#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PRDM16	63976	broad.mit.edu	37	1	3328714	3328714	+	Silent	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr1:3328714C>T	ENST00000270722.5	+	9	2002	c.1953C>T	c.(1951-1953)ggC>ggT	p.G651G	PRDM16_ENST00000511072.1_Silent_p.G652G|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Silent_p.G651G|PRDM16_ENST00000442529.2_Silent_p.G651G|PRDM16_ENST00000378398.3_Silent_p.G652G|PRDM16_ENST00000514189.1_Silent_p.G652G|PRDM16_ENST00000441472.2_Silent_p.G651G			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	651					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)	p.G651G(1)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGTTTGGGGGCGGCTTGGCGC	0.687			T	EVI1	"""MDS, AML"""																																		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	1	Substitution - coding silent(1)	ovary(1)	1											29.0	39.0	36.0					1																	3328714		1956	4118	6074	3318574	SO:0001819	synonymous_variant	63976			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1953C>T	1.37:g.3328714C>T		Unknown		x	x	x	3318574	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	ENST00000270722.5	37	CCDS41236.2	SNP	27	Broad																																																																																				0.687	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114		Silent
HEYL	26508	broad.mit.edu	37	1	40105268	40105268	+	Silent	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr1:40105268G>A	ENST00000372852.3	-	1	349	c.30C>T	c.(28-30)tcC>tcT	p.S10S		NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	10					atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.S10S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ACTCCCCGTCGGAGCCGCTCG	0.731																																																1	Substitution - coding silent(1)	ovary(1)	1											9.0	10.0	10.0					1																	40105268		2171	4271	6442	39877855	SO:0001819	synonymous_variant	26508			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.30C>T	1.37:g.40105268G>A		Unknown		x	x	x	39877855	Q5TG99	Silent	SNP	ENST00000372852.3	37	CCDS439.1	SNP	39	Broad																																																																																				0.731	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001179.2	NM_014571		Silent
COL11A1	1301	broad.mit.edu	37	1	103379910	103379910	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr1:103379910C>T	ENST00000370096.3	-	52	4288	c.3976G>A	c.(3976-3978)Gca>Aca	p.A1326T	COL11A1_ENST00000512756.1_Missense_Mutation_p.A1210T|COL11A1_ENST00000358392.2_Missense_Mutation_p.A1338T|COL11A1_ENST00000353414.4_Missense_Mutation_p.A1287T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1326	Triple-helical region.		A -> V (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATACTTACTGCAGGGCCAGGT	0.333																																																0			1											32.0	32.0	32.0					1																	103379910		2203	4300	6503	103152498	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3976G>A	1.37:g.103379910C>T	ENSP00000359114:p.Ala1326Thr	Unknown		x	x	x	103152498	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446358	0.43429	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	5.75	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.77432	0.4129	N	0.21583	0.68	0.49389	D	0.999785	B;B;B;B;B	0.32573	0.376;0.29;0.29;0.191;0.288	B;B;B;B;B	0.32864	0.073;0.154;0.154;0.073;0.109	T	0.72427	-0.4297	10	0.17369	T	0.5	.	8.7061	0.34356	0.2742:0.6581:0.0:0.0678	.	1210;1287;1338;1326;546	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	1326;1338;1287;546;1210	ENSP00000359114:A1326T;ENSP00000351163:A1338T;ENSP00000302551:A1287T;ENSP00000426533:A1210T	ENSP00000302551:A1287T	A	-	1	0	COL11A1	103152498	0.939000	0.31865	1.000000	0.80357	0.978000	0.69477	0.692000	0.25482	0.748000	0.32831	-0.182000	0.12963	GCA		0.333	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		Missense_Mutation
COL11A1	1301	broad.mit.edu	37	1	103491077	103491077	+	Splice_Site	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr1:103491077C>T	ENST00000370096.3	-	7	1302	c.990G>A	c.(988-990)gaG>gaA	p.E330E	COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000358392.2_Splice_Site_p.E342E|COL11A1_ENST00000353414.4_Splice_Site_p.E291E	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	330	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.E342E(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TACGTATTACCTCATTTGTCC	0.328																																																1	Substitution - coding silent(1)	ovary(1)	1											139.0	129.0	132.0					1																	103491077		2203	4300	6503	103263665	SO:0001630	splice_region_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.990+1G>A	1.37:g.103491077C>T		Unknown		x	x	x	103263665	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1	SNP	24	Broad																																																																																				0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Silent	Silent
PIFO	128344	broad.mit.edu	37	1	111891250	111891250	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr1:111891250A>C	ENST00000369738.4	+	4	736	c.371A>C	c.(370-372)aAg>aCg	p.K124T	PIFO_ENST00000484512.1_3'UTR|PIFO_ENST00000369737.4_Missense_Mutation_p.K91T	NM_181643.4	NP_857594.2	Q8TCI5	PIFO_HUMAN	primary cilia formation	124					cell projection organization (GO:0030030)|positive regulation of kinase activity (GO:0033674)|regulation of cell projection organization (GO:0031344)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-tubulin binding (GO:0048487)|gamma-tubulin binding (GO:0043015)|kinesin binding (GO:0019894)|protein kinase binding (GO:0019901)|Rab GTPase binding (GO:0017137)	p.K124T(1)									AACTACCCAAAGGACACTTAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											302.0	328.0	320.0					1																	111891250		2203	4300	6503	111692773	SO:0001583	missense	128344			BC050319	CCDS833.1, CCDS72836.1	1p13.2	2012-10-10	2012-10-10	2012-10-10	ENSG00000173947	ENSG00000173947			27009	protein-coding gene	gene with protein product		614234	"""chromosome 1 open reading frame 88"""	C1orf88		20643351	Standard	XM_005270472		Approved	FLJ23853, pitchfork	uc001eaw.2	Q8TCI5	OTTHUMG00000011168	ENST00000369738.4:c.371A>C	1.37:g.111891250A>C	ENSP00000358753:p.Lys124Thr	Unknown		x	x	x	111692773	D9J0A2|D9J0A3|Q4G0K4|Q52LJ6|Q5T5D5|Q5T5D6|Q8N310	Missense_Mutation	SNP	ENST00000369738.4	37	CCDS833.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	11.54	1.670568	0.29693	.	.	ENSG00000173947	ENST00000369738;ENST00000369737	T;T	0.32023	1.89;1.47	4.36	4.36	0.52297	.	0.704488	0.12956	N	0.425443	T	0.20373	0.0490	M	0.65975	2.015	0.18873	N	0.999988	P;P	0.46142	0.873;0.787	B;B	0.43916	0.436;0.344	T	0.05178	-1.0901	10	0.35671	T	0.21	-4.3398	10.5682	0.45186	1.0:0.0:0.0:0.0	.	91;124	Q8TCI5-3;Q8TCI5	.;PIFO_HUMAN	T	124;91	ENSP00000358753:K124T;ENSP00000358752:K91T	ENSP00000358752:K91T	K	+	2	0	C1orf88	111692773	0.035000	0.19736	0.235000	0.24058	0.129000	0.20672	0.637000	0.24659	1.939000	0.56221	0.369000	0.22263	AAG		0.398	PIFO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030718.1	NM_181643		Missense_Mutation
WNT2B	7482	broad.mit.edu	37	1	113059875	113059875	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr1:113059875G>T	ENST00000369684.4	+	4	1299	c.814G>T	c.(814-816)Gct>Tct	p.A272S	RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000256640.5_Missense_Mutation_p.A180S|WNT2B_ENST00000369686.5_Missense_Mutation_p.A253S	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	272					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.A272S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTATGATGGGGCTGTGCAGGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	56.0	58.0					1																	113059875		2203	4300	6503	112861398	SO:0001583	missense	7482			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.814G>T	1.37:g.113059875G>T	ENSP00000358698:p.Ala272Ser	Unknown		x	x	x	112861398	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	ENST00000369684.4	37	CCDS847.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.804188	0.96967	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	D;D;D	0.82526	-1.62;-1.62;-1.62	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.87661	0.6233	M	0.73217	2.22	0.80722	D	1	D;D	0.54601	0.967;0.959	P;P	0.58391	0.838;0.749	D	0.87477	0.2418	10	0.52906	T	0.07	.	19.0601	0.93090	0.0:0.0:1.0:0.0	.	272;253	Q93097;Q93097-2	WNT2B_HUMAN;.	S	180;253;272	ENSP00000256640:A180S;ENSP00000358700:A253S;ENSP00000358698:A272S	ENSP00000256640:A180S	A	+	1	0	WNT2B	112861398	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.599000	0.87857	0.555000	0.69702	GCT		0.602	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030692.1	NM_004185		Missense_Mutation
TAF3	83860	broad.mit.edu	37	10	8007168	8007168	+	Silent	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr10:8007168C>T	ENST00000344293.5	+	3	1901	c.1695C>T	c.(1693-1695)gaC>gaT	p.D565D		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	565	Lys-rich.				maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)	p.D565D(1)		NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						aagagaaagacaaggaAACTG	0.368																																																1	Substitution - coding silent(1)	ovary(1)	10											37.0	37.0	37.0					10																	8007168		1830	4085	5915	8047174	SO:0001819	synonymous_variant	83860			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1695C>T	10.37:g.8007168C>T		Unknown		x	x	x	8047174	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Silent	SNP	ENST00000344293.5	37	CCDS41487.1	SNP	17	Broad																																																																																				0.368	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923		Silent
SEPHS1	22929	broad.mit.edu	37	10	13361288	13361288	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr10:13361288A>T	ENST00000327347.5	-	9	1408	c.1033T>A	c.(1033-1035)Tat>Aat	p.Y345N	SEPHS1_ENST00000537130.1_Missense_Mutation_p.Y278N|SEPHS1_ENST00000545675.1_3'UTR|SEPHS1_ENST00000378614.4_Missense_Mutation_p.Y274N	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	345					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						CCTTCACCATATTTGGGGGAC	0.498																																																0			10											290.0	303.0	298.0					10																	13361288		2203	4298	6501	13401294	SO:0001583	missense	22929			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.1033T>A	10.37:g.13361288A>T	ENSP00000367893:p.Tyr345Asn	Unknown		x	x	x	13401294	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	ENST00000327347.5	37	CCDS7098.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	15.37	2.812568	0.50527	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000537130	T;T;T	0.17854	2.25;2.25;2.25	5.23	5.23	0.72850	AIR synthase-related protein, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.17280	0.0415	N	0.19112	0.55	0.80722	D	1	P;P;P;P	0.44521	0.837;0.837;0.837;0.734	B;P;P;B	0.46629	0.435;0.522;0.522;0.343	T	0.02352	-1.1172	10	0.52906	T	0.07	-19.6294	15.4457	0.75228	1.0:0.0:0.0:0.0	.	297;345;345;278	B4DLS1;P49903;D3DRS9;B4DWK0	.;SPS1_HUMAN;.;.	N	345;274;274;278	ENSP00000367893:Y345N;ENSP00000367877:Y274N;ENSP00000442768:Y278N	ENSP00000367887:Y274N	Y	-	1	0	SEPHS1	13401294	1.000000	0.71417	0.859000	0.33776	0.982000	0.71751	9.287000	0.95975	2.107000	0.64212	0.533000	0.62120	TAT		0.498	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046856.1	NM_012247		Missense_Mutation
SKIDA1	387640	broad.mit.edu	37	10	21805205	21805205	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr10:21805205G>C	ENST00000449193.2	-	4	3799	c.1547C>G	c.(1546-1548)tCg>tGg	p.S516W	SKIDA1_ENST00000444772.3_Missense_Mutation_p.S437W	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	435						nucleus (GO:0005634)											CTCCGCCGGCGACTCCGCTTT	0.607																																																0			10											33.0	38.0	37.0					10																	21805205		1991	4169	6160	21845211	SO:0001583	missense	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1547C>G	10.37:g.21805205G>C	ENSP00000410041:p.Ser516Trp	Unknown		x	x	x	21845211	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298642	0.40694	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.73	5.73	0.89815	.	0.253445	0.34386	N	0.004011	T	0.52661	0.1748	L	0.27053	0.805	0.54753	D	0.99998	D	0.64830	0.994	P	0.54664	0.758	T	0.55554	-0.8123	9	0.72032	D	0.01	-7.1782	12.8174	0.57673	0.0789:0.0:0.9211:0.0	.	516	E9PAX1	.	W	516;437	.	ENSP00000442432:S437W	S	-	2	0	C10orf140	21845211	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.872000	0.39549	2.712000	0.92718	0.650000	0.86243	TCG		0.607	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		Missense_Mutation
ZRANB1	54764	broad.mit.edu	37	10	126673350	126673350	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr10:126673350A>G	ENST00000359653.4	+	9	2287	c.1916A>G	c.(1915-1917)aAt>aGt	p.N639S		NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	639	TRAF-binding.				cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.N639S(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		AAGCTAGGTAATGAGGAACAG	0.478																																																1	Substitution - Missense(1)	ovary(1)	10											57.0	56.0	56.0					10																	126673350		2203	4300	6503	126663340	SO:0001583	missense	54764			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.1916A>G	10.37:g.126673350A>G	ENSP00000352676:p.Asn639Ser	Unknown		x	x	x	126663340	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	37	CCDS7642.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	3.630	-0.075795	0.07184	.	.	ENSG00000019995	ENST00000359653	T	0.16597	2.33	5.28	5.28	0.74379	.	0.165132	0.51477	D	0.000089	T	0.09113	0.0225	N	0.08118	0	0.58432	D	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.18871	-1.0323	10	0.10111	T	0.7	-24.7599	15.3621	0.74487	1.0:0.0:0.0:0.0	.	639	Q9UGI0	ZRAN1_HUMAN	S	639	ENSP00000352676:N639S	ENSP00000352676:N639S	N	+	2	0	ZRANB1	126663340	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	5.613000	0.67688	2.209000	0.71365	0.533000	0.62120	AAT		0.478	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580		Missense_Mutation
MOB2	81532	broad.mit.edu	37	11	1491585	1491585	+	Silent	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:1491585C>T	ENST00000329957.6	-	5	813	c.624G>A	c.(622-624)acG>acA	p.T208T	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	177					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)	4						GGACGTAGAGCGTGTTCAAGT	0.587																																																0			11											135.0	147.0	143.0					11																	1491585		2140	4230	6370	1448161	SO:0001819	synonymous_variant	81532				CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.624G>A	11.37:g.1491585C>T		Unknown		x	x	x	1448161	B4DKP3|Q96M67	Silent	SNP	ENST00000329957.6	37	CCDS53591.1	SNP	27	Broad																																																																																				0.587	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000384770.1	NM_053005		Silent
ART1	417	broad.mit.edu	37	11	3680873	3680873	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:3680873G>A	ENST00000250693.1	+	3	225	c.124G>A	c.(124-126)Gcc>Acc	p.A42T		NM_004314.2	NP_004305.2	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1	42					innate immune response (GO:0045087)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|skin(1)	8		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)		GCTGGACATGGCCCTGGCCTC	0.597																																																0			11											56.0	54.0	55.0					11																	3680873		2201	4298	6499	3637449	SO:0001583	missense	417			S74683	CCDS7744.1	11p15	2006-02-23			ENSG00000129744	ENSG00000129744		"""CD molecules"""	723	protein-coding gene	gene with protein product		601625				8812442	Standard	NM_004314		Approved	ART2, CD296	uc001lye.1	P52961	OTTHUMG00000011845	ENST00000250693.1:c.124G>A	11.37:g.3680873G>A	ENSP00000250693:p.Ala42Thr	Unknown		x	x	x	3637449	Q6NTD2|Q96KT9	Missense_Mutation	SNP	ENST00000250693.1	37	CCDS7744.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594043	0.66219	.	.	ENSG00000129744	ENST00000250693	T	0.11277	2.79	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.31451	0.0797	M	0.71206	2.165	0.48632	D	0.999685	D	0.65815	0.995	D	0.64595	0.927	T	0.00581	-1.1660	9	.	.	.	-14.3535	16.9558	0.86259	0.0:0.0:1.0:0.0	.	42	P52961	NAR1_HUMAN	T	42	ENSP00000250693:A42T	.	A	+	1	0	ART1	3637449	1.000000	0.71417	1.000000	0.80357	0.193000	0.23685	5.071000	0.64382	2.603000	0.88011	0.467000	0.42956	GCC		0.597	ART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032765.1	NM_004314		Missense_Mutation
OR51E2	81285	broad.mit.edu	37	11	4703227	4703227	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:4703227T>C	ENST00000396950.3	-	2	954	c.715A>G	c.(715-717)Acc>Gcc	p.T239A		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	239					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)	p.T239A(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GACACACAGGTTCCAAAGGCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											125.0	103.0	110.0					11																	4703227		2201	4298	6499	4659803	SO:0001583	missense	81285			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.715A>G	11.37:g.4703227T>C	ENSP00000380153:p.Thr239Ala	Unknown		x	x	x	4659803	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	CCDS7751.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126106	0.56721	.	.	ENSG00000167332	ENST00000396950	T	0.41065	1.01	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.139368	0.32918	N	0.005495	T	0.72415	0.3457	H	0.95780	3.72	0.39939	D	0.974385	P	0.43578	0.811	P	0.60173	0.87	T	0.81353	-0.0971	10	0.87932	D	0	.	13.6154	0.62105	0.0:0.0:0.0:1.0	.	239	Q9H255	O51E2_HUMAN	A	239	ENSP00000380153:T239A	ENSP00000380153:T239A	T	-	1	0	OR51E2	4659803	1.000000	0.71417	0.801000	0.32222	0.614000	0.37383	7.631000	0.83237	2.092000	0.63282	0.533000	0.62120	ACC		0.507	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		Missense_Mutation
TRIM5	85363	broad.mit.edu	37	11	5700994	5700994	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:5700994G>T	ENST00000380034.3	-	2	670	c.414C>A	c.(412-414)taC>taA	p.Y138*	TRIM5_ENST00000396847.3_Nonsense_Mutation_p.Y138*|TRIM5_ENST00000305836.5_Nonsense_Mutation_p.Y138*|TRIM5_ENST00000380027.1_Nonsense_Mutation_p.Y138*|TRIM5_ENST00000396855.3_Nonsense_Mutation_p.Y138*|TRIM5_ENST00000483835.1_5'UTR|TRIM5_ENST00000396853.4_Nonsense_Mutation_p.Y138*	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	138					activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y138*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		CTCTTACTTGGTACTCCCGGG	0.512																																																1	Substitution - Nonsense(1)	ovary(1)	11											104.0	90.0	95.0					11																	5700994		2201	4297	6498	5657570	SO:0001587	stop_gained	85363			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.414C>A	11.37:g.5700994G>T	ENSP00000369373:p.Tyr138*	Unknown		x	x	x	5657570	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Nonsense_Mutation	SNP	ENST00000380034.3	37	CCDS31393.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.544092|7.544092	0.98348|0.98348	.|.	.|.	ENSG00000132256|ENSG00000132256	ENST00000438025|ENST00000396855;ENST00000305836;ENST00000380034;ENST00000380027;ENST00000396847;ENST00000396853;ENST00000412903	.|.	.|.	.|.	4.07|4.07	1.17|1.17	0.20885|0.20885	.|.	.|0.290402	.|0.25189	.|N	.|0.032462	T|.	0.11239|.	0.0274|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31971|.	-0.9924|.	3|.	.|0.02654	.|T	.|1	.|.	3.6669|3.6669	0.08260|0.08260	0.3084:0.1884:0.5032:0.0|0.3084:0.1884:0.5032:0.0	.|.	.|.	.|.	.|.	N|X	15|138	.|.	.|ENSP00000307031:Y138X	T|Y	-|-	2|3	0|2	TRIM5|TRIM5	5657570|5657570	1.000000|1.000000	0.71417|0.71417	0.013000|0.013000	0.15412|0.15412	0.006000|0.006000	0.05464|0.05464	3.034000|3.034000	0.49751|0.49751	0.277000|0.277000	0.22141|0.22141	0.650000|0.650000	0.86243|0.86243	ACC|TAC		0.512	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143360.3	NM_033034		Nonsense_Mutation
ADM	133	broad.mit.edu	37	11	10327544	10327544	+	Silent	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:10327544C>A	ENST00000528655.1	+	2	764	c.147C>A	c.(145-147)tcC>tcA	p.S49S	ADM_ENST00000526492.1_Silent_p.S49S|ADM_ENST00000528544.1_Silent_p.S49S|ADM_ENST00000524948.1_Silent_p.S49S|ADM_ENST00000530439.1_5'UTR|ADM_ENST00000525063.1_Silent_p.S49S|RP11-351I24.1_ENST00000526906.1_RNA|ADM_ENST00000278175.5_Silent_p.S49S|ADM_ENST00000534464.1_Silent_p.S2S			P35318	ADML_HUMAN	adrenomedullin	49					aging (GO:0007568)|androgen metabolic process (GO:0008209)|blood circulation (GO:0008015)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cAMP biosynthetic process (GO:0006171)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|developmental growth (GO:0048589)|female pregnancy (GO:0007565)|G-protein coupled receptor internalization (GO:0002031)|heart development (GO:0007507)|hormone secretion (GO:0046879)|negative regulation of cell proliferation (GO:0008285)|negative regulation of vascular permeability (GO:0043116)|negative regulation of vasoconstriction (GO:0045906)|neural tube closure (GO:0001843)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of vasculogenesis (GO:2001214)|positive regulation of vasodilation (GO:0045909)|progesterone biosynthetic process (GO:0006701)|receptor internalization (GO:0031623)|regulation of the force of heart contraction (GO:0002026)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|spongiotrophoblast layer development (GO:0060712)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor binding (GO:0005102)	p.S49S(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(1)	6				all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)		TGCGGATGTCCAGCAGCTACC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	11											77.0	71.0	73.0					11																	10327544		2201	4294	6495	10284120	SO:0001819	synonymous_variant	133			D14874	CCDS7801.1	11p15.4	2013-02-25			ENSG00000148926	ENSG00000148926		"""Endogenous ligands"""	259	protein-coding gene	gene with protein product		103275				7688224	Standard	NM_001124		Approved	AM	uc001mil.1	P35318	OTTHUMG00000165907	ENST00000528655.1:c.147C>A	11.37:g.10327544C>A		Unknown		x	x	x	10284120	B2R793|D3DQV3|Q6FGW2	Silent	SNP	ENST00000528655.1	37	CCDS7801.1	SNP	21	Broad																																																																																				0.627	ADM-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387008.1	NM_001124		Silent
TMEM86A	144110	broad.mit.edu	37	11	18723200	18723200	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:18723200G>T	ENST00000280734.2	+	3	463	c.367G>T	c.(367-369)Gtg>Ttg	p.V123L	TMEM86A_ENST00000527002.1_3'UTR	NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A	123						integral component of membrane (GO:0016021)		p.V123L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						GACAGGTCTGGTGATGGCAGC	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											99.0	88.0	92.0					11																	18723200		2199	4293	6492	18679776	SO:0001583	missense	144110			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4		ENST00000280734.2:c.367G>T	11.37:g.18723200G>T	ENSP00000280734:p.Val123Leu	Unknown		x	x	x	18679776	Q96AJ0	Missense_Mutation	SNP	ENST00000280734.2	37	CCDS7844.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	7.144	0.582475	0.13749	.	.	ENSG00000151117	ENST00000535380;ENST00000280734	T	0.19806	2.12	5.03	4.11	0.48088	.	0.342297	0.31847	N	0.006967	T	0.10895	0.0266	N	0.16016	0.355	0.35927	D	0.832233	B	0.02656	0.0	B	0.04013	0.001	T	0.18304	-1.0341	10	0.13108	T	0.6	-12.8537	9.9808	0.41813	0.0734:0.3874:0.5391:0.0	.	123	Q8N2M4	TM86A_HUMAN	L	123	ENSP00000280734:V123L	ENSP00000280734:V123L	V	+	1	0	TMEM86A	18679776	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.828000	0.39111	1.467000	0.48044	0.561000	0.74099	GTG		0.597	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387812.1	NM_153347		Missense_Mutation
OR5R1	219479	broad.mit.edu	37	11	56185013	56185013	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:56185013C>A	ENST00000312253.1	-	1	695	c.696G>T	c.(694-696)caG>caT	p.Q232H		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q232H(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					TGTGTTGCCCCTGAGTAGAGC	0.443																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	11											142.0	130.0	134.0					11																	56185013		2201	4296	6497	55941589	SO:0001583	missense	219479			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.696G>T	11.37:g.56185013C>A	ENSP00000308595:p.Gln232His	Unknown		x	x	x	55941589		Missense_Mutation	SNP	ENST00000312253.1	37	CCDS31530.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	13.75	2.329163	0.41197	.	.	ENSG00000174942	ENST00000312253	T	0.00224	8.51	5.53	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.287283	0.18380	U	0.142981	T	0.00178	0.0005	N	0.19112	0.55	0.09310	N	0.999995	P	0.48834	0.916	P	0.50314	0.637	T	0.51505	-0.8697	10	0.72032	D	0.01	-7.7762	5.4787	0.16710	0.1282:0.5868:0.0:0.285	.	232	Q8NH85	OR5R1_HUMAN	H	232	ENSP00000308595:Q232H	ENSP00000308595:Q232H	Q	-	3	2	OR5R1	55941589	0.000000	0.05858	0.675000	0.29917	0.331000	0.28603	0.017000	0.13399	0.676000	0.31285	0.579000	0.79373	CAG		0.443	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744		Missense_Mutation
TBC1D10C	374403	broad.mit.edu	37	11	67173112	67173112	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:67173112G>C	ENST00000542590.1	+	4	421	c.407G>C	c.(406-408)gGc>gCc	p.G136A	TBC1D10C_ENST00000312390.5_Missense_Mutation_p.G136A|TBC1D10C_ENST00000526387.1_Missense_Mutation_p.G136A			Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	136	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				retrograde transport, endosome to Golgi (GO:0042147)	filopodium membrane (GO:0031527)|membrane (GO:0016020)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)	p.G136A(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GAGACCATTGGCAGGGACCTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	94.0	95.0					11																	67173112		2200	4295	6495	66929688	SO:0001583	missense	374403			BC035630	CCDS8162.1, CCDS58150.1	11q13.1	2013-07-09			ENSG00000175463	ENSG00000175463			24702	protein-coding gene	gene with protein product		610831				17230191, 20404108	Standard	NM_001256508		Approved	FLJ00332, Carabin, EPI64C	uc001ola.4	Q8IV04	OTTHUMG00000167139	ENST00000542590.1:c.407G>C	11.37:g.67173112G>C	ENSP00000443654:p.Gly136Ala	Unknown		x	x	x	66929688	G3V1D6	Missense_Mutation	SNP	ENST00000542590.1	37	CCDS8162.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157175	0.38119	.	.	ENSG00000175463	ENST00000526387;ENST00000312390;ENST00000542590	T;T;T	0.21031	2.03;2.03;2.03	4.86	3.93	0.45458	Rab-GAP/TBC domain (4);	0.428732	0.20229	N	0.096539	T	0.09818	0.0241	N	0.04880	-0.145	0.28494	N	0.914354	B;B	0.29612	0.0;0.251	B;B	0.34138	0.01;0.176	T	0.07947	-1.0746	10	0.38643	T	0.18	.	4.5303	0.12002	0.186:0.1931:0.6209:0.0	.	136;136	Q8IV04;G3V1D6	TB10C_HUMAN;.	A	136	ENSP00000435543:G136A;ENSP00000310193:G136A;ENSP00000443654:G136A	ENSP00000310193:G136A	G	+	2	0	TBC1D10C	66929688	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.615000	0.54167	2.245000	0.73994	0.455000	0.32223	GGC		0.642	TBC1D10C-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395492.2	NM_198517		Missense_Mutation
TECTA	7007	broad.mit.edu	37	11	121023628	121023628	+	Missense_Mutation	SNP	G	G	A	rs199637730		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:121023628G>A	ENST00000392793.1	+	13	4415	c.4144G>A	c.(4144-4146)Gtg>Atg	p.V1382M	TECTA_ENST00000264037.2_Missense_Mutation_p.V1382M			O75443	TECTA_HUMAN	tectorin alpha	1382	TIL 3.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CGAGAGCTGCGTGAGTGTCTG	0.597																																																0			11											60.0	55.0	57.0					11																	121023628		2203	4299	6502	120528838	SO:0001583	missense	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4144G>A	11.37:g.121023628G>A	ENSP00000376543:p.Val1382Met	Unknown		x	x	x	120528838		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687976	0.48097	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.90844	-2.74;-2.74	5.33	4.42	0.53409	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.277859	0.34555	N	0.003875	T	0.80449	0.4625	N	0.17248	0.465	0.32444	N	0.546312	P	0.40398	0.716	B	0.30716	0.119	T	0.82697	-0.0329	10	0.37606	T	0.19	.	13.7145	0.62689	0.0741:0.0:0.9259:0.0	.	1382	O75443	TECTA_HUMAN	M	1382	ENSP00000376543:V1382M;ENSP00000264037:V1382M	ENSP00000264037:V1382M	V	+	1	0	TECTA	120528838	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.795000	0.55499	1.232000	0.43678	0.563000	0.77884	GTG		0.597	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422		Missense_Mutation
VWA5A	4013	broad.mit.edu	37	11	123989726	123989726	+	Silent	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr11:123989726C>G	ENST00000456829.2	+	7	941	c.690C>G	c.(688-690)ctC>ctG	p.L230L	VWA5A_ENST00000449321.1_Silent_p.L230L|VWA5A_ENST00000360334.4_Silent_p.L230L|VWA5A_ENST00000392748.1_Silent_p.L230L|VWA5A_ENST00000392744.4_Silent_p.L246L|VWA5A_ENST00000361352.5_Silent_p.L230L	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	230								p.L230L(1)		autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						ACGTGGAACTCCTGATTTACT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	11											147.0	117.0	127.0					11																	123989726		2201	4299	6500	123494936	SO:0001819	synonymous_variant	4013			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.690C>G	11.37:g.123989726C>G		Unknown		x	x	x	123494936	Q6UN19|Q6UN20|Q9BVF8	Silent	SNP	ENST00000456829.2	37	CCDS8444.1	SNP	30	Broad																																																																																				0.478	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622		Silent
CHD4	1108	broad.mit.edu	37	12	6692033	6692033	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr12:6692033C>A	ENST00000357008.2	-	28	4380	c.4217G>T	c.(4216-4218)cGt>cTt	p.R1406L	RP5-940J5.6_ENST00000501075.2_RNA|CHD4_ENST00000309577.6_Missense_Mutation_p.R1434L|CHD4_ENST00000540960.1_5'UTR|CHD4_ENST00000544040.1_Missense_Mutation_p.R1399L|SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000544484.1_Missense_Mutation_p.R1431L	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1406					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R1434L(1)		central_nervous_system(2)	2						CCCACCAACACGGGCCAACAG	0.502																																					Colon(32;586 792 4568 16848 45314)											1	Substitution - Missense(1)	ovary(1)	12											163.0	166.0	165.0					12																	6692033		2203	4300	6503	6562294	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.4217G>T	12.37:g.6692033C>A	ENSP00000349508:p.Arg1406Leu	Unknown		x	x	x	6562294	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398108	0.83120	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.92348	-3.02;-2.91;-3.02;-2.91	5.96	5.96	0.96718	Domain of unknown function DUF1086 (1);	0.000000	0.85682	D	0.000000	D	0.96546	0.8873	M	0.82323	2.585	0.80722	D	1	D;D;D	0.69078	0.996;0.995;0.997	P;D;D	0.75484	0.891;0.972;0.986	D	0.96272	0.9199	10	0.72032	D	0.01	-5.1401	20.422	0.99049	0.0:1.0:0.0:0.0	.	1434;1406;1399	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	L	1431;1399;1434;1406;1380	ENSP00000440392:R1431L;ENSP00000440542:R1399L;ENSP00000312419:R1434L;ENSP00000349508:R1406L	ENSP00000312419:R1434L	R	-	2	0	CHD4	6562294	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	7.461000	0.80834	2.832000	0.97577	0.655000	0.94253	CGT		0.502	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
SLCO1B3	28234	broad.mit.edu	37	12	21032524	21032524	+	Silent	SNP	C	C	T	rs369799686		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr12:21032524C>T	ENST00000381545.3	+	11	1509	c.1290C>T	c.(1288-1290)tgC>tgT	p.C430C	SLCO1B3_ENST00000553473.1_Silent_p.C430C|SLCO1B3_ENST00000261196.2_Silent_p.C430C|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|LST3_ENST00000540229.1_Silent_p.C430C	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	430					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.C430C(3)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	CTCTAATCTGCGAAAGCAAAT	0.299																																																3	Substitution - coding silent(3)	prostate(1)|ovary(1)|lung(1)	12						T		1,4405		0,1,2202	85.0	81.0	82.0		1290	3.3	0.5	12		82	0,8598		0,0,4299	no	coding-synonymous	SLCO1B3	NM_019844.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		430/703	21032524	1,13003	2203	4299	6502	20923791	SO:0001819	synonymous_variant	28234				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1290C>T	12.37:g.21032524C>T		Unknown		x	x	x	20923791	E7EMT8|Q5JAR4	Silent	SNP	ENST00000381545.3	37	CCDS8684.1	SNP	27	Broad																																																																																				0.299	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844		Silent
SPRYD4	283377	broad.mit.edu	37	12	56863221	56863221	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr12:56863221C>A	ENST00000338146.5	+	2	559	c.484C>A	c.(484-486)Ctg>Atg	p.L162M	MIP_ENST00000555551.1_5'Flank	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	162	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.L162M(1)		kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						GGCCCAGAAGCTGAGCCTGGT	0.587																																																1	Substitution - Missense(1)	ovary(1)	12											93.0	86.0	88.0					12																	56863221		2203	4300	6503	55149488	SO:0001583	missense	283377			AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.484C>A	12.37:g.56863221C>A	ENSP00000338034:p.Leu162Met	Unknown		x	x	x	55149488	A8K7A5	Missense_Mutation	SNP	ENST00000338146.5	37	CCDS8920.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	19.95	3.922460	0.73213	.	.	ENSG00000176422	ENST00000338146;ENST00000543121	T	0.71579	-0.58	5.28	3.46	0.39613	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.85177	0.5637	M	0.91872	3.25	0.58432	D	0.99999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.99	D	0.85567	0.1231	10	0.72032	D	0.01	-12.5712	9.3912	0.38374	0.0:0.7647:0.0:0.2353	.	84;162	B4DUC9;Q8WW59	.;SPRY4_HUMAN	M	162;84	ENSP00000338034:L162M	ENSP00000338034:L162M	L	+	1	2	SPRYD4	55149488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.595000	0.46197	0.735000	0.32537	0.561000	0.74099	CTG		0.587	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_207344		Missense_Mutation
NACA	4666	broad.mit.edu	37	12	57115174	57115174	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr12:57115174G>T	ENST00000454682.1	-	3	421	c.140C>A	c.(139-141)cCt>cAt	p.P47H	NACA_ENST00000356769.3_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Missense_Mutation_p.P47H|NACA_ENST00000552540.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000548563.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	47	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						AGAGCAAGGAGGGGGGAGGGT	0.552			T	BCL6	NHL																																		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0			12											32.0	30.0	31.0					12																	57115174		1568	3582	5150	55401441	SO:0001583	missense	4666			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.140C>A	12.37:g.57115174G>T	ENSP00000403817:p.Pro47His	Unknown		x	x	x	55401441		Missense_Mutation	SNP	ENST00000454682.1	37		SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	8.085	0.773138	0.16051	.	.	ENSG00000196531	ENST00000454682;ENST00000550952	T;T	0.32023	1.47;1.47	3.26	3.26	0.37387	.	.	.	.	.	T	0.27419	0.0673	N	0.08118	0	0.19575	N	0.999963	D;D	0.65815	0.986;0.995	P;P	0.55824	0.575;0.785	T	0.10177	-1.0641	9	0.87932	D	0	.	10.251	0.43368	0.0:0.0:1.0:0.0	.	47;47	E9PAV3;F8VU71	.;.	H	47	ENSP00000403817:P47H;ENSP00000448035:P47H	ENSP00000403817:P47H	P	-	2	0	NACA	55401441	0.986000	0.35501	0.093000	0.20910	0.131000	0.20780	2.679000	0.46909	1.849000	0.53698	0.456000	0.33151	CCT		0.552	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594		Missense_Mutation
STARD13	90627	broad.mit.edu	37	13	33703981	33703981	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr13:33703981G>A	ENST00000336934.5	-	5	949	c.833C>T	c.(832-834)tCt>tTt	p.S278F	STARD13_ENST00000255486.4_Missense_Mutation_p.S270F|STARD13_ENST00000399365.3_Missense_Mutation_p.S160F	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	278					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		TGTCCGCCCAGACCCCTTATG	0.557																																																0			13											90.0	87.0	88.0					13																	33703981		2203	4300	6503	32601981	SO:0001583	missense	90627			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.833C>T	13.37:g.33703981G>A	ENSP00000338785:p.Ser278Phe	Unknown		x	x	x	32601981	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356964	0.24598	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.06933	3.24;3.24;3.24	5.69	3.91	0.45181	.	1.126930	0.06507	N	0.737366	T	0.12944	0.0314	L	0.50333	1.59	0.22401	N	0.999135	B;B;B;P	0.36354	0.086;0.323;0.217;0.549	B;B;B;B	0.41571	0.033;0.36;0.128;0.188	T	0.35001	-0.9806	10	0.59425	D	0.04	.	6.6853	0.23142	0.1447:0.0:0.7097:0.1456	.	270;243;278;270	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	F	160;270;278;270	ENSP00000382300:S160F;ENSP00000255486:S270F;ENSP00000338785:S278F	ENSP00000255486:S270F	S	-	2	0	STARD13	32601981	0.000000	0.05858	0.001000	0.08648	0.429000	0.31625	0.663000	0.25053	0.706000	0.31912	0.655000	0.94253	TCT		0.557	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466		Missense_Mutation
FREM2	341640	broad.mit.edu	37	13	39262931	39262931	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr13:39262931G>A	ENST00000280481.7	+	1	1666	c.1450G>A	c.(1450-1452)Gtg>Atg	p.V484M		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	484					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V484M(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GCTAGAGGTGGTGGCTGGGCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	13											42.0	44.0	43.0					13																	39262931		2203	4300	6503	38160931	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1450G>A	13.37:g.39262931G>A	ENSP00000280481:p.Val484Met	Unknown		x	x	x	38160931	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	11.25	1.581871	0.28180	.	.	ENSG00000150893	ENST00000280481	T	0.23950	1.88	5.4	5.4	0.78164	.	0.197379	0.46145	D	0.000312	T	0.23965	0.0580	L	0.55481	1.735	0.43965	D	0.996642	B	0.28439	0.212	B	0.25140	0.058	T	0.04976	-1.0914	10	0.54805	T	0.06	.	9.205	0.37285	0.0766:0.1472:0.7762:0.0	.	484	Q5SZK8	FREM2_HUMAN	M	484	ENSP00000280481:V484M	ENSP00000280481:V484M	V	+	1	0	FREM2	38160931	0.989000	0.36119	1.000000	0.80357	0.997000	0.91878	1.134000	0.31442	2.538000	0.85594	0.561000	0.74099	GTG		0.612	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		Missense_Mutation
DLEU7	220107	broad.mit.edu	37	13	51417470	51417472	+	Missense_Mutation	TNP	GGG	GGG	TAT			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr13:51417470_51417472GGG>TAT	ENST00000504404.1	-	1	360_362	c.311_313CCC>ATA	c.(310-315)cCCCgg>cATAgg	p.P104H	DLEU7-AS1_ENST00000413510.2_RNA|DLEU7_ENST00000400393.3_Missense_Mutation_p.P104H			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	104													Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		CCGCGGTCCCGGGGGAAGGGCAG	0.744																																																0			13																																								50315473	SO:0001583	missense	220107			AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.311_313CCC>ATA	13.37:g.51417470GGG>TAT	ENSP00000427177:p.Pro104His	Unknown		x	x	x	50315471	Q2M2E4|Q6ZT82	Missense_Mutation	TNP	ENST00000504404.1	37		TNP	39	Broad																																																																																				0.744	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045005.2	NM_198989		Missense_Mutation
SNX6	58533	broad.mit.edu	37	14	35050769	35050769	+	Silent	SNP	T	T	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr14:35050769T>G	ENST00000362031.4	-	10	898	c.868A>C	c.(868-870)Aga>Cga	p.R290R	SNX6_ENST00000396526.3_Silent_p.R162R|SNX6_ENST00000355110.5_Silent_p.R166R|SNX6_ENST00000396534.3_Silent_p.R162R	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	278					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)	p.R278R(1)		endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		GTACTTACTCTTGTTTTATCG	0.279																																																1	Substitution - coding silent(1)	ovary(1)	14											59.0	65.0	63.0					14																	35050769		2201	4297	6498	34120520	SO:0001819	synonymous_variant	58533			AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.868A>C	14.37:g.35050769T>G		Unknown		x	x	x	34120520	C0H5W9|Q9Y449	Silent	SNP	ENST00000362031.4	37	CCDS41942.1	SNP	56	Broad																																																																																				0.279	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276642.3			Silent
ZBTB25	7597	broad.mit.edu	37	14	64954742	64954742	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr14:64954742T>G	ENST00000608382.1	-	3	398	c.207A>C	c.(205-207)caA>caC	p.Q69H	ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000394715.1_Missense_Mutation_p.Q69H	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	69	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q69H(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		ATATGTCAGGTTGGATGTCAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											74.0	66.0	69.0					14																	64954742		2203	4300	6503	64024495	SO:0001583	missense	7597			X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.207A>C	14.37:g.64954742T>G	ENSP00000476746:p.Gln69His	Unknown		x	x	x	64024495	B3KUX6|Q8IYH9	Missense_Mutation	SNP	ENST00000608382.1	37	CCDS9765.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	17.61	3.432338	0.62844	.	.	ENSG00000089775	ENST00000261683;ENST00000394715	T;T	0.22134	1.97;1.97	5.92	-7.13	0.01532	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.35828	0.0945	L	0.43757	1.38	0.51233	D	0.999914	D	0.89917	1.0	D	0.91635	0.999	T	0.46373	-0.9196	10	0.51188	T	0.08	-14.1568	23.2312	0.99981	0.0:0.802:0.0:0.198	.	69	P24278	ZBT25_HUMAN	H	69	ENSP00000261683:Q69H;ENSP00000378204:Q69H	ENSP00000261683:Q69H	Q	-	3	2	ZBTB25	64024495	0.056000	0.20664	0.508000	0.27688	0.996000	0.88848	-0.617000	0.05584	-1.801000	0.01245	0.459000	0.35465	CAA		0.393	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977		Missense_Mutation
DYNC1H1	1778	broad.mit.edu	37	14	102461589	102461589	+	Silent	SNP	T	T	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr14:102461589T>C	ENST00000360184.4	+	15	3680	c.3516T>C	c.(3514-3516)taT>taC	p.Y1172Y		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1172	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.Y1172Y(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCATCACCTATGTGCAGTCTT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	14											181.0	181.0	181.0					14																	102461589		2203	4300	6503	101531342	SO:0001819	synonymous_variant	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.3516T>C	14.37:g.102461589T>C		Unknown		x	x	x	101531342	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1	SNP	51	Broad																																																																																				0.502	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		Silent
CATSPER2	117155	broad.mit.edu	37	15	43940168	43940168	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr15:43940168T>A	ENST00000321596.5	-	2	291	c.92A>T	c.(91-93)cAt>cTt	p.H31L	CATSPER2_ENST00000464721.1_Intron|CATSPER2_ENST00000354127.4_Missense_Mutation_p.H31L|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000381761.1_Missense_Mutation_p.H37L|CATSPER2_ENST00000396879.1_Missense_Mutation_p.H31L|CATSPER2_ENST00000355438.2_Missense_Mutation_p.H31L			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	31					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.H31L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GCCTTGCAAATGCTCAATGAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	15											183.0	181.0	182.0					15																	43940168		2199	4296	6495	41727460	SO:0001583	missense	117155			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.92A>T	15.37:g.43940168T>A	ENSP00000321463:p.His31Leu	Unknown		x	x	x	41727460	Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	ENST00000321596.5	37	CCDS10099.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	11.67	1.706661	0.30232	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438;ENST00000432420;ENST00000409481;ENST00000419473	T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27	2.64	2.64	0.31445	.	2.597920	0.01853	N	0.036089	T	0.44138	0.1279	M	0.73598	2.24	0.32017	N	0.601232	B;B;B	0.33044	0.395;0.147;0.091	B;B;B	0.37267	0.245;0.073;0.033	T	0.41770	-0.9490	10	0.31617	T	0.26	.	7.0877	0.25267	0.0:0.0:0.0:1.0	.	31;37;31	Q96P56-4;F8W9H2;Q96P56	.;.;CTSR2_HUMAN	L	31;31;37;31;31;31;31;31;31	ENSP00000380088:H31L;ENSP00000371180:H37L;ENSP00000321463:H31L;ENSP00000339137:H31L;ENSP00000347613:H31L;ENSP00000407694:H31L;ENSP00000386595:H31L	ENSP00000299989:H31L	H	-	2	0	CATSPER2	41727460	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	3.580000	0.53907	1.219000	0.43474	0.155000	0.16302	CAT		0.473	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133151.2	NM_054020		Missense_Mutation
IGDCC3	9543	broad.mit.edu	37	15	65624296	65624296	+	Silent	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr15:65624296C>T	ENST00000327987.4	-	7	1382	c.1131G>A	c.(1129-1131)agG>agA	p.R377R	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	377	Ig-like C2-type 4.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.R377R(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TATTCTTGAGCCTGACGTGGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	15											103.0	91.0	95.0					15																	65624296		2201	4299	6500	63411349	SO:0001819	synonymous_variant	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1131G>A	15.37:g.65624296C>T		Unknown		x	x	x	63411349	O95215	Silent	SNP	ENST00000327987.4	37	CCDS10205.1	SNP	26	Broad																																																																																				0.607	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884		Silent
DPP8	54878	broad.mit.edu	37	15	65799595	65799595	+	Silent	SNP	A	A	G	rs150368102		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr15:65799595A>G	ENST00000341861.5	-	3	1986	c.406T>C	c.(406-408)Ttg>Ctg	p.L136L	DPP8_ENST00000559233.1_Silent_p.L136L|DPP8_ENST00000300141.6_Silent_p.L120L|DPP8_ENST00000339244.5_Silent_p.L136L|DPP8_ENST00000321147.6_Silent_p.L136L|DPP8_ENST00000358939.4_Silent_p.L120L|DPP8_ENST00000321118.7_Silent_p.L136L	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	136					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.L120L(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAAAGATCCAAAAGAGGCTTC	0.343													A|||	1	0.000199681	0.0	0.0014	5008	,	,		16142	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15						A	,,,	1,4401	2.1+/-5.4	0,1,2200	101.0	99.0	100.0		358,358,406,406	-0.3	1.0	15	dbSNP_134	100	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DPP8	NM_017743.4,NM_130434.3,NM_197960.2,NM_197961.2	,,,	0,3,6497	GG,GA,AA		0.0233,0.0227,0.0231	,,,	120/783,120/883,136/899,136/848	65799595	3,12997	2201	4299	6500	63586648	SO:0001819	synonymous_variant	54878			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.406T>C	15.37:g.65799595A>G		Unknown		x	x	x	63586648	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Silent	SNP	ENST00000341861.5	37	CCDS10207.1	SNP	1	Broad																																																																																				0.343	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743		Silent
SYNM	23336	broad.mit.edu	37	15	99671917	99671917	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr15:99671917G>C	ENST00000560674.1	+	4	2963	c.2494G>C	c.(2494-2496)Gag>Cag	p.E832Q	SYNM_ENST00000336292.6_Missense_Mutation_p.E1117Q|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000328642.7_Missense_Mutation_p.E1117Q			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1118	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)	p.E1117Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						ACAGGTGCTGGAGGATGTGAG	0.612																																					Pancreas(125;1071 1762 21750 40003 40381)											1	Substitution - Missense(1)	ovary(1)	15											22.0	25.0	24.0					15																	99671917		2100	4231	6331	97489440	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.2494G>C	15.37:g.99671917G>C	ENSP00000453040:p.Glu832Gln	Unknown		x	x	x	97489440	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000560674.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153585	0.57259	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.83992	-1.79;-1.78	5.32	5.32	0.75619	.	.	.	.	.	D	0.89677	0.6784	.	.	.	0.31585	N	0.654587	D;D	0.76494	0.999;0.998	D;P	0.71184	0.972;0.895	D	0.89618	0.3846	8	0.66056	D	0.02	.	11.6608	0.51345	0.0846:0.0:0.9154:0.0	.	1118;1117	O15061;C9JIE4	SYNEM_HUMAN;.	Q	1117	ENSP00000336775:E1117Q;ENSP00000330469:E1117Q	ENSP00000330469:E1117Q	E	+	1	0	SYNM	97489440	0.935000	0.31712	0.998000	0.56505	0.571000	0.35966	1.875000	0.39578	2.463000	0.83235	0.655000	0.94253	GAG		0.612	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728		Missense_Mutation
ELMO3	79767	broad.mit.edu	37	16	67235933	67235933	+	Silent	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr16:67235933G>T	ENST00000360833.1	+	11	1269	c.1212G>T	c.(1210-1212)ctG>ctT	p.L404L	ELMO3_ENST00000393997.2_Silent_p.L421L|ELMO3_ENST00000477898.1_Silent_p.L255L|MIR328_ENST00000385213.1_RNA			Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	368	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				apoptotic process (GO:0006915)|phagocytosis (GO:0006909)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.L421L(1)		cervix(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		TGCTGGCCCTGGACAACATGT	0.677																																																1	Substitution - coding silent(1)	ovary(1)	16											48.0	57.0	54.0					16																	67235933		1960	4144	6104	65793434	SO:0001819	synonymous_variant	79767				CCDS10833.2	16q22.1	2010-03-18	2006-01-20		ENSG00000102890	ENSG00000102890		"""Engulfment and cell motility proteins"""	17289	protein-coding gene	gene with protein product		606422	"""engulfment and cell motility 3 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_024712		Approved	FLJ13824, CED12, ELMO-3, CED-12	uc002esa.3	Q96BJ8	OTTHUMG00000133570	ENST00000360833.1:c.1212G>T	16.37:g.67235933G>T		Unknown		x	x	x	65793434	B4DV86|Q9H8A5	Silent	SNP	ENST00000360833.1	37		SNP	47	Broad																																																																																				0.677	ELMO3-001	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000257667.2	NM_024712		Silent
FUK	197258	broad.mit.edu	37	16	70513276	70513276	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr16:70513276G>C	ENST00000288078.6	+	23	3355	c.3123G>C	c.(3121-3123)gaG>gaC	p.E1041D	FUK_ENST00000378912.2_Missense_Mutation_p.E1047D|FUK_ENST00000571514.1_Missense_Mutation_p.E532D	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	1041						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)	p.E1041D(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				AGCAAAAGGAGGCCTTGGAGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											28.0	32.0	31.0					16																	70513276		1954	4149	6103	69070777	SO:0001583	missense	197258				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.3123G>C	16.37:g.70513276G>C	ENSP00000288078:p.Glu1041Asp	Unknown		x	x	x	69070777	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	ENST00000288078.6	37	CCDS10891.2	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	2.213	-0.380279	0.05000	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	D;D	0.90900	-2.75;-2.75	4.64	0.51	0.16983	GHMP kinase, C-terminal (1);	0.267120	0.41712	D	0.000825	T	0.77412	0.4126	N	0.16266	0.395	0.09310	N	0.999997	B;B;B	0.12630	0.004;0.006;0.006	B;B;B	0.20184	0.005;0.028;0.028	T	0.60265	-0.7297	10	0.15952	T	0.53	-5.4303	4.6487	0.12584	0.3856:0.0:0.4747:0.1396	.	1047;947;1041	Q8N0W3-2;B2RDL5;Q8N0W3	.;.;FUK_HUMAN	D	1041;1047	ENSP00000288078:E1041D;ENSP00000368192:E1047D	ENSP00000288078:E1041D	E	+	3	2	FUK	69070777	0.149000	0.22717	0.011000	0.14972	0.023000	0.10783	0.510000	0.22723	-0.023000	0.13963	-0.140000	0.14226	GAG		0.612	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059		Missense_Mutation
ZCCHC14	23174	broad.mit.edu	37	16	87454225	87454225	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr16:87454225T>C	ENST00000268616.4	-	5	744	c.527A>G	c.(526-528)gAc>gGc	p.D176G		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	176							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.D176G(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		CAGGCCTGAGTCCAGATCCAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	16											97.0	70.0	79.0					16																	87454225		2198	4300	6498	86011726	SO:0001583	missense	23174			AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.527A>G	16.37:g.87454225T>C	ENSP00000268616:p.Asp176Gly	Unknown		x	x	x	86011726	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	CCDS10961.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	12.82	2.052519	0.36181	.	.	ENSG00000140948	ENST00000268616	T	0.69806	-0.43	5.46	4.35	0.52113	Phox homologous domain (2);	0.183399	0.46758	D	0.000273	T	0.43077	0.1231	N	0.08118	0	0.34579	D	0.714307	P	0.37864	0.61	B	0.29598	0.104	T	0.59101	-0.7517	10	0.87932	D	0	-9.1359	12.5121	0.56011	0.0:0.0:0.1395:0.8605	.	176	Q8WYQ9	ZCH14_HUMAN	G	176	ENSP00000268616:D176G	ENSP00000268616:D176G	D	-	2	0	ZCCHC14	86011726	1.000000	0.71417	0.990000	0.47175	0.230000	0.25150	5.448000	0.66612	0.878000	0.35920	0.533000	0.62120	GAC		0.567	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578177	7578177	+	Splice_Site	SNP	C	C	T	rs267605076		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr17:7578177C>T	ENST00000269305.4	-	6	861	c.672G>A	c.(670-672)gaG>gaA	p.E224E	TP53_ENST00000359597.4_Splice_Site_p.E224E|TP53_ENST00000420246.2_Splice_Site_p.E224E|TP53_ENST00000445888.2_Splice_Site_p.E224E|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Splice_Site_p.E224E|TP53_ENST00000455263.2_Splice_Site_p.E224E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	224	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E224D(20)|p.?(13)|p.E224E(12)|p.0?(8)|p.E131D(3)|p.E131E(2)|p.V218_E224delVPYEPPE(1)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACCAGACCTCAGGCGGCT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	61	Substitution - Missense(23)|Substitution - coding silent(14)|Unknown(13)|Whole gene deletion(8)|Deletion - In frame(1)|Insertion - Frameshift(1)|Insertion - In frame(1)	lung(23)|large_intestine(7)|bone(6)|biliary_tract(5)|endometrium(5)|oesophagus(3)|breast(3)|stomach(2)|central_nervous_system(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|ovary(1)|liver(1)	17											81.0	76.0	78.0					17																	7578177		2203	4300	6503	7518902	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>A	17.37:g.7578177C>T		Unknown		x	x	x	7518902	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	24	Broad																																																																																				0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent	Silent
ODF4	146852	broad.mit.edu	37	17	8243569	8243569	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr17:8243569C>T	ENST00000328248.2	+	1	388	c.200C>T	c.(199-201)cCc>cTc	p.P67L	ODF4_ENST00000584943.1_Intron|RP11-849F2.4_ENST00000585275.1_lincRNA	NM_153007.4	NP_694552.2	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	67					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|outer dense fiber (GO:0001520)				endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)	8						TCTCCGCTGCCCTTTCAATGG	0.582																																																0			17											80.0	72.0	75.0					17																	8243569		2203	4300	6503	8184294	SO:0001583	missense	146852			AB081120	CCDS11140.1	17p13	2010-09-27			ENSG00000184650	ENSG00000184650			19056	protein-coding gene	gene with protein product	"""cancer/testis antigen 136"""	610097					Standard	NM_153007		Approved	OPPO1, CT136	uc002gle.1	Q2M2E3	OTTHUMG00000108190	ENST00000328248.2:c.200C>T	17.37:g.8243569C>T	ENSP00000331086:p.Pro67Leu	Unknown		x	x	x	8184294	Q8J021	Missense_Mutation	SNP	ENST00000328248.2	37	CCDS11140.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547637	0.45383	.	.	ENSG00000184650	ENST00000328248	T	0.28255	1.62	4.33	1.14	0.20703	.	0.312530	0.23547	N	0.047003	T	0.20495	0.0493	L	0.40543	1.245	0.09310	N	1	B	0.32101	0.356	B	0.33568	0.166	T	0.13926	-1.0491	10	0.22706	T	0.39	-7.5144	6.4378	0.21833	0.0:0.6712:0.0:0.3288	.	67	Q2M2E3	ODFP4_HUMAN	L	67	ENSP00000331086:P67L	ENSP00000331086:P67L	P	+	2	0	ODF4	8184294	0.000000	0.05858	0.007000	0.13788	0.046000	0.14306	0.045000	0.14013	0.474000	0.27392	0.655000	0.94253	CCC		0.582	ODF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226996.1			Missense_Mutation
CARD14	79092	broad.mit.edu	37	17	78171963	78171963	+	Splice_Site	SNP	T	T	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr17:78171963T>G	ENST00000573882.1	+	14	2194		c.e14+2		CARD14_ENST00000570421.1_Splice_Site|RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000344227.2_Splice_Site|CARD14_ENST00000392434.2_Splice_Site|CARD14_ENST00000573754.1_Splice_Site			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14						activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.?(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTCGGAGAGGTAAGCAGCAGG	0.602																																																1	Unknown(1)	ovary(1)	17											67.0	68.0	68.0					17																	78171963		2203	4300	6503	75786558	SO:0001630	splice_region_variant	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1658+2T>G	17.37:g.78171963T>G		Unknown		x	x	x	75786558	B8QQJ3|Q9BVB5	Splice_Site_SNP	SNP	ENST00000573882.1	37	CCDS11768.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	10.52	1.371858	0.24857	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	.	.	.	2.81	2.81	0.32909	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2921	0.15733	0.2558:0.0:0.0:0.7442	.	.	.	.	.	-1	.	.	.	+	.	.	CARD14	75786558	1.000000	0.71417	0.943000	0.38184	0.012000	0.07955	1.440000	0.35024	1.524000	0.49035	0.383000	0.25322	.		0.602	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		Intron	Splice_Site_SNP
NARF	26502	broad.mit.edu	37	17	80439030	80439030	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr17:80439030G>T	ENST00000309794.11	+	7	910	c.712G>T	c.(712-714)Gaa>Taa	p.E238*	NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Nonsense_Mutation_p.E284*|NARF_ENST00000412079.2_Nonsense_Mutation_p.E110*|NARF_ENST00000345415.7_Nonsense_Mutation_p.E190*|NARF_ENST00000390006.4_Nonsense_Mutation_p.E179*	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	238						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)	p.E238*(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GGCTCTTCAGGAAAGCCTTCC	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	17											100.0	100.0	100.0					17																	80439030		2203	4300	6503	78032319	SO:0001587	stop_gained	26502			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.712G>T	17.37:g.80439030G>T	ENSP00000309899:p.Glu238*	Unknown		x	x	x	78032319	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Nonsense_Mutation	SNP	ENST00000309794.11	37	CCDS32777.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	.	23.4	4.416406	0.83449	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415;ENST00000412079;ENST00000457415	.	.	.	5.36	5.36	0.76844	.	0.147818	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-20.4524	18.0663	0.89391	0.0:0.0:1.0:0.0	.	.	.	.	X	179;238;238;190;110;193	.	ENSP00000309899:E238X	E	+	1	0	NARF	78032319	1.000000	0.71417	0.159000	0.22649	0.028000	0.11728	7.396000	0.79891	2.513000	0.84729	0.491000	0.48974	GAA		0.577	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968		Nonsense_Mutation
CCDC94	55702	broad.mit.edu	37	19	4251129	4251129	+	Silent	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr19:4251129C>T	ENST00000262962.7	+	3	299	c.231C>T	c.(229-231)taC>taT	p.Y77Y		NM_018074.4	NP_060544.2	Q9BW85	CCD94_HUMAN	coiled-coil domain containing 94	77								p.Y77Y(1)		NS(1)|endometrium(1)|lung(2)|ovary(1)|stomach(2)	7				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0348)|STAD - Stomach adenocarcinoma(1328;0.183)		TCCGCTTTTACATCAAGTGCA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	19											108.0	101.0	104.0					19																	4251129		2203	4300	6503	4202129	SO:0001819	synonymous_variant	55702			AK001236	CCDS12124.1	19p13.3	2008-02-05				ENSG00000105248			25518	protein-coding gene	gene with protein product						12477932	Standard	NM_018074		Approved	FLJ10374	uc002lzv.4	Q9BW85		ENST00000262962.7:c.231C>T	19.37:g.4251129C>T		Unknown		x	x	x	4202129	O75270|Q9H862|Q9NW16	Silent	SNP	ENST00000262962.7	37	CCDS12124.1	SNP	17	Broad																																																																																				0.592	CCDC94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458007.2	NM_018074		Silent
PSG4	5672	broad.mit.edu	37	19	43702148	43702148	+	Splice_Site	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr19:43702148C>G	ENST00000405312.3	-	3	947		c.e3+1		PSG4_ENST00000244295.9_Splice_Site|PSG4_ENST00000433626.2_Intron	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4						female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)		p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				AGGATACTCACGGAGGAGATT	0.527																																																1	Unknown(1)	ovary(1)	19											39.0	46.0	44.0					19																	43702148		2108	4239	6347	48393988	SO:0001630	splice_region_variant	5672				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.709+1G>C	19.37:g.43702148C>G		Unknown		x	x	x	48393988	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Splice_Site_SNP	SNP	ENST00000405312.3	37	CCDS46093.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	2.854	-0.237699	0.05944	.	.	ENSG00000243137	ENST00000244295;ENST00000405312	.	.	.	1.96	0.858	0.19030	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4947	0.11831	0.0:0.7864:0.0:0.2136	.	.	.	.	.	-1	.	.	.	-	.	.	PSG4	48393988	0.171000	0.23029	0.017000	0.16124	0.007000	0.05969	0.119000	0.15626	0.170000	0.19704	-0.482000	0.04802	.		0.527	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	Intron	Splice_Site_SNP
RTN2	6253	broad.mit.edu	37	19	45997571	45997571	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr19:45997571G>C	ENST00000245923.4	-	4	902	c.667C>G	c.(667-669)Cga>Gga	p.R223G	RTN2_ENST00000430715.2_5'Flank|PPM1N_ENST00000456399.2_5'Flank|RTN2_ENST00000590526.1_5'UTR|RTN2_ENST00000589384.1_5'Flank|RTN2_ENST00000344680.4_Missense_Mutation_p.R223G|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000396737.2_5'Flank	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	223					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.R223G(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		TCTCGCGATCGGGATGGGGAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	61.0	64.0					19																	45997571		2203	4300	6503	50689411	SO:0001583	missense	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.667C>G	19.37:g.45997571G>C	ENSP00000245923:p.Arg223Gly	Unknown		x	x	x	50689411	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687778	0.29962	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.52057	0.79;0.68	5.68	-9.9	0.00461	.	1.137880	0.06663	N	0.764854	T	0.19327	0.0464	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.13202	-1.0518	10	0.25106	T	0.35	2.0394	6.3606	0.21427	0.0699:0.4769:0.1347:0.3184	.	223;223	O75298-2;O75298	.;RTN2_HUMAN	G	223	ENSP00000345127:R223G;ENSP00000245923:R223G	ENSP00000245923:R223G	R	-	1	2	RTN2	50689411	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.257000	0.02866	-1.623000	0.01558	-0.300000	0.09419	CGA		0.632	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		Missense_Mutation
ZNF649	65251	broad.mit.edu	37	19	52393927	52393927	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr19:52393927C>G	ENST00000354957.3	-	5	1746	c.1462G>C	c.(1462-1464)Gta>Cta	p.V488L	ZNF577_ENST00000451628.2_5'Flank|ZNF577_ENST00000420592.1_5'Flank|ZNF577_ENST00000412216.1_5'Flank|ZNF577_ENST00000301399.5_5'Flank|CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Missense_Mutation_p.V460L|ZNF577_ENST00000485702.1_5'Flank	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GCCACAGTTACCATATTAACA	0.483																																																0			19											161.0	132.0	142.0					19																	52393927		2203	4300	6503	57085739	SO:0001583	missense	65251			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.1462G>C	19.37:g.52393927C>G	ENSP00000347043:p.Val488Leu	Unknown		x	x	x	57085739	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	CCDS12843.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	9.413	1.081023	0.20309	.	.	ENSG00000198093	ENST00000354957	T	0.05513	3.43	2.13	2.13	0.27403	.	.	.	.	.	T	0.06416	0.0165	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28808	-1.0032	9	0.35671	T	0.21	.	6.7046	0.23244	0.0:0.7009:0.2991:0.0	.	488	Q9BS31	ZN649_HUMAN	L	488	ENSP00000347043:V488L	ENSP00000347043:V488L	V	-	1	0	ZNF649	57085739	0.000000	0.05858	0.055000	0.19348	0.184000	0.23303	-0.890000	0.04140	1.210000	0.43336	0.195000	0.17529	GTA		0.483	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074		Missense_Mutation
MYO7B	4648	broad.mit.edu	37	2	128380883	128380883	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:128380883A>T	ENST00000409816.2	+	27	3706	c.3674A>T	c.(3673-3675)cAc>cTc	p.H1225L	RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000409090.1_Missense_Mutation_p.H78L|MYO7B_ENST00000428314.1_Missense_Mutation_p.H1225L|MYO7B_ENST00000389524.4_Missense_Mutation_p.H1225L			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1225	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.H1225L(1)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ATGTGCATGCACATCGCTCAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	2											68.0	78.0	74.0					2																	128380883		2144	4247	6391	128097353	SO:0001583	missense	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3674A>T	2.37:g.128380883A>T	ENSP00000386461:p.His1225Leu	Unknown		x	x	x	128097353	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	.	2.422	-0.332889	0.05314	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000437387;ENST00000409090	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	4.82	4.82	0.62117	Band 4.1 domain (1);FERM domain (1);	0.476729	0.20435	N	0.092381	T	0.65873	0.2733	L	0.50333	1.59	0.09310	N	0.999991	B	0.06786	0.001	B	0.04013	0.001	T	0.56159	-0.8025	10	0.40728	T	0.16	.	7.8365	0.29374	0.6993:0.0:0.0:0.3007	.	1225	Q6PIF6	MYO7B_HUMAN	L	1225;1225;78;1225;78;78	ENSP00000374175:H1225L;ENSP00000415090:H1225L;ENSP00000386461:H1225L;ENSP00000404927:H78L;ENSP00000386850:H78L	ENSP00000272666:H78L	H	+	2	0	MYO7B	128097353	0.002000	0.14202	0.993000	0.49108	0.160000	0.22226	1.712000	0.37940	1.798000	0.52647	0.402000	0.26972	CAC		0.612	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		Missense_Mutation
ARHGEF4	50649	broad.mit.edu	37	2	131803046	131803046	+	Intron	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:131803046C>T	ENST00000326016.5	+	13	2440				ARHGEF4_ENST00000409303.1_Intron|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.R650W|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000355771.3_Intron|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.R650W	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CCCACCTCCTCGGCTGCCCGG	0.612																																																0			2											67.0	61.0	63.0					2																	131803046		2203	4300	6503	131519516	SO:0001627	intron_variant	50649			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1921+27C>T	2.37:g.131803046C>T		Unknown		x	x	x	131519516	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	SNP	31	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.80|11.80	1.746423|1.746423	0.30955|0.30955	.|.	.|.	ENSG00000136002|ENSG00000136002	ENST00000392953;ENST00000525839|ENST00000532720	T;T|.	0.69806|.	-0.43;-0.43|.	4.11|4.11	-5.41|-5.41	0.02648|0.02648	.|.	.|.	.|.	.|.	.|.	T|T	0.12220|0.12220	0.0297|0.0297	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.23297|0.23297	-1.0192|-1.0192	8|5	.|.	.|.	.|.	.|.	2.1814|2.1814	0.03876|0.03876	0.1097:0.1672:0.3338:0.3893|0.1097:0.1672:0.3338:0.3893	.|.	650|.	Q9NR80-4|.	.|.	W|L	650|266	ENSP00000376680:R650W;ENSP00000432267:R650W|.	.|.	R|S	+|+	1|2	2|0	ARHGEF4|ARHGEF4	131519516|131519516	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.032000|0.032000	0.12392|0.12392	-0.913000|-0.913000	0.04042|0.04042	-0.912000|-0.912000	0.03837|0.03837	-0.448000|-0.448000	0.05591|0.05591	CGG|TCG		0.612	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4			Missense_Mutation
MYO3B	140469	broad.mit.edu	37	2	171243790	171243790	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:171243790G>T	ENST00000408978.4	+	14	1692	c.1549G>T	c.(1549-1551)Gaa>Taa	p.E517*	MYO3B_ENST00000334231.6_Nonsense_Mutation_p.E526*|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000409044.3_Nonsense_Mutation_p.E517*	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	517	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						ATATCTCCTGGAAAAATCCAG	0.408																																																0			2											73.0	71.0	72.0					2																	171243790		1880	4131	6011	170952036	SO:0001587	stop_gained	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1549G>T	2.37:g.171243790G>T	ENSP00000386213:p.Glu517*	Unknown		x	x	x	170952036	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Nonsense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.609561	0.98387	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.2723	0.98479	0.0:0.0:1.0:0.0	.	.	.	.	X	517;517;516;526;526	.	ENSP00000314213:E516X	E	+	1	0	MYO3B	170952036	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.830000	0.99415	2.793000	0.96121	0.563000	0.77884	GAA		0.408	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			Nonsense_Mutation
GPR155	151556	broad.mit.edu	37	2	175331291	175331291	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:175331291G>C	ENST00000392552.2	-	6	1485	c.1247C>G	c.(1246-1248)aCt>aGt	p.T416S	GPR155_ENST00000295500.4_Missense_Mutation_p.T416S|GPR155_ENST00000392551.2_Missense_Mutation_p.T416S	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	416					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T416S(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						GAGTAAATTAGTTGTAAGCAT	0.313																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	90.0	87.0					2																	175331291		2202	4284	6486	175039537	SO:0001583	missense	151556			AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1247C>G	2.37:g.175331291G>C	ENSP00000376335:p.Thr416Ser	Unknown		x	x	x	175039537	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	37	CCDS2259.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809611	0.31961	.	.	ENSG00000163328	ENST00000392552;ENST00000392551;ENST00000295500	T;T;T	0.43688	0.94;0.94;0.94	5.73	3.93	0.45458	.	0.443842	0.28241	N	0.016072	T	0.29652	0.0740	N	0.21448	0.665	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.18555	-1.0333	10	0.45353	T	0.12	-1.6047	12.1151	0.53860	0.1385:0.0:0.8615:0.0	.	416	Q7Z3F1	GP155_HUMAN	S	416	ENSP00000376335:T416S;ENSP00000376334:T416S;ENSP00000295500:T416S	ENSP00000295500:T416S	T	-	2	0	GPR155	175039537	0.697000	0.27767	0.859000	0.33776	0.964000	0.63967	3.537000	0.53590	0.767000	0.33267	0.650000	0.86243	ACT		0.313	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179604888	179604888	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:179604888C>A	ENST00000591111.1	-	46	12345	c.12121G>T	c.(12121-12123)Gag>Tag	p.E4041*	TTN_ENST00000589042.1_Nonsense_Mutation_p.E4358*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.E4120*|TTN_ENST00000460472.2_Nonsense_Mutation_p.E3995*|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Nonsense_Mutation_p.E4187*|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E3995*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTTAGACTCAATGATTTGG	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	2											80.0	79.0	79.0					2																	179604888		1859	4097	5956	179313133	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12121G>T	2.37:g.179604888C>A	ENSP00000465570:p.Glu4041*	Unknown		x	x	x	179313133	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	52	19.472509	0.99919	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.92	2.99	0.34606	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.0541	0.19802	0.0:0.592:0.127:0.281	.	.	.	.	X	3995;4187;4120;3995	.	ENSP00000340554:E4187X	E	-	1	0	TTN	179313133	0.000000	0.05858	0.017000	0.16124	0.049000	0.14656	-0.319000	0.08039	0.828000	0.34709	0.655000	0.94253	GAG		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Nonsense_Mutation
CCDC141	285025	broad.mit.edu	37	2	179732789	179732789	+	Silent	SNP	G	G	T	rs553756414		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:179732789G>T	ENST00000420890.2	-	16	2655	c.2538C>A	c.(2536-2538)tcC>tcA	p.S846S	CCDC141_ENST00000295723.5_Silent_p.S271S	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	846								p.S271S(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CGACTCCTAAGGAAAGGGCCA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	2											133.0	114.0	120.0					2																	179732789		2203	4300	6503	179441034	SO:0001819	synonymous_variant	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2538C>A	2.37:g.179732789G>T		Unknown		x	x	x	179441034	H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	ENST00000420890.2	37		SNP	35	Broad																																																																																				0.507	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		Silent
WDR75	84128	broad.mit.edu	37	2	190339474	190339474	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:190339474C>G	ENST00000314761.4	+	20	2288	c.2228C>G	c.(2227-2229)tCt>tGt	p.S743C		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	743						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S743C(1)		breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			GTCCTGCCATCTGCTGCTTTC	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											129.0	109.0	116.0					2																	190339474		2203	4300	6503	190047719	SO:0001583	missense	84128			AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.2228C>G	2.37:g.190339474C>G	ENSP00000314193:p.Ser743Cys	Unknown		x	x	x	190047719	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Missense_Mutation	SNP	ENST00000314761.4	37	CCDS2298.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098556	0.56183	.	.	ENSG00000115368	ENST00000314761	T	0.64803	-0.12	5.63	5.63	0.86233	.	0.361239	0.33161	N	0.005201	T	0.75686	0.3883	L	0.59436	1.845	0.46774	D	0.999198	D;D	0.89917	1.0;1.0	D;D	0.65010	0.931;0.931	T	0.75847	-0.3173	10	0.59425	D	0.04	-11.2337	18.2374	0.89954	0.0:1.0:0.0:0.0	.	743;743	A8K330;Q8IWA0	.;WDR75_HUMAN	C	743	ENSP00000314193:S743C	ENSP00000314193:S743C	S	+	2	0	WDR75	190047719	0.995000	0.38212	0.123000	0.21794	0.209000	0.24338	6.673000	0.74482	2.826000	0.97356	0.655000	0.94253	TCT		0.448	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255913.1	NM_032168		Missense_Mutation
SLC40A1	30061	broad.mit.edu	37	2	190430258	190430258	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:190430258C>G	ENST00000261024.2	-	6	1008	c.582G>C	c.(580-582)caG>caC	p.Q194H		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	194					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)	p.Q194H(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			ATGTCATAATCTGGCCAACAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											99.0	102.0	101.0					2																	190430258		2203	4300	6503	190138503	SO:0001583	missense	30061			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.582G>C	2.37:g.190430258C>G	ENSP00000261024:p.Gln194His	Unknown		x	x	x	190138503	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	37	CCDS2299.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586344	0.86851	.	.	ENSG00000138449	ENST00000261024;ENST00000427241	T;D	0.94138	-1.41;-3.36	6.02	5.14	0.70334	Major facilitator superfamily domain, general substrate transporter (1);	0.148106	0.64402	N	0.000007	D	0.95159	0.8431	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92793	0.6250	10	0.27785	T	0.31	-12.0594	11.7984	0.52112	0.0:0.8656:0.0:0.1344	.	194	Q9NP59	S40A1_HUMAN	H	194	ENSP00000261024:Q194H;ENSP00000390005:Q194H	ENSP00000261024:Q194H	Q	-	3	2	SLC40A1	190138503	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.689000	0.46993	2.865000	0.98341	0.655000	0.94253	CAG		0.488	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2			Missense_Mutation
ABCA12	26154	broad.mit.edu	37	2	215807722	215807722	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:215807722G>C	ENST00000272895.7	-	50	7582	c.7363C>G	c.(7363-7365)Ctc>Gtc	p.L2455V	ABCA12_ENST00000389661.4_Missense_Mutation_p.L2137V|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2455	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.L2455V(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTGGTACAGAGAGCTTCACAT	0.383																																					Ovarian(66;664 1488 5121 34295)											1	Substitution - Missense(1)	ovary(1)	2											124.0	106.0	112.0					2																	215807722		2203	4300	6503	215515967	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7363C>G	2.37:g.215807722G>C	ENSP00000272895:p.Leu2455Val	Unknown		x	x	x	215515967	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219891	0.79464	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.97941	-4.62;-4.62	5.65	4.76	0.60689	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.56097	D	0.000033	D	0.98385	0.9463	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.966	D	0.98304	1.0520	10	0.66056	D	0.02	.	14.0358	0.64644	0.0736:0.0:0.9264:0.0	.	2455;2137	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	V	2455;2137	ENSP00000272895:L2455V;ENSP00000374312:L2137V	ENSP00000272895:L2455V	L	-	1	0	ABCA12	215515967	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.272000	0.65559	2.821000	0.97095	0.650000	0.86243	CTC		0.383	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		Missense_Mutation
C2orf57	165100	broad.mit.edu	37	2	232457879	232457879	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:232457879G>T	ENST00000313965.2	+	1	305	c.217G>T	c.(217-219)Gtt>Ttt	p.V73F		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	73								p.V73F(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		CAAGAGTGCAGTTGTTCCAGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											128.0	132.0	131.0					2																	232457879		2203	4300	6503	232166123	SO:0001583	missense	165100			BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.217G>T	2.37:g.232457879G>T	ENSP00000315557:p.Val73Phe	Unknown		x	x	x	232166123	Q8N4F2	Missense_Mutation	SNP	ENST00000313965.2	37	CCDS2487.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	g	12.92	2.083438	0.36758	.	.	ENSG00000177673	ENST00000313965	T	0.18338	2.22	3.62	1.82	0.25136	.	1.814210	0.03502	N	0.218268	T	0.12817	0.0311	N	0.14661	0.345	0.09310	N	1	P	0.49090	0.919	B	0.43536	0.423	T	0.18209	-1.0344	10	0.62326	D	0.03	.	5.5702	0.17192	0.2475:0.0:0.7525:0.0	.	73	Q53QW1	CB057_HUMAN	F	73	ENSP00000315557:V73F	ENSP00000315557:V73F	V	+	1	0	C2orf57	232166123	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.593000	0.23999	0.541000	0.28827	-0.251000	0.11542	GTT		0.522	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256962.1	NM_152614		Missense_Mutation
SAG	6295	broad.mit.edu	37	2	234237227	234237227	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:234237227C>A	ENST00000409110.1	+	8	846	c.616C>A	c.(616-618)Ccc>Acc	p.P206T	SAG_ENST00000449594.2_Missense_Mutation_p.P72T	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	206					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)	p.P206T(1)		cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		GTCTGACAAGCCCCTGCACCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	2											96.0	94.0	95.0					2																	234237227		1993	4169	6162	233901966	SO:0001583	missense	6295				CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.616C>A	2.37:g.234237227C>A	ENSP00000386444:p.Pro206Thr	Unknown		x	x	x	233901966	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	37	CCDS46545.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319868	0.81469	.	.	ENSG00000130561	ENST00000252857;ENST00000409110;ENST00000449594	T;T	0.17213	2.29;2.29	4.19	4.19	0.49359	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42131	0.1189	M	0.84683	2.71	0.58432	D	0.999996	D;D	0.61697	0.989;0.99	P;P	0.58130	0.77;0.833	T	0.52434	-0.8576	10	0.59425	D	0.04	-26.2467	17.1039	0.86657	0.0:1.0:0.0:0.0	.	72;206	B7Z7L5;P10523	.;ARRS_HUMAN	T	206;206;72	ENSP00000386444:P206T;ENSP00000392889:P72T	ENSP00000252857:P206T	P	+	1	0	SAG	233901966	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.830000	0.55768	2.342000	0.79632	0.655000	0.94253	CCC		0.607	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	NM_000541		Missense_Mutation
RBM44	375316	broad.mit.edu	37	2	238737961	238737961	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr2:238737961T>C	ENST00000409864.1	+	13	2959	c.2705T>C	c.(2704-2706)gTt>gCt	p.V902A	RBM44_ENST00000316997.4_Missense_Mutation_p.V902A			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	901	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.V902A(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GTGTGGCCTGTTAAAATTCTT	0.338																																																1	Substitution - Missense(1)	ovary(1)	2											111.0	109.0	110.0					2																	238737961		1830	4087	5917	238402700	SO:0001583	missense	375316			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2705T>C	2.37:g.238737961T>C	ENSP00000386727:p.Val902Ala	Unknown		x	x	x	238402700	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	CCDS46554.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	14.38	2.518769	0.44763	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.12147	2.71;2.71	4.46	3.3	0.37823	.	.	.	.	.	T	0.11281	0.0275	N	0.04746	-0.17	0.29905	N	0.824043	D	0.56968	0.978	P	0.55303	0.773	T	0.05370	-1.0889	9	0.56958	D	0.05	-11.8435	6.1208	0.20151	0.0:0.1144:0.0:0.8856	.	901	Q6ZP01	RBM44_HUMAN	A	902	ENSP00000321179:V902A;ENSP00000386727:V902A	ENSP00000321179:V902A	V	+	2	0	RBM44	238402700	0.957000	0.32711	0.997000	0.53966	0.920000	0.55202	1.873000	0.39558	1.784000	0.52394	0.450000	0.29827	GTT		0.338	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		Missense_Mutation
TGM2	7052	broad.mit.edu	37	20	36784476	36784476	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr20:36784476T>G	ENST00000361475.2	-	3	379	c.206A>C	c.(205-207)cAg>cCg	p.Q69P	TGM2_ENST00000536701.1_Intron|TGM2_ENST00000536724.1_Missense_Mutation_p.Q9P	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	69					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.Q69P(1)		endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	CCCGGCCTCCTGGCTAGGGGC	0.662																																																1	Substitution - Missense(1)	ovary(1)	20											24.0	25.0	24.0					20																	36784476		2203	4300	6503	36217890	SO:0001583	missense	7052			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.206A>C	20.37:g.36784476T>G	ENSP00000355330:p.Gln69Pro	Unknown		x	x	x	36217890	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	ENST00000361475.2	37	CCDS13302.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	5.153	0.213760	0.09810	.	.	ENSG00000198959	ENST00000361475;ENST00000536724;ENST00000373403;ENST00000453095	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	4.93	0.945	0.19543	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.828498	0.11004	N	0.610195	T	0.69611	0.3130	N	0.08118	0	0.09310	N	1	B;B;B;B	0.28667	0.005;0.219;0.019;0.007	B;B;B;B	0.33042	0.018;0.157;0.018;0.031	T	0.58803	-0.7572	10	0.32370	T	0.25	-8.2198	6.7521	0.23493	0.0:0.0782:0.2871:0.6347	.	9;69;69;69	F5H6P0;P21980-3;P21980-2;P21980	.;.;.;TGM2_HUMAN	P	69;9;69;69	ENSP00000355330:Q69P;ENSP00000437479:Q9P;ENSP00000362502:Q69P;ENSP00000387642:Q69P	ENSP00000355330:Q69P	Q	-	2	0	TGM2	36217890	0.912000	0.30974	0.479000	0.27329	0.002000	0.02628	2.971000	0.49248	0.281000	0.22233	-0.441000	0.05720	CAG		0.662	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951		Missense_Mutation
BAGE2	85319	broad.mit.edu	37	21	11098729	11098729	+	RNA	SNP	G	G	A	rs369329468		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr21:11098729G>A	ENST00000470054.1	-	0	196							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ttactgctccggccgccatct	0.627																																																0			21						A		3,4241		0,3,2119	103.0	151.0	135.0				0.0	21		135	0,8514		0,0,4257	no	intergenic				0,3,6376	AA,AG,GG		0.0,0.0707,0.0235			11098729	3,12755	2122	4257	6379	10120600			85317			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11098729G>A		Unknown		x	x	x	10120600	A8K925|Q08ER0	Silent	SNP	ENST00000470054.1	37		SNP	39	Broad																																																																																				0.627	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482		Silent
ADAMTS1	9510	broad.mit.edu	37	21	28216721	28216721	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr21:28216721G>C	ENST00000284984.3	-	1	1007	c.553C>G	c.(553-555)Ctc>Gtc	p.L185V		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	185					heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L185V(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CGCCGCAGGAGGTGGAACTGT	0.726											OREG0026151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	21											7.0	7.0	7.0					21																	28216721		1985	4020	6005	27138592	SO:0001583	missense	9510			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.553C>G	21.37:g.28216721G>C	ENSP00000284984:p.Leu185Val	Unknown	800	x	x	x	27138592	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	2.868	-0.234601	0.05983	.	.	ENSG00000154734	ENST00000284984	T	0.61040	0.14	4.23	3.31	0.37934	.	.	.	.	.	T	0.31071	0.0785	N	0.08118	0	0.24182	N	0.995584	B	0.06786	0.001	B	0.08055	0.003	T	0.19647	-1.0299	9	0.07482	T	0.82	.	8.1739	0.31270	0.0:0.1442:0.5414:0.3144	.	185	Q9UHI8	ATS1_HUMAN	V	185	ENSP00000284984:L185V	ENSP00000284984:L185V	L	-	1	0	ADAMTS1	27138592	0.057000	0.20700	1.000000	0.80357	0.230000	0.25150	2.288000	0.43514	0.923000	0.37045	0.455000	0.32223	CTC		0.726	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			Missense_Mutation
TXNRD2	10587	broad.mit.edu	37	22	19906508	19906508	+	Silent	SNP	G	G	A	rs375701461		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr22:19906508G>A	ENST00000400521.1	-	4	255	c.249C>T	c.(247-249)ggC>ggT	p.G83G	TXNRD2_ENST00000535882.1_Silent_p.G82G|TXNRD2_ENST00000400518.1_Silent_p.G53G|TXNRD2_ENST00000542719.1_Silent_p.G53G|TXNRD2_ENST00000491939.1_5'UTR|TXNRD2_ENST00000334363.9_Silent_p.G83G|TXNRD2_ENST00000400519.1_Silent_p.G82G	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	83					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)	p.G83G(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CGCAGGTGCCGCCGAGGCCCC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	22						G		0,3970		0,0,1985	26.0	29.0	28.0		249	-9.7	0.7	22		28	1,8295		0,1,4147	no	coding-synonymous	TXNRD2	NM_006440.3		0,1,6132	AA,AG,GG		0.0121,0.0,0.0082		83/525	19906508	1,12265	1985	4148	6133	18286508	SO:0001819	synonymous_variant	10587			AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.249C>T	22.37:g.19906508G>A		Unknown		x	x	x	18286508	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	ENST00000400521.1	37	CCDS42981.1	SNP	38	Broad																																																																																				0.592	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000314903.3	NM_006440		Silent
ZNRF3	84133	broad.mit.edu	37	22	29446883	29446883	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr22:29446883C>A	ENST00000544604.2	+	8	2889	c.2714C>A	c.(2713-2715)cCt>cAt	p.P905H	ZNRF3_ENST00000402174.1_Missense_Mutation_p.P805H|ZNRF3_ENST00000332811.4_Missense_Mutation_p.P805H|ZNRF3_ENST00000406323.3_Missense_Mutation_p.P805H	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	905					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P805H(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GCCAACTTCCCTAGTGCCCTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	22											16.0	17.0	16.0					22																	29446883		2025	4180	6205	27776883	SO:0001583	missense	84133			AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.2714C>A	22.37:g.29446883C>A	ENSP00000443824:p.Pro905His	Unknown		x	x	x	27776883	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	37	CCDS56225.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348458	0.41599	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.10960	2.93;2.82;2.82;2.82	5.61	5.61	0.85477	.	0.199902	0.34652	N	0.003785	T	0.18635	0.0447	L	0.47716	1.5	0.23120	N	0.998267	D	0.55172	0.97	P	0.49708	0.62	T	0.02698	-1.1122	10	0.87932	D	0	-14.2509	16.7882	0.85579	0.0:1.0:0.0:0.0	.	905	Q9ULT6	ZNRF3_HUMAN	H	905;805;612;805;805	ENSP00000443824:P905H;ENSP00000328614:P805H;ENSP00000384456:P805H;ENSP00000384553:P805H	ENSP00000328614:P805H	P	+	2	0	ZNRF3	27776883	0.158000	0.22850	0.187000	0.23214	0.030000	0.12068	1.636000	0.37144	2.652000	0.90054	0.655000	0.94253	CCT		0.647	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972		Missense_Mutation
CSF2RB	1439	broad.mit.edu	37	22	37332667	37332667	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr22:37332667G>A	ENST00000403662.3	+	13	1763	c.1541G>A	c.(1540-1542)tGg>tAg	p.W514*	CSF2RB_ENST00000406230.1_Nonsense_Mutation_p.W520*|CSF2RB_ENST00000536485.1_Nonsense_Mutation_p.W461*|CSF2RB_ENST00000262825.5_Nonsense_Mutation_p.W520*			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	514					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.W514*(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CAGGGGCCGTGGGGCAGCCGC	0.637																																																1	Substitution - Nonsense(1)	ovary(1)	22											23.0	25.0	24.0					22																	37332667		2202	4299	6501	35662613	SO:0001587	stop_gained	1439			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1541G>A	22.37:g.37332667G>A	ENSP00000384053:p.Trp514*	Unknown		x	x	x	35662613	Q5JZI1|Q6ICE0	Nonsense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829779	0.71258	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	.	.	.	4.76	-1.33	0.09172	.	3.395970	0.00559	N	0.000270	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	0.65	2.9564	0.05878	0.2871:0.0:0.3852:0.3277	.	.	.	.	X	514;514;520;520;461	.	ENSP00000262825:W520X	W	+	2	0	CSF2RB	35662613	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.388000	0.07352	-0.206000	0.10203	-0.188000	0.12872	TGG		0.637	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		Nonsense_Mutation
EIF3L	51386	broad.mit.edu	37	22	38266330	38266330	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr22:38266330C>A	ENST00000412331.2	+	8	1309	c.727C>A	c.(727-729)Cag>Aag	p.Q243K	EIF3L_ENST00000406934.1_Missense_Mutation_p.Q145K|EIF3L_ENST00000476955.1_3'UTR|EIF3L_ENST00000381683.6_Missense_Mutation_p.Q195K	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L									p.Q243K(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CATCAACCGACAGTTGGAGGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	22											87.0	75.0	79.0					22																	38266330		2203	4300	6503	36596276	SO:0001583	missense	51386			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.727C>A	22.37:g.38266330C>A	ENSP00000416892:p.Gln243Lys	Unknown		x	x	x	36596276		Missense_Mutation	SNP	ENST00000412331.2	37	CCDS13960.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569429	0.86439	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.43294	0.95;0.95;0.95	5.03	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	M	0.90369	3.11	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.995;0.997;0.999;0.999	T	0.72487	-0.4278	10	0.34782	T	0.22	-8.4816	13.7193	0.62717	0.0:0.9251:0.0:0.0749	.	195;145;243;286	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	K	243;286;195;210;145	ENSP00000416892:Q243K;ENSP00000371099:Q195K;ENSP00000384634:Q145K	ENSP00000262832:Q210K	Q	+	1	0	EIF3L	36596276	1.000000	0.71417	0.949000	0.38748	0.929000	0.56500	7.402000	0.79972	1.242000	0.43836	0.462000	0.41574	CAG		0.483	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2	NM_016091		Missense_Mutation
MOV10L1	54456	broad.mit.edu	37	22	50530527	50530527	+	Silent	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr22:50530527G>T	ENST00000262794.5	+	2	278	c.195G>T	c.(193-195)gtG>gtT	p.V65V	MOV10L1_ENST00000540615.1_Silent_p.V45V|MOV10L1_ENST00000545383.1_Silent_p.V65V|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000475190.1_3'UTR|MOV10L1_ENST00000395858.3_Silent_p.V65V	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	65					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTGATGCTGTGACTAGCAGAG	0.443																																																0			22											299.0	249.0	266.0					22																	50530527		2203	4300	6503	48872654	SO:0001819	synonymous_variant	54456			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.195G>T	22.37:g.50530527G>T		Unknown		x	x	x	48872654	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	CCDS14084.1	SNP	45	Broad																																																																																				0.443	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		Silent
RFTN1	23180	broad.mit.edu	37	3	16358606	16358606	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:16358606C>A	ENST00000334133.4	-	10	1738	c.1466G>T	c.(1465-1467)gGa>gTa	p.G489V	OXNAD1_ENST00000606098.1_Intron|RFTN1_ENST00000483671.1_5'UTR|OXNAD1_ENST00000605932.1_Intron|RFTN1_ENST00000432519.1_Missense_Mutation_p.G453V|RP11-415F23.2_ENST00000607464.1_RNA|OXNAD1_ENST00000544043.1_Intron|OXNAD1_ENST00000435829.2_Intron	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	489					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.G489V(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						TCCCATGTCTCCAGCTTTGGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											134.0	125.0	128.0					3																	16358606		2203	4300	6503	16333610	SO:0001583	missense	23180			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.1466G>T	3.37:g.16358606C>A	ENSP00000334153:p.Gly489Val	Unknown		x	x	x	16333610	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	37	CCDS33712.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664441	0.47572	.	.	ENSG00000131378	ENST00000432519;ENST00000334133	T;T	0.42900	0.96;1.05	5.43	1.49	0.22878	.	1.797300	0.02497	N	0.090031	T	0.51160	0.1658	L	0.57536	1.79	0.29984	N	0.817445	D;D	0.56746	0.96;0.977	P;P	0.54100	0.643;0.742	T	0.23084	-1.0198	10	0.72032	D	0.01	-8.4003	3.0083	0.06035	0.1457:0.5567:0.1409:0.1567	.	453;489	G3XAJ6;Q14699	.;RFTN1_HUMAN	V	453;489	ENSP00000403926:G453V;ENSP00000334153:G489V	ENSP00000334153:G489V	G	-	2	0	RFTN1	16333610	0.003000	0.15002	0.001000	0.08648	0.019000	0.09904	0.103000	0.15292	0.054000	0.16065	0.563000	0.77884	GGA		0.493	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150		Missense_Mutation
DHX30	22907	broad.mit.edu	37	3	47882572	47882573	+	Missense_Mutation	DNP	AG	AG	CA			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:47882572_47882573AG>CA	ENST00000445061.1	+	7	979_980	c.572_573AG>CA	c.(571-573)gAG>gCA	p.E191A	DHX30_ENST00000457607.1_Missense_Mutation_p.E219A|DHX30_ENST00000446256.2_Missense_Mutation_p.E152A|DHX30_ENST00000348968.4_Missense_Mutation_p.E163A	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	191	Poly-Glu.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.E191A(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GAAGAAGAGGAGGACGAGGAGG	0.579																																																1	Substitution - Missense(1)	ovary(1)	3																																								47857577	SO:0001583	missense	22907			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	Exception_encountered	3.37:g.47882572_47882573delinsCA	ENSP00000405620:p.Glu191Ala	Unknown		x	x	x	47857576	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	DNP	ENST00000445061.1	37	CCDS2759.1	DNP	11	Broad																																																																																				0.579	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615		Missense_Mutation
HYAL3	8372	broad.mit.edu	37	3	50332752	50332752	+	Silent	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:50332752G>T	ENST00000336307.1	-	2	554	c.282C>A	c.(280-282)ggC>ggA	p.G94G	HYAL3_ENST00000450982.1_Silent_p.G94G|HYAL3_ENST00000513170.1_Intron|HYAL3_ENST00000359051.3_Silent_p.G94G|IFRD2_ENST00000417626.2_5'Flank|IFRD2_ENST00000436390.1_5'Flank|IFRD2_ENST00000336089.4_5'Flank|IFRD2_ENST00000429673.2_5'Flank|HYAL3_ENST00000415204.1_Intron	NM_001200029.1|NM_003549.3	NP_001186958.1|NP_003540.2	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3	94					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)|response to virus (GO:0009615)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|lysosome (GO:0005764)	hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)	p.G94G(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|lung(5)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCTGGGGGATGCCCCCATTGT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	3											123.0	120.0	121.0					3																	50332752		2203	4300	6503	50307756	SO:0001819	synonymous_variant	8372			AF040710	CCDS2815.1, CCDS56259.1, CCDS56260.1, CCDS56257.1	3p21.3	2004-03-12			ENSG00000186792	ENSG00000186792			5322	protein-coding gene	gene with protein product		604038				10493834	Standard	NM_003549		Approved	LUCA-3, LUCA14, Minna14	uc021wyn.1	O43820	OTTHUMG00000156936	ENST00000336307.1:c.282C>A	3.37:g.50332752G>T		Unknown		x	x	x	50307756	O60540|Q8NFK2|Q8NFK3|Q8NFK4|Q96E56|Q9BRW9	Silent	SNP	ENST00000336307.1	37	CCDS2815.1	SNP	46	Broad																																																																																				0.582	HYAL3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000346664.1	NM_003549		Silent
DCBLD2	131566	broad.mit.edu	37	3	98531323	98531323	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:98531323A>G	ENST00000326840.6	-	10	1578	c.1216T>C	c.(1216-1218)Ttt>Ctt	p.F406L	DCBLD2_ENST00000326857.9_Missense_Mutation_p.F406L	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	406	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.F406L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						TTTCCTTGAAATATCTTTAAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	3											46.0	43.0	44.0					3																	98531323		1817	4080	5897	100014013	SO:0001583	missense	131566				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.1216T>C	3.37:g.98531323A>G	ENSP00000321573:p.Phe406Leu	Unknown		x	x	x	100014013	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	ENST00000326840.6	37	CCDS46878.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	26.4	4.736943	0.89482	.	.	ENSG00000057019	ENST00000326840;ENST00000404023;ENST00000326857	D;D	0.84516	-1.86;-1.86	5.88	5.88	0.94601	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.91878	0.7429	M	0.79475	2.455	0.80722	D	1	D;D	0.76494	0.989;0.999	D;D	0.79108	0.935;0.992	D	0.92324	0.5868	10	0.56958	D	0.05	-22.956	14.2535	0.66035	1.0:0.0:0.0:0.0	.	406;406	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	L	406;355;406	ENSP00000321573:F406L;ENSP00000321646:F406L	ENSP00000321573:F406L	F	-	1	0	DCBLD2	100014013	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.651000	0.91078	2.239000	0.73571	0.533000	0.62120	TTT		0.343	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927		Missense_Mutation
NIT2	56954	broad.mit.edu	37	3	100071324	100071324	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:100071324C>T	ENST00000394140.4	+	8	752	c.661C>T	c.(661-663)Cac>Tac	p.H221Y		NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	221	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)	p.H221Y(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						TGCCTGGGGACACAGCACCGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											134.0	118.0	124.0					3																	100071324		2203	4300	6503	101554014	SO:0001583	missense	56954			AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.661C>T	3.37:g.100071324C>T	ENSP00000377696:p.His221Tyr	Unknown		x	x	x	101554014	B2R9A3|D3DN47|Q8WUF0	Missense_Mutation	SNP	ENST00000394140.4	37	CCDS33806.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	28.4	4.919171	0.92249	.	.	ENSG00000114021	ENST00000394140	T	0.63417	-0.04	5.31	5.31	0.75309	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.044152	0.85682	D	0.000000	T	0.72732	0.3497	M	0.89601	3.045	0.80722	D	1	P	0.44776	0.843	B	0.41764	0.366	T	0.80605	-0.1308	10	0.66056	D	0.02	-6.0066	18.5749	0.91151	0.0:1.0:0.0:0.0	.	221	Q9NQR4	NIT2_HUMAN	Y	221	ENSP00000377696:H221Y	ENSP00000377696:H221Y	H	+	1	0	NIT2	101554014	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.360000	0.79487	2.495000	0.84180	0.557000	0.71058	CAC		0.537	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353142.2	NM_020202		Missense_Mutation
NFKBIZ	64332	broad.mit.edu	37	3	101574637	101574637	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:101574637G>A	ENST00000326172.5	+	9	1830	c.1715G>A	c.(1714-1716)aGa>aAa	p.R572K	NFKBIZ_ENST00000326151.5_Missense_Mutation_p.R450K|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.R472K	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	572	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R572K(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						GAACTCCAGAGAAATCAACAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											116.0	108.0	111.0					3																	101574637		2203	4300	6503	103057327	SO:0001583	missense	64332			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1715G>A	3.37:g.101574637G>A	ENSP00000325663:p.Arg572Lys	Unknown		x	x	x	103057327	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	ENST00000326172.5	37	CCDS2946.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.09|11.09	1.537684|1.537684	0.27475|0.27475	.|.	.|.	ENSG00000144802|ENSG00000144802	ENST00000477601|ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172	.|T;T;T;T	.|0.54279	.|0.63;0.58;0.65;0.67	5.92|5.92	2.95|2.95	0.34219|0.34219	.|Ankyrin repeat-containing domain (3);	.|0.416158	.|0.27577	.|N	.|0.018747	T|T	0.21881|0.21881	0.0527|0.0527	N|N	0.05608|0.05608	-0.01|-0.01	0.20489|0.20489	N|N	0.999897|0.999897	.|B;B	.|0.12630	.|0.006;0.003	.|B;B	.|0.10450	.|0.003;0.005	T|T	0.26643|0.26643	-1.0097|-1.0097	5|10	.|0.02654	.|T	.|1	-11.058|-11.058	3.4096|3.4096	0.07353|0.07353	0.1271:0.2732:0.4595:0.1403|0.1271:0.2732:0.4595:0.1403	.|.	.|450;572	.|Q9BYH8-3;Q9BYH8	.|.;IKBZ_HUMAN	K|K	21|472;472;450;572	.|ENSP00000419800:R472K;ENSP00000377618:R472K;ENSP00000325593:R450K;ENSP00000325663:R572K	.|ENSP00000325593:R450K	E|R	+|+	1|2	0|0	NFKBIZ|NFKBIZ	103057327|103057327	0.984000|0.984000	0.35163|0.35163	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	1.203000|1.203000	0.32284|0.32284	0.799000|0.799000	0.34018|0.34018	-0.188000|-0.188000	0.12872|0.12872	GAA|AGA		0.458	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419		Missense_Mutation
ARHGAP31	57514	broad.mit.edu	37	3	119133697	119133697	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:119133697G>A	ENST00000264245.4	+	12	3453	c.2921G>A	c.(2920-2922)aGc>aAc	p.S974N		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	974	Poly-Ser.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TCCTCCAGCAGCTGTGCTAAT	0.542																																					Pancreas(7;176 297 5394 51128 51241)											0			3											103.0	102.0	102.0					3																	119133697		1910	4130	6040	120616387	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2921G>A	3.37:g.119133697G>A	ENSP00000264245:p.Ser974Asn	Unknown		x	x	x	120616387	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222185	0.39300	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.06849	3.25	4.74	4.74	0.60224	.	0.379952	0.25768	N	0.028438	T	0.18425	0.0442	L	0.34521	1.04	0.31274	N	0.691387	D	0.63880	0.993	D	0.72982	0.979	T	0.01218	-1.1415	10	0.41790	T	0.15	.	15.0218	0.71635	0.0:0.0:1.0:0.0	.	974	Q2M1Z3	RHG31_HUMAN	N	974	ENSP00000264245:S974N	ENSP00000264245:S974N	S	+	2	0	ARHGAP31	120616387	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	3.830000	0.55768	2.446000	0.82766	0.462000	0.41574	AGC		0.542	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			Missense_Mutation
PRR23B	389151	broad.mit.edu	37	3	138739309	138739309	+	Silent	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:138739309C>G	ENST00000329447.5	-	1	459	c.195G>C	c.(193-195)gcG>gcC	p.A65A	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	65								p.A65A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGGCACAGCCCGCGGCCAGGA	0.726																																																1	Substitution - coding silent(1)	ovary(1)	3											17.0	16.0	16.0					3																	138739309		2196	4285	6481	140221999	SO:0001819	synonymous_variant	389151			BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.195G>C	3.37:g.138739309C>G		Unknown		x	x	x	140221999	B2RNV9	Silent	SNP	ENST00000329447.5	37	CCDS33868.1	SNP	23	Broad																																																																																				0.726	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361501.1	NM_001013650		Silent
MAN2B2	23324	broad.mit.edu	37	4	6598867	6598867	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr4:6598867A>G	ENST00000285599.3	+	8	1121	c.1085A>G	c.(1084-1086)tAc>tGc	p.Y362C	MAN2B2_ENST00000504248.1_Missense_Mutation_p.Y311C	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	362					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.Y362C(1)		breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						ACGGGCTTCTACACGTCCCGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	4											94.0	103.0	100.0					4																	6598867		2203	4300	6503	6649768	SO:0001583	missense	23324			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1085A>G	4.37:g.6598867A>G	ENSP00000285599:p.Tyr362Cys	Unknown		x	x	x	6649768	Q66MP2|Q86T67	Missense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	SNP	14	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.76|18.76	3.692885|3.692885	0.68271|0.68271	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000505907|ENST00000285599;ENST00000504248	.|D;D	.|0.87334	.|-2.24;-2.24	5.13|5.13	-1.16|-1.16	0.09678|0.09678	.|Glycoside hydrolase, family 38, central domain (2);	.|0.250811	.|0.39759	.|N	.|0.001262	D|D	0.91250|0.91250	0.7242|0.7242	H|H	0.94264|0.94264	3.515|3.515	0.50039|0.50039	D|D	0.999847|0.999847	.|P;P;P	.|0.46784	.|0.727;0.727;0.884	.|P;P;P	.|0.49665	.|0.562;0.478;0.618	D|D	0.90449|0.90449	0.4437|0.4437	5|10	.|0.66056	.|D	.|0.02	-19.2869|-19.2869	10.2095|10.2095	0.43132|0.43132	0.5008:0.0:0.0:0.4992|0.5008:0.0:0.0:0.4992	.|.	.|311;362;362	.|E9PCD7;Q9Y2E5;Q9Y2E5-2	.|.;MA2B2_HUMAN;.	A|C	361|362;311	.|ENSP00000285599:Y362C;ENSP00000423129:Y311C	.|ENSP00000285599:Y362C	T|Y	+|+	1|2	0|0	MAN2B2|MAN2B2	6649768|6649768	1.000000|1.000000	0.71417|0.71417	0.654000|0.654000	0.29608|0.29608	0.939000|0.939000	0.58152|0.58152	4.575000|4.575000	0.60908|0.60908	-0.071000|-0.071000	0.12886|0.12886	0.448000|0.448000	0.29417|0.29417	ACA|TAC		0.627	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274		Missense_Mutation
SPCS3	60559	broad.mit.edu	37	4	177241325	177241325	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr4:177241325A>T	ENST00000503362.1	+	1	211	c.98A>T	c.(97-99)aAa>aTa	p.K33I	RP11-87F15.2_ENST00000512634.1_RNA	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)	33					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)	p.D79V(1)		ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		ACCGCCTTCAAAGACAGGAGC	0.682																																																1	Substitution - Missense(1)	ovary(1)	4											44.0	52.0	49.0					4																	177241325		2018	4183	6201	177478319	SO:0001583	missense	60559			AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.98A>T	4.37:g.177241325A>T	ENSP00000427463:p.Lys33Ile	Unknown		x	x	x	177478319	P12280|Q9H0S7	Missense_Mutation	SNP	ENST00000503362.1	37	CCDS54823.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	10.84	1.465049	0.26335	.	.	ENSG00000129128	ENST00000503362	.	.	.	3.34	3.34	0.38264	.	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	L	0.29908	0.895	0.58432	D	0.999997	B	0.15719	0.014	B	0.25987	0.065	T	0.27434	-1.0074	9	0.21540	T	0.41	-6.895	11.1282	0.48330	1.0:0.0:0.0:0.0	.	33	P61009	SPCS3_HUMAN	I	33	.	ENSP00000427463:K33I	K	+	2	0	SPCS3	177478319	1.000000	0.71417	1.000000	0.80357	0.163000	0.22366	7.270000	0.78493	1.497000	0.48584	0.374000	0.22700	AAA		0.682	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362329.1	NM_021928		Missense_Mutation
EGR1	1958	broad.mit.edu	37	5	137803588	137803588	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr5:137803588T>G	ENST00000239938.4	+	2	1722	c.1450T>G	c.(1450-1452)Tcc>Gcc	p.S484A		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	484					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			gacctacccatccccTGTGCA	0.652																																																0			5											144.0	126.0	132.0					5																	137803588		2203	4300	6503	137831487	SO:0001583	missense	1958			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.1450T>G	5.37:g.137803588T>G	ENSP00000239938:p.Ser484Ala	Unknown		x	x	x	137831487		Missense_Mutation	SNP	ENST00000239938.4	37	CCDS4206.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	12.26	1.885611	0.33255	.	.	ENSG00000120738	ENST00000239938	T	0.08896	3.04	4.24	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.15262	0.0368	M	0.62723	1.935	0.41463	D	0.988052	P	0.38827	0.649	P	0.44673	0.457	T	0.01432	-1.1356	10	0.87932	D	0	-24.9577	12.7025	0.57041	0.0:0.0:0.0:1.0	.	484	P18146	EGR1_HUMAN	A	484	ENSP00000239938:S484A	ENSP00000239938:S484A	S	+	1	0	EGR1	137831487	1.000000	0.71417	0.698000	0.30274	0.772000	0.43724	6.128000	0.71650	1.781000	0.52344	0.533000	0.62120	TCC		0.652	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964		Missense_Mutation
PCDHA9	9752	broad.mit.edu	37	5	140229728	140229728	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr5:140229728A>T	ENST00000532602.1	+	1	2681	c.1648A>T	c.(1648-1650)Acg>Tcg	p.T550S	PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.T550S|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	550	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCAACGTGACGCTGCAGGT	0.677																																					Melanoma(55;1800 1972 14909)											0			5											62.0	68.0	66.0					5																	140229728		2196	4265	6461	140209912	SO:0001583	missense	9752			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1648A>T	5.37:g.140229728A>T	ENSP00000436042:p.Thr550Ser	Unknown		x	x	x	140209912	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	13.96	2.392282	0.42410	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.54479	0.57;0.57	3.39	3.39	0.38822	Cadherin (5);Cadherin-like (1);	0.327060	0.15668	U	0.250555	T	0.63710	0.2534	L	0.42686	1.345	0.32823	D	0.502995	B;D	0.71674	0.153;0.998	B;D	0.80764	0.17;0.994	T	0.71500	-0.4574	10	0.87932	D	0	.	12.2683	0.54691	1.0:0.0:0.0:0.0	.	550;550	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	S	550	ENSP00000436042:T550S;ENSP00000367362:T550S	ENSP00000367362:T550S	T	+	1	0	PCDHA9	140209912	0.003000	0.15002	1.000000	0.80357	0.404000	0.30871	1.482000	0.35486	1.519000	0.48950	0.260000	0.18958	ACG		0.677	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		Missense_Mutation
GCM2	9247	broad.mit.edu	37	6	10874450	10874450	+	Silent	SNP	C	C	T	rs527620122		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr6:10874450C>T	ENST00000379491.4	-	5	1446	c.1299G>A	c.(1297-1299)ccG>ccA	p.P433P	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	433					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P433P(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				TGACTGTCACCGGAGGACCCC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	6											44.0	45.0	45.0					6																	10874450		2203	4300	6503	10982436	SO:0001819	synonymous_variant	9247			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.1299G>A	6.37:g.10874450C>T		Unknown		x	x	x	10982436	D3GDV6|Q5THN5	Silent	SNP	ENST00000379491.4	37	CCDS4517.1	SNP	23	Broad																																																																																				0.552	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039844.1			Silent
HFE	3077	broad.mit.edu	37	6	26091606	26091606	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr6:26091606C>A	ENST00000357618.5	+	3	527	c.405C>A	c.(403-405)taC>taA	p.Y135*	HFE_ENST00000488199.1_Nonsense_Mutation_p.Y47*|HFE_ENST00000349999.4_Nonsense_Mutation_p.Y47*|HFE_ENST00000353147.5_Intron|HFE_ENST00000336625.8_Intron|HFE_ENST00000397022.3_Nonsense_Mutation_p.Y112*|HFE_ENST00000317896.7_Intron|HFE_ENST00000309234.6_Nonsense_Mutation_p.Y135*|HFE_ENST00000352392.4_Intron|HFE_ENST00000470149.1_Nonsense_Mutation_p.Y135*|HFE_ENST00000461397.1_Nonsense_Mutation_p.Y135*	NM_000410.3|NM_139006.2	NP_000401.1|NP_620575.1	Q30201	HFE_HUMAN	hemochromatosis	135	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular iron ion homeostasis (GO:0006879)|cellular response to iron ion starvation (GO:0010106)|female pregnancy (GO:0007565)|hormone biosynthetic process (GO:0042446)|immune response (GO:0006955)|iron ion import into cell (GO:0097459)|multicellular organismal iron ion homeostasis (GO:0060586)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein complex assembly (GO:0006461)	apical part of cell (GO:0045177)|basal part of cell (GO:0045178)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|MHC class I protein complex (GO:0042612)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	peptide antigen binding (GO:0042605)|receptor binding (GO:0005102)	p.Y135*(1)		endometrium(3)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCGAGGGCTACTGGAAGTACG	0.547									Hemochromatosis																																							1	Substitution - Nonsense(1)	ovary(1)	6											96.0	76.0	83.0					6																	26091606		2203	4300	6503	26199585	SO:0001587	stop_gained	3077	Familial Cancer Database			CCDS4578.1, CCDS4579.1, CCDS4580.1, CCDS4581.1, CCDS4582.1, CCDS47386.1, CCDS47387.1, CCDS54974.1, CCDS54975.1, CCDS75412.1	6p21.3	2014-09-17			ENSG00000010704	ENSG00000010704		"""Immunoglobulin superfamily / C1-set domain containing"""	4886	protein-coding gene	gene with protein product	"""high Fe"""	613609				3460331	Standard	XR_241893		Approved	HLA-H	uc003nfx.1	Q30201	OTTHUMG00000016348	ENST00000357618.5:c.405C>A	6.37:g.26091606C>A	ENSP00000417404:p.Tyr135*	Unknown		x	x	x	26199585	B2CKL0|O75929|O75930|O75931|Q17RT0|Q96KU5|Q96KU6|Q96KU7|Q96KU8|Q9HC64|Q9HC68|Q9HC70|Q9HC83	Nonsense_Mutation	SNP	ENST00000357618.5	37	CCDS4578.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001790	0.74932	.	.	ENSG00000010704	ENST00000349999;ENST00000397022;ENST00000535098;ENST00000539147;ENST00000357618;ENST00000470149;ENST00000461397;ENST00000488199;ENST00000309234	.	.	.	5.28	3.48	0.39840	.	0.694981	0.13837	N	0.359306	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.3431	0.15994	0.0:0.657:0.1682:0.1748	.	.	.	.	X	47;112;135;30;135;135;135;47;135	.	ENSP00000311698:Y135X	Y	+	3	2	HFE	26199585	0.978000	0.34361	0.510000	0.27712	0.805000	0.45488	0.511000	0.22739	0.782000	0.33613	0.655000	0.94253	TAC		0.547	HFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356133.1			Nonsense_Mutation
GNL1	2794	broad.mit.edu	37	6	30514931	30514931	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr6:30514931G>A	ENST00000376621.3	-	10	2369	c.1399C>T	c.(1399-1401)Ccc>Tcc	p.P467S		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	467					cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.P467S(1)		cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						TCCGCTGAGGGGTCCTCAGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	6											94.0	100.0	98.0					6																	30514931		1511	2708	4219	30622910	SO:0001583	missense	2794				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1399C>T	6.37:g.30514931G>A	ENSP00000365806:p.Pro467Ser	Unknown		x	x	x	30622910	B0S838|Q96CT5	Missense_Mutation	SNP	ENST00000376621.3	37	CCDS4680.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	14.02	2.411663	0.42817	.	.	ENSG00000204590	ENST00000376621;ENST00000426875;ENST00000429126	T	0.48522	0.81	4.99	4.04	0.47022	.	0.579041	0.17484	N	0.172599	T	0.12390	0.0301	N	0.19112	0.55	0.36319	D	0.858154	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.14671	-1.0464	10	0.13853	T	0.58	-21.5383	5.5565	0.17119	0.1092:0.2049:0.6858:0.0	.	465;264;467	B4DYK6;B4DWZ0;P36915	.;.;GNL1_HUMAN	S	467;289;264	ENSP00000365806:P467S	ENSP00000365806:P467S	P	-	1	0	GNL1	30622910	0.047000	0.20315	0.969000	0.41365	0.912000	0.54170	0.732000	0.26072	2.592000	0.87571	0.555000	0.69702	CCC		0.632	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2			Missense_Mutation
PTCHD4	442213	broad.mit.edu	37	6	47976544	47976544	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr6:47976544G>C	ENST00000339488.4	-	2	766	c.733C>G	c.(733-735)Ctg>Gtg	p.L245V	PTCHD4_ENST00000543600.1_Missense_Mutation_p.L228V	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	245	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.					integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.L245V(1)									GCTGTGGTCAGGATCAGCACG	0.562																																																1	Substitution - Missense(1)	ovary(1)	6											69.0	71.0	70.0					6																	47976544		2042	4206	6248	48084503	SO:0001583	missense	442213				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.733C>G	6.37:g.47976544G>C	ENSP00000341914:p.Leu245Val	Unknown		x	x	x	48084503	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	CCDS34473.2	SNP	35	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.27|12.27	1.887946|1.887946	0.33348|0.33348	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000339488;ENST00000543600|ENST00000398738	D;D|.	0.92647|.	-3.08;-3.08|.	6.16|6.16	3.95|3.95	0.45737|0.45737	Sterol-sensing domain (1);|.	0.307523|.	0.29493|.	N|.	0.011981|.	T|T	0.31451|0.31451	0.0797|0.0797	N|N	0.16602|0.16602	0.42|0.42	0.53688|0.53688	D|D	0.99997|0.99997	B;D|.	0.76494|.	0.178;0.999|.	B;D|.	0.80764|.	0.103;0.994|.	T|T	0.17930|0.17930	-1.0353|-1.0353	10|5	0.15499|.	T|.	0.54|.	.|.	13.2098|13.2098	0.59817|0.59817	0.1596:0.0:0.8404:0.0|0.1596:0.0:0.8404:0.0	.|.	245;228|.	Q6ZW05;B0QZ29|.	CF138_HUMAN;.|.	V|R	245;228|244	ENSP00000341914:L245V;ENSP00000439864:L228V|.	ENSP00000341914:L245V|.	L|P	-|-	1|2	2|0	C6orf138|C6orf138	48084503|48084503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	6.313000|6.313000	0.72844|0.72844	1.487000|1.487000	0.48415|0.48415	0.650000|0.650000	0.86243|0.86243	CTG|CCT		0.562	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		Missense_Mutation
TCF21	6943	broad.mit.edu	37	6	134210774	134210774	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr6:134210774A>C	ENST00000367882.4	+	1	499	c.239A>C	c.(238-240)cAg>cCg	p.Q80P	RP3-323P13.2_ENST00000606544.1_RNA|TCF21_ENST00000237316.3_Missense_Mutation_p.Q80P|RP3-323P13.2_ENST00000607641.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607033.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	80	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q80P(1)		cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		AAGCAGGTCCAGCGCAACGCC	0.711																																																1	Substitution - Missense(1)	ovary(1)	6											40.0	47.0	45.0					6																	134210774		2203	4299	6502	134252467	SO:0001583	missense	6943			AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.239A>C	6.37:g.134210774A>C	ENSP00000356857:p.Gln80Pro	Unknown		x	x	x	134252467	E1P581|O43545|Q6ICV0|Q9BZ14	Missense_Mutation	SNP	ENST00000367882.4	37	CCDS5167.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.152825	0.78001	.	.	ENSG00000118526	ENST00000367882;ENST00000237316	D;D	0.98105	-4.72;-4.72	4.47	4.47	0.54385	Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99804	1.1037	10	0.87932	D	0	-18.4361	13.7766	0.63057	1.0:0.0:0.0:0.0	.	80	O43680	TCF21_HUMAN	P	80	ENSP00000356857:Q80P;ENSP00000237316:Q80P	ENSP00000237316:Q80P	Q	+	2	0	TCF21	134252467	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.300000	0.96151	1.654000	0.50703	0.379000	0.24179	CAG		0.711	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392		Missense_Mutation
FOXK1	221937	broad.mit.edu	37	7	4800797	4800797	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr7:4800797C>G	ENST00000328914.4	+	8	1799	c.1799C>G	c.(1798-1800)aCg>aGg	p.T600R	FOXK1_ENST00000446823.1_Missense_Mutation_p.T437R	NM_001037165.1	NP_001032242.1			forkhead box K1									p.T600R(1)|p.T578R(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CCCGGACACACGGTCACCATC	0.667																																																2	Substitution - Missense(2)	ovary(2)	7											45.0	47.0	46.0					7																	4800797		2203	4298	6501	4767323	SO:0001583	missense	221937			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1799C>G	7.37:g.4800797C>G	ENSP00000328720:p.Thr600Arg	Unknown		x	x	x	4767323		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635606	0.47049	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.97209	-3.78;-4.29	5.46	5.46	0.80206	.	0.119854	0.56097	D	0.000027	D	0.97247	0.9100	L	0.55990	1.75	0.43080	D	0.994736	D;D	0.64830	0.99;0.994	P;P	0.57548	0.669;0.823	D	0.97232	0.9885	10	0.46703	T	0.11	.	16.4776	0.84136	0.0:1.0:0.0:0.0	.	600;437	P85037;P85037-2	FOXK1_HUMAN;.	R	437;356;600;483	ENSP00000394442:T437R;ENSP00000328720:T600R	ENSP00000328720:T600R	T	+	2	0	FOXK1	4767323	0.996000	0.38824	0.639000	0.29394	0.050000	0.14768	3.435000	0.52849	2.573000	0.86826	0.655000	0.94253	ACG		0.667	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2			Missense_Mutation
MOGAT3	346606	broad.mit.edu	37	7	100844038	100844038	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr7:100844038A>T	ENST00000223114.4	-	1	264	c.98T>A	c.(97-99)tTc>tAc	p.F33Y	MOGAT3_ENST00000440203.2_Missense_Mutation_p.F33Y|MOGAT3_ENST00000379423.3_Missense_Mutation_p.F33Y	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	33					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					CATGAAGAGGAAAGTGAGCAC	0.602																																																0			7											90.0	70.0	76.0					7																	100844038		2203	4300	6503	100630758	SO:0001583	missense	346606			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.98T>A	7.37:g.100844038A>T	ENSP00000223114:p.Phe33Tyr	Unknown		x	x	x	100630758	Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	CCDS5714.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	.	19.12	3.764968	0.69878	.	.	ENSG00000106384	ENST00000223114;ENST00000440203;ENST00000379423	T;T;T	0.36520	2.35;1.71;1.25	4.46	3.28	0.37604	.	0.070265	0.56097	D	0.000027	T	0.29976	0.0750	N	0.08118	0	0.31008	N	0.719532	D;D	0.64830	0.994;0.994	P;P	0.59424	0.857;0.831	T	0.16958	-1.0385	10	0.33940	T	0.23	-4.0501	8.2616	0.31788	0.7985:0.2014:0.0:0.0	.	33;33	Q86VF5-2;Q86VF5	.;MOGT3_HUMAN	Y	33	ENSP00000223114:F33Y;ENSP00000403756:F33Y;ENSP00000368734:F33Y	ENSP00000223114:F33Y	F	-	2	0	MOGAT3	100630758	0.997000	0.39634	0.013000	0.15412	0.956000	0.61745	2.912000	0.48782	0.847000	0.35167	0.448000	0.29417	TTC		0.602	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		Missense_Mutation
FAM131B	9715	broad.mit.edu	37	7	143056027	143056027	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr7:143056027C>T	ENST00000409408.1	-	4	1983	c.275G>A	c.(274-276)gGg>gAg	p.G92E	FAM131B_ENST00000409222.3_Missense_Mutation_p.G92E|FAM131B_ENST00000409346.1_Missense_Mutation_p.G92E|FAM131B_ENST00000409578.1_Missense_Mutation_p.G108E|FAM131B_ENST00000443739.2_Missense_Mutation_p.G120E			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	92								p.G92V(1)|p.G120V(1)|p.G120E(1)|p.G92E(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TGGTGTCTTCCCCCAGCCCTG	0.607																																																4	Substitution - Missense(4)	ovary(2)|lung(2)	7											81.0	62.0	69.0					7																	143056027		2203	4300	6503	142766149	SO:0001583	missense	9715			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.275G>A	7.37:g.143056027C>T	ENSP00000387017:p.Gly92Glu	Unknown		x	x	x	142766149	A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	ENST00000409408.1	37	CCDS5882.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916680	0.92249	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	5.26	5.26	0.73747	.	0.046471	0.85682	D	0.000000	T	0.49592	0.1566	M	0.63843	1.955	0.80722	D	1	D;D	0.71674	0.998;0.98	D;P	0.69479	0.964;0.773	T	0.48234	-0.9053	10	0.56958	D	0.05	-6.2043	18.8528	0.92240	0.0:1.0:0.0:0.0	.	108;92	Q86XD5-2;Q86XD5	.;F131B_HUMAN	E	120;108;92;96;92;92	ENSP00000410603:G120E;ENSP00000386568:G108E;ENSP00000386984:G92E;ENSP00000387017:G92E;ENSP00000387147:G92E	ENSP00000387147:G92E	G	-	2	0	FAM131B	142766149	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.774000	0.68906	2.442000	0.82660	0.561000	0.74099	GGG		0.607	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		Missense_Mutation
USP17L2	377630	broad.mit.edu	37	8	11995276	11995276	+	Missense_Mutation	SNP	C	C	T	rs372605534	byFrequency	TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr8:11995276C>T	ENST00000333796.3	-	1	1310	c.994G>A	c.(994-996)Gac>Aac	p.D332N	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	332	USP.			D -> N (in Ref. 1; AAR91701). {ECO:0000305}.	apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D332N(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TAATGTCCGTCGTGACAACTC	0.493													T|||	288	0.057508	0.1876	0.0288	5008	,	,		20795	0.005		0.003	False		,,,				2504	0.0123															1	Substitution - Missense(1)	ovary(1)	8											21.0	24.0	23.0					8																	11995276		1690	3931	5621	12032685	SO:0001583	missense	377630			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.994G>A	8.37:g.11995276C>T	ENSP00000333329:p.Asp332Asn	Unknown		x	x	x	12032685		Missense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	T	4.883	0.164168	0.09287	.	.	ENSG00000223443	ENST00000333796	T	0.28895	1.59	0.935	-0.328	0.12690	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.717965	0.12292	N	0.481969	T	0.12817	0.0311	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42378	-0.9455	8	0.08381	T	0.77	.	6.32	0.21213	0.0:0.6535:0.0:0.3465	.	332	Q6R6M4	U17L2_HUMAN	N	332	ENSP00000333329:D332N	ENSP00000333329:D332N	D	-	1	0	USP17L2	12032685	1.000000	0.71417	0.001000	0.08648	0.007000	0.05969	2.426000	0.44731	-0.621000	0.05633	-0.849000	0.03036	GAC		0.493	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402		Missense_Mutation
WRN	7486	broad.mit.edu	37	8	30924675	30924675	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr8:30924675C>G	ENST00000298139.5	+	6	880	c.631C>G	c.(631-633)Ctg>Gtg	p.L211V		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	211	3'-5' exonuclease.|Interaction with WRNIP1. {ECO:0000250}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.L211V(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GGACCAGAAACTGTATGCAGC	0.343			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	1	Substitution - Missense(1)	ovary(1)	8											77.0	69.0	72.0					8																	30924675		2203	4300	6503	31044217	SO:0001583	missense	7486	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.631C>G	8.37:g.30924675C>G	ENSP00000298139:p.Leu211Val	Unknown		x	x	x	31044217	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254685	0.39896	.	.	ENSG00000165392	ENST00000298139	T	0.64260	-0.09	5.68	1.69	0.24217	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.351767	0.25112	N	0.033048	T	0.48750	0.1517	L	0.43554	1.36	0.23930	N	0.996431	B	0.23591	0.088	B	0.32289	0.143	T	0.42275	-0.9461	10	0.49607	T	0.09	-3.5408	2.0348	0.03537	0.1382:0.4726:0.135:0.2541	.	211	Q14191	WRN_HUMAN	V	211	ENSP00000298139:L211V	ENSP00000298139:L211V	L	+	1	2	WRN	31044217	0.069000	0.21087	0.998000	0.56505	0.997000	0.91878	-0.320000	0.08028	0.748000	0.32831	0.561000	0.74099	CTG		0.343	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			Missense_Mutation
ADAM18	8749	broad.mit.edu	37	8	39502937	39502937	+	Silent	SNP	T	T	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr8:39502937T>C	ENST00000265707.5	+	11	1035	c.990T>C	c.(988-990)gaT>gaC	p.D330D	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Silent_p.D306D	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	330	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D330D(1)		NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TAACATATGATGACATCACTC	0.323																																																1	Substitution - coding silent(1)	ovary(1)	8											129.0	116.0	120.0					8																	39502937		2203	4300	6503	39622094	SO:0001819	synonymous_variant	8749			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.990T>C	8.37:g.39502937T>C		Unknown		x	x	x	39622094	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	ENST00000265707.5	37	CCDS6113.1	SNP	51	Broad																																																																																				0.323	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237		Silent
TMEM70	54968	broad.mit.edu	37	8	74888635	74888635	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr8:74888635C>A	ENST00000312184.5	+	1	192	c.119C>A	c.(118-120)tCc>tAc	p.S40Y	TMEM70_ENST00000517439.1_Missense_Mutation_p.S40Y|TMEM70_ENST00000523794.1_3'UTR	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	40					mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)		p.S40Y(1)		breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			TCCCGGGCGTCCTCCAGCAGC	0.746																																																1	Substitution - Missense(1)	ovary(1)	8											8.0	10.0	9.0					8																	74888635		2175	4246	6421	75051189	SO:0001583	missense	54968			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.119C>A	8.37:g.74888635C>A	ENSP00000312599:p.Ser40Tyr	Unknown		x	x	x	75051189	E9PDY9|Q9NWY5	Missense_Mutation	SNP	ENST00000312184.5	37	CCDS6215.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494870	0.64186	.	.	ENSG00000175606	ENST00000517439;ENST00000312184	T;T	0.48522	0.81;1.15	3.77	2.89	0.33648	.	0.644029	0.13635	N	0.373377	T	0.25680	0.0625	N	0.14661	0.345	0.09310	N	1	P;P	0.49447	0.924;0.875	B;B	0.37888	0.26;0.198	T	0.04522	-1.0945	10	0.40728	T	0.16	-2.9418	7.2929	0.26376	0.0:0.8792:0.0:0.1208	.	40;40	E9PDY9;Q9BUB7	.;TMM70_HUMAN	Y	40	ENSP00000429467:S40Y;ENSP00000312599:S40Y	ENSP00000312599:S40Y	S	+	2	0	TMEM70	75051189	0.341000	0.24801	0.207000	0.23584	0.005000	0.04900	0.362000	0.20284	1.194000	0.43101	0.491000	0.48974	TCC		0.746	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379028.1	NM_017866		Missense_Mutation
ANKRD20A2	441430	broad.mit.edu	37	9	42368519	42368519	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr9:42368519G>T	ENST00000377601.2	+	1	217	c.105G>T	c.(103-105)caG>caT	p.Q35H	RP11-216M21.7_ENST00000450520.1_RNA	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	35								p.Q35H(1)		large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						CCGAACTGCAGAAGATCCACA	0.652																																																1	Substitution - Missense(1)	ovary(1)	9											2.0	2.0	2.0					9																	42368519		1151	2406	3557	42358515	SO:0001583	missense	441430				CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.105G>T	9.37:g.42368519G>T	ENSP00000366826:p.Gln35His	Unknown		x	x	x	42358515		Missense_Mutation	SNP	ENST00000377601.2	37	CCDS35028.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	10.10	1.258652	0.23051	.	.	ENSG00000183148	ENST00000377601	T	0.52754	0.65	1.23	-2.46	0.06461	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.41096	0.1144	N	0.22421	0.69	0.09310	N	1	P;P	0.50156	0.932;0.932	P;B	0.58520	0.84;0.34	T	0.27938	-1.0059	9	0.45353	T	0.12	.	2.8159	0.05456	0.3812:0.2493:0.3694:0.0	.	35;35	Q5CZ79;Q5SQ80	AN20B_HUMAN;A20A2_HUMAN	H	35	ENSP00000366826:Q35H	ENSP00000366826:Q35H	Q	+	3	2	ANKRD20A2	42358515	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-3.789000	0.00366	-1.092000	0.03062	0.121000	0.15741	CAG		0.652	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129794.1	NM_001012421		Missense_Mutation
RABGAP1	23637	broad.mit.edu	37	9	125746913	125746913	+	Silent	SNP	C	C	G	rs376306008		TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr9:125746913C>G	ENST00000373647.4	+	3	434	c.300C>G	c.(298-300)ctC>ctG	p.L100L		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	100					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.L28L(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						CTAATCAGCTCTCCGCTTCAT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	9											142.0	111.0	122.0					9																	125746913		2203	4300	6503	124786734	SO:0001819	synonymous_variant	23637			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.300C>G	9.37:g.125746913C>G		Unknown		x	x	x	124786734	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2	SNP	32	Broad																																																																																				0.502	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197		Silent
ADAMTS13	11093	broad.mit.edu	37	9	136319629	136319629	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr9:136319629A>T	ENST00000371929.3	+	24	3581	c.3137A>T	c.(3136-3138)cAg>cTg	p.Q1046L	ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.Q1046L|ADAMTS13_ENST00000371910.1_5'Flank|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.Q1015L|ADAMTS13_ENST00000371916.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	1046	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GACCAAGGCCAGGACGTGGAG	0.662																																																0			9											78.0	64.0	69.0					9																	136319629		2202	4300	6502	135309450	SO:0001583	missense	11093			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.3137A>T	9.37:g.136319629A>T	ENSP00000360997:p.Gln1046Leu	Unknown		x	x	x	135309450	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	7.293	0.611523	0.14066	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.69175	-0.35;-0.38;-0.36	5.59	-2.87	0.05700	.	.	.	.	.	T	0.43211	0.1237	N	0.19112	0.55	0.47094	D	0.99931	B;B;B	0.13145	0.0;0.007;0.007	B;B;B	0.10450	0.004;0.005;0.005	T	0.04976	-1.0914	9	0.31617	T	0.26	.	5.8532	0.18704	0.429:0.0:0.4252:0.1458	.	1046;1015;1046	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	L	1046;1046;1015	ENSP00000360997:Q1046L;ENSP00000347927:Q1046L;ENSP00000348997:Q1015L	ENSP00000347927:Q1046L	Q	+	2	0	ADAMTS13	135309450	0.000000	0.05858	0.368000	0.25939	0.015000	0.08874	-1.076000	0.03420	-0.505000	0.06568	-0.366000	0.07423	CAG		0.662	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		Missense_Mutation
BMX	660	broad.mit.edu	37	X	15548148	15548148	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chrX:15548148A>C	ENST00000357607.2	+	10	1125	c.937A>C	c.(937-939)Aag>Cag	p.K313Q	BMX_ENST00000342014.6_Missense_Mutation_p.K313Q|BMX_ENST00000348343.6_Missense_Mutation_p.K313Q			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	313	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)	p.K313Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					ACTCAGACAAAAGGTAAATAG	0.358																																																1	Substitution - Missense(1)	ovary(1)	X											82.0	75.0	78.0					X																	15548148		2203	4300	6503	15458069	SO:0001583	missense	660			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.937A>C	X.37:g.15548148A>C	ENSP00000350224:p.Lys313Gln	Unknown		x	x	x	15458069	A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	37	CCDS14168.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759832	0.69763	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	D;D;D	0.88741	-2.42;-2.42;-2.42	5.03	5.03	0.67393	SH2 motif (4);	0.216848	0.32952	N	0.005442	D	0.88217	0.6377	N	0.16862	0.45	0.36802	D	0.88541	D	0.76494	0.999	D	0.65874	0.939	D	0.90832	0.4717	10	0.62326	D	0.03	.	11.3538	0.49605	1.0:0.0:0.0:0.0	.	313	P51813	BMX_HUMAN	Q	313	ENSP00000350224:K313Q;ENSP00000308774:K313Q;ENSP00000340082:K313Q	ENSP00000340082:K313Q	K	+	1	0	BMX	15458069	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.037000	0.41174	1.765000	0.52091	0.486000	0.48141	AAG		0.358	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	NM_001721		Missense_Mutation
SUPT20HL1	100130302	broad.mit.edu	37	X	24382764	24382764	+	IGR	SNP	T	T	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chrX:24382764T>C								AC004552.1 (15741 upstream) : PDK3 (100573 downstream)														p.P634P(1)									GTTTCAAGCCTGTGCAGGCCC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	X											24.0	24.0	24.0					X																	24382764		1568	3581	5149	24292685	SO:0001628	intergenic_variant	100130302																															X.37:g.24382764T>C		Unknown		x	x	x	24292685		Silent	SNP		37		SNP	55	Broad																																																																																			0	0.632									Silent
POLA1	5422	broad.mit.edu	37	X	24745898	24745898	+	Splice_Site	SNP	G	G	C			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chrX:24745898G>C	ENST00000379059.3	+	15	1528		c.e15-1		POLA1_ENST00000493342.1_Splice_Site|POLA1_ENST00000379068.3_Splice_Site	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit						cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TTCTCTTTCAGAGCTCTTGAA	0.383																																																0			X											125.0	105.0	112.0					X																	24745898		2203	4300	6503	24655819	SO:0001630	splice_region_variant	5422				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1514-1G>C	X.37:g.24745898G>C		Unknown		x	x	x	24655819	Q86UQ7	Splice_Site_SNP	SNP	ENST00000379059.3	37	CCDS14214.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	18.70	3.680301	0.68042	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6059	0.88037	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLA1	24655819	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	9.119000	0.94362	2.343000	0.79666	0.513000	0.50165	.		0.383	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	Intron	Splice_Site_SNP
PAK3	5063	broad.mit.edu	37	X	110391037	110391037	+	Nonsense_Mutation	SNP	C	C	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chrX:110391037C>T	ENST00000372010.1	+	8	836	c.394C>T	c.(394-396)Caa>Taa	p.Q132*	PAK3_ENST00000262836.4_Nonsense_Mutation_p.Q132*|PAK3_ENST00000518291.1_Nonsense_Mutation_p.Q153*|PAK3_ENST00000360648.4_Nonsense_Mutation_p.Q153*|PAK3_ENST00000446737.1_Nonsense_Mutation_p.Q117*|PAK3_ENST00000417227.1_Nonsense_Mutation_p.Q138*|PAK3_ENST00000425146.1_Nonsense_Mutation_p.Q117*|PAK3_ENST00000519681.1_Nonsense_Mutation_p.Q138*|PAK3_ENST00000372007.5_Nonsense_Mutation_p.Q117*			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	132	Autoregulatory region. {ECO:0000250}.|Linker.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						GAAGAACCCACAAGCTGTTCT	0.408										TSP Lung(19;0.15)																																						0			X											116.0	101.0	106.0					X																	110391037		2203	4300	6503	110277693	SO:0001587	stop_gained	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.394C>T	X.37:g.110391037C>T	ENSP00000361080:p.Gln132*	Unknown		x	x	x	110277693	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Nonsense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	38	6.995052	0.97990	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	.	.	.	5.74	4.85	0.62838	.	0.117195	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	15.0718	0.72042	0.1428:0.8572:0.0:0.0	.	.	.	.	X	117;117;132;138;117;153;153;153;138;132	.	ENSP00000262836:Q132X	Q	+	1	0	PAK3	110277693	1.000000	0.71417	0.278000	0.24718	0.802000	0.45316	7.487000	0.81328	1.135000	0.42183	0.538000	0.68166	CAA		0.408	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578		Nonsense_Mutation
GPR50	9248	broad.mit.edu	37	X	150348554	150348554	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chrX:150348554G>T	ENST00000218316.3	+	2	568	c.499G>T	c.(499-501)Ggc>Tgc	p.G167C	AF003625.3_ENST00000602313.1_lincRNA|GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	167					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.G167C(1)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CATGTACATTGGCACCATCGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	X											193.0	174.0	180.0					X																	150348554		2199	4290	6489	150099212	SO:0001583	missense	9248			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.499G>T	X.37:g.150348554G>T	ENSP00000218316:p.Gly167Cys	Unknown		x	x	x	150099212	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954798	0.53293	.	.	ENSG00000102195	ENST00000535473;ENST00000218316	T	0.40756	1.02	4.32	3.43	0.39272	GPCR, rhodopsin-like superfamily (1);	0.102201	0.64402	D	0.000002	T	0.70518	0.3233	H	0.95574	3.69	0.43107	D	0.9948	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.76055	-0.3099	10	0.45353	T	0.12	-18.8558	9.9231	0.41476	0.1129:0.0:0.8871:0.0	.	120;167	F5H1S3;Q13585	.;MTR1L_HUMAN	C	120;167	ENSP00000218316:G167C	ENSP00000218316:G167C	G	+	1	0	GPR50	150099212	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	5.579000	0.67457	1.898000	0.54952	0.523000	0.50628	GGC		0.527	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		Missense_Mutation
DMKN	93099	broad.mit.edu	37	19	36002362	36002412	+	In_Frame_Del	DEL	CTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	CTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	-	rs112672248|rs142519211|rs144877871|rs544198244|rs199498909|rs11667007|rs12981076|rs146822312|rs148799704|rs138902616|rs56743379|rs140071083|rs371511253|rs117522133|rs59309505|rs113540509|rs111543270|rs58579970|rs201369392	byFrequency	TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr19:36002362_36002412delCTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	ENST00000339686.3	-	5	995_1045	c.819_869delCAGTGGCAGCAGCAGTGGCGGCAGCAGTGGCGGCAGCAGTGGTGGCAGCAG	c.(817-870)agcagtggcagcagcagtggcggcagcagtggcggcagcagtggtggcagcagt>agt	p.273_290SSGSSSGGSSGGSSGGSS>S	DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000440396.1_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000451297.2_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000418261.1_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000447113.2_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000424570.2_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000461300.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	273	Gly-rich.		G -> S (in dbSNP:rs11667007). {ECO:0000269|PubMed:17380110}.	G -> GSSSG (in Ref. 4; AAQ88778). {ECO:0000305}.		extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			actgttgccactgctgccaccactgctgccgccactgctgccgccactgctgctgccactgctgctgccac	0.641																																																1	Deletion - In frame(1)	ovary(1)	19							,,,,,,	1051,3093		133,785,1154					,,,,,,	-3.2	0.0		dbSNP_130	28	1360,6640		184,992,2824	no	coding,coding,coding,intron,coding,coding,intron	DMKN	NM_033317.4,NM_001190349.1,NM_001190348.1,NM_001190347.1,NM_001126058.2,NM_001126057.2,NM_001126056.2	,,,,,,	317,1777,3978	A1A1,A1R,RR		17.0,25.362,19.8534	,,,,,,	,,,,,,		2411,9733				40694252	SO:0001651	inframe_deletion	93099			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.819_869delCAGTGGCAGCAGCAGTGGCGGCAGCAGTGGCGGCAGCAGTGGTGGCAGCAG	19.37:g.36002362_36002412delCTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	ENSP00000342012:p.Ser273_Ser289del	Unknown		Capture	Illumina GAIIx	Phase_I	40694202	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	In_Frame_Del	DEL	ENST00000339686.3	37	CCDS12463.1	DEL	20	Broad																																																																																				0.641	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317		In_Frame_Del
SLC35G2	80723	broad.mit.edu	37	3	136573502	136573516	+	In_Frame_Del	DEL	CTTTCTTTGGAACCA	CTTTCTTTGGAACCA	-			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr3:136573502_136573516delCTTTCTTTGGAACCA	ENST00000446465.2	+	2	828_842	c.200_214delCTTTCTTTGGAACCA	c.(199-216)gctttctttggaaccatg>gtg	p.67_72AFFGTM>V	RP11-85F14.5_ENST00000474250.1_RNA|RP11-85F14.5_ENST00000470236.1_RNA|RP11-85F14.5_ENST00000461864.1_RNA|SLC35G2_ENST00000393079.3_In_Frame_Del_p.67_72AFFGTM>V	NM_025246.2	NP_079522.2			solute carrier family 35, member G2									p.A67_M72>V(1)									AAAGGGAGAGCTTTCTTTGGAACCATGGATACCCT	0.386																																																1	Complex - deletion inframe(1)	ovary(1)	3																																								138056206	SO:0001651	inframe_deletion	80723			BC022557	CCDS3091.1	3q22.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000168917	ENSG00000168917		"""Solute carriers"""	28480	protein-coding gene	gene with protein product			"""transmembrane protein 22"""	TMEM22		11230166	Standard	NM_001097600		Approved	MGC3295, DKFZp564K2464	uc003erf.4	Q8TBE7	OTTHUMG00000159787	ENST00000446465.2:c.200_214delCTTTCTTTGGAACCA	3.37:g.136573502_136573516delCTTTCTTTGGAACCA	ENSP00000400839:p.Ala67_Met72delinsVal	Unknown		Capture	Illumina GAIIx	Phase_I	138056192		In_Frame_Del	DEL	ENST00000446465.2	37	CCDS3091.1	DEL	28	Broad																																																																																				0.386	SLC35G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357317.1	NM_025246		In_Frame_Del
GPR20	2843	broad.mit.edu	37	8	142367256	142367257	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-25-2042-01	TCGA-25-2042-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2042-01	TCGA-25-2042-10	g.chr8:142367256_142367257delGG	ENST00000377741.3	-	2	857_858	c.767_768delCC	c.(766-768)cccfs	p.P256fs	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	256					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.P256fs*63(1)		NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			GGGCGTGGAAGGGCGTGAAGCA	0.678																																																1	Deletion - Frameshift(1)	ovary(1)	8																																								142436439	SO:0001589	frameshift_variant	2843			U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.767_768delCC	8.37:g.142367256_142367257delGG	ENSP00000366970:p.Pro256fs	Unknown		Capture	Illumina GAIIx	Phase_I	142436438	Q17R96	Frame_Shift_Del	DEL	ENST00000377741.3	37	CCDS34949.1	DEL	35	Broad																																																																																				0.678	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293		Frame_Shift_Del
