#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACAT2	39	hgsc.bcm.edu	37	6	160183960	160183960	+	Missense_Mutation	SNP	A	A	G	rs199953042		TCGA-25-1631-01	TCGA-25-1631-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr6:160183960A>G	ENST00000367048.4	+	2	1825	c.65A>G	c.(64-66)aAt>aGt	p.N22S	ACAT2_ENST00000541436.1_Missense_Mutation_p.N51S|SOD2_ENST00000546087.1_5'Flank|SOD2_ENST00000535372.1_5'Flank	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	22					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)	p.N22S(1)		breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GGTTCCTTCAATGGTGCCTTA	0.552													a|||	1	0.000199681	0.0	0.0	5008	,	,		20527	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6						G	SER/ASN	0,4406		0,0,2203	174.0	160.0	164.0		65	1.3	1.0	6		164	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ACAT2	NM_005891.2	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	22/398	160183960	1,13005	2203	4300	6503	160103950	SO:0001583	missense	39			AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.65A>G	6.37:g.160183960A>G	ENSP00000356015:p.Asn22Ser	Somatic		Capture	SOLID	Phase_III	160103950	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Missense_Mutation	SNP	ENST00000367048.4	37	CCDS5268.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	a	11.24	1.580528	0.28180	0.0	1.16E-4	ENSG00000120437	ENST00000367048;ENST00000541436	T;T	0.43294	0.95;0.95	5.12	1.33	0.21861	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.097704	0.64402	N	0.000002	T	0.19927	0.0479	L	0.60455	1.87	0.50813	D	0.999896	B;B	0.22541	0.071;0.023	B;B	0.15484	0.013;0.005	T	0.07751	-1.0756	10	0.54805	T	0.06	-4.6168	9.3492	0.38126	0.7923:0.0:0.2077:0.0	.	51;22	B7Z233;Q9BWD1	.;THIC_HUMAN	S	22;51	ENSP00000356015:N22S;ENSP00000437850:N51S	ENSP00000356015:N22S	N	+	2	0	ACAT2	160103950	1.000000	0.71417	0.991000	0.47740	0.119000	0.20118	5.719000	0.68462	0.058000	0.16222	-0.368000	0.07277	AAT		0.552	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042912.1	NM_005891		Missense_Mutation
AP1B1	162	hgsc.bcm.edu	37	22	29737638	29737638	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr22:29737638C>T	ENST00000405198.1	-	12	1679	c.1648G>A	c.(1648-1650)Gaa>Aaa	p.E550K	AP1B1_ENST00000415447.1_Missense_Mutation_p.E550K|AP1B1_ENST00000432560.2_Missense_Mutation_p.E550K|AP1B1_ENST00000356015.2_Missense_Mutation_p.E550K|AP1B1_ENST00000402502.1_Missense_Mutation_p.E550K|AP1B1_ENST00000317368.7_Missense_Mutation_p.E550K|AP1B1_ENST00000472057.1_5'Flank|AP1B1_ENST00000357586.2_Missense_Mutation_p.E550K			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	550					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.E550K(1)		endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCCGTCTCTTCAGAGATGAGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											126.0	97.0	107.0					22																	29737638		2203	4300	6503	28067638	SO:0001583	missense	162			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1648G>A	22.37:g.29737638C>T	ENSP00000384194:p.Glu550Lys	Somatic		Capture	SOLID	Phase_III	28067638	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	CCDS13855.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549052	0.86127	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447;ENST00000421126	T;T;T;T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66;2.66;2.66;2.66	5.66	5.66	0.87406	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30166	0.0756	M	0.79011	2.435	0.80722	D	1	P;B;B;D;P	0.53745	0.946;0.066;0.272;0.962;0.847	P;B;B;B;B	0.48982	0.597;0.009;0.034;0.31;0.424	T	0.02868	-1.1100	10	0.52906	T	0.07	-19.9823	19.3511	0.94387	0.0:1.0:0.0:0.0	.	103;550;550;550;550	B4DS79;F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;.;AP1B1_HUMAN;.	K	550	ENSP00000350199:E550K;ENSP00000348297:E550K;ENSP00000400065:E550K;ENSP00000384194:E550K;ENSP00000319361:E550K;ENSP00000386071:E550K;ENSP00000387612:E550K;ENSP00000400022:E550K	ENSP00000319361:E550K	E	-	1	0	AP1B1	28067638	1.000000	0.71417	0.712000	0.30502	0.957000	0.61999	7.818000	0.86416	2.665000	0.90641	0.655000	0.94253	GAA		0.597	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127		Missense_Mutation
BCL9L	283149	hgsc.bcm.edu	37	11	118771885	118771885	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1631-01	TCGA-25-1631-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr11:118771885T>A	ENST00000334801.3	-	6	3531	c.2567A>T	c.(2566-2568)tAc>tTc	p.Y856F	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	856					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.Y856F(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		CATGGCTTGGTAGGGTCCCTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	84.0	88.0					11																	118771885		2200	4295	6495	118277095	SO:0001583	missense	283149			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2567A>T	11.37:g.118771885T>A	ENSP00000335320:p.Tyr856Phe	Somatic		Capture	SOLID	Phase_III	118277095	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.88	1.476742	0.26511	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	D	0.83914	-1.78	5.11	3.99	0.46301	.	0.000000	0.39341	N	0.001394	T	0.65893	0.2735	N	0.19112	0.55	0.35046	D	0.760199	B;B	0.23650	0.089;0.053	B;B	0.21546	0.035;0.016	T	0.62642	-0.6811	10	0.06236	T	0.91	-9.5344	9.3857	0.38340	0.0:0.0857:0.0:0.9143	.	851;856	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	F	856;819;149;856;856	ENSP00000335320:Y856F	ENSP00000335320:Y856F	Y	-	2	0	BCL9L	118277095	0.994000	0.37717	1.000000	0.80357	0.882000	0.50991	1.274000	0.33132	1.911000	0.55334	0.533000	0.62120	TAC		0.602	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557		Missense_Mutation
BMP5	653	hgsc.bcm.edu	37	6	55739403	55739403	+	Silent	SNP	G	G	T			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr6:55739403G>T	ENST00000370830.3	-	1	959	c.261C>A	c.(259-261)gcC>gcA	p.A87A	BMP5_ENST00000446683.2_Silent_p.A87A	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	87					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.A87A(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CATTGGTCATGGCATTGTAGA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	6											163.0	152.0	156.0					6																	55739403		2203	4300	6503	55847362	SO:0001819	synonymous_variant	653				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.261C>A	6.37:g.55739403G>T		Somatic		Capture	SOLID	Phase_III	55847362	B4E0Y4|Q9H547|Q9NTM5	Silent	SNP	ENST00000370830.3	37	CCDS4958.1	SNP	47	Baylor																																																																																				0.488	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1			Silent
RRNAD1	51093	hgsc.bcm.edu	37	1	156706497	156706497	+	Silent	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr1:156706497G>A	ENST00000368216.4	+	8	2010	c.1380G>A	c.(1378-1380)aaG>aaA	p.K460K	RRNAD1_ENST00000476229.1_3'UTR|MRPL24_ENST00000478899.1_5'Flank|RRNAD1_ENST00000481920.1_3'UTR|RRNAD1_ENST00000368218.4_3'UTR	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	460						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						TGGCCACCAAGATGCCCCTGG	0.537																																																0			1											79.0	73.0	75.0					1																	156706497		2203	4300	6503	154973121	SO:0001819	synonymous_variant	51093			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1380G>A	1.37:g.156706497G>A		Somatic		Capture	SOLID	Phase_III	154973121	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Silent	SNP	ENST00000368216.4	37	CCDS1154.1	SNP	33	Baylor																																																																																				0.537	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1	NM_015997		Silent
CATSPER1	117144	hgsc.bcm.edu	37	11	65788337	65788337	+	Silent	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr11:65788337G>A	ENST00000312106.5	-	6	2009	c.1872C>T	c.(1870-1872)ttC>ttT	p.F624F		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	624					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.F624F(1)		breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TGAGCAAGGTGAAGAGGGTGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	11											125.0	80.0	95.0					11																	65788337		2201	4296	6497	65544913	SO:0001819	synonymous_variant	117144			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1872C>T	11.37:g.65788337G>A		Somatic		Capture	SOLID	Phase_III	65544913	Q96P76	Silent	SNP	ENST00000312106.5	37	CCDS8127.1	SNP	45	Baylor																																																																																				0.627	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		Silent
CCL7	6354	hgsc.bcm.edu	37	17	32598200	32598200	+	Missense_Mutation	SNP	T	T	A	rs143597570	byFrequency	TCGA-25-1631-01	TCGA-25-1631-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr17:32598200T>A	ENST00000378569.2	+	2	182	c.112T>A	c.(112-114)Ttt>Att	p.F38I	CCL7_ENST00000394630.3_Intron|CCL7_ENST00000394627.1_Missense_Mutation_p.D55E|CCL7_ENST00000200307.4_Missense_Mutation_p.F48I	NM_006273.2	NP_006264.2	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7	38					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to ethanol (GO:0071361)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|positive regulation of cell migration (GO:0030335)|positive regulation of natural killer cell chemotaxis (GO:2000503)|regulation of cell shape (GO:0008360)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)	p.F38I(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CTGCTACAGATTTATCAATAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	17											88.0	88.0	88.0					17																	32598200		2203	4300	6503	29622313	SO:0001583	missense	6354			AF043338	CCDS11278.1	17q11.2-q12	2013-02-25	2002-08-22	2002-08-23	ENSG00000108688	ENSG00000108688		"""Chemokine ligands"", ""Endogenous ligands"""	10634	protein-coding gene	gene with protein product	"""monocyte chemoattractant protein 3"", ""monocyte chemotactic protein 3"""	158106	"""small inducible cytokine A7 (monocyte chemotactic protein 3)"""	SCYA6, SCYA7		8461011	Standard	NM_006273		Approved	MCP-3, NC28, FIC, MARC, MCP3	uc002hhz.4	P80098	OTTHUMG00000132889	ENST00000378569.2:c.112T>A	17.37:g.32598200T>A	ENSP00000367832:p.Phe38Ile	Somatic		Capture	SOLID	Phase_III	29622313	Q569J6	Missense_Mutation	SNP	ENST00000378569.2	37	CCDS11278.1	SNP	52	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.581|9.581	1.123569|1.123569	0.20959|0.20959	.|.	.|.	ENSG00000108688|ENSG00000108688	ENST00000394627|ENST00000378569;ENST00000200307	.|.	.|.	.|.	4.46|4.46	-0.708|-0.708	0.11241|0.11241	.|CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	.|0.132311	.|0.34906	.|N	.|0.003594	T|T	0.24044|0.24044	0.0582|0.0582	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.24258	.|0.1	.|B	.|0.25405	.|0.06	T|T	0.09751|0.09751	-1.0660|-1.0660	5|8	0.87932|0.46703	D|T	0|0.11	.|.	1.9327|1.9327	0.03331|0.03331	0.1509:0.1078:0.407:0.3343|0.1509:0.1078:0.407:0.3343	.|.	.|38	.|P80098	.|CCL7_HUMAN	E|I	65|48;38	.|.	ENSP00000378124:D65E|ENSP00000200307:F38I	D|F	+|+	3|1	2|0	CCL7|CCL7	29622313|29622313	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	-0.763000|-0.763000	0.04740|0.04740	-0.229000|-0.229000	0.09854|0.09854	0.533000|0.533000	0.62120|0.62120	GAT|TTT		0.443	CCL7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256386.2	NM_006273		Missense_Mutation
CREBBP	1387	hgsc.bcm.edu	37	16	3790512	3790512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr16:3790512G>A	ENST00000262367.5	-	24	4830	c.4021C>T	c.(4021-4023)Cga>Tga	p.R1341*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.R1303*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1341	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R1341*(3)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTGTTCACTCGGTCTTCCAAG	0.567			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	3	Substitution - Nonsense(3)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	16											70.0	72.0	71.0					16																	3790512		2197	4300	6497	3730513	SO:0001587	stop_gained	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4021C>T	16.37:g.3790512G>A	ENSP00000262367:p.Arg1341*	Somatic		Capture	SOLID	Phase_III	3730513	D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	g	18.35	3.604790	0.66445	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.05	1.64	0.23874	.	0.094335	0.44483	D	0.000453	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5698	11.1732	0.48584	0.0:0.1045:0.5694:0.3261	.	.	.	.	X	1341;1371;1303	.	ENSP00000262367:R1341X	R	-	1	2	CREBBP	3730513	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.982000	0.40638	0.582000	0.29556	0.555000	0.69702	CGA		0.567	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		Nonsense_Mutation
CYLC1	1538	hgsc.bcm.edu	37	X	83128420	83128420	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chrX:83128420C>A	ENST00000329312.4	+	4	741	c.704C>A	c.(703-705)tCa>tAa	p.S235*		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	235					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S234*(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GATCCCATATCAGAGATTTGC	0.333																																																1	Substitution - Nonsense(1)	ovary(1)	X											34.0	31.0	32.0					X																	83128420		2192	4289	6481	83015076	SO:0001587	stop_gained	1538			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.704C>A	X.37:g.83128420C>A	ENSP00000331556:p.Ser235*	Somatic		Capture	SOLID	Phase_III	83015076	A0AVQ8|Q5JQQ9	Nonsense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	c	15.00	2.704072	0.48412	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	.	.	.	4.13	0.2	0.15181	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5689	6.301	0.21113	0.0:0.4652:0.0:0.5348	.	.	.	.	X	235	.	ENSP00000331556:S235X	S	+	2	0	CYLC1	83015076	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.091000	0.11146	-0.104000	0.12154	-0.305000	0.09177	TCA		0.333	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		Nonsense_Mutation
DDHD1	80821	hgsc.bcm.edu	37	14	53525224	53525225	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-25-1631-01	TCGA-25-1631-10	GT	GT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr14:53525224_53525225delGT	ENST00000323669.5	-	9	1961_1962	c.1962_1963delAC	c.(1960-1965)ttactafs	p.LL654fs	DDHD1_ENST00000357758.3_Frame_Shift_Del_p.LL654fs|DDHD1_ENST00000395606.1_Frame_Shift_Del_p.LL661fs	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	654	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.L654fs*13(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					AAAATATTTAGTAACCGGTTAC	0.406																																																1	Deletion - Frameshift(1)	ovary(1)	14																																								52594975	SO:0001589	frameshift_variant	80821			AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.1962_1963delAC	14.37:g.53525224_53525225delGT	ENSP00000327104:p.Leu654fs	Somatic		Capture	SOLID	Phase_III	52594974	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Frame_Shift_Del	DEL	ENST00000323669.5	37	CCDS53895.1	DEL	36	Baylor																																																																																				0.406	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1			Frame_Shift_Del
FASTKD1	79675	hgsc.bcm.edu	37	2	170394536	170394536	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1631-01	TCGA-25-1631-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr2:170394536T>G	ENST00000453153.2	-	11	2407	c.2061A>C	c.(2059-2061)caA>caC	p.Q687H	FASTKD1_ENST00000495505.1_5'UTR|FASTKD1_ENST00000453929.2_Intron	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	687					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.Q687H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						TATTATATTGTTGACAGAAGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											122.0	135.0	131.0					2																	170394536		2203	4300	6503	170102782	SO:0001583	missense	79675			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.2061A>C	2.37:g.170394536T>G	ENSP00000400513:p.Gln687His	Somatic		Capture	SOLID	Phase_III	170102782	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	CCDS33318.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.73	3.460497	0.63401	.	.	ENSG00000138399	ENST00000453153	T	0.52983	0.64	5.02	-2.68	0.06041	FAST kinase-like protein, subdomain 2 (1);	0.434355	0.27056	N	0.021148	T	0.62307	0.2417	M	0.76002	2.32	0.80722	D	1	D	0.71674	0.998	D	0.69307	0.963	T	0.66268	-0.5966	10	0.59425	D	0.04	-14.6148	13.8544	0.63517	0.0:0.6547:0.0:0.3453	.	687	Q53R41	FAKD1_HUMAN	H	687	ENSP00000400513:Q687H	ENSP00000400513:Q687H	Q	-	3	2	FASTKD1	170102782	0.984000	0.35163	0.856000	0.33681	0.979000	0.70002	0.134000	0.15932	-0.378000	0.07918	0.460000	0.39030	CAA		0.333	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622		Missense_Mutation
GPR176	11245	hgsc.bcm.edu	37	15	40093373	40093373	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr15:40093373C>A	ENST00000561100.1	-	3	2373	c.1508G>T	c.(1507-1509)aGa>aTa	p.R503I	GPR176_ENST00000299092.3_Missense_Mutation_p.R502I|RP11-37C7.1_ENST00000558616.1_RNA|GPR176_ENST00000543580.1_Missense_Mutation_p.R458I|GPR176_ENST00000560729.1_5'Flank	NM_007223.1	NP_009154.1	Q14439	GP176_HUMAN	G protein-coupled receptor 176	503					G-protein coupled receptor signaling pathway (GO:0007186)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.R503I(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)	23		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		TTTATTGTTTCTGCTCATCTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	15											122.0	110.0	114.0					15																	40093373		2203	4300	6503	37880665	SO:0001583	missense	11245			BC067106	CCDS10051.1, CCDS61588.1, CCDS61589.1	15q14-q15.1	2012-08-21			ENSG00000166073	ENSG00000166073		"""GPCR / Class A : Orphans"""	32370	protein-coding gene	gene with protein product		612183				7893747	Standard	NM_007223		Approved	Gm1012	uc010uck.2	Q14439	OTTHUMG00000129873	ENST00000561100.1:c.1508G>T	15.37:g.40093373C>A	ENSP00000453076:p.Arg503Ile	Somatic		Capture	SOLID	Phase_III	37880665	Q6NXF6	Missense_Mutation	SNP	ENST00000561100.1	37	CCDS10051.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.4	4.735133	0.89482	.	.	ENSG00000166073	ENST00000299092;ENST00000543580	D	0.85411	-1.98	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90943	0.7153	L	0.48642	1.525	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.90538	0.4500	10	0.87932	D	0	-16.1377	20.8794	0.99867	0.0:1.0:0.0:0.0	.	503	Q14439	GP176_HUMAN	I	503;458	ENSP00000439361:R458I	ENSP00000299092:R503I	R	-	2	0	GPR176	37880665	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.802000	0.85969	2.941000	0.99782	0.655000	0.94253	AGA		0.512	GPR176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252117.2	NM_007223		Missense_Mutation
HCN4	10021	hgsc.bcm.edu	37	15	73617477	73617477	+	Silent	SNP	C	C	T	rs371484779		TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr15:73617477C>T	ENST00000261917.3	-	6	2790	c.1797G>A	c.(1795-1797)gcG>gcA	p.A599A		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	599					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.A599A(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		AGTTGGGGTCCGCATTGGCAA	0.567																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	15						C		0,4396		0,0,2198	138.0	122.0	128.0		1797	-5.8	0.9	15		128	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	HCN4	NM_005477.2		0,1,6494	TT,TC,CC		0.0116,0.0,0.0077		599/1204	73617477	1,12989	2198	4297	6495	71404530	SO:0001819	synonymous_variant	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1797G>A	15.37:g.73617477C>T		Somatic		Capture	SOLID	Phase_III	71404530	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1	SNP	23	Baylor																																																																																				0.567	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		Silent
HPGD	3248	hgsc.bcm.edu	37	4	175439136	175439136	+	Silent	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr4:175439136G>A	ENST00000296522.6	-	3	756	c.310C>T	c.(310-312)Ctg>Ttg	p.L104L	HPGD_ENST00000504433.1_Silent_p.L104L|HPGD_ENST00000541923.1_Intron|HPGD_ENST00000422112.2_Intron|HPGD_ENST00000296521.7_Silent_p.L104L|HPGD_ENST00000510901.1_5'UTR|HPGD_ENST00000542498.1_Silent_p.L104L	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	104					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		TTAATTTGCAGAGTTTTTTCC	0.299																																																0			4											62.0	60.0	60.0					4																	175439136		2200	4292	6492	175675711	SO:0001819	synonymous_variant	3248				CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.310C>T	4.37:g.175439136G>A		Somatic		Capture	SOLID	Phase_III	175675711	B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Silent	SNP	ENST00000296522.6	37	CCDS3821.1	SNP	33	Baylor																																																																																				0.299	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362228.3			Silent
LPAR3	23566	hgsc.bcm.edu	37	1	85279814	85279814	+	Silent	SNP	C	C	T			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr1:85279814C>T	ENST00000440886.1	-	2	815	c.777G>A	c.(775-777)ctG>ctA	p.L259L	LPAR3_ENST00000370611.3_Silent_p.L259L|LPAR3_ENST00000491034.1_5'UTR			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	259					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)	p.L259L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						CGTCGAGGAGCAGAACCACCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	1											61.0	58.0	59.0					1																	85279814		2203	4300	6503	85052402	SO:0001819	synonymous_variant	23566			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.777G>A	1.37:g.85279814C>T		Somatic		Capture	SOLID	Phase_III	85052402	A0AVA3	Silent	SNP	ENST00000440886.1	37	CCDS700.1	SNP	25	Baylor																																																																																				0.577	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152		Silent
MAS1L	116511	hgsc.bcm.edu	37	6	29455352	29455352	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr6:29455352C>A	ENST00000377127.3	-	1	386	c.328G>T	c.(328-330)Gta>Tta	p.V110L		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	110					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V110L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						AGGATGTATACCATGTAGGGA	0.527																																					NSCLC(153;755 1987 3859 11251 32945)											1	Substitution - Missense(1)	ovary(1)	6											72.0	66.0	68.0					6																	29455352		2203	4300	6503	29563331	SO:0001583	missense	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.328G>T	6.37:g.29455352C>A	ENSP00000366331:p.Val110Leu	Somatic		Capture	SOLID	Phase_III	29563331	Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	37	CCDS4661.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261657	0.39995	.	.	ENSG00000204687	ENST00000377127	T	0.71579	-0.58	2.6	0.657	0.17850	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.58495	0.2126	L	0.45285	1.41	0.09310	N	1	P	0.45474	0.859	P	0.57620	0.824	T	0.50110	-0.8866	9	0.66056	D	0.02	.	5.2885	0.15714	0.0:0.645:0.2167:0.1383	.	110	P35410	MAS1L_HUMAN	L	110	ENSP00000366331:V110L	ENSP00000366331:V110L	V	-	1	0	MAS1L	29563331	0.003000	0.15002	0.006000	0.13384	0.001000	0.01503	0.289000	0.18957	0.426000	0.26116	-0.261000	0.10672	GTA		0.527	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967		Missense_Mutation
MCM3AP	8888	hgsc.bcm.edu	37	21	47655329	47655329	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr21:47655329C>T	ENST00000397708.1	-	29	6050	c.5796G>A	c.(5794-5796)atG>atA	p.M1932I	MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000420074.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.M1932I|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000421927.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1932					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.M1932I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GTTGCTCCCTCATCATGTCAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	21											84.0	65.0	71.0					21																	47655329		2203	4300	6503	46479757	SO:0001583	missense	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5796G>A	21.37:g.47655329C>T	ENSP00000380820:p.Met1932Ile	Somatic		Capture	SOLID	Phase_III	46479757	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.394	1.076329	0.20227	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03242	4.0;4.0	4.94	-6.1	0.02138	.	1.746160	0.02579	N	0.098698	T	0.01592	0.0051	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46762	-0.9168	10	0.49607	T;T	0.09;0.09	0.0218	1.3031	0.02083	0.4438:0.2511:0.1117:0.1933	.	1932;427	O60318;B3KT88	MCM3A_HUMAN;.	I	1932;1932;427	ENSP00000380820:M1932I;ENSP00000291688:M1932I	ENSP00000291688:M1932I;ENSP00000291688:M1932I	M	-	3	0	MCM3AP	46479757	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.161000	0.16481	-0.337000	0.08426	-1.369000	0.01192	ATG		0.458	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		Missense_Mutation
MRPS22	56945	hgsc.bcm.edu	37	3	139069895	139069895	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1631-01	TCGA-25-1631-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr3:139069895A>G	ENST00000495075.1	+	7	1157	c.725A>G	c.(724-726)tAt>tGt	p.Y242C	MRPS22_ENST00000478464.1_Missense_Mutation_p.Y201C|RP11-219D15.3_ENST00000608472.1_RNA|MRPS22_ENST00000310776.4_Missense_Mutation_p.Y242C|MRPS22_ENST00000465056.1_Missense_Mutation_p.Y241C			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	242						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)	p.Y242C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						TCCACAGAGTATATCAAGGTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											175.0	159.0	165.0					3																	139069895		2203	4300	6503	140552585	SO:0001583	missense	56945			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.725A>G	3.37:g.139069895A>G	ENSP00000418008:p.Tyr242Cys	Somatic		Capture	SOLID	Phase_III	140552585	Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	37	CCDS3107.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.24	3.067268	0.55539	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000478464	D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22	5.59	5.59	0.84812	.	0.111088	0.64402	N	0.000005	D	0.93766	0.8007	M	0.84326	2.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.992;0.994;0.997	D	0.94613	0.7806	10	0.87932	D	0	-5.5059	15.7483	0.77965	1.0:0.0:0.0:0.0	.	201;241;242	G5E9W7;G5E9V5;P82650	.;.;RT22_HUMAN	C	242;242;241;201	ENSP00000418008:Y242C;ENSP00000310785:Y242C;ENSP00000418233:Y241C;ENSP00000419303:Y201C	ENSP00000310785:Y242C	Y	+	2	0	MRPS22	140552585	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	6.015000	0.70791	2.125000	0.65367	0.533000	0.62120	TAT		0.368	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1	NM_020191		Missense_Mutation
MYH2	4620	hgsc.bcm.edu	37	17	10435046	10435046	+	Silent	SNP	G	G	A	rs142129307	byFrequency	TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr17:10435046G>A	ENST00000245503.5	-	22	2985	c.2601C>T	c.(2599-2601)gaC>gaT	p.D867D	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Silent_p.D867D|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	867					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.D867D(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TGGCAAGTTCGTCTTTAATTT	0.428													g|||	2	0.000399361	0.0	0.0	5008	,	,		22173	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17						G	,	1,4405	2.1+/-5.4	0,1,2202	133.0	130.0	131.0		2601,2601	-9.4	0.0	17	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MYH2	NM_001100112.1,NM_017534.5	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	867/1942,867/1942	10435046	2,13004	2203	4300	6503	10375771	SO:0001819	synonymous_variant	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2601C>T	17.37:g.10435046G>A		Somatic		Capture	SOLID	Phase_III	10375771	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	CCDS11156.1	SNP	40	Baylor																																																																																				0.428	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		Silent
NHS	4810	hgsc.bcm.edu	37	X	17750349	17750349	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chrX:17750349C>T	ENST00000380060.3	+	8	4996	c.4658C>T	c.(4657-4659)tCc>tTc	p.S1553F	NHS_ENST00000398097.3_Missense_Mutation_p.S1397F	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1574					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.S1553F(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					GAGGCATTGTCCCCACTCTCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	X											104.0	88.0	94.0					X																	17750349		2203	4300	6503	17660270	SO:0001583	missense	4810				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.4658C>T	X.37:g.17750349C>T	ENSP00000369400:p.Ser1553Phe	Somatic		Capture	SOLID	Phase_III	17660270	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349327	0.61183	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.50548	0.74;0.74	5.69	5.69	0.88448	.	0.250624	0.42053	D	0.000771	T	0.66277	0.2773	M	0.62723	1.935	0.25264	N	0.989574	D;D;D;D	0.71674	0.958;0.958;0.958;0.998	P;P;P;D	0.63957	0.584;0.584;0.584;0.92	T	0.61865	-0.6975	10	0.72032	D	0.01	-14.2251	19.0571	0.93070	0.0:1.0:0.0:0.0	.	1574;1395;1397;1553	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	F	1553;1397;1395	ENSP00000369400:S1553F;ENSP00000381170:S1397F	ENSP00000369397:S1395F	S	+	2	0	NHS	17660270	0.997000	0.39634	1.000000	0.80357	0.947000	0.59692	4.230000	0.58632	2.536000	0.85505	0.600000	0.82982	TCC		0.587	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270		Missense_Mutation
NKAPL	222698	hgsc.bcm.edu	37	6	28228152	28228152	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr6:28228152G>A	ENST00000343684.3	+	1	1055	c.1003G>A	c.(1003-1005)Gaa>Aaa	p.E335K	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	335								p.E335K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						CGGTTCTTTTGAATGCTCAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	6											183.0	178.0	180.0					6																	28228152		2203	4300	6503	28336131	SO:0001583	missense	222698			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.1003G>A	6.37:g.28228152G>A	ENSP00000345716:p.Glu335Lys	Somatic		Capture	SOLID	Phase_III	28336131	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	37	CCDS34353.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822845	0.90873	.	.	ENSG00000189134	ENST00000343684	T	0.54675	0.56	4.74	4.74	0.60224	.	0.049529	0.85682	D	0.000000	T	0.70842	0.3270	M	0.89163	3.01	0.80722	D	1	P	0.52061	0.95	D	0.64042	0.921	T	0.76580	-0.2907	10	0.87932	D	0	-19.7265	15.6397	0.76989	0.0:0.0:1.0:0.0	.	335	Q5M9Q1	NKAPL_HUMAN	K	335	ENSP00000345716:E335K	ENSP00000345716:E335K	E	+	1	0	NKAPL	28336131	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.545000	0.98095	2.635000	0.89317	0.655000	0.94253	GAA		0.488	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1			Missense_Mutation
OPTN	10133	hgsc.bcm.edu	37	10	13166082	13166082	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr10:13166082G>C	ENST00000378748.3	+	10	1332	c.970G>C	c.(970-972)Gag>Cag	p.E324Q	OPTN_ENST00000263036.5_Missense_Mutation_p.E324Q|OPTN_ENST00000378764.2_Missense_Mutation_p.E318Q|OPTN_ENST00000378757.2_Missense_Mutation_p.E324Q|OPTN_ENST00000378747.3_Missense_Mutation_p.E324Q|OPTN_ENST00000378752.3_Missense_Mutation_p.E318Q	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	324					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)	p.E324Q(2)		breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CAGCAAAGCTGAGCTAATGAA	0.373																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	10											48.0	48.0	48.0					10																	13166082		2203	4300	6503	13206088	SO:0001583	missense	10133			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.970G>C	10.37:g.13166082G>C	ENSP00000368022:p.Glu324Gln	Somatic		Capture	SOLID	Phase_III	13206088	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252437	0.59212	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	6.17	6.17	0.99709	.	0.089808	0.85682	D	0.000000	D	0.93145	0.7817	M	0.70275	2.135	0.47819	D	0.999521	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.972	D	0.91430	0.5165	10	0.35671	T	0.21	-18.4797	12.9056	0.58149	0.0745:0.0:0.9255:0.0	.	318;324	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	Q	324;318;324;318;324;324	ENSP00000263036:E324Q;ENSP00000368040:E318Q;ENSP00000368032:E324Q;ENSP00000368027:E318Q;ENSP00000368022:E324Q;ENSP00000368021:E324Q	ENSP00000263036:E324Q	E	+	1	0	OPTN	13206088	1.000000	0.71417	0.996000	0.52242	0.274000	0.26718	6.074000	0.71253	2.941000	0.99782	0.655000	0.94253	GAG		0.373	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980		Missense_Mutation
OR10H2	26538	hgsc.bcm.edu	37	19	15839078	15839078	+	Silent	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr19:15839078G>A	ENST00000305899.3	+	1	245	c.225G>A	c.(223-225)gtG>gtA	p.V75V		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V75V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TCTACACCGTGGCCATCATCC	0.622																																																1	Substitution - coding silent(1)	ovary(1)	19											153.0	125.0	135.0					19																	15839078		2203	4300	6503	15700078	SO:0001819	synonymous_variant	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.225G>A	19.37:g.15839078G>A		Somatic		Capture	SOLID	Phase_III	15700078	Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	CCDS12333.1	SNP	47	Baylor																																																																																				0.622	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1			Silent
OR2B11	127623	hgsc.bcm.edu	37	1	247615261	247615261	+	Frame_Shift_Del	DEL	G	G	-	rs35305980|rs397733455	byFrequency	TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr1:247615261delG	ENST00000318749.6	-	1	47	c.24delC	c.(22-24)ttcfs	p.F8fs		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L9fs*1(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGTCCCCTAAGAAGCTATGGT	0.478																																																1	Deletion - Frameshift(1)	ovary(1)	1											103.0	116.0	112.0					1																	247615261		2203	4300	6503	245681884	SO:0001589	frameshift_variant	127623				CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.24delC	1.37:g.247615261delG	ENSP00000325682:p.Phe8fs	Somatic		Capture	SOLID	Phase_III	245681884	B2RP03	Frame_Shift_Del	DEL	ENST00000318749.6	37	CCDS31090.1	DEL	33	Baylor																																																																																				0.478	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		Frame_Shift_Del
PKHD1	5314	hgsc.bcm.edu	37	6	51732836	51732836	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr6:51732836G>A	ENST00000371117.3	-	48	7833	c.7558C>T	c.(7558-7560)Cat>Tat	p.H2520Y	PKHD1_ENST00000340994.4_Missense_Mutation_p.H2520Y	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2520					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.H2520Y(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ATTGCTGCATGAGGAAATGGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											72.0	69.0	70.0					6																	51732836		2203	4299	6502	51840795	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7558C>T	6.37:g.51732836G>A	ENSP00000360158:p.His2520Tyr	Somatic		Capture	SOLID	Phase_III	51840795	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566386	0.65651	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.90261	-2.46;-2.64	5.67	4.8	0.61643	.	0.068571	0.64402	N	0.000011	D	0.94105	0.8110	M	0.82630	2.6	0.34735	D	0.730151	D;D;D	0.89917	0.999;0.978;1.0	D;D;D	0.75484	0.986;0.933;0.963	D	0.95365	0.8459	10	0.87932	D	0	.	13.8751	0.63648	0.0732:0.0:0.9268:0.0	.	2520;2520;2520	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	Y	2520	ENSP00000360158:H2520Y;ENSP00000341097:H2520Y	ENSP00000341097:H2520Y	H	-	1	0	PKHD1	51840795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.758000	0.62220	1.402000	0.46780	0.591000	0.81541	CAT		0.383	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Missense_Mutation
SLC12A3	6559	hgsc.bcm.edu	37	16	56926038	56926038	+	Missense_Mutation	SNP	C	C	A	rs368730391		TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr16:56926038C>A	ENST00000563236.1	+	20	2437	c.2412C>A	c.(2410-2412)agC>agA	p.S804R	SLC12A3_ENST00000438926.2_Missense_Mutation_p.S804R|SLC12A3_ENST00000566786.1_Missense_Mutation_p.S803R|SLC12A3_ENST00000262502.5_Missense_Mutation_p.S803R			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	804					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)	p.S804R(1)		breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	AGGAAGCCAGCGCCAGAGGTG	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											118.0	113.0	115.0					16																	56926038		2198	4300	6498	55483539	SO:0001583	missense	6559				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2412C>A	16.37:g.56926038C>A	ENSP00000456149:p.Ser804Arg	Somatic		Capture	SOLID	Phase_III	55483539	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	CCDS58464.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.660	1.143772	0.21205	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.0	-8.88	0.00789	.	1.003210	0.08023	N	0.992339	T	0.18299	0.0439	N	0.25245	0.725	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.10450	0.005;0.001;0.002	T	0.16689	-1.0394	9	0.16896	T	0.51	.	2.9024	0.05709	0.2359:0.2058:0.0753:0.483	.	803;804;804	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	R	803;804	.	ENSP00000262502:S804R	S	+	3	2	SLC12A3	55483539	0.000000	0.05858	0.003000	0.11579	0.238000	0.25445	-1.107000	0.03316	-1.820000	0.01215	-0.812000	0.03155	AGC		0.612	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1			Missense_Mutation
SLC30A8	169026	hgsc.bcm.edu	37	8	118170071	118170071	+	Missense_Mutation	SNP	C	C	T	rs141202988		TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr8:118170071C>T	ENST00000456015.2	+	4	560	c.560C>T	c.(559-561)gCg>gTg	p.A187V	SLC30A8_ENST00000519688.1_Missense_Mutation_p.A138V|SLC30A8_ENST00000427715.2_Missense_Mutation_p.A138V|SLC30A8_ENST00000521243.1_Missense_Mutation_p.A138V	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	187					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.A187V(1)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TGCGCAGTGGCGGCCAACATT	0.517																																					Ovarian(162;1202 1922 6011 16223 52092)											1	Substitution - Missense(1)	ovary(1)	8						C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	179.0	149.0	159.0		413,413,413,413,560	2.1	1.0	8	dbSNP_134	159	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense,missense,missense,missense	SLC30A8	NM_001172811.1,NM_001172813.1,NM_001172814.1,NM_001172815.1,NM_173851.2	64,64,64,64,64	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign,benign,benign	138/321,138/321,138/321,138/321,187/370	118170071	3,13003	2203	4300	6503	118239252	SO:0001583	missense	169026				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.560C>T	8.37:g.118170071C>T	ENSP00000415011:p.Ala187Val	Somatic		Capture	SOLID	Phase_III	118239252	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	37	CCDS6322.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.744	-0.775314	0.02951	0.0	3.49E-4	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.76	2.11	0.27256	.	0.832250	0.11028	N	0.607612	T	0.34135	0.0887	N	0.21240	0.645	0.25532	N	0.987267	B	0.06786	0.001	B	0.09377	0.004	T	0.29212	-1.0019	10	0.05620	T	0.96	0.941	4.8273	0.13423	0.0:0.2227:0.135:0.6423	.	187	Q8IWU4	ZNT8_HUMAN	V	138;138;138;187	ENSP00000428545:A138V;ENSP00000407505:A138V;ENSP00000431069:A138V;ENSP00000415011:A187V	ENSP00000407505:A138V	A	+	2	0	SLC30A8	118239252	0.389000	0.25205	0.993000	0.49108	0.213000	0.24496	1.004000	0.29822	0.101000	0.17610	0.650000	0.86243	GCG		0.517	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851		Missense_Mutation
STC2	8614	hgsc.bcm.edu	37	5	172755131	172755131	+	Silent	SNP	C	C	G			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr5:172755131C>G	ENST00000265087.4	-	1	1375	c.66G>C	c.(64-66)gcG>gcC	p.A22A		NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	22					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CGGTCCCCCGCGCCGGGTCAA	0.632																																																0			5											96.0	100.0	99.0					5																	172755131		2203	4300	6503	172687737	SO:0001819	synonymous_variant	8614			AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.66G>C	5.37:g.172755131C>G		Somatic		Capture	SOLID	Phase_III	172687737		Silent	SNP	ENST00000265087.4	37	CCDS4388.1	SNP	27	Baylor																																																																																				0.632	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714		Silent
TNFAIP3	7128	hgsc.bcm.edu	37	6	138202336	138202336	+	Silent	SNP	G	G	A			TCGA-25-1631-01	TCGA-25-1631-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr6:138202336G>A	ENST00000237289.4	+	9	2319	c.2253G>A	c.(2251-2253)gaG>gaA	p.E751E		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	751	Interaction with TNIP1. {ECO:0000250}.|Required for lysosomal localization and for TRAF2 lysosomal degradation.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		ACCGGGGTGAGCCTGCCCCCG	0.642			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	6											43.0	52.0	49.0					6																	138202336		2203	4300	6503	138244029	SO:0001819	synonymous_variant	7128			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.2253G>A	6.37:g.138202336G>A		Somatic		Capture	SOLID	Phase_III	138244029	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Silent	SNP	ENST00000237289.4	37	CCDS5187.1	SNP	34	Baylor																																																																																				0.642	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			Silent
TP53	7157	hgsc.bcm.edu	37	17	7579311	7579311	+	Splice_Site	SNP	C	C	A			TCGA-25-1631-01	TCGA-25-1631-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr17:7579311C>A	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	17	GRCh37	CS951538	TP53	S							66.0	61.0	63.0					17																	7579311		2203	4300	6503	7520036	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579311C>A		Somatic		Capture	SOLID	Phase_III	7520036	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954926	0.73902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6586	0.68852	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520036	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.208000	0.72165	2.403000	0.81681	0.655000	0.94253	.		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
ZFYVE9	9372	hgsc.bcm.edu	37	1	52798516	52798516	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1631-01	TCGA-25-1631-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-25-1631-01	TCGA-25-1631-10	g.chr1:52798516A>T	ENST00000371591.1	+	13	3646	c.3515A>T	c.(3514-3516)cAt>cTt	p.H1172L	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.H1172L|ZFYVE9_ENST00000469134.1_3'UTR|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.H1113L	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1172					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)	p.H1172L(1)		breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GCAGACTCTCATCTTGTGTGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	103.0	108.0					1																	52798516		2203	4300	6503	52571104	SO:0001583	missense	9372			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3515A>T	1.37:g.52798516A>T	ENSP00000360647:p.His1172Leu	Somatic		Capture	SOLID	Phase_III	52571104	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611379	0.87258	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.45668	0.98;0.89;0.89	4.59	4.59	0.56863	Domain of unknown function DUF3480 (1);	0.000000	0.85682	D	0.000000	T	0.65739	0.2720	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.973;0.998	T	0.71510	-0.4571	10	0.72032	D	0.01	.	14.1308	0.65253	1.0:0.0:0.0:0.0	.	1113;1172	O95405-2;O95405	.;ZFYV9_HUMAN	L	1113;1172;1172	ENSP00000349737:H1113L;ENSP00000287727:H1172L;ENSP00000360647:H1172L	ENSP00000287727:H1172L	H	+	2	0	ZFYVE9	52571104	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	8.922000	0.92789	1.944000	0.56390	0.455000	0.32223	CAT		0.433	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324		Missense_Mutation
