#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SRRM1	10250	genome.wustl.edu	37	1	24978036	24978036	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr1:24978036A>G	ENST00000323848.9	+	6	973	c.658A>G	c.(658-660)Act>Gct	p.T220A	SRRM1_ENST00000374389.4_Missense_Mutation_p.T220A|SRRM1_ENST00000537199.1_Missense_Mutation_p.T89A|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.T220A	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	220	Arg-rich.|Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.T220A(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GAAGGAAAAAACTCCAGAGCT	0.438																																					Ovarian(68;897 1494 3282 17478)											1	Substitution - Missense(1)	ovary(1)	1											47.0	55.0	52.0					1																	24978036		2203	4300	6503	24850623	SO:0001583	missense	10250			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.658A>G	1.37:g.24978036A>G	ENSP00000326261:p.Thr220Ala	Somatic		Capture	Illumina GAIIx	4	24850623	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	14.34	2.505956	0.44558	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389;ENST00000537199	T;T;T;T	0.44482	0.96;0.97;0.96;0.92	5.81	4.66	0.58398	.	0.192383	0.36268	N	0.002694	T	0.30039	0.0752	L	0.36672	1.1	0.28574	N	0.910473	B;B	0.18461	0.002;0.028	B;B	0.14578	0.003;0.011	T	0.20571	-1.0271	10	0.09338	T	0.73	-1.2736	11.9499	0.52948	0.8661:0.0:0.0:0.1339	.	220;220	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	A	220;220;220;89	ENSP00000326261:T220A;ENSP00000391430:T220A;ENSP00000363510:T220A;ENSP00000441776:T89A	ENSP00000326261:T220A	T	+	1	0	SRRM1	24850623	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.324000	0.43831	0.974000	0.38366	0.528000	0.53228	ACT		0.438	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179482108	179482110	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-25-1322-01	TCGA-25-1322-10	CTT	CTT	CTT	-	CTT	CTT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:179482108_179482110delCTT	ENST00000591111.1	-	204	43003_43005	c.42779_42781delAAG	c.(42778-42783)gaagga>gga	p.E14260del	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.E13333del|TTN_ENST00000359218.5_In_Frame_Del_p.E6961del|TTN_ENST00000460472.2_In_Frame_Del_p.E6836del|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_In_Frame_Del_p.E7028del|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000589042.1_In_Frame_Del_p.E15901del|TTN-AS1_ENST00000604956.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14260	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTATCTTTTCCTTCTTCGCATCG	0.389																																																0			2																																								179190355	SO:0001651	inframe_deletion	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.42779_42781delAAG	2.37:g.179482111_179482113delCTT	ENSP00000465570:p.Glu14260del	Somatic		Capture	Illumina GAIIx	4	179190353	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	ENST00000591111.1	37		DEL	24	WashU																																																																																				0.389	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		In_Frame_Del
LHCGR	3973	genome.wustl.edu	37	2	48915353	48915353	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:48915353A>G	ENST00000294954.7	-	11	1604	c.1583T>C	c.(1582-1584)aTa>aCa	p.I528T	LHCGR_ENST00000405626.1_Missense_Mutation_p.I501T|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000344775.3_Missense_Mutation_p.I466T|LHCGR_ENST00000401907.1_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	528					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.I528T(2)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GATGGTTAATATATAGACTTG	0.398																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	2											106.0	108.0	108.0					2																	48915353		2203	4300	6503	48768857	SO:0001583	missense	3973				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1583T>C	2.37:g.48915353A>G	ENSP00000294954:p.Ile528Thr	Somatic		Capture	Illumina GAIIx	Phase_III	48768857	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	18.04	3.533691	0.64972	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.73258	-0.73;-0.73;-0.73	5.68	5.68	0.88126	GPCR, rhodopsin-like superfamily (1);	0.097702	0.64402	D	0.000001	D	0.84884	0.5571	M	0.83012	2.62	0.58432	D	0.999991	D	0.71674	0.998	D	0.85130	0.997	D	0.86311	0.1686	9	.	.	.	.	15.1242	0.72469	1.0:0.0:0.0:0.0	.	528	P22888	LSHR_HUMAN	T	466;528;501	ENSP00000344301:I466T;ENSP00000294954:I528T;ENSP00000386033:I501T	.	I	-	2	0	LHCGR	48768857	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	9.339000	0.96797	2.176000	0.68965	0.477000	0.44152	ATA		0.398	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3		Missense_Mutation
GRB14	2888	genome.wustl.edu	37	2	165404236	165404236	+	Silent	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:165404236G>A	ENST00000263915.3	-	3	953	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	GRB14_ENST00000543549.1_Silent_p.L52L	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	139	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.L139L(1)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TGATTCTTCAGGATCAACAGC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	2											94.0	86.0	89.0					2																	165404236		2203	4300	6503	165112482	SO:0001819	synonymous_variant	2888				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.415C>T	2.37:g.165404236G>A		Somatic		Capture	Illumina GAIIx	Phase_III	165112482	B7Z7F9|Q7Z6I1	Silent	SNP	ENST00000263915.3	37	CCDS2222.1	SNP	35	WashU																																																																																				0.443	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2			Silent
DAPK1	1612	genome.wustl.edu	37	9	90312052	90312052	+	Silent	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr9:90312052C>T	ENST00000408954.3	+	22	2879	c.2544C>T	c.(2542-2544)atC>atT	p.I848I	DAPK1_ENST00000358077.5_Silent_p.I848I|DAPK1_ENST00000491893.1_Intron|DAPK1_ENST00000472284.1_Silent_p.I848I|DAPK1_ENST00000469640.2_Silent_p.I848I	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	848					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I849I(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						CCTATGAGATCCAGCTGAACC	0.458									Chronic Lymphocytic Leukemia, Familial Clustering of																																							1	Substitution - coding silent(1)	ovary(1)	9											173.0	162.0	166.0					9																	90312052		1904	4137	6041	89501872	SO:0001819	synonymous_variant	1612	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2544C>T	9.37:g.90312052C>T		Somatic		Capture	Illumina GAIIx	Phase_III	89501872	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	CCDS43842.1	SNP	30	WashU																																																																																				0.458	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938		Silent
TP53	7157	genome.wustl.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1322-01	TCGA-25-1322-10	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000445888.2_Missense_Mutation_p.Y205C|TP53_ENST00000420246.2_Missense_Mutation_p.Y205C|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000455263.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)	17											136.0	121.0	126.0					17																	7578235		2203	4300	6503	7518960	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	17.37:g.7578235T>C	ENSP00000269305:p.Tyr205Cys	Somatic		PCR	ABI 3730xl	Phase_III	7518960	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CDK12	51755	genome.wustl.edu	37	17	37667817	37667817	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr17:37667817A>G	ENST00000447079.4	+	8	2735	c.2702A>G	c.(2701-2703)tAc>tGc	p.Y901C	CDK12_ENST00000430627.2_Missense_Mutation_p.Y901C	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	901	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.Y901C(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						ACTTTGTGGTACCGACCTCCA	0.383			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	1	Substitution - Missense(1)	ovary(1)	17											123.0	118.0	119.0					17																	37667817		2203	4300	6503	34921343	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2702A>G	17.37:g.37667817A>G	ENSP00000398880:p.Tyr901Cys	Somatic		Capture	Illumina GAIIx	Phase_III	34921343	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	17.82	3.484148	0.63962	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.71817	-0.6;-0.6	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40302	N	0.001134	D	0.88934	0.6572	H	0.96398	3.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.92473	0.5987	10	0.87932	D	0	-7.2054	15.122	0.72450	1.0:0.0:0.0:0.0	.	900;901;901	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	C	901	ENSP00000407720:Y901C;ENSP00000398880:Y901C	ENSP00000407720:Y901C	Y	+	2	0	CDK12	34921343	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	9.167000	0.94773	2.039000	0.60335	0.454000	0.30748	TAC		0.383	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		Missense_Mutation
MUC16	94025	genome.wustl.edu	37	19	9075296	9075296	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1322-01	TCGA-25-1322-10	T	T	A	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr19:9075296T>A	ENST00000397910.4	-	3	12353	c.12150A>T	c.(12148-12150)gaA>gaT	p.E4050D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4052	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.E4050D(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGAGGTAATTTCTGTTCTAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											152.0	139.0	143.0					19																	9075296		1923	4123	6046	8936296	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12150A>T	19.37:g.9075296T>A	ENSP00000381008:p.Glu4050Asp	Somatic		Capture	Illumina GAIIx	Phase_III	8936296	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	t	7.785	0.710247	0.15239	.	.	ENSG00000181143	ENST00000397910	T	0.02606	4.23	2.23	-2.88	0.05682	.	.	.	.	.	T	0.01800	0.0057	N	0.22421	0.69	.	.	.	B	0.28713	0.22	B	0.20184	0.028	T	0.43507	-0.9387	8	0.87932	D	0	.	2.3664	0.04320	0.4117:0.2891:0.0:0.2991	.	4050	B5ME49	.	D	4050	ENSP00000381008:E4050D	ENSP00000381008:E4050D	E	-	3	2	MUC16	8936296	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-3.551000	0.00433	-0.943000	0.03691	0.260000	0.18958	GAA		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
ZNF675	171392	genome.wustl.edu	37	19	23837047	23837047	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr19:23837047A>G	ENST00000359788.4	-	4	856	c.688T>C	c.(688-690)Tgt>Cgt	p.C230R	ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	230					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C230R(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CATTCTTGACATTTGTAGAGT	0.313																																																1	Substitution - Missense(1)	ovary(1)	19											50.0	53.0	52.0					19																	23837047		2200	4296	6496	23628887	SO:0001583	missense	171392				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.688T>C	19.37:g.23837047A>G	ENSP00000352836:p.Cys230Arg	Somatic		Capture	Illumina GAIIx	Phase_III	23628887	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	.	12.68	2.010143	0.35415	.	.	ENSG00000197372	ENST00000359788	T	0.40225	1.04	0.916	0.916	0.19373	Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71195	0.3311	H	0.98866	4.355	0.58432	D	0.999992	D	0.60575	0.988	P	0.62298	0.9	T	0.71971	-0.4431	9	0.72032	D	0.01	.	6.7351	0.23405	1.0:0.0:0.0:0.0	.	230	Q8TD23	ZN675_HUMAN	R	230	ENSP00000352836:C230R	ENSP00000352836:C230R	C	-	1	0	ZNF675	23628887	0.987000	0.35691	0.275000	0.24674	0.273000	0.26683	5.638000	0.67861	0.257000	0.21650	0.254000	0.18369	TGT		0.313	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330		Missense_Mutation
RNF220	55182	genome.wustl.edu	37	1	44878304	44878304	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr1:44878304G>A	ENST00000355387.2	+	2	985	c.535G>A	c.(535-537)Gtt>Att	p.V179I	RNF220_ENST00000361799.2_Missense_Mutation_p.V179I|RNF220_ENST00000372247.2_Missense_Mutation_p.V179I			Q5VTB9	RN220_HUMAN	ring finger protein 220	179					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V179I(2)		endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TTCACTAAAGGTTGATGACAC	0.498																																																2	Substitution - Missense(2)	ovary(2)	1											92.0	84.0	87.0					1																	44878304		2203	4300	6503	44650891	SO:0001583	missense	55182			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.535G>A	1.37:g.44878304G>A	ENSP00000347548:p.Val179Ile	Somatic		Capture	Illumina GAIIx	4	44650891	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	ENST00000355387.2	37	CCDS510.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	14.94	2.683984	0.47991	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	5.69	5.69	0.88448	.	0.136762	0.48767	D	0.000162	T	0.63438	0.2511	L	0.27053	0.805	0.80722	D	1	P	0.44690	0.841	P	0.55824	0.785	T	0.62680	-0.6803	9	0.48119	T	0.1	.	19.8074	0.96536	0.0:0.0:1.0:0.0	.	179	Q5VTB9	RN220_HUMAN	I	179	.	ENSP00000347548:V179I	V	+	1	0	RNF220	44650891	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.529000	0.81952	2.684000	0.91462	0.655000	0.94253	GTT		0.498	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150		Missense_Mutation
CFHR2	3080	genome.wustl.edu	37	1	196871732	196871732	+	Intron	SNP	G	G	A	rs77556138	byFrequency	TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr1:196871732G>A	ENST00000367421.3	+	2	135				CFHR4_ENST00000608469.1_Intron|CFHR4_ENST00000367416.2_Silent_p.T80T|CFHR4_ENST00000251424.4_Silent_p.T81T|CFHR4_ENST00000367418.2_Intron			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)		p.T81T(1)		large_intestine(2)|ovary(1)|skin(3)	6						GGTCACCAACGGTCCCATGCC	0.353													A|||	40	0.00798722	0.0303	0.0	5008	,	,		15564	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						A	,,	123,4135		8,107,2014	109.0	108.0	108.0		243,240,243	2.1	0.0	1	dbSNP_131	108	0,8574		0,0,4287	no	coding-synonymous,coding-synonymous,coding-synonymous	CFHR4	NM_001201550.2,NM_001201551.1,NM_006684.4	,,	8,107,6301	AA,AG,GG		0.0,2.8887,0.9585	,,	81/579,80/578,81/332	196871732	123,12709	2129	4287	6416	195138355	SO:0001627	intron_variant	10877			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-46853G>A	1.37:g.196871732G>A		Somatic		Capture	Illumina GAIIx	4	195138355	Q14310|Q5T9T1	Silent	SNP	ENST00000367421.3	37		SNP	39	WashU																																																																																				0.353	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005666		Silent
CAMK1D	57118	genome.wustl.edu	37	10	12858300	12858300	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr10:12858300C>T	ENST00000378847.3	+	8	1143	c.806C>T	c.(805-807)aCg>aTg	p.T269M	CAMK1D_ENST00000378845.1_Missense_Mutation_p.T269M	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	269	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.T269M(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		AAAAGATACACGTGTGAGCAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											85.0	78.0	80.0					10																	12858300		2203	4300	6503	12898306	SO:0001583	missense	57118			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.806C>T	10.37:g.12858300C>T	ENSP00000368124:p.Thr269Met	Somatic		Capture	Illumina GAIIx	4	12898306	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	37	CCDS7091.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797766	0.90538	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.50548	0.74;0.74	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.048926	0.85682	D	0.000000	T	0.76948	0.4059	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.70487	0.947;0.969	T	0.82814	-0.0271	10	0.87932	D	0	-21.8846	17.4922	0.87707	0.0:1.0:0.0:0.0	.	269;269	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	M	269	ENSP00000368124:T269M;ENSP00000368122:T269M	ENSP00000368122:T269M	T	+	2	0	CAMK1D	12898306	1.000000	0.71417	0.963000	0.40424	0.955000	0.61496	7.471000	0.80985	2.724000	0.93272	0.561000	0.74099	ACG		0.507	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397		Missense_Mutation
PTPN5	84867	genome.wustl.edu	37	11	18751412	18751412	+	Intron	SNP	A	A	T			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr11:18751412A>T	ENST00000358540.2	-	13	1760				PTPN5_ENST00000477854.1_Intron|PTPN5_ENST00000396167.2_Intron|PTPN5_ENST00000396170.1_Intron|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396166.3_Missense_Mutation_p.L34Q|PTPN5_ENST00000396168.1_Intron|PTPN5_ENST00000396171.4_Intron	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GAACTCTTTCAGCTCACAAAC	0.547																																																0			11											25.0	31.0	29.0					11																	18751412		2150	4258	6408	18707988	SO:0001627	intron_variant	84867			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1330-47T>A	11.37:g.18751412A>T		Somatic		Capture	Illumina GAIIx	4	18707988	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	CCDS7845.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821000	0.32237	.	.	ENSG00000110786	ENST00000396166	T	0.09255	3.0	3.79	-1.59	0.08453	.	.	.	.	.	T	0.05364	0.0142	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41215	-0.9521	5	.	.	.	.	1.0505	0.01578	0.4343:0.1588:0.0974:0.3095	.	.	.	.	Q	34	ENSP00000379469:L34Q	.	L	-	2	0	PTPN5	18707988	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.146000	0.16180	-0.155000	0.11098	-0.333000	0.08304	CTG		0.547	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970		Missense_Mutation
FIBP	9158	genome.wustl.edu	37	11	65651944	65651944	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr11:65651944C>T	ENST00000338369.2	-	9	1056	c.944G>A	c.(943-945)cGc>cAc	p.R315H	FIBP_ENST00000426652.2_5'Flank|FIBP_ENST00000533045.1_Silent_p.P300P|FIBP_ENST00000357519.4_Missense_Mutation_p.R308H	NM_198897.1	NP_942600.1	O43427	FIBP_HUMAN	fibroblast growth factor (acidic) intracellular binding protein	315					fibroblast growth factor receptor signaling pathway (GO:0008543)|platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)	p.R315H(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	10				READ - Rectum adenocarcinoma(159;0.166)		GTGGTCGGAGCGGCAGGGTTC	0.587											OREG0021089	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											54.0	54.0	54.0					11																	65651944		2201	4296	6497	65408520	SO:0001583	missense	9158			AF010187	CCDS8118.1, CCDS8119.1	11q13.1	2006-06-15			ENSG00000172500	ENSG00000172500			3705	protein-coding gene	gene with protein product		608296				9806903	Standard	NM_004214		Approved	FGFIBP	uc001ogd.3	O43427	OTTHUMG00000166846	ENST00000338369.2:c.944G>A	11.37:g.65651944C>T	ENSP00000344572:p.Arg315His	Somatic	1085	Capture	Illumina GAIIx	4	65408520	A8K0J7|Q27Q85|Q6IBQ3|Q9HD65	Missense_Mutation	SNP	ENST00000338369.2	37	CCDS8119.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556363	0.86231	.	.	ENSG00000172500	ENST00000338369;ENST00000357519	T;T	0.28255	1.62;1.62	3.77	3.77	0.43336	.	0.138704	0.48286	D	0.000198	T	0.45478	0.1344	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	0.999;1.0	P;P	0.61874	0.835;0.895	T	0.45026	-0.9289	10	0.87932	D	0	-13.8139	7.3392	0.26627	0.0:0.8813:0.0:0.1187	.	308;315	O43427-2;O43427	.;FIBP_HUMAN	H	315;308	ENSP00000344572:R315H;ENSP00000350124:R308H	ENSP00000344572:R315H	R	-	2	0	FIBP	65408520	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.377000	0.44300	2.120000	0.65058	0.561000	0.74099	CGC		0.587	FIBP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000391575.2	NM_198897		Missense_Mutation
PYROXD1	79912	genome.wustl.edu	37	12	21615759	21615759	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr12:21615759G>C	ENST00000240651.9	+	10	1133	c.1079G>C	c.(1078-1080)tGt>tCt	p.C360S	PYROXD1_ENST00000538582.1_Missense_Mutation_p.C289S	NM_024854.3	NP_079130.2	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 1	360							oxidoreductase activity (GO:0016491)	p.C360S(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|soft_tissue(1)	18						GGTGACATCTGTACTACATCC	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											96.0	82.0	87.0					12																	21615759		2203	4300	6503	21507026	SO:0001583	missense	79912			AL832441	CCDS31755.1	12p12.1	2014-02-12			ENSG00000121350	ENSG00000121350			26162	protein-coding gene	gene with protein product						12477932	Standard	NM_024854		Approved	DKFZp762G094, FLJ22028	uc001rew.3	Q8WU10	OTTHUMG00000169129	ENST00000240651.9:c.1079G>C	12.37:g.21615759G>C	ENSP00000240651:p.Cys360Ser	Somatic		Capture	Illumina GAIIx	4	21507026	A6NKI6|B3KWN8|Q9H6P1	Missense_Mutation	SNP	ENST00000240651.9	37	CCDS31755.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038380	0.75617	.	.	ENSG00000121350	ENST00000536935;ENST00000240651;ENST00000538582	T;T	0.43688	0.94;0.94	4.72	4.72	0.59763	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.64238	0.2580	M	0.77712	2.385	0.80722	D	1	D	0.62365	0.991	D	0.70016	0.967	T	0.66716	-0.5853	9	.	.	.	.	15.2327	0.73404	0.0:0.0:1.0:0.0	.	360	Q8WU10	PYRD1_HUMAN	S	66;360;289	ENSP00000240651:C360S;ENSP00000438505:C289S	.	C	+	2	0	PYROXD1	21507026	1.000000	0.71417	0.996000	0.52242	0.764000	0.43329	8.751000	0.91628	2.337000	0.79520	0.655000	0.94253	TGT		0.428	PYROXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402363.1	NM_024854		Missense_Mutation
KIF21A	55605	genome.wustl.edu	37	12	39695437	39695437	+	Silent	SNP	C	C	A			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr12:39695437C>A	ENST00000361418.5	-	37	4791	c.4776G>T	c.(4774-4776)gtG>gtT	p.V1592V	KIF21A_ENST00000544797.2_Silent_p.V1555V|KIF21A_ENST00000395670.3_Silent_p.V1593V|KIF21A_ENST00000541463.2_Silent_p.V1539V|KIF21A_ENST00000361961.3_Silent_p.V1579V			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1592					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V1579V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				GGTCTGGCACCACTCCCAGGG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	12											134.0	138.0	137.0					12																	39695437		2203	4300	6503	37981704	SO:0001819	synonymous_variant	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4776G>T	12.37:g.39695437C>A		Somatic		Capture	Illumina GAIIx	4	37981704	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	37	CCDS53776.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	6.071	0.381317	0.11466	.	.	ENSG00000139116	ENST00000552961	.	.	.	4.43	3.54	0.40534	.	.	.	.	.	T	0.57902	0.2085	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51325	-0.8720	4	.	.	.	.	8.3139	0.32088	0.0:0.7135:0.1315:0.1549	.	.	.	.	L	893	.	.	W	-	2	0	KIF21A	37981704	0.983000	0.35010	0.992000	0.48379	0.885000	0.51271	0.720000	0.25896	0.509000	0.28195	-0.813000	0.03139	TGG		0.463	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641		Silent
AQP2	359	genome.wustl.edu	37	12	50344952	50344952	+	Silent	SNP	C	C	T	rs144253988		TCGA-25-1322-01	TCGA-25-1322-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr12:50344952C>T	ENST00000199280.3	+	1	424	c.339C>T	c.(337-339)cgC>cgT	p.R113R	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	113					actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.R113R(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						CAGACATCCGCGGGGACCTGG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	12						C		1,4401		0,1,2200	17.0	18.0	18.0		339	-9.4	0.0	12	dbSNP_134	18	0,8594		0,0,4297	no	coding-synonymous	AQP2	NM_000486.5		0,1,6497	TT,TC,CC		0.0,0.0227,0.0077		113/272	50344952	1,12995	2201	4297	6498	48631219	SO:0001819	synonymous_variant					CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.339C>T	12.37:g.50344952C>T		Somatic		Capture	Illumina GAIIx	4	48631219	Q9UD68	Missense_Mutation	SNP	ENST00000199280.3	37	CCDS8792.1	SNP	27	WashU																																																																																				0.622	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405540.1	NM_000486		Missense_Mutation
SCN8A	6334	genome.wustl.edu	37	12	52100321	52100321	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr12:52100321A>G	ENST00000354534.6	+	11	1635	c.1457A>G	c.(1456-1458)aAg>aGg	p.K486R	SCN8A_ENST00000545061.1_Missense_Mutation_p.K486R|SCN8A_ENST00000550891.1_Missense_Mutation_p.K486R	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	486					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.K486R(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTCAGCTCAAAGAGTGCAAAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	12											29.0	27.0	28.0					12																	52100321		1837	4086	5923	50386588	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.1457A>G	12.37:g.52100321A>G	ENSP00000346534:p.Lys486Arg	Somatic		Capture	Illumina GAIIx	4	50386588	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091426	0.76756	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961;ENST00000551216	D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87	4.3	4.3	0.51218	Domain of unknown function DUF3451 (1);	0.000000	0.85682	D	0.000000	D	0.94716	0.8295	M	0.79805	2.47	0.58432	D	0.999998	B;D;B;D	0.76494	0.143;0.991;0.229;0.999	B;D;B;D	0.81914	0.081;0.931;0.081;0.995	D	0.94236	0.7481	10	0.39692	T	0.17	.	13.9164	0.63899	1.0:0.0:0.0:0.0	.	486;486;486;486	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	R	486;486;486;486;399;284	ENSP00000448415:K486R;ENSP00000346534:K486R;ENSP00000440360:K486R;ENSP00000347255:K486R;ENSP00000447567:K284R	ENSP00000346534:K486R	K	+	2	0	SCN8A	50386588	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.139000	0.94554	1.935000	0.56089	0.379000	0.24179	AAG		0.483	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		Missense_Mutation
OR10A7	121364	genome.wustl.edu	37	12	55615678	55615678	+	Silent	SNP	C	C	T	rs375889018		TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr12:55615678C>T	ENST00000326258.1	+	1	870	c.870C>T	c.(868-870)taC>taT	p.Y290Y		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y290Y(1)		endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						CCATCATCTACGGCCTGAGGA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	12						C		0,4406		0,0,2203	85.0	74.0	77.0		870	-0.2	1.0	12		77	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR10A7	NM_001005280.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		290/317	55615678	1,13005	2203	4300	6503	53901945	SO:0001819	synonymous_variant	121364			BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.870C>T	12.37:g.55615678C>T		Somatic		Capture	Illumina GAIIx	4	53901945	Q6IFD5|Q96R19	Silent	SNP	ENST00000326258.1	37	CCDS31815.1	SNP	19	WashU																																																																																				0.448	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1			Silent
NAV3	89795	genome.wustl.edu	37	12	78516137	78516137	+	Silent	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr12:78516137G>A	ENST00000397909.2	+	16	4340	c.4167G>A	c.(4165-4167)ctG>ctA	p.L1389L	NAV3_ENST00000536525.2_Silent_p.L1389L|NAV3_ENST00000266692.7_Intron|NAV3_ENST00000228327.6_Silent_p.L1389L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1389	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.L1389L(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGTCTGGACTGACCACAGGCA	0.542										HNSCC(70;0.22)																																						1	Substitution - coding silent(1)	ovary(1)	12											116.0	107.0	110.0					12																	78516137		2026	4189	6215	77040268	SO:0001819	synonymous_variant	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4167G>A	12.37:g.78516137G>A		Somatic		Capture	Illumina GAIIx	4	77040268	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		SNP	45	WashU																																																																																				0.542	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		Silent
STOML3	161003	genome.wustl.edu	37	13	39541003	39541003	+	Missense_Mutation	SNP	C	C	T	rs533210440		TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr13:39541003C>T	ENST00000379631.4	-	7	1179	c.835G>A	c.(835-837)Gtc>Atc	p.V279I	STOML3_ENST00000423210.1_Missense_Mutation_p.V270I	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	279					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.V279I(1)		breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		TCATAGCTGACGCCACCAATG	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18002	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	13											99.0	96.0	97.0					13																	39541003		2203	4300	6503	38439003	SO:0001583	missense	161003			BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.835G>A	13.37:g.39541003C>T	ENSP00000368952:p.Val279Ile	Somatic		Capture	Illumina GAIIx	4	38439003	B4E285|Q5JS35	Missense_Mutation	SNP	ENST00000379631.4	37	CCDS9367.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	5.870	0.344639	0.11126	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	D;D	0.98437	-4.92;-4.93	5.16	-10.3	0.00346	.	0.538720	0.20842	N	0.084682	D	0.89199	0.6647	N	0.02247	-0.625	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.76613	-0.2895	10	0.16896	T	0.51	-9.5721	13.9834	0.64319	0.0:0.5308:0.0:0.4692	.	270;279	B4E285;Q8TAV4	.;STML3_HUMAN	I	279;270	ENSP00000368952:V279I;ENSP00000401989:V270I	ENSP00000368952:V279I	V	-	1	0	STOML3	38439003	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.308000	0.02730	-2.167000	0.00779	-1.106000	0.02097	GTC		0.493	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044604.2			Missense_Mutation
DGKH	160851	genome.wustl.edu	37	13	42793919	42793919	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr13:42793919G>A	ENST00000337343.4	+	28	3452	c.3431G>A	c.(3430-3432)aGt>aAt	p.S1144N	DGKH_ENST00000536612.1_Missense_Mutation_p.S1008N|DGKH_ENST00000540693.1_Missense_Mutation_p.S1144N|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000261491.5_Missense_Mutation_p.S1144N|DGKH_ENST00000379274.2_Missense_Mutation_p.S1008N|DGKH_ENST00000538674.1_Missense_Mutation_p.S899N	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	1144					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.S1144N(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		CAGAAGACAAGTTCACAGCCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	13											59.0	51.0	54.0					13																	42793919		2203	4300	6503	41691919	SO:0001583	missense	160851			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.3431G>A	13.37:g.42793919G>A	ENSP00000337572:p.Ser1144Asn	Somatic		Capture	Illumina GAIIx	4	41691919	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	16.38	3.105719	0.56291	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.80123	-1.33;-1.16;-1.33;-1.34;-1.34;1.91	5.44	5.44	0.79542	.	0.147857	0.64402	D	0.000009	D	0.87450	0.6180	L	0.52364	1.645	0.47819	D	0.999525	D;B;D;B	0.71674	0.998;0.004;0.996;0.004	D;B;D;B	0.80764	0.994;0.008;0.914;0.004	D	0.85858	0.1408	10	0.40728	T	0.16	.	19.6384	0.95746	0.0:0.0:1.0:0.0	.	899;1008;1144;1144	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	N	1144;1144;1144;1008;1008;899	ENSP00000440823:S1144N;ENSP00000337572:S1144N;ENSP00000261491:S1144N;ENSP00000368576:S1008N;ENSP00000445114:S1008N;ENSP00000441308:S899N	ENSP00000261491:S1144N	S	+	2	0	DGKH	41691919	1.000000	0.71417	0.884000	0.34674	0.991000	0.79684	6.951000	0.75983	2.703000	0.92315	0.655000	0.94253	AGT		0.408	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009		Missense_Mutation
SLITRK5	26050	genome.wustl.edu	37	13	88329445	88329445	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr13:88329445C>A	ENST00000325089.6	+	2	2021	c.1802C>A	c.(1801-1803)aCc>aAc	p.T601N	SLITRK5_ENST00000400028.3_Missense_Mutation_p.T360N	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	601	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.T601N(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TTCGCTGAGACCGACATGCGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	13											169.0	152.0	158.0					13																	88329445		2203	4300	6503	87127446	SO:0001583	missense	26050			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1802C>A	13.37:g.88329445C>A	ENSP00000366283:p.Thr601Asn	Somatic		Capture	Illumina GAIIx	4	87127446	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	4.064	0.009749	0.07912	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.52983	0.64;0.71	5.47	3.73	0.42828	Cysteine-rich flanking region, C-terminal (1);	0.433164	0.24130	N	0.041274	T	0.28134	0.0694	N	0.24115	0.695	0.28421	N	0.917737	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.15206	-1.0445	9	.	.	.	-4.2483	5.3863	0.16220	0.1601:0.6701:0.0:0.1698	.	360;601	B4DSH5;O94991	.;SLIK5_HUMAN	N	601;360	ENSP00000366283:T601N;ENSP00000442244:T360N	.	T	+	2	0	SLITRK5	87127446	0.752000	0.28338	0.892000	0.35008	0.973000	0.67179	1.311000	0.33562	0.659000	0.30945	0.555000	0.69702	ACC		0.557	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			Missense_Mutation
MYO16	23026	genome.wustl.edu	37	13	109540816	109540816	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr13:109540816A>T	ENST00000357550.2	+	13	1625	c.1584A>T	c.(1582-1584)agA>agT	p.R528S	MYO16_ENST00000251041.5_Missense_Mutation_p.R528S|MYO16_ENST00000356711.2_Missense_Mutation_p.R528S|MYO16_ENST00000457511.2_Missense_Mutation_p.R40S	NM_001198950.1	NP_001185879.1			myosin XVI									p.R528S(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGGATTCCAGATTCAAACATG	0.443																																																1	Substitution - Missense(1)	ovary(1)	13											57.0	64.0	62.0					13																	109540816		2203	4300	6503	108338817	SO:0001583	missense	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1584A>T	13.37:g.109540816A>T	ENSP00000350160:p.Arg528Ser	Somatic		Capture	Illumina GAIIx	4	108338817		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	12.02	1.813518	0.32053	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16	5.18	0.245	0.15512	Myosin head, motor domain (2);	0.165663	0.26578	U	0.023595	D	0.86418	0.5928	M	0.72479	2.2	0.28502	N	0.913957	P;B;P	0.42556	0.73;0.348;0.783	B;B;P	0.46796	0.167;0.108;0.527	T	0.79838	-0.1634	9	.	.	.	.	8.8428	0.35153	0.5156:0.0:0.4844:0.0	.	40;528;528	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	S	528;528;528;528;316;40	ENSP00000349145:R528S;ENSP00000350160:R528S;ENSP00000251041:R528S;ENSP00000401633:R40S	.	R	+	3	2	MYO16	108338817	0.997000	0.39634	0.132000	0.22025	0.233000	0.25261	0.440000	0.21592	-0.128000	0.11641	0.533000	0.62120	AGA		0.443	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		Missense_Mutation
FAM227B	196951	genome.wustl.edu	37	15	49833998	49833998	+	Silent	SNP	A	A	G	rs190343255		TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr15:49833998A>G	ENST00000299338.6	-	10	1056	c.753T>C	c.(751-753)taT>taC	p.Y251Y	FAM227B_ENST00000561064.1_Silent_p.Y217Y	NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	251								p.Y251Y(1)									AACAATCAGGATATATCTACC	0.269													A|||	1	0.000199681	0.0	0.0	5008	,	,		11238	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15						A		0,4388		0,0,2194	57.0	60.0	59.0		753	0.9	0.9	15		59	3,8573		0,3,4285	no	coding-synonymous	C15orf33	NM_152647.2		0,3,6479	GG,GA,AA		0.035,0.0,0.0231		251/509	49833998	3,12961	2194	4288	6482	47621290	SO:0001819	synonymous_variant	196951				CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.753T>C	15.37:g.49833998A>G		Somatic		Capture	Illumina GAIIx	4	47621290	Q86WS2	Silent	SNP	ENST00000299338.6	37	CCDS32237.1	SNP	12	WashU																																																																																				0.269	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647		Silent
UNC13C	440279	genome.wustl.edu	37	15	54860143	54860143	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr15:54860143A>C	ENST00000260323.11	+	29	6104	c.6104A>C	c.(6103-6105)cAg>cCg	p.Q2035P	UNC13C_ENST00000545554.1_Missense_Mutation_p.Q2035P|UNC13C_ENST00000537900.1_Missense_Mutation_p.Q2033P	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2035					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.Q2035P(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAAACCTCACAGAGTAAGTAA	0.328																																																1	Substitution - Missense(1)	ovary(1)	15											54.0	48.0	50.0					15																	54860143		1799	4064	5863	52647435	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6104A>C	15.37:g.54860143A>C	ENSP00000260323:p.Gln2035Pro	Somatic		Capture	Illumina GAIIx	4	52647435	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339282	0.81911	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.82255	-1.58;-1.58;-1.59	5.81	5.81	0.92471	.	0.176829	0.51477	D	0.000091	T	0.80199	0.4579	L	0.49513	1.565	0.80722	D	1	P	0.34546	0.456	B	0.33568	0.166	T	0.81470	-0.0918	10	0.87932	D	0	.	15.3427	0.74311	1.0:0.0:0.0:0.0	.	2035	Q8NB66	UN13C_HUMAN	P	2035;2035;2033	ENSP00000260323:Q2035P;ENSP00000438156:Q2035P;ENSP00000442569:Q2033P	ENSP00000260323:Q2035P	Q	+	2	0	UNC13C	52647435	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.273000	0.95719	2.218000	0.71995	0.377000	0.23210	CAG		0.328	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		Missense_Mutation
MNS1	55329	genome.wustl.edu	37	15	56721366	56721366	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr15:56721366A>G	ENST00000260453.3	-	10	1585	c.1421T>C	c.(1420-1422)aTt>aCt	p.I474T	TEX9_ENST00000352903.2_Intron|TEX9_ENST00000537232.1_Intron|MNS1_ENST00000566386.1_5'UTR	NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	474					cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)	p.I474T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		AAGCAGATCAATATCATCCTC	0.313																																																1	Substitution - Missense(1)	ovary(1)	15											96.0	91.0	93.0					15																	56721366		2191	4285	6476	54508658	SO:0001583	missense	55329			AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.1421T>C	15.37:g.56721366A>G	ENSP00000260453:p.Ile474Thr	Somatic		Capture	Illumina GAIIx	4	54508658	Q8IYT6|Q9NUP4	Missense_Mutation	SNP	ENST00000260453.3	37	CCDS10158.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	15.76	2.929003	0.52759	.	.	ENSG00000138587	ENST00000260453	T	0.14640	2.49	6.08	6.08	0.98989	.	0.672261	0.15854	N	0.241362	T	0.14570	0.0352	L	0.44542	1.39	0.32864	D	0.508349	B	0.32245	0.361	B	0.25140	0.058	T	0.09037	-1.0693	10	0.59425	D	0.04	-1.9293	15.8323	0.78764	1.0:0.0:0.0:0.0	.	474	Q8NEH6	MNS1_HUMAN	T	474	ENSP00000260453:I474T	ENSP00000260453:I474T	I	-	2	0	MNS1	54508658	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	6.099000	0.71466	2.333000	0.79357	0.482000	0.46254	ATT		0.313	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255047.2	NM_018365		Missense_Mutation
MT1M	4499	genome.wustl.edu	37	16	56667260	56667260	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1322-01	TCGA-25-1322-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr16:56667260T>C	ENST00000379818.3	+	2	536	c.37T>C	c.(37-39)Tgc>Cgc	p.C13R	MT1JP_ENST00000564564.1_RNA|AC026461.1_ENST00000600389.1_5'Flank	NM_176870.2	NP_789846.1	Q8N339	MT1M_HUMAN	metallothionein 1M	13	Beta.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.C13R(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5						AGGTGTCTCCTGCGCCTGCAC	0.572																																																1	Substitution - Missense(1)	ovary(1)	16											107.0	108.0	108.0					16																	56667260		2196	4300	6496	55224761	SO:0001583	missense	4499			AF136177	CCDS42166.1	16q13	2008-02-05				ENSG00000205364		"""Metallothioneins"""	14296	protein-coding gene	gene with protein product		156357	"""metallothionein 1K"""	MT1, MT1K		2286373, 8049263	Standard	NM_176870		Approved		uc002ejn.3	Q8N339		ENST00000379818.3:c.37T>C	16.37:g.56667260T>C	ENSP00000369146:p.Cys13Arg	Somatic		Capture	Illumina GAIIx	4	55224761	Q8TDN3	Missense_Mutation	SNP	ENST00000379818.3	37	CCDS42166.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	13.58	2.279801	0.40294	.	.	ENSG00000205364	ENST00000379818	T	0.27402	1.67	2.66	1.44	0.22558	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	0.000000	0.64402	U	0.000003	T	0.22859	0.0552	.	.	.	0.80722	D	1	B	0.29909	0.261	B	0.31812	0.136	T	0.05500	-1.0881	9	0.72032	D	0.01	.	4.8639	0.13598	0.0:0.1609:0.0:0.8391	.	13	Q8N339	MT1M_HUMAN	R	13	ENSP00000369146:C13R	ENSP00000369146:C13R	C	+	1	0	MT1M	55224761	1.000000	0.71417	0.398000	0.26321	0.008000	0.06430	1.917000	0.39996	0.208000	0.20626	0.378000	0.23410	TGC		0.572	MT1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434359.1	NM_176870		Missense_Mutation
DNAAF1	123872	genome.wustl.edu	37	16	84188224	84188224	+	Missense_Mutation	SNP	G	G	A	rs371065429		TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr16:84188224G>A	ENST00000378553.5	+	4	519	c.395G>A	c.(394-396)cGc>cAc	p.R132H	DNAAF1_ENST00000334315.5_Missense_Mutation_p.R132H	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	132					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.R132H(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						ACAGGGCTGCGCTGTCTCTGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	16											100.0	95.0	97.0					16																	84188224		2200	4300	6500	82745725	SO:0001583	missense	123872			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.395G>A	16.37:g.84188224G>A	ENSP00000367815:p.Arg132His	Somatic		Capture	Illumina GAIIx	4	82745725	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	ENST00000378553.5	37	CCDS10943.2	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724081	0.68959	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.24538	1.85;1.85	4.99	4.99	0.66335	.	0.060211	0.64402	D	0.000017	T	0.45994	0.1370	M	0.68952	2.095	0.37074	D	0.898659	D	0.89917	1.0	D	0.77004	0.989	T	0.54642	-0.8263	10	0.72032	D	0.01	-15.3567	9.7038	0.40203	0.146:0.0:0.854:0.0	.	132	Q8NEP3	DAAF1_HUMAN	H	132	ENSP00000334593:R132H;ENSP00000367815:R132H	ENSP00000334593:R132H	R	+	2	0	DNAAF1	82745725	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.759000	0.55227	2.306000	0.77630	0.650000	0.86243	CGC		0.498	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452		Missense_Mutation
SYNRG	11276	genome.wustl.edu	37	17	35902214	35902214	+	Missense_Mutation	SNP	G	G	A	rs143632042		TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr17:35902214G>A	ENST00000339208.6	-	15	3202	c.3062C>T	c.(3061-3063)tCg>tTg	p.S1021L	SYNRG_ENST00000502449.2_Missense_Mutation_p.S898L|SYNRG_ENST00000345615.4_Missense_Mutation_p.S943L|SYNRG_ENST00000591288.1_Missense_Mutation_p.S815L|SYNRG_ENST00000585472.1_Missense_Mutation_p.S942L|SYNRG_ENST00000394378.2_Missense_Mutation_p.S943L|SYNRG_ENST00000346661.4_Missense_Mutation_p.S1021L	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1021					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)	p.S1021L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AAAGTCATCCGAACATTCGTT	0.483													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18187	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17						G	LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	83.0	88.0	87.0		2828,2825,2693,2444,3062,2828,2828	4.1	0.0	17	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	SYNRG	NM_001163544.1,NM_001163545.1,NM_001163546.1,NM_001163547.1,NM_007247.4,NM_080550.3,NM_198882.1	145,145,145,145,145,145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign	943/1237,942/1236,898/1180,815/1109,1021/1315,943/1225,943/1260	35902214	1,13005	2203	4300	6503	32976327	SO:0001583	missense	11276			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3062C>T	17.37:g.35902214G>A	ENSP00000343610:p.Ser1021Leu	Somatic		Capture	Illumina GAIIx	4	32976327	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443458	0.43429	0.0	1.16E-4	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T	0.46819	1.43;0.86	6.02	4.05	0.47172	.	0.768902	0.12751	N	0.442179	T	0.37839	0.1018	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B;B	0.10296	0.002;0.002;0.002;0.002;0.003;0.003	B;B;B;B;B;B	0.09377	0.004;0.004;0.004;0.004;0.002;0.002	T	0.28933	-1.0028	10	0.52906	T	0.07	0.0377	10.606	0.45394	0.1456:0.0:0.8544:0.0	.	815;943;943;943;1021;1021	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	L	1021;815;1021;943;943	ENSP00000005279:S1021L;ENSP00000377903:S943L	ENSP00000343610:S815L	S	-	2	0	SYNRG	32976327	0.208000	0.23494	0.031000	0.17742	0.968000	0.65278	2.996000	0.49449	0.884000	0.36064	0.650000	0.86243	TCG		0.483	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247		Missense_Mutation
PSG6	5675	genome.wustl.edu	37	19	43411283	43411283	+	Missense_Mutation	SNP	C	C	T	rs143813812	byFrequency	TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr19:43411283C>T	ENST00000292125.2	-	5	1075	c.1031G>A	c.(1030-1032)cGt>cAt	p.R344H	PSG6_ENST00000402603.4_Missense_Mutation_p.R251H|PSG6_ENST00000187910.2_Missense_Mutation_p.R344H	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	344	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R344H(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				TTCTCCTGAACGGTAATAGGT	0.478													.|||	2	0.000399361	0.0	0.0014	5008	,	,		19088	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						C	HIS/ARG,HIS/ARG	0,4402		0,0,2201	159.0	173.0	168.0		1031,1031	-3.1	0.0	19	dbSNP_134	168	11,8589		0,11,4289	no	missense,missense	PSG6	NM_001031850.2,NM_002782.3	29,29	0,11,6490	TT,TC,CC		0.1279,0.0,0.0846	,	344/425,344/436	43411283	11,12991	2201	4300	6501	48103123	SO:0001583	missense	5675				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.1031G>A	19.37:g.43411283C>T	ENSP00000292125:p.Arg344His	Somatic		Capture	Illumina GAIIx	4	48103123	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	CCDS12613.1	SNP	19	WashU	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	N	0.061	-1.224119	0.01530	0.0	0.001279	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125	T;T;T	0.13307	2.6;2.6;2.6	1.54	-3.08	0.05347	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06826	0.0174	L	0.28556	0.865	0.09310	N	1	B;B;B	0.12630	0.006;0.001;0.002	B;B;B	0.14023	0.006;0.01;0.005	T	0.40021	-0.9585	9	0.21014	T	0.42	.	0.454	0.00505	0.1931:0.3105:0.1933:0.3031	.	344;344;251	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	H	344;251;344	ENSP00000187910:R344H;ENSP00000385736:R251H;ENSP00000292125:R344H	ENSP00000187910:R344H	R	-	2	0	PSG6	48103123	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.013000	0.00646	-1.981000	0.00989	-1.368000	0.01194	CGT		0.478	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		Missense_Mutation
SIGLEC14	100049587	genome.wustl.edu	37	19	52149193	52149193	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr19:52149193G>A	ENST00000360844.6	-	3	583	c.542C>T	c.(541-543)aCg>aTg	p.T181M	SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000222107.4_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	181	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.T181M(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GGCATTCCCCGTCCAGGAGAA	0.657																																																2	Substitution - Missense(2)	ovary(2)	19																																								56841005	SO:0001583	missense				AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.542C>T	19.37:g.52149193G>A	ENSP00000354090:p.Thr181Met	Somatic		Capture	Illumina GAIIx	4	56841005	Q6UXG0	Missense_Mutation	SNP	ENST00000360844.6	37	CCDS42604.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	4.638	0.118691	0.08881	.	.	ENSG00000254415	ENST00000360844	D	0.86432	-2.12	3.09	-6.18	0.02085	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	2.183180	0.02203	N	0.062409	T	0.73401	0.3582	N	0.16266	0.395	0.09310	N	1	D	0.55172	0.97	P	0.45232	0.474	T	0.68712	-0.5336	10	0.07990	T	0.79	.	4.391	0.11341	0.5534:0.0:0.1647:0.2819	.	181	Q08ET2	SIG14_HUMAN	M	181	ENSP00000354090:T181M	ENSP00000354090:T181M	T	-	2	0	SIGLEC14	56841005	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-5.926000	0.00090	-1.582000	0.01640	0.508000	0.49915	ACG		0.657	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612		Missense_Mutation
POTEF	728378	genome.wustl.edu	37	2	130833008	130833008	+	Silent	SNP	A	A	G			TCGA-25-1322-01	TCGA-25-1322-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:130833008A>G	ENST00000409914.2	-	17	2436	c.2037T>C	c.(2035-2037)gaT>gaC	p.D679D	POTEF_ENST00000357462.5_Silent_p.D679D|POTEF_ENST00000360967.5_3'UTR|POTEF_ENST00000361163.4_3'UTR	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	679					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.D679D(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CACTTTCAATATCCTCCAAAT	0.388																																																2	Substitution - coding silent(2)	ovary(2)	2											33.0	34.0	34.0					2																	130833008		2100	4238	6338	130549478	SO:0001819	synonymous_variant	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2037T>C	2.37:g.130833008A>G		Somatic		Capture	Illumina GAIIx	4	130549478	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1	SNP	16	WashU																																																																																				0.388	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		Silent
PPIL3	53938	genome.wustl.edu	37	2	201752550	201752550	+	Intron	SNP	C	C	T	rs555380286	byFrequency	TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:201752550C>T	ENST00000392283.4	-	2	199				PPIL3_ENST00000465823.1_Intron|NIF3L1_ENST00000416651.1_5'Flank|NIF3L1_ENST00000409357.1_5'Flank|NIF3L1_ENST00000359683.4_5'Flank|PPIL3_ENST00000286175.8_Intron|PPIL3_ENST00000409361.1_Intron|NIF3L1_ENST00000409020.1_5'Flank|PPIL3_ENST00000409449.1_Intron	NM_130906.2	NP_570981.1	Q9H2H8	PPIL3_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 3						mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.?(1)		endometrium(1)|lung(2)	3						gaggccgaggcgggtggatca	0.512													C|||	2	0.000399361	0.0	0.0	5008	,	,		14470	0.0		0.0	False		,,,				2504	0.002															1	Unknown(1)	ovary(1)	2																																								201460795	SO:0001627	intron_variant	53938			AF251049	CCDS2332.1, CCDS2333.1	2q33.1	2008-02-05			ENSG00000240344	ENSG00000240344			9262	protein-coding gene	gene with protein product	"""Cyclophilin J"""	615811				11435694	Standard	NM_032472		Approved	CyPJ	uc002uwi.3	Q9H2H8	OTTHUMG00000132782	ENST00000392283.4:c.70-142G>A	2.37:g.201752550C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	201460795	Q86WF9|Q96IA9|Q9BXZ1	Splice_Site_SNP	SNP	ENST00000392283.4	37	CCDS2333.1	SNP	27	WashU																																																																																				0.512	PPIL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256190.3			Splice_Site_SNP
RPL37A	6168	genome.wustl.edu	37	2	217364707	217364707	+	Silent	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:217364707C>T	ENST00000491306.1	+	3	854	c.168C>T	c.(166-168)caC>caT	p.H56H	RPL37A_ENST00000600880.1_Silent_p.H56H|AC098820.3_ENST00000438978.1_RNA|RPL37A_ENST00000598925.1_Silent_p.H32H|RPL37A_ENST00000446558.1_Silent_p.H56H|AC098820.3_ENST00000453157.1_RNA|RPL37A_ENST00000441179.2_Silent_p.H32H|RPL37A_ENST00000427280.2_Silent_p.H32H|RPL37A_ENST00000456586.1_Silent_p.H32H	NM_000998.4	NP_000989.1	P61513	RL37A_HUMAN	ribosomal protein L37a	56					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.H56H(1)		NS(1)|ovary(1)	2		Renal(323;0.0458)		Epithelial(149;3.51e-06)|all cancers(144;0.000249)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGATCTGGCACTGTGGTTCCT	0.463																																																1	Substitution - coding silent(1)	ovary(1)	2											128.0	124.0	125.0					2																	217364707		2203	4300	6503	217072952	SO:0001819	synonymous_variant	6168				CCDS2404.1	2q35	2011-04-06			ENSG00000197756	ENSG00000197756		"""L ribosomal proteins"""	10348	protein-coding gene	gene with protein product		613314				1437567	Standard	NM_000998		Approved	L37A	uc002vgf.3	P61513	OTTHUMG00000133052	ENST00000491306.1:c.168C>T	2.37:g.217364707C>T		Somatic		Capture	Illumina GAIIx	4	217072952	P12751|Q6FGF5	Silent	SNP	ENST00000491306.1	37	CCDS2404.1	SNP	20	WashU																																																																																				0.463	RPL37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256665.2	NM_000998		Silent
DOCK10	55619	genome.wustl.edu	37	2	225669934	225669934	+	Missense_Mutation	SNP	G	G	A	rs368517297		TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr2:225669934G>A	ENST00000258390.7	-	36	4107	c.4040C>T	c.(4039-4041)aCg>aTg	p.T1347M	DOCK10_ENST00000409592.3_Missense_Mutation_p.T1341M	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1347					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T1345M(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GTACGAAATCGTTTTCATAAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2						G	MET/THR	0,3616		0,0,1808	100.0	95.0	97.0		4040	4.8	1.0	2		97	1,8129		0,1,4064	no	missense	DOCK10	NM_014689.2	81	0,1,5872	AA,AG,GG		0.0123,0.0,0.0085	possibly-damaging	1347/2187	225669934	1,11745	1808	4065	5873	225378178	SO:0001583	missense	55619			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4040C>T	2.37:g.225669934G>A	ENSP00000258390:p.Thr1347Met	Somatic		Capture	Illumina GAIIx	4	225378178	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	SNP	40	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.217|8.217	0.801642|0.801642	0.16397|0.16397	0.0|0.0	1.23E-4|1.23E-4	ENSG00000135905|ENSG00000135905	ENST00000422684|ENST00000409592;ENST00000258390	.|T;T	.|0.01767	.|4.65;4.65	5.74|5.74	4.85|4.85	0.62838|0.62838	.|.	.|0.103808	.|0.64402	.|D	.|0.000003	.|T	.|0.01156	.|0.0038	N|N	0.16790|0.16790	0.44|0.44	0.39483|0.39483	D|D	0.967917|0.967917	.|P;P;B;B	.|0.48350	.|0.909;0.669;0.397;0.122	.|B;B;B;B	.|0.33454	.|0.164;0.022;0.032;0.011	.|T	.|0.73981	.|-0.3811	.|10	.|0.29301	.|T	.|0.29	.|.	9.8094|9.8094	0.40812|0.40812	0.0693:0.0:0.7898:0.1409|0.0693:0.0:0.7898:0.1409	.|.	.|1347;201;1341;9	.|Q96BY6;B4DF07;B3FL70;B4DEY4	.|DOC10_HUMAN;.;.;.	X|M	229|1341;1347	.|ENSP00000386694:T1341M;ENSP00000258390:T1347M	.|ENSP00000258390:T1347M	R|T	-|-	1|2	2|0	DOCK10|DOCK10	225378178|225378178	1.000000|1.000000	0.71417|0.71417	0.971000|0.971000	0.41717|0.41717	0.450000|0.450000	0.32258|0.32258	6.152000|6.152000	0.71812|0.71812	1.536000|1.536000	0.49237|0.49237	0.561000|0.561000	0.74099|0.74099	CGA|ACG		0.363	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			Missense_Mutation
RAPGEF5	9771	genome.wustl.edu	37	7	22347969	22347969	+	Silent	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr7:22347969G>A	ENST00000405243.1	-	5	752	c.669C>T	c.(667-669)ggC>ggT	p.G223G	RAPGEF5_ENST00000344041.6_Silent_p.G70G			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	0					nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.G70G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						GTTCACAGATGCCACCTCTGG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	7											64.0	60.0	61.0					7																	22347969		1937	4128	6065	22314494	SO:0001819	synonymous_variant	9771			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000405243.1:c.669C>T	7.37:g.22347969G>A		Somatic		Capture	Illumina GAIIx	4	22314494	A4D140|Q8IXU5	Silent	SNP	ENST00000405243.1	37		SNP	46	WashU																																																																																				0.398	RAPGEF5-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000326591.1	NM_012294		Silent
PHTF2	57157	genome.wustl.edu	37	7	77552051	77552051	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr7:77552051C>T	ENST00000248550.7	+	10	1151	c.1075C>T	c.(1075-1077)Cgg>Tgg	p.R359W	PHTF2_ENST00000450574.1_Missense_Mutation_p.R325W|PHTF2_ENST00000454592.1_3'UTR|PHTF2_ENST00000416283.2_Missense_Mutation_p.R325W|PHTF2_ENST00000424760.1_Missense_Mutation_p.R321W|PHTF2_ENST00000415251.2_Missense_Mutation_p.R321W|PHTF2_ENST00000307305.8_Missense_Mutation_p.R321W|PHTF2_ENST00000422959.2_Missense_Mutation_p.R325W|PHTF2_ENST00000275575.7_Missense_Mutation_p.R321W			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R359W(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						AGGTGTTCTTCGGAATAGAAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	7											63.0	60.0	61.0					7																	77552051		1858	4097	5955	77389987	SO:0001583	missense	57157			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.1075C>T	7.37:g.77552051C>T	ENSP00000248550:p.Arg359Trp	Somatic		Capture	Illumina GAIIx	4	77389987	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	37		SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294932	0.81025	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000415251;ENST00000275575;ENST00000450574;ENST00000416283;ENST00000248550	.	.	.	5.72	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.64091	0.2567	L	0.32530	0.975	0.58432	D	0.999999	B;D;D;D;D;D;D;B;D	0.89917	0.333;1.0;1.0;1.0;1.0;1.0;1.0;0.413;1.0	B;D;D;D;D;D;D;B;D	0.97110	0.061;0.999;0.999;0.998;0.994;1.0;0.989;0.093;0.999	T	0.66670	-0.5865	9	0.87932	D	0	-5.0602	9.7763	0.40621	0.1387:0.7909:0.0:0.0704	.	163;321;184;325;359;325;321;321;321	Q8WVD6;Q8N3S3-4;Q8N5I6;Q8N3S3-2;Q8N3S3;G5E9H7;Q8N3S3-3;B3KQZ2;E9PEE3	.;.;.;.;PHTF2_HUMAN;.;.;.;.	W	325;325;321;321;321;321;325;325;359	.	ENSP00000248550:R359W	R	+	1	2	PHTF2	77389987	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.725000	0.54970	1.423000	0.47198	0.655000	0.94253	CGG		0.363	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432		Missense_Mutation
KCND2	3751	genome.wustl.edu	37	7	119915105	119915105	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr7:119915105G>A	ENST00000331113.4	+	1	1384	c.419G>A	c.(418-420)cGc>cAc	p.R140H		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	140					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.R140H(2)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TACAAGGATCGCAGGCGAGAG	0.607																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	7											94.0	98.0	96.0					7																	119915105		2203	4300	6503	119702341	SO:0001583	missense	3751			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.419G>A	7.37:g.119915105G>A	ENSP00000333496:p.Arg140His	Somatic		Capture	Illumina GAIIx	4	119702341	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675417	0.67928	.	.	ENSG00000184408	ENST00000331113	T	0.46451	0.87	5.71	5.71	0.89125	BTB/POZ-like (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	M	0.62266	1.93	0.80722	D	1	P	0.40107	0.703	B	0.25506	0.061	T	0.35151	-0.9800	9	.	.	.	.	19.8677	0.96824	0.0:0.0:1.0:0.0	.	140	Q9NZV8	KCND2_HUMAN	H	140	ENSP00000333496:R140H	.	R	+	2	0	KCND2	119702341	1.000000	0.71417	0.929000	0.37066	0.952000	0.60782	8.062000	0.89475	2.709000	0.92574	0.655000	0.94253	CGC		0.607	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		Missense_Mutation
AKNA	80709	genome.wustl.edu	37	9	117139670	117139670	+	Silent	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr9:117139670C>T	ENST00000307564.4	-	3	578	c.417G>A	c.(415-417)gaG>gaA	p.E139E	AKNA_ENST00000312033.3_Silent_p.E139E|AKNA_ENST00000374075.5_Silent_p.E58E|AKNA_ENST00000374088.3_Silent_p.E139E|AKNA_ENST00000223791.3_5'Flank	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	139					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E139E(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TTGAGGAGCTCTCTCCAGCCT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	9											41.0	38.0	39.0					9																	117139670		2203	4300	6503	116179491	SO:0001819	synonymous_variant	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.417G>A	9.37:g.117139670C>T		Somatic		Capture	Illumina GAIIx	4	116179491	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Silent	SNP	ENST00000307564.4	37	CCDS6805.1	SNP	32	WashU																																																																																				0.627	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767		Silent
FOCAD	54914	genome.wustl.edu	37	9	20715367	20715367	+	Silent	SNP	C	C	A			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr9:20715367C>A	ENST00000380249.1	+	4	379	c.15C>A	c.(13-15)atC>atA	p.I5I	MIR491_ENST00000384877.1_RNA|FOCAD_ENST00000338382.6_Silent_p.I5I	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	5						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.I5I(1)									CAGATGATATCAGGAAAAGGT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	9											116.0	111.0	113.0					9																	20715367		2203	4300	6503	20705367	SO:0001819	synonymous_variant	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.15C>A	9.37:g.20715367C>A		Somatic		Capture	Illumina GAIIx	4	20705367	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	ENST00000380249.1	37	CCDS34993.1	SNP	29	WashU																																																																																				0.333	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		Silent
AGTPBP1	23287	genome.wustl.edu	37	9	88287523	88287523	+	Silent	SNP	C	C	T			TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr9:88287523C>T	ENST00000357081.3	-	7	654	c.510G>A	c.(508-510)ttG>ttA	p.L170L	AGTPBP1_ENST00000376080.1_Silent_p.L112L|AGTPBP1_ENST00000376109.3_Silent_p.L222L|AGTPBP1_ENST00000376081.4_Silent_p.L170L|AGTPBP1_ENST00000337006.4_Silent_p.L112L|AGTPBP1_ENST00000432218.1_Intron|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000376083.3_Silent_p.L170L			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	170					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.L170L(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						GATGATTCTGCAAATTCTGCT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	9											98.0	98.0	98.0					9																	88287523		2203	4300	6503	87477343	SO:0001819	synonymous_variant	23287			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.510G>A	9.37:g.88287523C>T		Somatic		Capture	Illumina GAIIx	4	87477343	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	ENST00000357081.3	37		SNP	25	WashU																																																																																				0.343	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239		Silent
UAP1L1	91373	genome.wustl.edu	37	9	139976466	139976466	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1322-01	TCGA-25-1322-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chr9:139976466G>A	ENST00000409858.3	+	8	1413	c.1381G>A	c.(1381-1383)Gac>Aac	p.D461N	UAP1L1_ENST00000360271.3_Missense_Mutation_p.D338N	NM_207309.2	NP_997192.2	Q3KQV9	UAP1L_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1 like 1	461							uridylyltransferase activity (GO:0070569)	p.D338N(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CCCAAATGGAGACCCTCCGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	9											193.0	181.0	185.0					9																	139976466		2203	4300	6503	139096287	SO:0001583	missense	91373			AK022632	CCDS7028.2	9q34.3	2014-07-31	2014-07-31		ENSG00000197355	ENSG00000197355			28082	protein-coding gene	gene with protein product							Standard	NM_207309		Approved		uc010ncb.3	Q3KQV9	OTTHUMG00000020962	ENST00000409858.3:c.1381G>A	9.37:g.139976466G>A	ENSP00000386935:p.Asp461Asn	Somatic		Capture	Illumina GAIIx	4	139096287	A2AMJ8|Q5SPZ2|Q69YQ3|Q6ZR38	Missense_Mutation	SNP	ENST00000409858.3	37	CCDS7028.2	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	11.17	1.558459	0.27827	.	.	ENSG00000197355	ENST00000409858;ENST00000360271	T;T	0.17691	2.26;2.26	4.06	2.88	0.33553	.	0.425646	0.26688	N	0.023001	T	0.12263	0.0298	N	0.19112	0.55	0.35747	D	0.819112	B;B	0.14012	0.009;0.002	B;B	0.25140	0.058;0.005	T	0.14839	-1.0458	10	0.62326	D	0.03	.	11.6632	0.51358	0.1091:0.0:0.8909:0.0	.	461;338	Q3KQV9;Q3KQV9-2	UAP1L_HUMAN;.	N	461;338	ENSP00000386935:D461N;ENSP00000353409:D338N	ENSP00000353409:D338N	D	+	1	0	UAP1L1	139096287	1.000000	0.71417	0.914000	0.36105	0.445000	0.32107	3.066000	0.50002	1.803000	0.52742	0.561000	0.74099	GAC		0.572	UAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055216.2	XM_038063		Missense_Mutation
TENM1	10178	genome.wustl.edu	37	X	123517988	123517988	+	Missense_Mutation	SNP	C	C	T	rs377058853		TCGA-25-1322-01	TCGA-25-1322-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-25-1322-01	TCGA-25-1322-10	g.chrX:123517988C>T	ENST00000371130.3	-	29	6835	c.6772G>A	c.(6772-6774)Gcg>Acg	p.A2258T	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.A2265T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2258					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A2260T(2)									GACTTACTCGCGACACGTCGC	0.458																																																2	Substitution - Missense(2)	ovary(1)|stomach(1)	X											98.0	94.0	95.0					X																	123517988		2203	4300	6503	123345669	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6772G>A	X.37:g.123517988C>T	ENSP00000360171:p.Ala2258Thr	Somatic		Capture	Illumina GAIIx	4	123345669	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077722	0.55753	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86030	-2.06;-2.03	5.66	4.74	0.60224	.	0.051235	0.85682	D	0.000000	D	0.83889	0.5352	L	0.28649	0.875	0.58432	D	0.999999	D;P;P	0.71674	0.998;0.9;0.868	P;B;B	0.56398	0.797;0.118;0.143	T	0.80870	-0.1189	10	0.21014	T	0.42	.	14.4108	0.67113	0.1479:0.8521:0.0:0.0	.	2264;2265;2258	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	2258;2265	ENSP00000360171:A2258T;ENSP00000403954:A2265T	ENSP00000360171:A2258T	A	-	1	0	ODZ1	123345669	0.995000	0.38212	0.988000	0.46212	0.989000	0.77384	3.100000	0.50275	2.356000	0.79943	0.600000	0.82982	GCG		0.458	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
