2203	4300	6503	99617665	SO:0001819	synonymous_variant	10734			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.133T>C	7.37:g.99779729T>C		Somatic		Capture	SOLID	Phase_IV	99617665	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Silent	SNP	ENST00000426455.1	37	CCDS34703.1	SNP	60	Baylor																																																																																				0.418	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447		Silent
TAF6L	10629	hgsc.bcm.edu	37	11	62543286	62543286	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr11:62543286G>A	ENST00000294168.3	+	2	232	c.31G>A	c.(31-33)Gag>Aag	p.E11K	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	11					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.E11K(1)		endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						GCGGTTTGTGGAGATCCCTCG	0.642																																																1	Substitution - Missense(1)	ovary(1)	11											59.0	62.0	61.0					11																	62543286		2201	4299	6500	62299862	SO:0001583	missense	10629			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.31G>A	11.37:g.62543286G>A	ENSP00000294168:p.Glu11Lys	Somatic		Capture	SOLID	Phase_IV	62299862	B2RAT0|Q96HA6	Missense_Mutation	SNP	ENST00000294168.3	37	CCDS8035.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205018	0.79127	.	.	ENSG00000162227	ENST00000294168;ENST00000526261;ENST00000529509	T;T;T	0.42900	0.96;0.96;0.96	4.78	4.78	0.61160	Histone-fold (2);TATA box binding protein associated factor (TAF) (2);	0.065639	0.64402	D	0.000015	T	0.45054	0.1323	L	0.50333	1.59	0.80722	D	1	P;P	0.43542	0.81;0.81	B;P	0.46659	0.339;0.523	T	0.21965	-1.0230	10	0.28530	T	0.3	-10.367	15.6813	0.77371	0.0:0.0:1.0:0.0	.	11;11	B4DVM4;Q9Y6J9	.;TAF6L_HUMAN	K	11	ENSP00000294168:E11K;ENSP00000435116:E11K;ENSP00000434662:E11K	ENSP00000294168:E11K	E	+	1	0	TAF6L	62299862	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.568000	0.67385	2.633000	0.89246	0.561000	0.74099	GAG		0.642	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395352.1	NM_006473		Missense_Mutation
TBCD	6904	hgsc.bcm.edu	37	17	80890559	80890559	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr17:80890559C>G	ENST00000355528.4	+	34	3269	c.3139C>G	c.(3139-3141)Ctg>Gtg	p.L1047V	TBCD_ENST00000539345.2_Missense_Mutation_p.L1047V	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	1047					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)	p.L1047V(1)				Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCTGAAGACGCTGGACCACGT	0.577																																																1	Substitution - Missense(1)	ovary(1)	17											60.0	65.0	63.0					17																	80890559		2156	4254	6410	78483848	SO:0001583	missense	6904			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3139C>G	17.37:g.80890559C>G	ENSP00000347719:p.Leu1047Val	Somatic		Capture	SOLID	Phase_IV	78483848	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442008	0.25900	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000539345	T;T	0.75477	-0.94;2.0	4.28	2.22	0.28083	Armadillo-like helical (1);Armadillo-type fold (1);Tubulin-specific chaperone D, C-terminal (1);	0.000000	0.64402	D	0.000002	T	0.74435	0.3716	M	0.72894	2.215	0.80722	D	1	P;P	0.48640	0.913;0.825	P;P	0.49301	0.606;0.471	T	0.71137	-0.4680	9	.	.	.	.	6.7076	0.23260	0.0:0.7054:0.0:0.2946	.	1047;1047	Q9BTW9;Q9BTW9-4	TBCD_HUMAN;.	V	1047;798;39	ENSP00000347719:L1047V;ENSP00000440671:L39V	.	L	+	1	2	TBCD	78483848	1.000000	0.71417	0.553000	0.28255	0.022000	0.10575	1.681000	0.37618	0.527000	0.28560	0.655000	0.94253	CTG		0.577	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993		Missense_Mutation
TFAP4	7023	hgsc.bcm.edu	37	16	4312652	4312652	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr16:4312652C>T	ENST00000204517.6	-	2	468	c.140G>A	c.(139-141)cGg>cAg	p.R47Q		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	47					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.R47Q(1)		NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CCGCCGAATCCGCCGCTCCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	16											88.0	91.0	90.0					16																	4312652		2197	4300	6497	4252653	SO:0001583	missense	7023			X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.140G>A	16.37:g.4312652C>T	ENSP00000204517:p.Arg47Gln	Somatic		Capture	SOLID	Phase_IV	4252653	O60409	Missense_Mutation	SNP	ENST00000204517.6	37	CCDS10510.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829840	0.91036	.	.	ENSG00000090447	ENST00000204517	D	0.98876	-5.2	5.57	5.57	0.84162	Helix-loop-helix DNA-binding (2);	0.000000	0.64402	D	0.000001	D	0.97639	0.9226	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	D	0.99888	1.1127	10	0.62326	D	0.03	.	18.3242	0.90247	0.0:1.0:0.0:0.0	.	47	Q01664	TFAP4_HUMAN	Q	47	ENSP00000204517:R47Q	ENSP00000204517:R47Q	R	-	2	0	TFAP4	4252653	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.192000	0.77771	2.618000	0.88619	0.591000	0.81541	CGG		0.622	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251595.2	NM_003223		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	A	rs28934575|rs397516437		TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr17:7577548C>A	ENST00000269305.4	-	7	922	c.733G>T	c.(733-735)Ggc>Tgc	p.G245C	TP53_ENST00000413465.2_Missense_Mutation_p.G245C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245C|TP53_ENST00000455263.2_Missense_Mutation_p.G245C|TP53_ENST00000445888.2_Missense_Mutation_p.G245C|TP53_ENST00000420246.2_Missense_Mutation_p.G245C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575						149.0	112.0	125.0					17																	7577548		2203	4300	6503	7518273	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>T	17.37:g.7577548C>A	ENSP00000269305:p.Gly245Cys	Somatic		Capture	SOLID	Phase_IV	7518273	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579580	0.86645	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99901	-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245C;ENSP00000352610:G245C;ENSP00000269305:G245C;ENSP00000398846:G245C;ENSP00000391127:G245C;ENSP00000391478:G245C;ENSP00000425104:G113C;ENSP00000423862:G152C	ENSP00000269305:G245C	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TTK	7272	hgsc.bcm.edu	37	6	80751897	80751897	+	Frame_Shift_Del	DEL	A	A	-			TCGA-25-1317-01	TCGA-25-1317-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr6:80751897delA	ENST00000369798.2	+	22	2663	c.2552delA	c.(2551-2553)gaafs	p.E851fs	TTK_ENST00000230510.3_Frame_Shift_Del_p.E850fs|TTK_ENST00000509894.1_Frame_Shift_Del_p.E850fs	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	851					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R838fs*4(3)|p.R838fs*>4(2)|p.R838fs*>5(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AAGACTTTTGAAAAAAAAAGG	0.299																																																6	Deletion - Frameshift(5)|Insertion - Frameshift(1)	stomach(2)|ovary(2)|lung(1)|large_intestine(1)	6											48.0	52.0	51.0					6																	80751897		2202	4283	6485	80808616	SO:0001589	frameshift_variant	7272				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2552delA	6.37:g.80751897delA	ENSP00000358813:p.Glu851fs	Somatic		Capture	SOLID	Phase_IV	80808616	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Frame_Shift_Del	DEL	ENST00000369798.2	37	CCDS4993.1	DEL	9	Baylor																																																																																				0.299	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			Frame_Shift_Del
UTP14A	10813	hgsc.bcm.edu	37	X	129060071	129060071	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chrX:129060071T>A	ENST00000394422.3	+	13	1954	c.1926T>A	c.(1924-1926)agT>agA	p.S642R	UTP14A_ENST00000425117.2_Missense_Mutation_p.S590R|UTP14A_ENST00000371042.3_Missense_Mutation_p.S474R|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Missense_Mutation_p.S588R	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	642					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TAAAGCCCAGTGCCAAGAAAA	0.572											OREG0019920	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			X											40.0	43.0	42.0					X																	129060071		2203	4300	6503	128887752	SO:0001583	missense	10813			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1926T>A	X.37:g.129060071T>A	ENSP00000377944:p.Ser642Arg	Somatic	1569	Capture	SOLID	Phase_IV	128887752	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	ENST00000394422.3	37	CCDS14615.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.00	2.106681	0.37145	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000371042	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	4.99	1.12	0.20585	.	0.128887	0.64402	D	0.000001	T	0.18509	0.0444	M	0.71036	2.16	0.49687	D	0.999816	B;B;B	0.25351	0.016;0.124;0.02	B;B;B	0.32022	0.019;0.139;0.02	T	0.05852	-1.0860	10	0.17369	T	0.5	-7.6044	8.855	0.35223	0.0:0.4264:0.0:0.5736	.	588;590;642	F8WD00;E9PEL7;Q9BVJ6	.;.;UT14A_HUMAN	R	590;642;588;474	ENSP00000388669:S590R;ENSP00000377944:S642R;ENSP00000360090:S588R;ENSP00000360081:S474R	ENSP00000360081:S474R	S	+	3	2	UTP14A	128887752	0.988000	0.35896	0.995000	0.50966	0.984000	0.73092	0.040000	0.13905	-0.001000	0.14495	0.486000	0.48141	AGT		0.572	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649		Missense_Mutation
VWF	7450	hgsc.bcm.edu	37	12	6077326	6077326	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr12:6077326C>T	ENST00000261405.5	-	46	7991	c.7737G>A	c.(7735-7737)atG>atA	p.M2579I		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2579					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.M2579I(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGCAGGCCTCCATGCGCTCTG	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											89.0	78.0	82.0					12																	6077326		2203	4300	6503	5947587	SO:0001583	missense	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7737G>A	12.37:g.6077326C>T	ENSP00000261405:p.Met2579Ile	Somatic		Capture	SOLID	Phase_IV	5947587	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.330	0.428920	0.11987	.	.	ENSG00000110799	ENST00000261405	T	0.34859	1.34	4.73	3.77	0.43336	.	0.977550	0.08318	N	0.964295	T	0.25680	0.0625	N	0.22421	0.69	0.29305	N	0.868437	B	0.02656	0.0	B	0.01281	0.0	T	0.03818	-1.1001	10	0.30854	T	0.27	.	9.6542	0.39917	0.2076:0.7924:0.0:0.0	.	2579	P04275	VWF_HUMAN	I	2579	ENSP00000261405:M2579I	ENSP00000261405:M2579I	M	-	3	0	VWF	5947587	0.147000	0.22687	0.404000	0.26397	0.182000	0.23217	1.111000	0.31159	2.615000	0.88500	0.555000	0.69702	ATG		0.612	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		Missense_Mutation
WNT16	51384	hgsc.bcm.edu	37	7	120971878	120971879	+	Frame_Shift_Ins	INS	-	-	G			TCGA-25-1317-01	TCGA-25-1317-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr7:120971878_120971879insG	ENST00000222462.2	+	3	783_784	c.493_494insG	c.(493-495)tggfs	p.W165fs	WNT16_ENST00000361301.2_Frame_Shift_Ins_p.W155fs	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16	165					bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.C168fs*4(2)|p.G167fs*17(1)		breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					AGGCTGGCACTGGGGGGGCTGC	0.535																																																3	Insertion - Frameshift(2)|Deletion - Frameshift(1)	ovary(1)|lung(1)|large_intestine(1)	7																																								120759115	SO:0001589	frameshift_variant	51384			AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.500dupG	7.37:g.120971885_120971885dupG	ENSP00000222462:p.Trp165fs	Somatic		Capture	SOLID	Phase_IV	120759114	Q2M3G1|Q9Y5C0	Frame_Shift_Ins	INS	ENST00000222462.2	37	CCDS5781.1	INS	55	Baylor																																																																																				0.535	WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346843.1	NM_057168		Frame_Shift_Ins
ZNF106	64397	hgsc.bcm.edu	37	15	42734333	42734333	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1317-01	TCGA-25-1317-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr15:42734333T>C	ENST00000263805.4	-	7	3958	c.3632A>G	c.(3631-3633)aAt>aGt	p.N1211S	ZNF106_ENST00000565380.1_Missense_Mutation_p.N439S|ZNF106_ENST00000565611.1_Missense_Mutation_p.N396S	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1211					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.N1211S(1)									AGCATTCACATTCTCATCTTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	15											184.0	165.0	172.0					15																	42734333		2203	4299	6502	40521625	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.3632A>G	15.37:g.42734333T>C	ENSP00000263805:p.Asn1211Ser	Somatic		Capture	SOLID	Phase_IV	40521625	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.107	1.005669	0.19199	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.59364	0.27	5.44	-4.22	0.03800	.	0.665589	0.15217	N	0.274139	T	0.39989	0.1099	L	0.44542	1.39	0.18873	N	0.999982	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.002	T	0.14172	-1.0482	10	0.27082	T	0.32	-0.6926	6.9252	0.24412	0.0:0.2369:0.3043:0.4587	.	439;1211;439	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	S	1211;439	ENSP00000263805:N1211S	ENSP00000263805:N1211S	N	-	2	0	ZFP106	40521625	0.747000	0.28283	0.001000	0.08648	0.733000	0.41908	-0.169000	0.09911	-1.502000	0.01814	-1.255000	0.01485	AAT		0.463	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473		Missense_Mutation
ZFP36L1	677	hgsc.bcm.edu	37	14	69259623	69259623	+	Silent	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr14:69259623G>A	ENST00000439696.2	-	1	334	c.33C>T	c.(31-33)ttC>ttT	p.F11F	ZFP36L1_ENST00000555997.1_5'Flank|ZFP36L1_ENST00000336440.3_Silent_p.F11F	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	11					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F11L(1)|p.F11F(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CGCTCAAGTCGAAGATGGTGG	0.547																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|breast(1)	14											148.0	149.0	148.0					14																	69259623		2203	4300	6503	68329376	SO:0001819	synonymous_variant	677			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.33C>T	14.37:g.69259623G>A		Somatic		Capture	SOLID	Phase_IV	68329376	Q13851	Silent	SNP	ENST00000439696.2	37	CCDS9791.1	SNP	37	Baylor																																																																																				0.547	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			Silent
ZMYND8	23613	hgsc.bcm.edu	37	20	45905083	45905083	+	Silent	SNP	G	G	A			TCGA-25-1317-01	TCGA-25-1317-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr20:45905083G>A	ENST00000311275.7	-	11	1648	c.1395C>T	c.(1393-1395)tcC>tcT	p.S465S	ZMYND8_ENST00000461685.1_Silent_p.S485S|ZMYND8_ENST00000396281.4_Silent_p.S465S|ZMYND8_ENST00000536340.1_Silent_p.S492S|ZMYND8_ENST00000355972.4_Silent_p.S465S|ZMYND8_ENST00000540497.1_Silent_p.S460S|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000446994.2_Silent_p.S402S|ZMYND8_ENST00000471951.2_Silent_p.S485S|ZMYND8_ENST00000352431.2_Silent_p.S485S|ZMYND8_ENST00000372023.3_Silent_p.S460S|ZMYND8_ENST00000458360.2_Silent_p.S460S|ZMYND8_ENST00000262975.4_Silent_p.S465S|ZMYND8_ENST00000360911.3_Silent_p.S460S	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	465					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GGAAGTCCATGGACTCCTCGC	0.632																																																0			20											41.0	35.0	37.0					20																	45905083		2203	4300	6503	45338490	SO:0001819	synonymous_variant	23613			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1395C>T	20.37:g.45905083G>A		Somatic		Capture	SOLID	Phase_IV	45338490	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Silent	SNP	ENST00000311275.7	37		SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.18	1.278530	0.23307	.	.	ENSG00000101040	ENST00000467200	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	T	0.74951	0.3784	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73833	-0.3858	4	.	.	.	-16.6195	18.9255	0.92541	0.0:0.0:1.0:0.0	.	.	.	.	Y	392	.	.	H	-	1	0	ZMYND8	45338490	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.271000	0.33098	2.477000	0.83638	0.655000	0.94253	CAT		0.632	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047		Silent
ZNF571	51276	hgsc.bcm.edu	37	19	38055894	38055894	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1317-01	TCGA-25-1317-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1317-01	TCGA-25-1317-10	g.chr19:38055894C>T	ENST00000328550.2	-	4	1535	c.1436G>A	c.(1435-1437)tGt>tAt	p.C479Y	ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571_ENST00000593133.1_Missense_Mutation_p.C479Y|ZNF571_ENST00000451802.2_Missense_Mutation_p.C479Y|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF540_ENST00000592533.1_Intron|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571_ENST00000590751.1_Intron|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571_ENST00000358744.3_Missense_Mutation_p.C479Y			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C479Y(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGTCTTCCCACATTCCTTACA	0.368																																																1	Substitution - Missense(1)	ovary(1)	19											92.0	87.0	89.0					19																	38055894		2203	4300	6503	42747734	SO:0001583	missense	51276			AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.1436G>A	19.37:g.38055894C>T	ENSP00000333660:p.Cys479Tyr	Somatic		Capture	SOLID	Phase_IV	42747734	Q2HIY0|Q3ZCU3|Q9NZX7	Missense_Mutation	SNP	ENST00000328550.2	37	CCDS12505.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421600	0.62622	.	.	ENSG00000180479	ENST00000328550;ENST00000451802;ENST00000358744	D;D;D	0.85861	-2.04;-2.04;-2.04	3.53	3.53	0.40419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93979	0.8072	H	0.94423	3.535	0.41343	D	0.987317	D	0.89917	1.0	D	0.97110	1.0	D	0.95649	0.8705	9	0.87932	D	0	.	13.9758	0.64273	0.0:1.0:0.0:0.0	.	479	Q7Z3V5	ZN571_HUMAN	Y	479	ENSP00000333660:C479Y;ENSP00000392638:C479Y;ENSP00000351594:C479Y	ENSP00000333660:C479Y	C	-	2	0	ZNF571	42747734	1.000000	0.71417	0.691000	0.30163	0.839000	0.47603	6.568000	0.73987	1.783000	0.52377	0.305000	0.20034	TGT		0.368	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458669.1	NM_016536		Missense_Mutation
