#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
UBE2J2	118424	broad.mit.edu	37	1	1192678	1192678	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:1192678T>A	ENST00000349431.6	-	4	404	c.185A>T	c.(184-186)cAt>cTt	p.H62L	UBE2J2_ENST00000339385.6_Missense_Mutation_p.H27L|UBE2J2_ENST00000347370.2_Missense_Mutation_p.H10L|UBE2J2_ENST00000400929.2_Missense_Mutation_p.H10L|UBE2J2_ENST00000348298.7_Missense_Mutation_p.H10L|UBE2J2_ENST00000400930.4_Missense_Mutation_p.H78L|UBE2J2_ENST00000360466.2_Missense_Mutation_p.H62L|UBE2J2_ENST00000491779.1_5'UTR	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	62					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.H78L(1)		cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		TAGTTTTCCATGATAATAGCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											35.0	43.0	40.0					1																	1192678		2201	4299	6500	1182541	SO:0001583	missense	118424			AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.185A>T	1.37:g.1192678T>A	ENSP00000305826:p.His62Leu	Unknown		x	x	x	1182541	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	ENST00000349431.6	37	CCDS14.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386481	0.82902	.	.	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930;ENST00000435198;ENST00000422076;ENST00000502382	T;T;T;T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;1.2;1.2;1.2;1.2	5.28	5.28	0.74379	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.046469	0.85682	D	0.000000	T	0.57902	0.2085	M	0.66378	2.025	0.80722	D	1	D;B;D;D	0.89917	0.999;0.18;0.982;1.0	D;B;P;D	0.75484	0.971;0.314;0.878;0.986	T	0.60865	-0.7178	10	0.59425	D	0.04	-4.0035	14.3748	0.66867	0.0:0.0:0.0:1.0	.	10;78;62;95	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	L	10;62;27;10;10;62;78;62;78;62	ENSP00000344857:H10L;ENSP00000305826:H62L;ENSP00000340197:H27L;ENSP00000342541:H10L;ENSP00000383718:H10L;ENSP00000353653:H62L;ENSP00000383719:H78L;ENSP00000393301:H62L;ENSP00000401898:H78L;ENSP00000424342:H62L	ENSP00000340197:H27L	H	-	2	0	UBE2J2	1182541	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	7.613000	0.82986	1.995000	0.58328	0.459000	0.35465	CAT		0.517	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005430.1	NM_058167		Missense_Mutation
CROCC	9696	broad.mit.edu	37	1	17281935	17281935	+	Silent	SNP	A	A	G			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:17281935A>G	ENST00000375541.5	+	24	3663	c.3594A>G	c.(3592-3594)gcA>gcG	p.A1198A		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.A1198A(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCCAGGAGGCAGGCGAGCTGC	0.706																																																1	Substitution - coding silent(1)	ovary(1)	1											13.0	13.0	13.0					1																	17281935		2180	4270	6450	17154522	SO:0001819	synonymous_variant	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3594A>G	1.37:g.17281935A>G		Unknown		x	x	x	17154522		Silent	SNP	ENST00000375541.5	37	CCDS30616.1	SNP	7	Broad																																																																																				0.706	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		Silent
TM2D1	83941	broad.mit.edu	37	1	62174999	62174999	+	Splice_Site	SNP	A	A	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:62174999A>C	ENST00000606498.1	-	3	368		c.e3+1		TM2D1_ENST00000371177.2_Splice_Site|TM2D1_ENST00000472989.1_Splice_Site|TM2D1_ENST00000371180.2_Splice_Site|TM2D1_ENST00000294613.5_Splice_Site			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1						apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|lung(3)|ovary(1)	6						TAATGTACTTACACATTTCGG	0.358																																																0			1											75.0	71.0	72.0					1																	62174999		1839	4082	5921	61947587	SO:0001630	splice_region_variant	83941			AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.347+1T>G	1.37:g.62174999A>C		Unknown		x	x	x	61947587	A6NDA8	Splice_Site_SNP	SNP	ENST00000606498.1	37		SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	18.43	3.621859	0.66787	.	.	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3315	0.66559	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TM2D1	61947587	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.512000	0.73737	2.226000	0.72624	0.482000	0.46254	.		0.358	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470779.2	NM_032027	Intron	Splice_Site_SNP
VAV3	10451	broad.mit.edu	37	1	108311108	108311108	+	Silent	SNP	T	T	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:108311108T>C	ENST00000370056.4	-	7	946	c.672A>G	c.(670-672)agA>agG	p.R224R	VAV3_ENST00000527011.1_Silent_p.R224R|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000371846.4_Silent_p.R159R	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	224	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.R224R(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		CTGTCAGAAATCTTTTTAGTG	0.294																																																1	Substitution - coding silent(1)	ovary(1)	1											87.0	87.0	87.0					1																	108311108		2203	4296	6499	108112631	SO:0001819	synonymous_variant	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.672A>G	1.37:g.108311108T>C		Unknown		x	x	x	108112631	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Silent	SNP	ENST00000370056.4	37	CCDS785.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	10.41	1.342568	0.24339	.	.	ENSG00000134215	ENST00000490388	.	.	.	5.47	1.93	0.25924	.	.	.	.	.	T	0.39835	0.1093	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23940	-1.0174	4	.	.	.	.	6.8715	0.24123	0.0:0.4768:0.0:0.5232	.	.	.	.	G	219	.	.	D	-	2	0	VAV3	108112631	0.988000	0.35896	1.000000	0.80357	0.979000	0.70002	0.105000	0.15333	0.373000	0.24621	0.379000	0.24179	GAT		0.294	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		Silent
GNAI3	2773	broad.mit.edu	37	1	110116390	110116390	+	Silent	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:110116390G>A	ENST00000369851.4	+	2	260	c.150G>A	c.(148-150)gtG>gtA	p.V50V		NM_006496.3	NP_006487.1	P08754	GNAI3_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3	50					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|negative regulation of adenylate cyclase activity (GO:0007194)|platelet activation (GO:0030168)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle fusion (GO:0006906)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|plasma membrane (GO:0005886)|zymogen granule (GO:0042588)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.V50V(1)		NS(1)|endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)		GCACCATTGTGAAACAGATGA	0.333																																																1	Substitution - coding silent(1)	ovary(1)	1											150.0	144.0	146.0					1																	110116390		2203	4300	6503	109917913	SO:0001819	synonymous_variant	2773			M27543	CCDS802.1	1p13	2012-10-02			ENSG00000065135	ENSG00000065135			4387	protein-coding gene	gene with protein product		139370				3109953	Standard	NM_006496		Approved	87U6	uc001dxz.3	P08754	OTTHUMG00000011648	ENST00000369851.4:c.150G>A	1.37:g.110116390G>A		Unknown		x	x	x	109917913	P17539|Q5TZX1	Silent	SNP	ENST00000369851.4	37	CCDS802.1	SNP	45	Broad																																																																																				0.333	GNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032222.1	NM_006496		Silent
SNX27	81609	broad.mit.edu	37	1	151641080	151641080	+	Missense_Mutation	SNP	A	A	G	rs149636067		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:151641080A>G	ENST00000458013.2	+	7	1238	c.1118A>G	c.(1117-1119)aAt>aGt	p.N373S	SNX27_ENST00000482791.1_3'UTR|SNX27_ENST00000368838.1_Missense_Mutation_p.N280S|SNX27_ENST00000368843.3_Missense_Mutation_p.N373S			Q96L92	SNX27_HUMAN	sorting nexin family member 27	373	FERM-like region F2.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.N373S(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTAAATGACAATGACCTTGCT	0.363																																					Colon(46;291 966 40145 41237 41888)											1	Substitution - Missense(1)	ovary(1)	1						A	SER/ASN	0,4406		0,0,2203	80.0	78.0	79.0		1118	5.1	1.0	1	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense	SNX27	NM_030918.5	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	373/529	151641080	1,13005	2203	4300	6503	149907704	SO:0001583	missense	81609			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1118A>G	1.37:g.151641080A>G	ENSP00000400333:p.Asn373Ser	Unknown		x	x	x	149907704	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	37		SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	13.49	2.252180	0.39797	0.0	1.16E-4	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.49432	0.78;0.79;1.0	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.27933	0.0688	L	0.57536	1.79	0.58432	D	0.999998	B;B	0.23990	0.034;0.095	B;B	0.15484	0.006;0.013	T	0.10917	-1.0609	10	0.25106	T	0.35	.	13.853	0.63508	1.0:0.0:0.0:0.0	.	373;373	Q96L92;Q96L92-3	SNX27_HUMAN;.	S	373;373;280	ENSP00000400333:N373S;ENSP00000357836:N373S;ENSP00000357831:N280S	ENSP00000357831:N280S	N	+	2	0	SNX27	149907704	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.426000	0.90273	2.145000	0.66743	0.254000	0.18369	AAT		0.363	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918		Missense_Mutation
RHBG	57127	broad.mit.edu	37	1	156348062	156348062	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:156348062C>A	ENST00000368249.1	+	4	583	c.545C>A	c.(544-546)tCc>tAc	p.S182Y	RHBG_ENST00000400992.2_Missense_Mutation_p.S150Y|RHBG_ENST00000368246.2_Missense_Mutation_p.S182Y|RHBG_ENST00000537040.1_Intron|RHBG_ENST00000255013.3_Missense_Mutation_p.S113Y|RHBG_ENST00000451864.2_Missense_Mutation_p.S150Y	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	182					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.S182Y(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GCCGGAGGCTCCATGACTATC	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	77.0	75.0					1																	156348062		2055	4227	6282	154614686	SO:0001583	missense	57127			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.545C>A	1.37:g.156348062C>A	ENSP00000357232:p.Ser182Tyr	Unknown		x	x	x	154614686	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	ENST00000368249.1	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965274	0.74131	.	.	ENSG00000132677	ENST00000368249;ENST00000368246;ENST00000400992;ENST00000255013;ENST00000451864	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	4.68	4.68	0.58851	Ammonium transporter AmtB-like (3);	0.000000	0.85682	D	0.000000	T	0.64983	0.2648	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	0.983;0.998;1.0	P;D;D	0.87578	0.9;0.961;0.998	T	0.75728	-0.3216	10	0.87932	D	0	-12.4595	16.3174	0.82932	0.0:1.0:0.0:0.0	.	182;150;219	Q9H310;Q9H310-3;Q5SZW5	RHBG_HUMAN;.;.	Y	182;182;150;113;150	ENSP00000357232:S182Y;ENSP00000357229:S182Y;ENSP00000383777:S150Y;ENSP00000255013:S113Y;ENSP00000389836:S150Y	ENSP00000255013:S113Y	S	+	2	0	RHBG	154614686	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	7.462000	0.80851	2.415000	0.81967	0.511000	0.50034	TCC		0.662	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395		Missense_Mutation
IRF6	3664	broad.mit.edu	37	1	209968703	209968703	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr1:209968703T>C	ENST00000367021.3	-	5	612	c.440A>G	c.(439-441)gAa>gGa	p.E147G	IRF6_ENST00000542854.1_Missense_Mutation_p.E52G	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	147					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E147G(1)		cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CAGCTCATCTTCCTCATCTTC	0.517										HNSCC(57;0.16)																																						1	Substitution - Missense(1)	ovary(1)	1											330.0	239.0	270.0					1																	209968703		2203	4300	6503	208035326	SO:0001583	missense	3664			AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.440A>G	1.37:g.209968703T>C	ENSP00000355988:p.Glu147Gly	Unknown		x	x	x	208035326	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	37	CCDS1492.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	14.48	2.547585	0.45383	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.97959	-4.55;-4.06;-4.63	5.4	5.4	0.78164	.	0.516015	0.21408	N	0.075022	D	0.93939	0.8060	N	0.19112	0.55	0.80722	D	1	B	0.15719	0.014	B	0.15484	0.013	D	0.91328	0.5087	9	.	.	.	.	15.4348	0.75137	0.0:0.0:0.0:1.0	.	147	O14896	IRF6_HUMAN	G	147;52;147	ENSP00000355988:E147G;ENSP00000440532:E52G;ENSP00000403855:E147G	.	E	-	2	0	IRF6	208035326	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.601000	0.67606	2.048000	0.60808	0.533000	0.62120	GAA		0.517	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147		Missense_Mutation
MUC2	4583	broad.mit.edu	37	11	1082622	1082622	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr11:1082622A>G	ENST00000441003.2	+	15	1898	c.1871A>G	c.(1870-1872)aAt>aGt	p.N624S	MUC2_ENST00000359061.5_Missense_Mutation_p.N624S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	624					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.N624S(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGTCAGAACAATGAGGACTGC	0.647																																																2	Substitution - Missense(2)	ovary(2)	11											58.0	62.0	61.0					11																	1082622		2166	4255	6421	1072622	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.1871A>G	11.37:g.1082622A>G	ENSP00000415183:p.Asn624Ser	Unknown		x	x	x	1072622	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	a	8.745	0.919862	0.17982	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.75938	-0.98;-0.98	3.97	-4.86	0.03132	.	0.208574	0.36740	N	0.002422	T	0.30417	0.0764	N	0.01656	-0.775	0.09310	N	1	B	0.18013	0.025	B	0.13407	0.009	T	0.48736	-0.9009	10	0.02654	T	1	.	3.084	0.06272	0.3924:0.1178:0.3747:0.1151	.	624	E7EUV1	.	S	624	ENSP00000415183:N624S;ENSP00000351956:N624S	ENSP00000351956:N624S	N	+	2	0	MUC2	1072622	0.000000	0.05858	0.000000	0.03702	0.789000	0.44602	-0.235000	0.09016	-0.834000	0.04239	0.454000	0.30748	AAT		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		Missense_Mutation
ACRBP	84519	broad.mit.edu	37	12	6756111	6756111	+	Silent	SNP	A	A	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr12:6756111A>C	ENST00000229243.2	-	2	204	c.111T>G	c.(109-111)ccT>ccG	p.P37P	ACRBP_ENST00000414226.2_Silent_p.P37P|ACRBP_ENST00000536350.1_Silent_p.P37P	NM_032489.2	NP_115878.2			acrosin binding protein									p.P37P(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						TAGGAGAGAGAGGGCTGCCTG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	12											82.0	82.0	82.0					12																	6756111		2203	4300	6503	6626372	SO:0001819	synonymous_variant	84519			AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.111T>G	12.37:g.6756111A>C		Unknown		x	x	x	6626372		Silent	SNP	ENST00000229243.2	37	CCDS8554.1	SNP	11	Broad																																																																																				0.632	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400703.1	NM_032489		Silent
A2ML1	144568	broad.mit.edu	37	12	9020925	9020925	+	Nonsense_Mutation	SNP	C	C	T	rs374267852		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr12:9020925C>T	ENST00000299698.7	+	31	4213	c.4033C>T	c.(4033-4035)Cga>Tga	p.R1345*	A2ML1_ENST00000539547.1_Nonsense_Mutation_p.R854*	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.R1345*(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GACTTCACCTCGATCCTTGAC	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	12						C	stop/ARG	0,3940		0,0,1970	159.0	156.0	157.0		4033	0.5	0.2	12		157	1,8321		0,1,4160	no	stop-gained	A2ML1	NM_144670.3		0,1,6130	TT,TC,CC		0.012,0.0,0.0082		1345/1455	9020925	1,12261	1970	4161	6131	8912192	SO:0001587	stop_gained	144568			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.4033C>T	12.37:g.9020925C>T	ENSP00000299698:p.Arg1345*	Unknown		x	x	x	8912192		Nonsense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.231816	0.98717	0.0	1.2E-4	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	.	.	.	3.69	0.518	0.17030	.	4.993110	0.00691	N	0.000724	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	6.3487	0.21363	0.3686:0.3182:0.3132:0.0	.	.	.	.	X	1345;1345;895;854	.	ENSP00000299698:R1345X	R	+	1	2	A2ML1	8912192	0.000000	0.05858	0.232000	0.24009	0.127000	0.20565	0.265000	0.18515	0.098000	0.17522	0.561000	0.74099	CGA		0.488	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670		Nonsense_Mutation
LRRK2	120892	broad.mit.edu	37	12	40668477	40668477	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr12:40668477A>C	ENST00000298910.7	+	15	1807	c.1749A>C	c.(1747-1749)gaA>gaC	p.E583D	LRRK2_ENST00000343742.2_Missense_Mutation_p.E583D	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	583					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.E583D(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TATCCCTGGAAGGTGCTATGG	0.363																																																2	Substitution - Missense(2)	ovary(2)	12											151.0	149.0	150.0					12																	40668477		2203	4300	6503	38954744	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1749A>C	12.37:g.40668477A>C	ENSP00000298910:p.Glu583Asp	Unknown		x	x	x	38954744	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	14.58	2.579276	0.46006	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.65364	-0.15;1.18;1.18	5.97	-1.22	0.09494	Armadillo-like helical (1);Armadillo-type fold (1);	0.163970	0.56097	D	0.000036	T	0.35158	0.0922	N	0.14661	0.345	0.22835	N	0.998679	B;B	0.21309	0.003;0.054	B;B	0.21360	0.002;0.034	T	0.09465	-1.0673	10	0.33940	T	0.23	.	4.1581	0.10270	0.4765:0.0:0.3018:0.2217	.	583;583	E9PC85;Q5S007	.;LRRK2_HUMAN	D	331;583;583	ENSP00000398726:E331D;ENSP00000341930:E583D;ENSP00000298910:E583D	ENSP00000298910:E583D	E	+	3	2	LRRK2	38954744	1.000000	0.71417	0.996000	0.52242	0.658000	0.38924	0.891000	0.28309	-0.196000	0.10366	0.477000	0.44152	GAA		0.363	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		Missense_Mutation
ADAMTS20	80070	broad.mit.edu	37	12	43824219	43824219	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1320-01	TCGA-25-1320-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr12:43824219T>A	ENST00000389420.3	-	23	3316	c.3317A>T	c.(3316-3318)gAg>gTg	p.E1106V	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.E1106V|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.E260V	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1106	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E1106V(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACTAGCTAGCTCATTGACACA	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											153.0	131.0	138.0					12																	43824219		2203	4300	6503	42110486	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3317A>T	12.37:g.43824219T>A	ENSP00000374071:p.Glu1106Val	Somatic		x	x	x	42110486	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	t	15.65	2.895929	0.52121	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.3	2.79	0.32731	.	0.553881	0.16200	N	0.224952	T	0.35508	0.0934	N	0.21097	0.63	0.26810	N	0.969027	P;P	0.50528	0.664;0.936	B;P	0.45712	0.326;0.491	T	0.09015	-1.0694	10	0.21540	T	0.41	.	4.4793	0.11759	0.0:0.2073:0.1706:0.6221	.	1106;260	P59510;E9PBD5	ATS20_HUMAN;.	V	1106;272;260;1106;1106	ENSP00000374071:E1106V;ENSP00000447427:E272V;ENSP00000378911:E260V;ENSP00000448341:E1106V	ENSP00000374068:E1106V	E	-	2	0	ADAMTS20	42110486	0.996000	0.38824	0.470000	0.27216	0.060000	0.15804	3.585000	0.53943	1.113000	0.41760	0.454000	0.30748	GAG		0.383	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		Missense_Mutation
TRPC4	7223	broad.mit.edu	37	13	38211441	38211441	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr13:38211441A>T	ENST00000379705.3	-	11	3390	c.2533T>A	c.(2533-2535)Ttt>Att	p.F845I	TRPC4_ENST00000379681.3_Missense_Mutation_p.F850I|TRPC4_ENST00000379679.1_Missense_Mutation_p.F672I|TRPC4_ENST00000447043.1_Intron|TRPC4_ENST00000358477.2_Intron|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000355779.2_Intron|TRPC4_ENST00000338947.5_Missense_Mutation_p.F672I			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	845	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AATAACCCAAAGTTTTTGATA	0.438																																																0			13											75.0	76.0	76.0					13																	38211441		2203	4300	6503	37109441	SO:0001583	missense	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2533T>A	13.37:g.38211441A>T	ENSP00000369027:p.Phe845Ile	Unknown		x	x	x	37109441	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	22.9	4.343779	0.82022	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679	T;T;T;T	0.66815	-0.22;-0.23;-0.07;-0.07	5.9	5.9	0.94986	.	4.494280	0.00397	N	0.000048	T	0.76622	0.4013	N	0.19112	0.55	0.80722	D	1	D;P;P	0.61080	0.989;0.838;0.75	D;B;B	0.72625	0.978;0.414;0.236	T	0.59101	-0.7517	10	0.39692	T	0.17	-29.2223	16.3318	0.83023	1.0:0.0:0.0:0.0	.	850;672;845	Q9UBN4-5;Q9UBN4-6;Q9UBN4	.;.;TRPC4_HUMAN	I	845;850;672;672	ENSP00000369027:F845I;ENSP00000369003:F850I;ENSP00000342580:F672I;ENSP00000369001:F672I	ENSP00000342580:F672I	F	-	1	0	TRPC4	37109441	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.444000	0.60001	2.248000	0.74166	0.460000	0.39030	TTT		0.438	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		Missense_Mutation
TRPC4	7223	broad.mit.edu	37	13	38225457	38225457	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr13:38225457G>A	ENST00000379705.3	-	8	2881	c.2024C>T	c.(2023-2025)aCa>aTa	p.T675I	TRPC4_ENST00000379681.3_Missense_Mutation_p.T675I|TRPC4_ENST00000379679.1_Missense_Mutation_p.T502I|TRPC4_ENST00000447043.1_Missense_Mutation_p.T675I|TRPC4_ENST00000358477.2_Missense_Mutation_p.T675I|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000355779.2_Missense_Mutation_p.T675I|TRPC4_ENST00000338947.5_Missense_Mutation_p.T502I			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	675	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.T675I(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GCACAAGTGTGTCCAGATCCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	13											136.0	133.0	134.0					13																	38225457		2203	4300	6503	37123457	SO:0001583	missense	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2024C>T	13.37:g.38225457G>A	ENSP00000369027:p.Thr675Ile	Unknown		x	x	x	37123457	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095181	0.36952	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000447043	D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.7	4.8	0.61643	.	0.360627	0.34411	N	0.003998	T	0.63628	0.2527	N	0.02916	-0.46	0.80722	D	1	B;B;B;B;B	0.22983	0.017;0.078;0.043;0.043;0.025	B;B;B;B;B	0.29077	0.037;0.022;0.098;0.037;0.017	T	0.61535	-0.7043	10	0.35671	T	0.21	-27.888	9.3542	0.38157	0.0:0.2472:0.6265:0.1264	.	675;675;502;675;675	Q9UBN4-3;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	I	675;675;502;502;675;675;675	ENSP00000369027:T675I;ENSP00000369003:T675I;ENSP00000342580:T502I;ENSP00000369001:T502I;ENSP00000348025:T675I;ENSP00000351264:T675I;ENSP00000414316:T675I	ENSP00000342580:T502I	T	-	2	0	TRPC4	37123457	0.871000	0.30034	0.998000	0.56505	0.993000	0.82548	1.371000	0.34250	2.701000	0.92244	0.561000	0.74099	ACA		0.403	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		Missense_Mutation
CCDC88C	440193	broad.mit.edu	37	14	91757415	91757416	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr14:91757415_91757416CA>AC	ENST00000389857.6	-	24	4211_4212	c.4125_4126TG>GT	c.(4123-4128)aaTGcc>aaGTcc	p.1375_1376NA>KS		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1375					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.N1375_A1376>KS(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTTCGTAAGGCATTTAATTTGT	0.376																																																1	Complex - compound substitution(1)	ovary(1)	14																																								90827169	SO:0001583	missense	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4125_4126delinsAC	14.37:g.91757415_91757416delinsAC	ENSP00000374507:p.N1375_A1376delinsKS	Unknown		x	x	x	90827168	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	DNP	ENST00000389857.6	37	CCDS45151.1	DNP	25	Broad																																																																																				0.376	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		Missense_Mutation
NPAP1	23742	broad.mit.edu	37	15	24921536	24921536	+	Silent	SNP	C	C	T	rs368120585		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr15:24921536C>T	ENST00000329468.2	+	1	996	c.522C>T	c.(520-522)gaC>gaT	p.D174D		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	174					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D174D(2)									GGGAGGATGACGAGAAAAGGA	0.622																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	15						C		1,4405		0,1,2202	48.0	41.0	43.0		522	-5.4	0.0	15		43	0,8600		0,0,4300	no	coding-synonymous	C15orf2	NM_018958.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		174/1157	24921536	1,13005	2203	4300	6503	22472629	SO:0001819	synonymous_variant	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.522C>T	15.37:g.24921536C>T		Unknown		x	x	x	22472629		Silent	SNP	ENST00000329468.2	37	CCDS10015.1	SNP	19	Broad																																																																																				0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		Silent
CEMIP	57214	broad.mit.edu	37	15	81173442	81173442	+	Silent	SNP	C	C	T	rs146635298	byFrequency	TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr15:81173442C>T	ENST00000394685.3	+	6	1001	c.582C>T	c.(580-582)atC>atT	p.I194I	KIAA1199_ENST00000220244.3_Silent_p.I194I|KIAA1199_ENST00000356249.5_Silent_p.I194I			Q8WUJ3	CEMIP_HUMAN		194					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.I194I(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTCATGTCATCGACCCCAAAT	0.468													C|||	5	0.000998403	0.0008	0.0043	5008	,	,		21618	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15						C		10,4396	16.8+/-37.8	0,10,2193	188.0	170.0	176.0		582	-2.4	1.0	15	dbSNP_134	176	0,8600		0,0,4300	no	coding-synonymous	KIAA1199	NM_018689.1		0,10,6493	TT,TC,CC		0.0,0.227,0.0769		194/1362	81173442	10,12996	2203	4300	6503	78960497	SO:0001819	synonymous_variant	57214																														ENST00000394685.3:c.582C>T	15.37:g.81173442C>T		Unknown		x	x	x	78960497	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1	SNP	31	Broad																																																																																				0.468	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			Silent
BNC1	646	broad.mit.edu	37	15	83932792	83932792	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr15:83932792C>T	ENST00000345382.2	-	4	1296	c.1211G>A	c.(1210-1212)cGc>cAc	p.R404H	BNC1_ENST00000569704.1_Missense_Mutation_p.R397H|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	404					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R404H(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GGCGCTATGGCGATTCCGGCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	15											170.0	159.0	163.0					15																	83932792		2203	4300	6503	81723796	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1211G>A	15.37:g.83932792C>T	ENSP00000307041:p.Arg404His	Unknown		x	x	x	81723796	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745100	0.89663	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.30981	1.51	5.51	5.51	0.81932	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.61022	0.2314	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.65261	-0.6211	10	0.87932	D	0	-33.1899	19.4213	0.94723	0.0:1.0:0.0:0.0	.	397;404	F5GY04;Q01954	.;BNC1_HUMAN	H	404;397	ENSP00000307041:R404H	ENSP00000307041:R404H	R	-	2	0	BNC1	81723796	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.755000	0.85180	2.589000	0.87451	0.655000	0.94253	CGC		0.527	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		Missense_Mutation
NMB	4828	broad.mit.edu	37	15	85198549	85198549	+	3'UTR	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr15:85198549C>T	ENST00000360476.3	-	0	817				WDR73_ENST00000398528.3_5'Flank|WDR73_ENST00000434634.2_5'Flank|NMB_ENST00000394588.3_Silent_p.K139K			P08949	NMB_HUMAN	neuromedin B						arachidonic acid secretion (GO:0050482)|cell-cell signaling (GO:0007267)|glucose homeostasis (GO:0042593)|negative regulation of hormone secretion (GO:0046888)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hormone secretion (GO:0046887)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|neuron projection (GO:0043005)	hormone activity (GO:0005179)	p.K139K(1)		endometrium(1)	1				all cancers(203;3.5e-06)		CATTCAGCACCTTCCCTGGGT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	15											193.0	193.0	193.0					15																	85198549		2203	4299	6502	82999553	SO:0001624	3_prime_UTR_variant	4828				CCDS10332.1, CCDS42076.1	15q25.2-q25.3	2013-09-19			ENSG00000197696	ENSG00000197696			7842	protein-coding gene	gene with protein product		162340				2458345	Standard	NM_021077		Approved	MGC2277, MGC3936, MGC17211	uc002bla.3	P08949	OTTHUMG00000148666	ENST00000360476.3:c.*56G>A	15.37:g.85198549C>T		Unknown		x	x	x	82999553	Q96A06|Q96HH5	Silent	SNP	ENST00000360476.3	37	CCDS10332.1	SNP	24	Broad																																																																																				0.493	NMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308995.1	NM_021077		Silent
TSC2	7249	broad.mit.edu	37	16	2129153	2129153	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr16:2129153G>T	ENST00000219476.3	+	27	3717	c.3087G>T	c.(3085-3087)atG>atT	p.M1029I	TSC2_ENST00000568366.1_3'UTR|TSC2_ENST00000382538.6_Missense_Mutation_p.M937I|TSC2_ENST00000353929.4_Missense_Mutation_p.M986I|TSC2_ENST00000401874.2_Missense_Mutation_p.M985I|TSC2_ENST00000568454.1_Missense_Mutation_p.M996I|TSC2_ENST00000350773.4_Missense_Mutation_p.M1029I|TSC2_ENST00000439673.2_Missense_Mutation_p.M949I	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1029					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.M1029I(2)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GTCTGGACATGATGGCTCGAT	0.622			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	2	Substitution - Missense(2)	ovary(2)	16											124.0	99.0	108.0					16																	2129153		2198	4300	6498	2069154	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.3087G>T	16.37:g.2129153G>T	ENSP00000219476:p.Met1029Ile	Unknown		x	x	x	2069154	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.211231	0.95069	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.91686	-2.63;-2.89;-2.62;-2.68;-2.65;-2.6	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.95370	0.8497	M	0.61703	1.905	0.80722	D	1	D;P;D;P;D;P	0.56521	0.964;0.93;0.976;0.956;0.975;0.74	D;P;D;D;D;P	0.73380	0.968;0.835;0.92;0.98;0.974;0.577	D	0.95495	0.8572	10	0.59425	D	0.04	-47.9348	18.5973	0.91234	0.0:0.0:1.0:0.0	.	937;949;1029;985;985;1029	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	I	1029;986;986;949;937;1029	ENSP00000219476:M1029I;ENSP00000384468:M986I;ENSP00000248099:M986I;ENSP00000399232:M949I;ENSP00000371978:M937I;ENSP00000344383:M1029I	ENSP00000219476:M1029I	M	+	3	0	TSC2	2069154	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.787000	0.99055	2.389000	0.81357	0.655000	0.94253	ATG		0.622	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548		Missense_Mutation
EEF2K	29904	broad.mit.edu	37	16	22278092	22278092	+	Silent	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr16:22278092C>T	ENST00000263026.5	+	15	2133	c.1659C>T	c.(1657-1659)ttC>ttT	p.F553F		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	553					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		CGGCTGTCTTCCACCTGGAGC	0.632																																					NSCLC(195;1411 2157 20319 27471 51856)											0			16											83.0	69.0	74.0					16																	22278092		2197	4300	6497	22185593	SO:0001819	synonymous_variant	29904			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1659C>T	16.37:g.22278092C>T		Unknown		x	x	x	22185593	Q8N588	Silent	SNP	ENST00000263026.5	37	CCDS10604.1	SNP	30	Broad																																																																																				0.632	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302		Silent
EEF2K	29904	broad.mit.edu	37	16	22278171	22278171	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr16:22278171C>T	ENST00000263026.5	+	15	2212	c.1738C>T	c.(1738-1740)Cac>Tac	p.H580Y		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	580					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GTTGCCTCATCACATCCTAGC	0.637																																					NSCLC(195;1411 2157 20319 27471 51856)											0			16											101.0	76.0	85.0					16																	22278171		2197	4300	6497	22185672	SO:0001583	missense	29904			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1738C>T	16.37:g.22278171C>T	ENSP00000263026:p.His580Tyr	Unknown		x	x	x	22185672	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547612	0.86022	.	.	ENSG00000103319	ENST00000263026	T	0.08634	3.07	5.7	5.7	0.88788	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.23846	0.0577	L	0.57536	1.79	0.80722	D	1	D	0.58970	0.984	P	0.57620	0.824	T	0.00043	-1.2226	10	0.66056	D	0.02	-10.2653	19.8247	0.96612	0.0:1.0:0.0:0.0	.	580	O00418	EF2K_HUMAN	Y	580	ENSP00000263026:H580Y	ENSP00000263026:H580Y	H	+	1	0	EEF2K	22185672	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	7.487000	0.81328	2.696000	0.92011	0.655000	0.94253	CAC		0.637	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302		Missense_Mutation
SMPD3	55512	broad.mit.edu	37	16	68405429	68405429	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr16:68405429T>C	ENST00000219334.5	-	3	1259	c.656A>G	c.(655-657)cAc>cGc	p.H219R	SMPD3_ENST00000568373.1_Missense_Mutation_p.H219R|SMPD3_ENST00000563226.1_Missense_Mutation_p.H219R|SMPD3_ENST00000566009.1_5'Flank	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	219					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.H219R(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GTCACCGGGGTGCCGCCCACC	0.701																																																1	Substitution - Missense(1)	ovary(1)	16											14.0	16.0	16.0					16																	68405429		2193	4297	6490	66962930	SO:0001583	missense	55512			AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.656A>G	16.37:g.68405429T>C	ENSP00000219334:p.His219Arg	Unknown		x	x	x	66962930	B7ZL82|Q2M1S8	Missense_Mutation	SNP	ENST00000219334.5	37	CCDS10867.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	7.728	0.698535	0.15106	.	.	ENSG00000103056	ENST00000219334	.	.	.	5.0	-0.539	0.11865	.	0.810474	0.11636	N	0.544314	T	0.22085	0.0532	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.16988	-1.0384	9	0.46703	T	0.11	-13.1344	5.6229	0.17467	0.0:0.2284:0.1758:0.5958	.	219;219;219	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	R	219	.	ENSP00000219334:H219R	H	-	2	0	SMPD3	66962930	0.999000	0.42202	0.376000	0.26042	0.587000	0.36485	2.621000	0.46418	0.055000	0.16094	0.459000	0.35465	CAC		0.701	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667		Missense_Mutation
FAM83G	644815	broad.mit.edu	37	17	18881625	18881625	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr17:18881625T>A	ENST00000388995.6	-	5	1577	c.1354A>T	c.(1354-1356)Acc>Tcc	p.T452S	SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.T452S|FAM83G_ENST00000585154.2_Missense_Mutation_p.T452S|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395647.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	452					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.T452S(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						GCCTGGGAGGTGTCACGGATC	0.652																																																1	Substitution - Missense(1)	ovary(1)	17											19.0	24.0	22.0					17																	18881625		2129	4232	6361	18822350	SO:0001583	missense	644815			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.1354A>T	17.37:g.18881625T>A	ENSP00000373647:p.Thr452Ser	Unknown		x	x	x	18822350	Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	ENST00000388995.6	37	CCDS42276.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165061	0.38217	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.11277	2.79;2.79	5.72	4.62	0.57501	.	0.519966	0.15593	U	0.254310	T	0.06781	0.0173	N	0.25426	0.745	0.38571	D	0.949931	B	0.17852	0.024	B	0.12156	0.007	T	0.31364	-0.9946	10	0.22109	T	0.4	-19.9292	4.421	0.11481	0.221:0.1182:0.0:0.6608	.	452	A6ND36	FA83G_HUMAN	S	452	ENSP00000373647:T452S;ENSP00000343279:T452S	ENSP00000343279:T452S	T	-	1	0	FAM83G	18822350	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	0.979000	0.29500	2.189000	0.69895	0.533000	0.62120	ACC		0.652	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4			Missense_Mutation
SCN4A	6329	broad.mit.edu	37	17	62024486	62024486	+	Silent	SNP	C	C	T	rs377187913		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr17:62024486C>T	ENST00000435607.1	-	18	3436	c.3360G>A	c.(3358-3360)tcG>tcA	p.S1120S	SCN4A_ENST00000578147.1_Silent_p.S1120S	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1120					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S1120S(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCCCAGCTCCGAGTAGCCCA	0.667											OREG0024655	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	17						C		1,4159		0,1,2079	60.0	70.0	67.0		3360	-6.2	1.0	17		67	1,8403		0,1,4201	no	coding-synonymous	SCN4A	NM_000334.4		0,2,6280	TT,TC,CC		0.0119,0.024,0.0159		1120/1837	62024486	2,12562	2080	4202	6282	59378218	SO:0001819	synonymous_variant	6329			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3360G>A	17.37:g.62024486C>T		Unknown	1058	x	x	x	59378218	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1	SNP	23	Broad																																																																																				0.667	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		Silent
CNDP2	55748	broad.mit.edu	37	18	72183571	72183571	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr18:72183571G>A	ENST00000324262.4	+	9	1328	c.1012G>A	c.(1012-1014)Ggc>Agc	p.G338S	CNDP2_ENST00000324301.8_Missense_Mutation_p.G254S|CNDP2_ENST00000579847.1_Missense_Mutation_p.G338S	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	338					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.G338S(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		GAAGGTGGTTGGCAAGTTCTC	0.627																																																1	Substitution - Missense(1)	ovary(1)	18											122.0	94.0	104.0					18																	72183571		2203	4300	6503	70334551	SO:0001583	missense	55748			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.1012G>A	18.37:g.72183571G>A	ENSP00000325548:p.Gly338Ser	Unknown		x	x	x	70334551	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	37	CCDS12006.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283965	0.80803	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.56776	0.44;0.44	5.44	5.44	0.79542	Peptidase M20, dimerisation (1);	0.000000	0.85682	D	0.000000	T	0.78502	0.4293	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	T	0.82623	-0.0366	10	0.87932	D	0	7.4759	19.2585	0.93957	0.0:0.0:1.0:0.0	.	254;338	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	S	338;254	ENSP00000325548:G338S;ENSP00000325756:G254S	ENSP00000325548:G338S	G	+	1	0	CNDP2	70334551	1.000000	0.71417	0.954000	0.39281	0.034000	0.12701	9.756000	0.98918	2.552000	0.86080	0.591000	0.81541	GGC		0.627	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235		Missense_Mutation
DOT1L	84444	broad.mit.edu	37	19	2210819	2210821	+	Missense_Mutation	TNP	AGA	AGA	CCG			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr19:2210819_2210821AGA>CCG	ENST00000398665.3	+	14	1352_1354	c.1316_1318AGA>CCG	c.(1315-1320)cAGAcc>cCCGcc	p.439_440QT>PA	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	439					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.Q439_T440>PP(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCACGCTCAGACCGTGTCTCA	0.69																																																1	Complex - compound substitution(1)	ovary(1)	19																																								2161821	SO:0001583	missense	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1316_1318AGA>CCG	19.37:g.2210819AGA>CCG	ENSP00000381657:p.Q439_T440delinsPA	Unknown		x	x	x	2161819	O60379|Q96JL1	Missense_Mutation	TNP	ENST00000398665.3	37	CCDS42460.1	TNP	7	Broad																																																																																				0.690	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482		Missense_Mutation
RDH8	50700	broad.mit.edu	37	19	10132084	10132084	+	Silent	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr19:10132084C>T	ENST00000171214.1	+	5	939	c.690C>T	c.(688-690)tcC>tcT	p.S230S	RDH8_ENST00000591589.1_Silent_p.S250S	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	230					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.S230S(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	TGTTTTGCTCCGTGGGACAGA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	19											75.0	73.0	74.0					19																	10132084		2203	4300	6503	9993084	SO:0001819	synonymous_variant	50700			AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.690C>T	19.37:g.10132084C>T		Somatic		x	x	x	9993084	Q9H838	Silent	SNP	ENST00000171214.1	37		SNP	23	Broad																																																																																				0.617	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				Silent
NCAN	1463	broad.mit.edu	37	19	19339041	19339041	+	Missense_Mutation	SNP	C	C	T	rs145824706		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr19:19339041C>T	ENST00000252575.6	+	8	2711	c.2612C>T	c.(2611-2613)aCg>aTg	p.T871M	NCAN_ENST00000538881.1_Missense_Mutation_p.T322M	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	871					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.T871M(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	AGCATTGTGACGCCCCTCACG	0.577																																																1	Substitution - Missense(1)	ovary(1)	19						C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	85.0	89.0	87.0		2612	-3.8	0.0	19	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense	NCAN	NM_004386.2	81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	871/1322	19339041	2,13004	2203	4300	6503	19200041	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2612C>T	19.37:g.19339041C>T	ENSP00000252575:p.Thr871Met	Unknown		x	x	x	19200041	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	8.787	0.929745	0.18131	2.27E-4	1.16E-4	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.88586	-2.1;-2.4	4.08	-3.77	0.04346	.	0.767725	0.11094	N	0.600387	T	0.70570	0.3239	N	0.14661	0.345	0.09310	N	1	B;B	0.34181	0.44;0.27	B;B	0.20955	0.032;0.016	T	0.60372	-0.7276	10	0.33141	T	0.24	.	5.2882	0.15712	0.0:0.304:0.1592:0.5368	.	885;871	Q4LE67;O14594	.;NCAN_HUMAN	M	885;871;322	ENSP00000252575:T871M;ENSP00000442202:T322M	ENSP00000252575:T871M	T	+	2	0	NCAN	19200041	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.423000	0.07034	-0.551000	0.06175	-0.339000	0.08088	ACG		0.577	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		Missense_Mutation
ZNF536	9745	broad.mit.edu	37	19	30936480	30936480	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr19:30936480C>T	ENST00000355537.3	+	2	2158	c.2011C>T	c.(2011-2013)Cgg>Tgg	p.R671W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	671					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.R671W(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCTGGATGAGCGGCGTGGCTC	0.697																																																1	Substitution - Missense(1)	ovary(1)	19											38.0	42.0	40.0					19																	30936480		2203	4298	6501	35628320	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2011C>T	19.37:g.30936480C>T	ENSP00000347730:p.Arg671Trp	Unknown		x	x	x	35628320	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928854	0.52759	.	.	ENSG00000198597	ENST00000355537	T	0.11277	2.79	5.42	1.89	0.25635	.	0.000000	0.85682	D	0.000000	T	0.19327	0.0464	N	0.24115	0.695	0.48901	D	0.999728	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.02391	-1.1166	10	0.87932	D	0	-32.6045	14.7741	0.69703	0.5321:0.4679:0.0:0.0	.	671;671	A7E228;O15090	.;ZN536_HUMAN	W	671	ENSP00000347730:R671W	ENSP00000347730:R671W	R	+	1	2	ZNF536	35628320	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	1.792000	0.38754	0.566000	0.29273	0.655000	0.94253	CGG		0.697	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		Missense_Mutation
SP100	6672	broad.mit.edu	37	2	231331929	231331929	+	Splice_Site	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr2:231331929G>A	ENST00000264052.5	+	13	1645	c.1290G>A	c.(1288-1290)aaG>aaA	p.K430K	SP100_ENST00000409824.1_Splice_Site_p.K405K|SP100_ENST00000340126.4_Splice_Site_p.K430K|SP100_ENST00000409897.1_Splice_Site_p.K395K|SP100_ENST00000427101.2_Intron|SP100_ENST00000341950.4_Splice_Site_p.K430K|SP100_ENST00000409112.1_Splice_Site_p.K430K|SP100_ENST00000409341.1_Splice_Site_p.K430K	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	430	Sufficient to mediate interaction with ETS1.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.K430N(2)|p.K430K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ATGGTGAGAAGGGTAAGAACA	0.557																																																3	Substitution - Missense(2)|Substitution - coding silent(1)	lung(2)|ovary(1)	2											103.0	111.0	108.0					2																	231331929		2203	4300	6503	231040173	SO:0001630	splice_region_variant	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1291+1G>A	2.37:g.231331929G>A		Unknown		x	x	x	231040173	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Silent	SNP	ENST00000264052.5	37	CCDS2477.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	1.063	-0.672144	0.03403	.	.	ENSG00000067066	ENST00000413284	.	.	.	3.78	-6.09	0.02145	.	.	.	.	.	T	0.15305	0.0369	.	.	.	0.20638	N	0.999872	.	.	.	.	.	.	T	0.22347	-1.0219	4	.	.	.	.	0.6459	0.00818	0.3665:0.1209:0.1624:0.3502	.	.	.	.	K	78	.	.	R	+	2	0	SP100	231040173	0.001000	0.12720	0.000000	0.03702	0.034000	0.12701	-1.030000	0.03581	-1.564000	0.01678	-0.493000	0.04662	AGG		0.557	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	Silent	Silent
GIGYF2	26058	broad.mit.edu	37	2	233659580	233659580	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr2:233659580G>T	ENST00000409547.1	+	15	1716	c.1405G>T	c.(1405-1407)Gtt>Ttt	p.V469F	GIGYF2_ENST00000409196.3_Missense_Mutation_p.V463F|GIGYF2_ENST00000452341.2_Missense_Mutation_p.V300F|GIGYF2_ENST00000373563.4_Missense_Mutation_p.V469F|GIGYF2_ENST00000409480.1_Missense_Mutation_p.V491F|GIGYF2_ENST00000409451.3_Missense_Mutation_p.V490F|GIGYF2_ENST00000373566.3_Missense_Mutation_p.V491F	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	469	Pro-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.V469F(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TGAAACACCAGTTGTAGGTGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											240.0	241.0	241.0					2																	233659580		2203	4300	6503	233367824	SO:0001583	missense	26058			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1405G>T	2.37:g.233659580G>T	ENSP00000386537:p.Val469Phe	Unknown		x	x	x	233367824	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894942	0.33442	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.75367	-0.72;-0.73;-0.72;-0.73;-0.93;-0.72;-0.73;-0.88;-0.58	4.92	4.04	0.47022	.	0.285366	0.33057	N	0.005324	T	0.81536	0.4843	L	0.55481	1.735	0.09310	N	1	D;D;B;D	0.76494	0.999;0.997;0.145;0.998	D;P;B;P	0.68483	0.958;0.798;0.058;0.852	T	0.73613	-0.3927	10	0.51188	T	0.08	-5.2888	13.2994	0.60315	0.0772:0.0:0.9227:0.0	.	300;490;469;463	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	F	491;412;469;491;469;469;412;463;490;463;300	ENSP00000362667:V491F;ENSP00000362664:V469F;ENSP00000386765:V491F;ENSP00000386537:V469F;ENSP00000404195:V412F;ENSP00000387070:V463F;ENSP00000387170:V490F;ENSP00000410297:V463F;ENSP00000411505:V300F	ENSP00000362664:V469F	V	+	1	0	GIGYF2	233367824	0.990000	0.36364	0.005000	0.12908	0.566000	0.35808	4.753000	0.62183	1.205000	0.43262	0.563000	0.77884	GTT		0.473	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146		Missense_Mutation
TTI1	9675	broad.mit.edu	37	20	36641782	36641782	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr20:36641782G>C	ENST00000373448.2	-	3	675	c.437C>G	c.(436-438)tCc>tGc	p.S146C	TTI1_ENST00000487362.1_Intron|TTI1_ENST00000373447.3_Missense_Mutation_p.S146C|TTI1_ENST00000449821.1_Missense_Mutation_p.S146C	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	146					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.S146C(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						TGGCAGAATGGAGGGCTCATA	0.428																																																1	Substitution - Missense(1)	ovary(1)	20											80.0	79.0	80.0					20																	36641782		2203	4300	6503	36075196	SO:0001583	missense	9675			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.437C>G	20.37:g.36641782G>C	ENSP00000362547:p.Ser146Cys	Unknown		x	x	x	36075196	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	7.836	0.720803	0.15372	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.67523	-0.27;-0.27;-0.27	5.35	3.3	0.37823	Armadillo-type fold (1);	0.637433	0.17507	N	0.171774	T	0.58736	0.2143	L	0.38838	1.175	0.41784	D	0.989836	B	0.06786	0.001	B	0.08055	0.003	T	0.59825	-0.7381	10	0.54805	T	0.06	-21.3948	16.4489	0.83973	0.0:0.2609:0.7391:0.0	.	146	O43156	TTI1_HUMAN	C	146	ENSP00000362547:S146C;ENSP00000362546:S146C;ENSP00000407270:S146C	ENSP00000362546:S146C	S	-	2	0	TTI1	36075196	0.960000	0.32886	1.000000	0.80357	0.987000	0.75469	2.143000	0.42187	1.479000	0.48272	0.555000	0.69702	TCC		0.428	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		Missense_Mutation
MRPS25	64432	broad.mit.edu	37	3	15100889	15100889	+	Silent	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr3:15100889C>T	ENST00000253686.2	-	2	368	c.228G>A	c.(226-228)ctG>ctA	p.L76L	MRPS25_ENST00000444840.2_Silent_p.L76L|MRPS25_ENST00000449354.2_Silent_p.L76L	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	76						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(1)	2						AGTAGAATCGCAGGAAGGGTG	0.512																																																0			3											116.0	103.0	108.0					3																	15100889		2203	4300	6503	15075893	SO:0001819	synonymous_variant	64432			AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.228G>A	3.37:g.15100889C>T		Unknown		x	x	x	15075893	B4DFJ5|B4DQG6|Q9H7P5	Silent	SNP	ENST00000253686.2	37	CCDS2622.1	SNP	25	Broad																																																																																				0.512	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252076.2	NM_022497		Silent
NBEAL2	23218	broad.mit.edu	37	3	47039163	47039163	+	Silent	SNP	C	C	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr3:47039163C>A	ENST00000450053.3	+	20	3116	c.2937C>A	c.(2935-2937)atC>atA	p.I979I	NBEAL2_ENST00000292309.5_Silent_p.I979I|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	979					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.I540I(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GGCCTGCCATCATCGGGGCCC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	3											16.0	18.0	18.0					3																	47039163		1907	4110	6017	47014167	SO:0001819	synonymous_variant	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.2937C>A	3.37:g.47039163C>A		Unknown		x	x	x	47014167	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	37	CCDS46817.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	10.53	1.374712	0.24857	.	.	ENSG00000160796	ENST00000416683	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0188	0.53331	0.0:0.9207:0.0:0.0793	.	.	.	.	X	451	.	.	S	+	2	0	NBEAL2	47014167	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	1.241000	0.32743	2.739000	0.93911	0.561000	0.74099	TCA		0.627	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		Silent
PCYT1A	5130	broad.mit.edu	37	3	195997337	195997337	+	Silent	SNP	G	G	A	rs201702214		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr3:195997337G>A	ENST00000292823.2	-	3	238	c.66C>T	c.(64-66)aaC>aaT	p.N22N	PCYT1A_ENST00000419333.1_Silent_p.N22N|PCYT1A_ENST00000431016.1_Silent_p.N22N|PCYT1A_ENST00000491544.1_5'UTR|RP11-447L10.1_ENST00000431391.1_3'UTR	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	22					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)	p.N22N(1)		cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	CTGTTGCCCCGTTGGGTCCGG	0.493																																																1	Substitution - coding silent(1)	ovary(1)	3											257.0	255.0	256.0					3																	195997337		2203	4300	6503	197481734	SO:0001819	synonymous_variant	5130			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.66C>T	3.37:g.195997337G>A		Unknown		x	x	x	197481734	A9LYK9|D3DXB1|Q86Y88	Silent	SNP	ENST00000292823.2	37	CCDS3315.1	SNP	40	Broad																																																																																				0.493	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017		Silent
PIGZ	80235	broad.mit.edu	37	3	196674486	196674486	+	Missense_Mutation	SNP	C	C	T	rs539732732		TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr3:196674486C>T	ENST00000412723.1	-	3	1428	c.1282G>A	c.(1282-1284)Ggc>Agc	p.G428S		NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	428					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)	p.G428S(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		TGCAGGCAGCCGAAGAGGAGG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		19358	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											41.0	39.0	40.0					3																	196674486		2203	4300	6503	198158883	SO:0001583	missense	80235			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.1282G>A	3.37:g.196674486C>T	ENSP00000413405:p.Gly428Ser	Unknown		x	x	x	198158883	Q9H9G6	Missense_Mutation	SNP	ENST00000412723.1	37	CCDS3324.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174788	0.78452	.	.	ENSG00000119227	ENST00000412723	T	0.64991	-0.13	5.0	5.0	0.66597	.	0.000000	0.53938	D	0.000048	D	0.82967	0.5152	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85763	0.1350	10	0.52906	T	0.07	-18.2499	17.6591	0.88187	0.0:1.0:0.0:0.0	.	428	Q86VD9	PIGZ_HUMAN	S	428	ENSP00000413405:G428S	ENSP00000413405:G428S	G	-	1	0	PIGZ	198158883	1.000000	0.71417	0.998000	0.56505	0.778000	0.44026	5.114000	0.64648	2.499000	0.84300	0.561000	0.74099	GGC		0.647	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163		Missense_Mutation
POLN	353497	broad.mit.edu	37	4	2074720	2074720	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr4:2074720A>C	ENST00000511885.2	-	25	2845	c.2492T>G	c.(2491-2493)gTg>gGg	p.V831G	POLN_ENST00000382865.1_Missense_Mutation_p.V831G			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	831					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.V831G(1)		kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CAATGCCTGCACCTGTTCCAA	0.632								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	4											90.0	81.0	84.0					4																	2074720		2203	4300	6503	2044518	SO:0001583	missense	353497			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.2492T>G	4.37:g.2074720A>C	ENSP00000435506:p.Val831Gly	Unknown		x	x	x	2044518	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	37	CCDS3360.1	SNP	6	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.199|3.199	-0.164149|-0.164149	0.06502|0.06502	.|.	.|.	ENSG00000130997|ENSG00000130997	ENST00000511098;ENST00000253313|ENST00000511885;ENST00000382865	.|D;D	.|0.96774	.|-4.12;-4.12	4.09|4.09	1.5|1.5	0.22942|0.22942	.|DNA-directed DNA polymerase, family A, palm domain (1);	.|0.799140	.|0.10743	.|N	.|0.639208	.|D	.|0.95395	.|0.8505	L|L	0.58101|0.58101	1.795|1.795	0.18873|0.18873	N|N	0.999983|0.999983	.|P	.|0.37015	.|0.578	.|P	.|0.48141	.|0.568	.|D	.|0.89714	.|0.3914	.|10	.|0.87932	.|D	.|0	.|-1.9358	3.2865|3.2865	0.06934|0.06934	0.6843:0.0:0.113:0.2027|0.6843:0.0:0.113:0.2027	.|.	.|831	.|Q7Z5Q5	.|DPOLN_HUMAN	.|G	-1|831	.|ENSP00000435506:V831G;ENSP00000372316:V831G	.|ENSP00000372316:V831G	.|V	-|-	.|2	.|0	POLN|POLN	2044518|2044518	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.075000|0.075000	0.17131|0.17131	0.889000|0.889000	0.28282|0.28282	0.213000|0.213000	0.20722|0.20722	0.459000|0.459000	0.35465|0.35465	.|GTG		0.632	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808		Missense_Mutation
ADAMTS16	170690	broad.mit.edu	37	5	5235235	5235235	+	Silent	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr5:5235235C>T	ENST00000274181.7	+	13	2097	c.1959C>T	c.(1957-1959)gcC>gcT	p.A653A	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	653	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A653A(4)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CTCAGTGTGCCGAGCACAACA	0.522																																																4	Substitution - coding silent(4)	ovary(2)|lung(2)	5											76.0	80.0	78.0					5																	5235235		1955	4151	6106	5288235	SO:0001819	synonymous_variant	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1959C>T	5.37:g.5235235C>T		Unknown		x	x	x	5288235	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1	SNP	23	Broad																																																																																				0.522	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		Silent
STC2	8614	broad.mit.edu	37	5	172744869	172744869	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr5:172744869T>A	ENST00000265087.4	-	4	2199	c.890A>T	c.(889-891)tAt>tTt	p.Y297F	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	297					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.Y297F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GATATCAGAATACTCAGACTG	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											85.0	90.0	88.0					5																	172744869		2203	4300	6503	172677475	SO:0001583	missense	8614			AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.890A>T	5.37:g.172744869T>A	ENSP00000265087:p.Tyr297Phe	Unknown		x	x	x	172677475		Missense_Mutation	SNP	ENST00000265087.4	37	CCDS4388.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	14.48	2.547452	0.45383	.	.	ENSG00000113739	ENST00000265087	.	.	.	5.3	4.13	0.48395	.	0.362079	0.30752	N	0.008957	T	0.22820	0.0551	N	0.14661	0.345	0.25960	N	0.982634	B	0.02656	0.0	B	0.01281	0.0	T	0.18493	-1.0335	9	0.14656	T	0.56	-13.0319	9.3871	0.38349	0.4484:0.0:0.0:0.5516	.	297	O76061	STC2_HUMAN	F	297	.	ENSP00000265087:Y297F	Y	-	2	0	STC2	172677475	1.000000	0.71417	0.988000	0.46212	0.951000	0.60555	3.353000	0.52247	0.830000	0.34757	0.528000	0.53228	TAT		0.532	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714		Missense_Mutation
RUFY1	80230	broad.mit.edu	37	5	178996334	178996334	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr5:178996334G>A	ENST00000319449.4	+	5	748	c.736G>A	c.(736-738)Gag>Aag	p.E246K	RUFY1_ENST00000377001.2_Missense_Mutation_p.E246K|RUFY1_ENST00000437570.2_Missense_Mutation_p.E138K|RUFY1_ENST00000393438.2_Missense_Mutation_p.E138K	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	246	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTTAATGATGGAGGAAGAAGG	0.498										HNSCC(44;0.11)																																						0			5											304.0	265.0	278.0					5																	178996334		2203	4300	6503	178928940	SO:0001583	missense	80230			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.736G>A	5.37:g.178996334G>A	ENSP00000325594:p.Glu246Lys	Unknown		x	x	x	178928940	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	SNP	41	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.824385|4.824385	0.90955|0.90955	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000319449;ENST00000377001;ENST00000437570;ENST00000393438|ENST00000502984;ENST00000508609	T;T;T;T|.	0.11063|.	2.81;2.81;2.81;2.81|.	5.04|5.04	5.04|5.04	0.67666|0.67666	RUN (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73458|.	0.3589|.	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	P|.	0.47762|.	0.9|.	P|.	0.48488|.	0.579|.	T|.	0.71998|.	-0.4423|.	10|.	0.20046|.	T|.	0.44|.	-23.013|-23.013	18.7431|18.7431	0.91782|0.91782	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	246|.	Q96T51|.	RUFY1_HUMAN|.	K|X	246;246;138;138|203;56	ENSP00000325594:E246K;ENSP00000366200:E246K;ENSP00000390025:E138K;ENSP00000377087:E138K|.	ENSP00000325594:E246K|.	E|W	+|+	1|3	0|0	RUFY1|RUFY1	178928940|178928940	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.869000|7.869000	0.87170|0.87170	2.490000|2.490000	0.84030|0.84030	0.561000|0.561000	0.74099|0.74099	GAG|TGG		0.498	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451		Missense_Mutation
PPP1R10	5514	broad.mit.edu	37	6	30572408	30572408	+	Silent	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr6:30572408G>A	ENST00000376511.2	-	12	1611	c.1059C>T	c.(1057-1059)ggC>ggT	p.G353G		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	353					protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)	p.G353G(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						GAACCGGGGTGCCTGGACGGT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	6											273.0	291.0	285.0					6																	30572408		1511	2709	4220	30680387	SO:0001819	synonymous_variant	5514			Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.1059C>T	6.37:g.30572408G>A		Somatic		x	x	x	30680387	O00405	Silent	SNP	ENST00000376511.2	37	CCDS4681.1	SNP	46	Broad																																																																																				0.552	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714		Silent
RARS2	57038	broad.mit.edu	37	6	88258335	88258335	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr6:88258335A>C	ENST00000369536.5	-	6	470	c.425T>G	c.(424-426)gTt>gGt	p.V142G		NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	142					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.V142G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		CAAATGTCCAACATGAAATTT	0.318																																																1	Substitution - Missense(1)	ovary(1)	6											73.0	70.0	71.0					6																	88258335		2203	4300	6503	88315054	SO:0001583	missense	57038			AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.425T>G	6.37:g.88258335A>C	ENSP00000358549:p.Val142Gly	Unknown		x	x	x	88315054	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	37	CCDS5011.1	SNP	2	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.59|17.59	3.427989|3.427989	0.62733|0.62733	.|.	.|.	ENSG00000146282|ENSG00000146282	ENST00000451155|ENST00000369536;ENST00000369523	.|T	.|0.69806	.|-0.43	5.63|5.63	4.46|4.46	0.54185|0.54185	.|Aminoacyl-tRNA synthetase, class I, conserved site (1);Arginyl-tRNA synthetase, class Ia, core (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	.|0.167697	.|0.52532	.|D	.|0.000070	T|T	0.77837|0.77837	0.4190|0.4190	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	.|P	.|0.49559	.|0.925	.|P	.|0.62649	.|0.905	T|T	0.81820|0.81820	-0.0757|-0.0757	5|10	.|0.87932	.|D	.|0	.|.	10.4176|10.4176	0.44331|0.44331	0.9218:0.0:0.0782:0.0|0.9218:0.0:0.0782:0.0	.|.	.|142	.|Q5T160	.|SYRM_HUMAN	V|G	170|142;169	.|ENSP00000358549:V142G	.|ENSP00000358536:V169G	L|V	-|-	1|2	2|0	RARS2|RARS2	88315054|88315054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.210000|4.210000	0.58500|0.58500	2.261000|2.261000	0.74972|0.74972	0.528000|0.528000	0.53228|0.53228	TTG|GTT		0.318	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320		Missense_Mutation
MICALL2	79778	broad.mit.edu	37	7	1476384	1476384	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr7:1476384C>G	ENST00000297508.7	-	15	2760	c.2585G>C	c.(2584-2586)cGg>cCg	p.R862P	MICALL2_ENST00000471899.1_5'UTR|MICALL2_ENST00000405088.4_Missense_Mutation_p.R650P	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	862	Mediates interaction with RAB13 and is required for transition from the closed to the opened conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)	p.R862P(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		TCACCGGAGCCGGTCCTCGTC	0.692																																																1	Substitution - Missense(1)	ovary(1)	7											34.0	32.0	33.0					7																	1476384		2203	4297	6500	1442910	SO:0001583	missense	79778			BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.2585G>C	7.37:g.1476384C>G	ENSP00000297508:p.Arg862Pro	Unknown		x	x	x	1442910	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Missense_Mutation	SNP	ENST00000297508.7	37	CCDS5324.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419370	0.83559	.	.	ENSG00000164877	ENST00000405088;ENST00000297508	T;T	0.53857	0.6;0.6	4.15	4.15	0.48705	Domain of unknown function DUF3585 (1);	0.000000	0.33591	N	0.004751	T	0.76586	0.4008	M	0.89095	3.005	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.82701	-0.0327	10	0.72032	D	0.01	.	16.2331	0.82357	0.0:1.0:0.0:0.0	.	862;650;451	Q8IY33;D3YTD2;Q8IY33-3	MILK2_HUMAN;.;.	P	650;862	ENSP00000385928:R650P;ENSP00000297508:R862P	ENSP00000297508:R862P	R	-	2	0	MICALL2	1442910	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.026000	0.70873	2.132000	0.65825	0.555000	0.69702	CGG		0.692	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924		Missense_Mutation
FBXL18	80028	broad.mit.edu	37	7	5540288	5540288	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr7:5540288G>A	ENST00000382368.3	-	3	1735	c.1612C>T	c.(1612-1614)Ctc>Ttc	p.L538F	FBXL18_ENST00000453700.3_Missense_Mutation_p.L538F	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	538								p.L538F(1)	FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		AGCTGTGCGAGCGTCAGGTGC	0.687																																																1	Substitution - Missense(1)	ovary(1)	7											15.0	19.0	17.0					7																	5540288		2026	4194	6220	5506814	SO:0001583	missense	80028			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1612C>T	7.37:g.5540288G>A	ENSP00000371805:p.Leu538Phe	Unknown		x	x	x	5506814	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	ENST00000382368.3	37	CCDS43546.1	SNP	34	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.42|17.42	3.384934|3.384934	0.61956|0.61956	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000297035|ENST00000382368;ENST00000312577;ENST00000453700	.|T;T	.|0.42513	.|0.97;0.97	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49525|0.49525	0.1562|0.1562	L|L	0.34521|0.34521	1.04|1.04	0.53005|0.53005	D|D	0.999962|0.999962	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.50816|0.50816	-0.8783|-0.8783	6|10	0.87932|0.72032	D|D	0|0.01	.|.	7.9088|7.9088	0.29778|0.29778	0.1788:0.0:0.8212:0.0|0.1788:0.0:0.8212:0.0	.|.	.|538;538	.|F5H4Z4;Q96ME1-4	.|.;.	V|F	97|538	.|ENSP00000371805:L538F;ENSP00000444797:L538F	ENSP00000297035:A97V|ENSP00000311990:L538F	A|L	-|-	2|1	0|0	FBXL18|FBXL18	5506814|5506814	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.967000|0.967000	0.64934|0.64934	2.977000|2.977000	0.49297|0.49297	2.579000|2.579000	0.87056|0.87056	0.585000|0.585000	0.79938|0.79938	GCT|CTC		0.687	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963		Missense_Mutation
BAZ1B	9031	broad.mit.edu	37	7	72891394	72891394	+	Silent	SNP	T	T	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr7:72891394T>C	ENST00000339594.4	-	7	2735	c.2397A>G	c.(2395-2397)aaA>aaG	p.K799K	BAZ1B_ENST00000404251.1_Silent_p.K799K	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	799					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)	p.K799K(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				cttccatttctttccgtttct	0.398																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)											1	Substitution - coding silent(1)	ovary(1)	7											86.0	80.0	82.0					7																	72891394		2203	4300	6503	72529330	SO:0001819	synonymous_variant	9031			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.2397A>G	7.37:g.72891394T>C		Unknown		x	x	x	72529330	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	ENST00000339594.4	37	CCDS5549.1	SNP	56	Broad																																																																																				0.398	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408		Silent
YWHAG	7532	broad.mit.edu	37	7	75959469	75959469	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr7:75959469G>A	ENST00000307630.3	-	2	391	c.169C>T	c.(169-171)Cgc>Tgc	p.R57C		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	57		Interaction with phosphoserine on interacting protein.			apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)	p.R57C(1)		endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						CAGGAAGAGCGGCGTGCCCCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											121.0	101.0	108.0					7																	75959469		2203	4300	6503	75797405	SO:0001583	missense	7532			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.169C>T	7.37:g.75959469G>A	ENSP00000306330:p.Arg57Cys	Unknown		x	x	x	75797405	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Missense_Mutation	SNP	ENST00000307630.3	37	CCDS5584.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091380	0.76756	.	.	ENSG00000170027	ENST00000307630;ENST00000536755;ENST00000453207	T	0.76448	-1.02	5.97	5.08	0.68730	14-3-3 domain (4);	0.047908	0.85682	D	0.000000	D	0.91905	0.7437	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94487	0.7698	10	0.87932	D	0	-20.2272	16.2179	0.82239	0.0:0.1331:0.8669:0.0	.	57	P61981	1433G_HUMAN	C	57;35;57	ENSP00000306330:R57C	ENSP00000306330:R57C	R	-	1	0	YWHAG	75797405	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.838000	0.86804	1.504000	0.48704	0.650000	0.86243	CGC		0.527	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479		Missense_Mutation
PPP1R3A	5506	broad.mit.edu	37	7	113517860	113517860	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr7:113517860A>G	ENST00000284601.3	-	4	3355	c.3287T>C	c.(3286-3288)aTt>aCt	p.I1096T		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1096					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.I1096T(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGTCAAGCCAATCATTAAGTC	0.348																																																1	Substitution - Missense(1)	ovary(1)	7											87.0	88.0	87.0					7																	113517860		2203	4299	6502	113305096	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3287T>C	7.37:g.113517860A>G	ENSP00000284601:p.Ile1096Thr	Unknown		x	x	x	113305096	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	12.42	1.932422	0.34096	.	.	ENSG00000154415	ENST00000284601	T	0.21543	2.0	5.85	3.49	0.39957	.	0.424704	0.22478	N	0.059521	T	0.26846	0.0657	M	0.69823	2.125	0.27692	N	0.946086	P	0.46395	0.877	B	0.43360	0.417	T	0.13335	-1.0513	10	0.87932	D	0	-0.3318	10.1897	0.43019	0.8658:0.0:0.1342:0.0	.	1096	Q16821	PPR3A_HUMAN	T	1096	ENSP00000284601:I1096T	ENSP00000284601:I1096T	I	-	2	0	PPP1R3A	113305096	0.998000	0.40836	0.500000	0.27589	0.745000	0.42441	3.492000	0.53259	0.476000	0.27440	0.528000	0.53228	ATT		0.348	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		Missense_Mutation
MET	4233	broad.mit.edu	37	7	116339936	116339936	+	Missense_Mutation	SNP	G	G	C	rs185301166	byFrequency	TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr7:116339936G>C	ENST00000318493.6	+	2	985	c.798G>C	c.(796-798)agG>agC	p.R266S	MET_ENST00000436117.2_Missense_Mutation_p.R266S|MET_ENST00000397752.3_Missense_Mutation_p.R266S			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R266S(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CGGTCCAAAGGGAAACTCTAG	0.388			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	1	Substitution - Missense(1)	ovary(1)	7											153.0	146.0	148.0					7																	116339936		1845	4104	5949	116127172	SO:0001583	missense	4233	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.798G>C	7.37:g.116339936G>C	ENSP00000317272:p.Arg266Ser	Unknown		x	x	x	116127172	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086439	0.36855	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.11169	2.8;2.8;2.8	6.07	0.637	0.17735	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.312054	0.35151	N	0.003404	T	0.26593	0.0650	M	0.74647	2.275	0.80722	D	1	P;P;P;P;P;P;P;P;D;B;P;B;B	0.61697	0.565;0.732;0.874;0.874;0.874;0.732;0.874;0.874;0.99;0.259;0.732;0.181;0.181	B;P;P;P;P;P;P;P;D;B;P;B;B	0.74674	0.305;0.794;0.794;0.794;0.794;0.794;0.864;0.794;0.984;0.301;0.794;0.287;0.287	T	0.01015	-1.1480	10	0.66056	D	0.02	.	8.1458	0.31110	0.6887:0.0:0.3113:0.0	.	266;266;266;266;266;266;266;266;266;266;266;266;266	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	S	266	ENSP00000380860:R266S;ENSP00000317272:R266S;ENSP00000410980:R266S	ENSP00000317272:R266S	R	+	3	2	MET	116127172	1.000000	0.71417	0.971000	0.41717	0.972000	0.66771	0.766000	0.26560	0.167000	0.19631	0.655000	0.94253	AGG		0.388	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			Missense_Mutation
DOK2	9046	broad.mit.edu	37	8	21766911	21766911	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr8:21766911C>A	ENST00000276420.4	-	5	1408	c.1150G>T	c.(1150-1152)Gtc>Ttc	p.V384F	DOK2_ENST00000544659.1_Missense_Mutation_p.V230F	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	384					blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)	p.V384F(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		GCTGGCTGGACATGCTGGAGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	8											47.0	49.0	48.0					8																	21766911		2203	4295	6498	21822857	SO:0001583	missense	9046			AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.1150G>T	8.37:g.21766911C>A	ENSP00000276420:p.Val384Phe	Unknown		x	x	x	21822857	Q8N5A4	Missense_Mutation	SNP	ENST00000276420.4	37	CCDS6016.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.518791	0.00967	.	.	ENSG00000147443	ENST00000276420;ENST00000544659	T;T	0.30448	1.94;1.53	4.1	-1.66	0.08265	.	4.573090	0.00357	N	0.000035	T	0.18718	0.0449	L	0.27053	0.805	0.09310	N	1	B;B	0.25169	0.119;0.036	B;B	0.18871	0.023;0.023	T	0.08289	-1.0729	10	0.11794	T	0.64	.	5.242	0.15477	0.1371:0.4847:0.0:0.3782	.	384;384	O60496;A8K7W1	DOK2_HUMAN;.	F	384;230	ENSP00000276420:V384F;ENSP00000443602:V230F	ENSP00000276420:V384F	V	-	1	0	DOK2	21822857	0.000000	0.05858	0.001000	0.08648	0.137000	0.21094	-0.128000	0.10531	-0.323000	0.08602	-0.797000	0.03246	GTC		0.607	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253735.3	NM_003974		Missense_Mutation
CYP7B1	9420	broad.mit.edu	37	8	65527670	65527670	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr8:65527670G>T	ENST00000310193.3	-	4	1143	c.970C>A	c.(970-972)Cgt>Agt	p.R324S	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	324				R -> H (in Ref. 1; AAC95426). {ECO:0000305}.	bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.R324S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TGCAGCAAACGGTCAATTTCG	0.468																																																1	Substitution - Missense(1)	ovary(1)	8											113.0	105.0	108.0					8																	65527670		2203	4300	6503	65690224	SO:0001583	missense	9420			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.970C>A	8.37:g.65527670G>T	ENSP00000310721:p.Arg324Ser	Unknown		x	x	x	65690224	B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	37	CCDS6180.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	4.628	0.116706	0.08881	.	.	ENSG00000172817	ENST00000310193	T	0.69040	-0.37	5.93	4.11	0.48088	.	0.617158	0.19131	N	0.121927	T	0.38054	0.1026	N	0.03891	-0.335	0.24453	N	0.994473	B	0.19817	0.039	B	0.20955	0.032	T	0.21381	-1.0247	10	0.06099	T	0.92	-19.8849	10.8751	0.46906	0.0672:0.0:0.7986:0.1342	.	324	O75881	CP7B1_HUMAN	S	324	ENSP00000310721:R324S	ENSP00000310721:R324S	R	-	1	0	CYP7B1	65690224	1.000000	0.71417	0.931000	0.37212	0.997000	0.91878	2.186000	0.42593	0.815000	0.34398	0.655000	0.94253	CGT		0.468	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1			Missense_Mutation
MFSD3	113655	broad.mit.edu	37	8	145738054	145738054	+	IGR	SNP	G	G	C			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr8:145738054G>C	ENST00000301327.4	+	0	1548				RECQL4_ENST00000428558.2_Silent_p.G952G|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.G952G(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCTGGGCAGGGCCCCCAGGGC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	8											39.0	46.0	44.0					8																	145738054		2018	4184	6202	145708862	SO:0001628	intergenic_variant	9401				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738054G>C		Unknown		x	x	x	145708862		Silent	SNP	ENST00000301327.4	37	CCDS6431.1	SNP	42	Broad																																																																																				0.627	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431		Silent
FOXB2	442425	broad.mit.edu	37	9	79634952	79634952	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr9:79634952C>T	ENST00000376708.1	+	1	382	c.382C>T	c.(382-384)Ccg>Tcg	p.P128S		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	128					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P128S(1)		breast(1)|lung(8)|ovary(1)	10						CAAGAGCGCGCCGGGCGCCGG	0.667																																																1	Substitution - Missense(1)	ovary(1)	9											11.0	14.0	13.0					9																	79634952		2188	4287	6475	78824772	SO:0001583	missense	442425				CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.382C>T	9.37:g.79634952C>T	ENSP00000365898:p.Pro128Ser	Unknown		x	x	x	78824772		Missense_Mutation	SNP	ENST00000376708.1	37	CCDS35045.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	6.538	0.467493	0.12402	.	.	ENSG00000204612	ENST00000376708	D	0.96913	-4.17	4.29	2.25	0.28309	.	1.343900	0.06129	U	0.670256	D	0.89462	0.6722	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.80504	-0.1353	10	0.19147	T	0.46	.	6.9209	0.24387	0.0:0.3581:0.5241:0.1178	.	128	Q5VYV0	FOXB2_HUMAN	S	128	ENSP00000365898:P128S	ENSP00000365898:P128S	P	+	1	0	FOXB2	78824772	.	.	0.544000	0.28141	0.425000	0.31504	.	.	0.713000	0.32060	0.462000	0.41574	CCG		0.667	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735		Missense_Mutation
FAM102A	399665	broad.mit.edu	37	9	130707805	130707805	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr9:130707805G>A	ENST00000373095.1	-	8	1133	c.758C>T	c.(757-759)tCa>tTa	p.S253L	FAM102A_ENST00000373084.4_Missense_Mutation_p.S111L|FAM102A_ENST00000300434.3_5'UTR	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	253	Ser-rich.							p.S253L(1)		breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						CGTCAGGTCTGAGAGGCTGGA	0.692																																																1	Substitution - Missense(1)	ovary(1)	9											20.0	20.0	20.0					9																	130707805		2177	4266	6443	129747626	SO:0001583	missense	399665				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.758C>T	9.37:g.130707805G>A	ENSP00000362187:p.Ser253Leu	Unknown		x	x	x	129747626	A2A329|Q8TEL4	Missense_Mutation	SNP	ENST00000373095.1	37	CCDS35150.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349371	0.61183	.	.	ENSG00000167106	ENST00000373095;ENST00000373084	T;T	0.26957	1.7;1.7	4.89	4.89	0.63831	.	0.126191	0.56097	D	0.000033	T	0.27832	0.0685	L	0.58428	1.81	0.54753	D	0.99998	P	0.35077	0.483	B	0.30943	0.122	T	0.12993	-1.0526	10	0.62326	D	0.03	-11.8725	16.6339	0.85041	0.0:0.0:1.0:0.0	.	253	Q5T9C2	F102A_HUMAN	L	253;111	ENSP00000362187:S253L;ENSP00000362176:S111L	ENSP00000362176:S111L	S	-	2	0	FAM102A	129747626	1.000000	0.71417	0.957000	0.39632	0.686000	0.39977	9.288000	0.96055	2.262000	0.75019	0.313000	0.20887	TCA		0.692	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2			Missense_Mutation
SURF1	6834	broad.mit.edu	37	9	136218948	136218948	+	Silent	SNP	C	C	G			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr9:136218948C>G	ENST00000371974.3	-	8	832	c.801G>C	c.(799-801)ctG>ctC	p.L267L	SNORD24_ENST00000383884.1_RNA|SNORD36B_ENST00000363961.1_RNA|SNORD36C_ENST00000516733.1_RNA|SNORD36A_ENST00000362874.1_RNA|SURF1_ENST00000495952.1_5'UTR	NM_001280787.1|NM_003172.2	NP_001267716.1|NP_003163.1	Q15526	SURF1_HUMAN	surfeit 1	267					aerobic respiration (GO:0009060)|ATP biosynthetic process (GO:0006754)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory chain complex IV assembly (GO:0008535)	integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)	p.L267L(1)		breast(2)|endometrium(1)|ovary(2)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;5.06e-07)|Epithelial(140;4.25e-06)|all cancers(34;3.93e-05)		GCTCGTTCCTCAGAGTAACTC	0.592											OREG0019585	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	9											67.0	61.0	63.0					9																	136218948		2202	4299	6501	135208769	SO:0001819	synonymous_variant	6834				CCDS6966.1, CCDS75928.1	9q33-q34	2012-10-12			ENSG00000148290	ENSG00000148290		"""Mitochondrial respiratory chain complex assembly factors"""	11474	protein-coding gene	gene with protein product	"""surfeit locus protein 1"""	185620				8499913, 9843204	Standard	NM_003172		Approved		uc004cdh.1	Q15526	OTTHUMG00000020866	ENST00000371974.3:c.801G>C	9.37:g.136218948C>G		Unknown	1624	x	x	x	135208769	Q5T8T3|Q5T8T4	Silent	SNP	ENST00000371974.3	37	CCDS6966.1	SNP	29	Broad																																																																																				0.592	SURF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054879.1	NM_003172		Silent
UBC	7316	broad.mit.edu	37	12	125397961	125397986	+	Frame_Shift_Del	DEL	CAACCTCTGCTGGTCAGGAGGAATGC	CAACCTCTGCTGGTCAGGAGGAATGC	-	rs112066590	byFrequency	TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr12:125397961_125397986delCAACCTCTGCTGGTCAGGAGGAATGC	ENST00000538617.1	-	3	648_673	c.332_357delGCATTCCTCCTGACCAGCAGAGGTTG	c.(331-357)ggcattcctcctgaccagcagaggttgfs	p.GIPPDQQRL111fs	UBC_ENST00000339647.5_Frame_Shift_Del_p.GIPPDQQRL111fs|UBC_ENST00000536769.1_Frame_Shift_Del_p.GIPPDQQRL111fs|UBC_ENST00000546120.1_Intron|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	491	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.G111fs*15(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CGGCAAAGATCAACCTCTGCTGGTCAGGAGGAATGCCTTCCTTGTC	0.54																																																1	Deletion - Frameshift(1)	ovary(1)	12																																								123963939	SO:0001589	frameshift_variant	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.332_357delGCATTCCTCCTGACCAGCAGAGGTTG	12.37:g.125397961_125397986delCAACCTCTGCTGGTCAGGAGGAATGC	ENSP00000443053:p.Gly111fs	Unknown		Capture	Illumina GAIIx	Phase_I	123963914	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Frame_Shift_Del	DEL	ENST00000538617.1	37		DEL	29	Broad																																																																																				0.540	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009		Frame_Shift_Del
TP53	7157	broad.mit.edu	37	17	7579315	7579315	+	Frame_Shift_Del	DEL	G	G	-			TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr17:7579315delG	ENST00000269305.4	-	4	561	c.372delC	c.(370-372)tgcfs	p.C124fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.C124fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.C124fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C124*(3)|p.G59fs*23(3)|p.C124fs*1(1)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.T125fs*24(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGACCGTGCAAGTCACAG	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	21	Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)|Deletion - In frame(1)|Insertion - Frameshift(1)	lung(5)|upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(2)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|ovary(1)	17											66.0	61.0	63.0					17																	7579315		2203	4300	6503	7520040	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.372delC	17.37:g.7579315delG	ENSP00000269305:p.Cys124fs	Unknown		Capture	Illumina GAIIx	Phase_I	7520040	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	46	Broad																																																																																				0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
AATK	9625	broad.mit.edu	37	17	79093270	79093271	+	In_Frame_Ins	INS	-	-	GGGCGT	rs55713566|rs541665071|rs376907005	byFrequency	TCGA-25-1320-01	TCGA-25-1320-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-1320-01	TCGA-25-1320-10	g.chr17:79093270_79093271insGGGCGT	ENST00000326724.4	-	13	4017_4018	c.3993_3994insACGCCC	c.(3991-3996)cccgct>cccACGCCCgct	p.1330_1331insPT	AATK_ENST00000417379.1_In_Frame_Ins_p.1227_1228insPT	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1330					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.P1331_A1332insTP(1)		endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GAGAAGGGAGCGGGCGTGGGCG	0.713																																																1	Insertion - In frame(1)	ovary(1)	17							,	365,224,3171		3,1,358,21,181,1316					,	1.2	0.0			19	193,266,7379		3,0,187,18,230,3481	no	codingComplex,codingComplex	AATK	NM_004920.2,NM_001080395.2	,	6,1,545,39,411,4797	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8561,15.6649,9.036	,	,		558,490,10550				76707866	SO:0001652	inframe_insertion	9625			AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3988_3993dupACGCCC	17.37:g.79093271_79093276dupGGGCGT	ENSP00000324196:p.Pro1329_Thr1330dup	Unknown		Capture	Illumina GAIIx	Phase_I	76707865	O75136|Q6ZN31|Q86X28	In_Frame_Ins	INS	ENST00000326724.4	37	CCDS45807.1	INS	27	Broad																																																																																				0.713	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920		In_Frame_Ins
