#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ARHGEF10L	55160	broad.mit.edu	37	1	17961477	17961477	+	Silent	SNP	C	C	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:17961477C>T	ENST00000361221.3	+	18	2052	c.1893C>T	c.(1891-1893)ggC>ggT	p.G631G	ARHGEF10L_ENST00000375415.1_Silent_p.G592G|ARHGEF10L_ENST00000452522.1_Silent_p.G592G|ARHGEF10L_ENST00000167825.4_Silent_p.G334G|ARHGEF10L_ENST00000375420.3_Silent_p.G389G|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000434513.1_Silent_p.G626G|ARHGEF10L_ENST00000375408.3_Silent_p.G404G	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	631						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G631G(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		AGCACTCAGGCGCCAAGAAGG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	1											68.0	65.0	66.0					1																	17961477		2203	4300	6503	17834064	SO:0001819	synonymous_variant	55160			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1893C>T	1.37:g.17961477C>T		Unknown		x	x	x	17834064	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Silent	SNP	ENST00000361221.3	37	CCDS182.1	SNP	27	Broad																																																																																				0.647	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125		Silent
MACF1	23499	broad.mit.edu	37	1	39827223	39827223	+	Silent	SNP	A	A	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:39827223A>G	ENST00000372915.3	+	48	12747	c.12660A>G	c.(12658-12660)ctA>ctG	p.L4220L	MACF1_ENST00000289893.4_Silent_p.L2655L|MACF1_ENST00000545844.1_Silent_p.L2153L|MACF1_ENST00000564288.1_Silent_p.L4215L|MACF1_ENST00000539005.1_Silent_p.L2153L|MACF1_ENST00000317713.7_Silent_p.L2153L|MACF1_ENST00000361689.2_Silent_p.L2153L|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000567887.1_Silent_p.L4252L			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4220					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.L2655L(1)|p.L2153L(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAAGCTTCTACCCCAGGCAG	0.517																																																2	Substitution - coding silent(2)	ovary(2)	1											67.0	68.0	68.0					1																	39827223		2203	4300	6503	39599810	SO:0001819	synonymous_variant	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12660A>G	1.37:g.39827223A>G		Unknown		x	x	x	39599810	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	G	9.706	1.155751	0.21454	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.95	3.06	0.35304	.	.	.	.	.	T	0.57125	0.2032	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49485	-0.8935	4	.	.	.	.	7.5985	0.28063	0.2483:0.1077:0.644:0.0	.	.	.	.	A	1287	.	.	T	+	1	0	MACF1	39599810	0.938000	0.31826	1.000000	0.80357	0.992000	0.81027	0.135000	0.15952	0.438000	0.26450	-0.213000	0.12676	ACC		0.517	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		Silent
DAB1	1600	broad.mit.edu	37	1	57480699	57480699	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:57480699G>T	ENST00000371231.1	-	13	1434	c.1400C>A	c.(1399-1401)cCc>cAc	p.P467H	DAB1_ENST00000414851.2_Missense_Mutation_p.P416H|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Missense_Mutation_p.P348H|DAB1_ENST00000371234.4_Missense_Mutation_p.P434H|DAB1_ENST00000420954.2_Missense_Mutation_p.P432H|DAB1_ENST00000371236.2_Missense_Mutation_p.P434H			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	467					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.P434H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGTGAGGGAGGGCTGGTCGGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											73.0	76.0	75.0					1																	57480699		2203	4300	6503	57253287	SO:0001583	missense	1600			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1400C>A	1.37:g.57480699G>T	ENSP00000360275:p.Pro467His	Unknown		x	x	x	57253287	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480222	0.84747	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.69;1.73;0.71	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.68458	0.3003	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.965;0.984;0.983;0.999;0.991	T	0.68731	-0.5331	10	0.72032	D	0.01	-37.959	19.6787	0.95950	0.0:0.0:1.0:0.0	.	416;467;434;348;432	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	H	434;434;434;432;416;348;467	ENSP00000360280:P434H;ENSP00000360278:P434H;ENSP00000395296:P432H;ENSP00000387581:P416H;ENSP00000409328:P348H;ENSP00000360275:P467H	ENSP00000360275:P467H	P	-	2	0	DAB1	57253287	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.263000	0.95617	2.890000	0.99128	0.650000	0.86243	CCC		0.562	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		Missense_Mutation
CEPT1	10390	broad.mit.edu	37	1	111703829	111703829	+	Silent	SNP	T	T	C	rs567601468		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:111703829T>C	ENST00000545121.1	+	4	748	c.540T>C	c.(538-540)gaT>gaC	p.D180D	CEPT1_ENST00000357172.4_Silent_p.D180D	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1	180					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)	p.D180D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	CAAACCCTGATTGGATGTTTT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											243.0	243.0	243.0					1																	111703829		2203	4300	6503	111505352	SO:0001819	synonymous_variant	10390			AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.540T>C	1.37:g.111703829T>C		Unknown		x	x	x	111505352	Q69YJ9|Q9P0Y8	Silent	SNP	ENST00000545121.1	37	CCDS830.1	SNP	52	Broad																																																																																				0.388	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034462.2	NM_006090		Silent
TBX15	6913	broad.mit.edu	37	1	119427404	119427404	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:119427404T>A	ENST00000369429.3	-	8	1769	c.1760A>T	c.(1759-1761)tAt>tTt	p.Y587F	TBX15_ENST00000207157.3_Missense_Mutation_p.Y481F			Q96SF7	TBX15_HUMAN	T-box 15	587					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Y481F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		AACTGCCCCATACTGCCGGCC	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	78.0	79.0					1																	119427404		2203	4300	6503	119228927	SO:0001583	missense	6913			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1760A>T	1.37:g.119427404T>A	ENSP00000358437:p.Tyr587Phe	Unknown		x	x	x	119228927	Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	37		SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	13.74	2.328497	0.41197	.	.	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873	D;D;T	0.88586	-2.4;-2.26;-1.26	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.75102	0.3804	N	0.24115	0.695	0.52099	D	0.999941	D;P	0.53745	0.962;0.874	P;P	0.44422	0.449;0.449	T	0.76305	-0.3008	10	0.13470	T	0.59	.	15.4222	0.75022	0.0:0.0:0.0:1.0	.	384;587	E9PCG3;Q96SF7	.;TBX15_HUMAN	F	384;481;587;315	ENSP00000207157:Y481F;ENSP00000358437:Y587F;ENSP00000398625:Y315F	ENSP00000207157:Y481F	Y	-	2	0	TBX15	119228927	1.000000	0.71417	0.980000	0.43619	0.481000	0.33189	6.973000	0.76116	2.234000	0.73211	0.459000	0.35465	TAT		0.557	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		Missense_Mutation
ADCY10	55811	broad.mit.edu	37	1	167847868	167847868	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:167847868C>A	ENST00000367851.4	-	12	1406	c.1222G>T	c.(1222-1224)Ggt>Tgt	p.G408C	ADCY10_ENST00000367848.1_Missense_Mutation_p.G316C|ADCY10_ENST00000545172.1_Missense_Mutation_p.G255C	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	408	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.G408C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						ACTTTTTGACCAATGACTATA	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	72.0	75.0					1																	167847868		2203	4300	6503	166114492	SO:0001583	missense	55811			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1222G>T	1.37:g.167847868C>A	ENSP00000356825:p.Gly408Cys	Unknown		x	x	x	166114492	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	CCDS1265.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057417	0.76074	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	D;D;D	0.90732	-2.72;-2.72;-2.72	5.38	5.38	0.77491	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000002	D	0.96642	0.8904	H	0.96111	3.77	0.38323	D	0.943593	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97395	0.9992	9	0.87932	D	0	-16.6646	14.9981	0.71449	0.0:1.0:0.0:0.0	.	255;316;408	F5GWS5;Q96PN6-2;Q96PN6	.;.;ADCYA_HUMAN	C	255;408;316	ENSP00000441992:G255C;ENSP00000356825:G408C;ENSP00000356822:G316C	ENSP00000356822:G316C	G	-	1	0	ADCY10	166114492	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.664000	0.61540	2.683000	0.91414	0.655000	0.94253	GGT		0.418	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		Missense_Mutation
PPP1R12B	4660	broad.mit.edu	37	1	202385964	202385964	+	Missense_Mutation	SNP	G	G	C	rs139402597		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:202385964G>C	ENST00000608999.1	+	2	494	c.341G>C	c.(340-342)aGa>aCa	p.R114T	PPP1R12B_ENST00000356764.2_Missense_Mutation_p.R114T|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.R114T|PPP1R12B_ENST00000480184.1_Missense_Mutation_p.R114T	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	114					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.R114T(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			GTGGAGAACAGAGCCAATGTA	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16685	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						G	THR/ARG,THR/ARG,THR/ARG	2,4404	4.2+/-10.8	0,2,2201	185.0	172.0	176.0		341,341,341	3.2	1.0	1	dbSNP_134	176	0,8600		0,0,4300	no	missense,missense,missense	PPP1R12B	NM_001167857.1,NM_001167858.1,NM_002481.3	71,71,71	0,2,6501	CC,CG,GG		0.0,0.0454,0.0154	benign,benign,benign	114/516,114/387,114/983	202385964	2,13004	2203	4300	6503	200652587	SO:0001583	missense	4660			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.341G>C	1.37:g.202385964G>C	ENSP00000476755:p.Arg114Thr	Unknown		x	x	x	200652587	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.70|17.70	3.453307|3.453307	0.63290|0.63290	4.54E-4|4.54E-4	0.0|0.0	ENSG00000077157|ENSG00000077157	ENST00000466968|ENST00000406302;ENST00000336894;ENST00000480184;ENST00000356764	.|T;T;T;T	.|0.52983	.|0.64;0.64;0.64;0.64	6.06|6.06	3.22|3.22	0.36961|0.36961	.|Ankyrin repeat-containing domain (3);	.|0.421085	.|0.25358	.|N	.|0.031247	T|T	0.44052|0.44052	0.1275|0.1275	L|L	0.39514|0.39514	1.22|1.22	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.32526	.|0.042;0.026;0.374;0.213	.|B;B;B;B	.|0.39465	.|0.3;0.036;0.135;0.149	T|T	0.41070|0.41070	-0.9529|-0.9529	5|10	.|0.87932	.|D	.|0	.|.	11.7385|11.7385	0.51780|0.51780	0.1794:0.0:0.8206:0.0|0.1794:0.0:0.8206:0.0	.|.	.|114;114;114;114	.|O60237-2;O60237;F8W8M3;Q2TAI8	.|.;MYPT2_HUMAN;.;.	H|T	2|114	.|ENSP00000384496:R114T;ENSP00000337897:R114T;ENSP00000417159:R114T;ENSP00000349206:R114T	.|ENSP00000337897:R114T	Q|R	+|+	3|2	2|0	PPP1R12B|PPP1R12B	200652587|200652587	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.298000|3.298000	0.51818|0.51818	0.453000|0.453000	0.26858|0.26858	0.655000|0.655000	0.94253|0.94253	CAG|AGA		0.443	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105		Missense_Mutation
GFRA1	2674	broad.mit.edu	37	10	117856204	117856204	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr10:117856204T>A	ENST00000355422.6	-	7	1392	c.842A>T	c.(841-843)aAc>aTc	p.N281I	GFRA1_ENST00000544592.1_Missense_Mutation_p.N160I|GFRA1_ENST00000369236.1_Missense_Mutation_p.N276I|GFRA1_ENST00000439649.3_Missense_Mutation_p.N276I	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	281					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.N276I(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GTCAGCGTAGTTTTCCTTTAG	0.507																																					Ovarian(128;329 1725 45498 46808 50759)											1	Substitution - Missense(1)	ovary(1)	10											68.0	64.0	66.0					10																	117856204		2203	4300	6503	117846194	SO:0001583	missense	2674			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.842A>T	10.37:g.117856204T>A	ENSP00000347591:p.Asn281Ile	Unknown		x	x	x	117846194	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	24.1	4.494925	0.85069	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.50548	1.34;0.74	5.93	5.93	0.95920	GDNF/GAS1 (2);	0.133773	0.64402	D	0.000003	T	0.65770	0.2723	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.60575	0.981;0.988	P;P	0.62089	0.898;0.896	T	0.69446	-0.5143	10	0.87932	D	0	-36.5533	14.9654	0.71188	0.0:0.0:0.0:1.0	.	281;276	P56159;P56159-2	GFRA1_HUMAN;.	I	281;276;276;160;276	ENSP00000358239:N276I;ENSP00000442179:N160I	ENSP00000347591:N276I	N	-	2	0	GFRA1	117846194	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.731000	0.62022	2.281000	0.76405	0.533000	0.62120	AAC		0.507	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		Missense_Mutation
OR5M11	219487	broad.mit.edu	37	11	56310660	56310660	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr11:56310660G>C	ENST00000528616.2	-	1	97	c.74C>G	c.(73-75)tCt>tGt	p.S25C		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						AAAAAGCAGAGACTGGAGTTC	0.473																																																0			11											99.0	99.0	99.0					11																	56310660		2017	4199	6216	56067236	SO:0001583	missense	219487			AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.74C>G	11.37:g.56310660G>C	ENSP00000432417:p.Ser25Cys	Unknown		x	x	x	56067236	B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	37	CCDS53629.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	2.801	-0.249057	0.05867	.	.	ENSG00000255223	ENST00000528616	T	0.00438	7.42	5.1	3.08	0.35506	.	.	.	.	.	T	0.00356	0.0011	L	0.43598	1.365	0.09310	N	1	B	0.33073	0.396	B	0.39068	0.289	T	0.43702	-0.9375	9	0.46703	T	0.11	.	3.5558	0.07863	0.2629:0.0:0.5454:0.1917	.	25	Q96RB7	OR5MB_HUMAN	C	25	ENSP00000432417:S25C	ENSP00000432417:S25C	S	-	2	0	OR5M11	56067236	0.000000	0.05858	0.997000	0.53966	0.021000	0.10359	-0.484000	0.06528	1.407000	0.46875	0.632000	0.83419	TCT		0.473	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245		Missense_Mutation
NRXN2	9379	broad.mit.edu	37	11	64428304	64428304	+	Silent	SNP	C	C	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr11:64428304C>A	ENST00000377551.1	-	9	2317	c.2106G>T	c.(2104-2106)ggG>ggT	p.G702G	NRXN2_ENST00000265459.6_Silent_p.G702G|NRXN2_ENST00000409571.1_Silent_p.G695G|NRXN2_ENST00000496291.1_5'UTR|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000377559.3_Silent_p.G671G			Q9P2S2	NRX2A_HUMAN	neurexin 2	702	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.G702G(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GACAGACGCCCCCATTGCGAC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	11											79.0	76.0	77.0					11																	64428304		2201	4297	6498	64184880	SO:0001819	synonymous_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2106G>T	11.37:g.64428304C>A		Unknown		x	x	x	64184880	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1	SNP	22	Broad																																																																																				0.637	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		Silent
AP5B1	91056	broad.mit.edu	37	11	65546387	65546387	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr11:65546387A>C	ENST00000532090.2	-	2	1787	c.1577T>G	c.(1576-1578)gTg>gGg	p.V526G		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	526					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						GGACACCACCACCTGCCGCAA	0.602																																																0			11											23.0	28.0	26.0					11																	65546387		2068	4211	6279	65302963	SO:0001583	missense	91056			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1577T>G	11.37:g.65546387A>C	ENSP00000454303:p.Val526Gly	Unknown		x	x	x	65302963	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	ENST00000532090.2	37	CCDS58146.1	SNP	6	Broad																																																																																				0.602	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390636.2	NM_138368		Missense_Mutation
RAB1B	81876	broad.mit.edu	37	11	66043557	66043557	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr11:66043557G>A	ENST00000311481.6	+	6	601	c.454G>A	c.(454-456)Gcc>Acc	p.A152T	CNIH2_ENST00000311445.6_5'Flank|RAB1B_ENST00000527397.1_Missense_Mutation_p.A120T|CNIH2_ENST00000528852.1_5'Flank|RP11-867G23.4_ENST00000528650.1_RNA|RP11-867G23.4_ENST00000526951.1_RNA|RP11-867G23.3_ENST00000501708.1_lincRNA	NM_030981.2	NP_112243.1	Q9H0U4	RAB1B_HUMAN	RAB1B, member RAS oncogene family	152					ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of glycoprotein metabolic process (GO:1903020)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.A152T(1)		large_intestine(2)|lung(1)|ovary(1)|prostate(1)	5						GGAGACGAGCGCCAAGAATGC	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											53.0	51.0	52.0					11																	66043557		2200	4295	6495	65800133	SO:0001583	missense	81876			AJ245875	CCDS31613.1	11q13.1	2008-02-05			ENSG00000174903	ENSG00000174903		"""RAB, member RAS oncogene"""	18370	protein-coding gene	gene with protein product		612565				9030196	Standard	NM_030981		Approved		uc001ohf.3	Q9H0U4	OTTHUMG00000166916	ENST00000311481.6:c.454G>A	11.37:g.66043557G>A	ENSP00000310226:p.Ala152Thr	Unknown		x	x	x	65800133	A8K7S1	Missense_Mutation	SNP	ENST00000311481.6	37	CCDS31613.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478928	0.63849	.	.	ENSG00000174903	ENST00000311481;ENST00000527397	D;D	0.88741	-2.42;-2.42	3.9	3.9	0.45041	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	D	0.95947	0.8680	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97089	0.9789	10	0.87932	D	0	.	13.7053	0.62633	0.0:0.0:1.0:0.0	.	152	Q9H0U4	RAB1B_HUMAN	T	152;120	ENSP00000310226:A152T;ENSP00000435195:A120T	ENSP00000310226:A152T	A	+	1	0	RAB1B	65800133	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	7.749000	0.85096	1.880000	0.54463	0.313000	0.20887	GCC		0.597	RAB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391886.2	NM_030981		Missense_Mutation
NTF3	4908	broad.mit.edu	37	12	5603753	5603753	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr12:5603753G>C	ENST00000331010.6	+	1	456	c.373G>C	c.(373-375)Ggc>Cgc	p.G125R	NTF3_ENST00000423158.3_Missense_Mutation_p.G138R|NTF3_ENST00000535299.1_Intron	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	125					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)	p.G125R(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						GGATTACGTGGGCAGCCCCGT	0.602																																					GBM(194;1104 2182 8339 9578 18493)											1	Substitution - Missense(1)	ovary(1)	12											73.0	73.0	73.0					12																	5603753		2203	4300	6503	5474014	SO:0001583	missense	4908				CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.373G>C	12.37:g.5603753G>C	ENSP00000328738:p.Gly125Arg	Unknown		x	x	x	5474014	B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	37	CCDS8538.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093963	0.76870	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.42900	0.96;0.96	5.52	5.52	0.82312	.	0.061993	0.64402	D	0.000006	T	0.50394	0.1613	M	0.81112	2.525	0.47698	D	0.999497	P;P	0.46512	0.879;0.879	B;B	0.40410	0.328;0.328	T	0.61816	-0.6985	10	0.87932	D	0	-12.5457	18.4188	0.90582	0.0:0.0:1.0:0.0	.	125;138	P20783;B7Z1T5	NTF3_HUMAN;.	R	138;125	ENSP00000397297:G138R;ENSP00000328738:G125R	ENSP00000328738:G125R	G	+	1	0	NTF3	5474014	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.325000	0.79124	2.610000	0.88304	0.591000	0.81541	GGC		0.602	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1			Missense_Mutation
CUX2	23316	broad.mit.edu	37	12	111785434	111785434	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr12:111785434C>T	ENST00000261726.6	+	22	3920	c.3766C>T	c.(3766-3768)Ccc>Tcc	p.P1256S		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1256					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.P1256S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCACCCAGACCCCACCCCGCA	0.637																																																1	Substitution - Missense(1)	ovary(1)	12											44.0	53.0	50.0					12																	111785434		1912	4109	6021	110269817	SO:0001583	missense	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3766C>T	12.37:g.111785434C>T	ENSP00000261726:p.Pro1256Ser	Unknown		x	x	x	110269817	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	9.518	1.107438	0.20714	.	.	ENSG00000111249	ENST00000261726	T	0.40756	1.02	5.78	5.78	0.91487	.	0.115111	0.64402	D	0.000011	T	0.31420	0.0796	L	0.32530	0.975	0.52099	D	0.999941	B	0.27229	0.172	B	0.18871	0.023	T	0.10870	-1.0611	10	0.09590	T	0.72	-26.2041	17.5142	0.87768	0.0:1.0:0.0:0.0	.	1256	O14529	CUX2_HUMAN	S	1256	ENSP00000261726:P1256S	ENSP00000261726:P1256S	P	+	1	0	CUX2	110269817	0.491000	0.26019	0.919000	0.36401	0.194000	0.23727	0.956000	0.29202	2.729000	0.93468	0.650000	0.86243	CCC		0.637	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		Missense_Mutation
FLT3	2322	broad.mit.edu	37	13	28609758	28609758	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr13:28609758C>G	ENST00000241453.7	-	12	1552	c.1471G>C	c.(1471-1473)Gtg>Ctg	p.V491L	FLT3_ENST00000380982.4_Missense_Mutation_p.V491L|FLT3_ENST00000537084.1_Missense_Mutation_p.V491L	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	491					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.V491L(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGTCCAAACACTTTTCTGTTA	0.428			"""Mis, O"""		"""AML, ALL"""																																		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	2	Substitution - Missense(2)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	13											200.0	175.0	183.0					13																	28609758		2203	4300	6503	27507758	SO:0001583	missense	2322			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1471G>C	13.37:g.28609758C>G	ENSP00000241453:p.Val491Leu	Unknown		x	x	x	27507758	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	37	CCDS31953.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	3.175	-0.169202	0.06461	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.77358	-1.03;-1.09;-0.82	4.93	3.17	0.36434	.	0.380726	0.23017	N	0.052889	T	0.52158	0.1717	N	0.24115	0.695	0.09310	N	1	P;P	0.42871	0.792;0.737	B;B	0.35039	0.194;0.077	T	0.50617	-0.8807	10	0.06757	T	0.87	.	4.5822	0.12264	0.3307:0.5009:0.0:0.1683	.	491;491	P36888-2;P36888	.;FLT3_HUMAN	L	491	ENSP00000241453:V491L;ENSP00000370369:V491L;ENSP00000438139:V491L	ENSP00000241453:V491L	V	-	1	0	FLT3	27507758	0.380000	0.25131	0.261000	0.24466	0.080000	0.17528	1.718000	0.38001	0.585000	0.29608	0.655000	0.94253	GTG		0.428	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2			Missense_Mutation
NID2	22795	broad.mit.edu	37	14	52478316	52478316	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr14:52478316G>C	ENST00000216286.5	-	17	3505	c.3506C>G	c.(3505-3507)gCt>gGt	p.A1169G	NID2_ENST00000541773.1_Missense_Mutation_p.A1068G	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	1169					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.A1169G(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TTCCAGACCAGCACGGCTGAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	14											150.0	123.0	132.0					14																	52478316		2203	4300	6503	51548066	SO:0001583	missense	22795			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.3506C>G	14.37:g.52478316G>C	ENSP00000216286:p.Ala1169Gly	Unknown		x	x	x	51548066	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	SNP	34	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.50|10.50	1.368906|1.368906	0.24771|0.24771	.|.	.|.	ENSG00000087303|ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773|ENST00000556572	T;T|.	0.30448|.	1.53;1.53|.	5.92|5.92	-1.33|-1.33	0.09172|0.09172	Six-bladed beta-propeller, TolB-like (1);|.	0.289804|.	0.43579|.	D|.	0.000546|.	T|T	0.54447|0.54447	0.1859|0.1859	M|M	0.75884|0.75884	2.315|2.315	0.09310|0.09310	N|N	1|1	P;B;B|.	0.42993|.	0.797;0.13;0.031|.	B;B;B|.	0.43018|.	0.405;0.087;0.038|.	T|T	0.53187|0.53187	-0.8474|-0.8474	10|5	0.51188|.	T|.	0.08|.	.|.	11.1165|11.1165	0.48264|0.48264	0.4342:0.0:0.5658:0.0|0.4342:0.0:0.5658:0.0	.|.	763;1068;1169|.	E7EPP3;Q14112-2;Q14112|.	.;.;NID2_HUMAN|.	G|W	1169;763;1068|437	ENSP00000216286:A1169G;ENSP00000443730:A1068G|.	ENSP00000216286:A1169G|.	A|C	-|-	2|3	0|2	NID2|NID2	51548066|51548066	0.994000|0.994000	0.37717|0.37717	0.000000|0.000000	0.03702|0.03702	0.059000|0.059000	0.15707|0.15707	2.965000|2.965000	0.49200|0.49200	-0.585000|-0.585000	0.05905|0.05905	-0.812000|-0.812000	0.03155|0.03155	GCT|TGC		0.498	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			Missense_Mutation
AQR	9716	broad.mit.edu	37	15	35230978	35230978	+	Silent	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr15:35230978G>A	ENST00000156471.5	-	9	903	c.678C>T	c.(676-678)atC>atT	p.I226I		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	226					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I226I(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TAAACTTCTGGATGAGTTGTG	0.333																																																1	Substitution - coding silent(1)	ovary(1)	15											131.0	119.0	122.0					15																	35230978		1811	4082	5893	33018270	SO:0001819	synonymous_variant	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.678C>T	15.37:g.35230978G>A		Unknown		x	x	x	33018270	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Silent	SNP	ENST00000156471.5	37	CCDS42013.1	SNP	41	Broad																																																																																				0.333	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691		Silent
ZNF106	64397	broad.mit.edu	37	15	42744056	42744056	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr15:42744056C>A	ENST00000263805.4	-	2	671	c.345G>T	c.(343-345)gaG>gaT	p.E115D	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	115					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E115D(1)									GACTGTAACTCTCTCTGTCTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											202.0	178.0	186.0					15																	42744056		2203	4299	6502	40531348	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.345G>T	15.37:g.42744056C>A	ENSP00000263805:p.Glu115Asp	Unknown		x	x	x	40531348	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808249	0.31961	.	.	ENSG00000103994	ENST00000263805	T	0.13420	2.59	5.63	1.06	0.20224	.	0.153862	0.44097	D	0.000484	T	0.08403	0.0209	L	0.43152	1.355	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.28138	-1.0053	10	0.31617	T	0.26	-18.8995	0.1774	0.00120	0.2802:0.2657:0.2068:0.2474	.	115	Q9H2Y7	ZF106_HUMAN	D	115	ENSP00000263805:E115D	ENSP00000263805:E115D	E	-	3	2	ZFP106	40531348	0.193000	0.23313	1.000000	0.80357	0.993000	0.82548	0.228000	0.17814	0.746000	0.32786	0.632000	0.83419	GAG		0.453	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473		Missense_Mutation
C15orf40	123207	broad.mit.edu	37	15	83680351	83680351	+	Silent	SNP	C	C	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr15:83680351C>T	ENST00000513601.2	-	1	16	c.9G>A	c.(7-9)cgG>cgA	p.R3R	RP11-382A20.5_ENST00000566841.1_RNA|C15orf40_ENST00000304177.5_5'UTR|C15orf40_ENST00000451195.3_Silent_p.R3R|RP11-382A20.7_ENST00000570202.1_RNA|C15orf40_ENST00000538348.2_Silent_p.R3R|C15orf40_ENST00000565712.1_Silent_p.R3R			Q8WUR7	CO040_HUMAN	chromosome 15 open reading frame 40	3								p.R3R(1)		large_intestine(3)|lung(2)|skin(1)	6						CGCTGCGGAGCCGCAGCATCC	0.706											OREG0023391	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	15											14.0	18.0	17.0					15																	83680351		691	1590	2281	81471355	SO:0001819	synonymous_variant	123207			BC019820	CCDS32312.1, CCDS32312.2, CCDS53968.1, CCDS53969.1	15q25.2	2012-05-30			ENSG00000169609	ENSG00000169609			28443	protein-coding gene	gene with protein product							Standard	NM_144597		Approved	MGC29937	uc010uoo.1	Q8WUR7	OTTHUMG00000160473	ENST00000513601.2:c.9G>A	15.37:g.83680351C>T		Unknown	1223	x	x	x	81471355	A6NIC9|B2R5E7|F5GX92|F8WD31|G5EA00	Silent	SNP	ENST00000513601.2	37	CCDS32312.2	SNP	26	Broad																																																																																				0.706	C15orf40-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360737.2	NM_144597		Silent
ZNF629	23361	broad.mit.edu	37	16	30794743	30794743	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr16:30794743G>T	ENST00000262525.4	-	3	1113	c.906C>A	c.(904-906)aaC>aaA	p.N302K		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N302K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGAGGTTGTGGTTCTGGCCGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											90.0	96.0	94.0					16																	30794743		2190	4300	6490	30702244	SO:0001583	missense	23361			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.906C>A	16.37:g.30794743G>T	ENSP00000262525:p.Asn302Lys	Unknown		x	x	x	30702244	Q15938	Missense_Mutation	SNP	ENST00000262525.4	37	CCDS45463.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147952	0.37923	.	.	ENSG00000102870	ENST00000262525	T	0.00976	5.48	5.59	4.63	0.57726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000142	T	0.01353	0.0044	N	0.03194	-0.395	0.31949	N	0.609889	D	0.69078	0.997	D	0.75484	0.986	T	0.65071	-0.6257	10	0.15952	T	0.53	-56.7816	12.539	0.56158	0.0831:0.0:0.9169:0.0	.	302	Q9UEG4	ZN629_HUMAN	K	302	ENSP00000262525:N302K	ENSP00000262525:N302K	N	-	3	2	ZNF629	30702244	0.145000	0.22656	1.000000	0.80357	0.996000	0.88848	1.603000	0.36794	1.331000	0.45412	0.561000	0.74099	AAC		0.632	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309		Missense_Mutation
AP2B1	163	broad.mit.edu	37	17	34044340	34044340	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:34044340G>C	ENST00000262325.7	+	20	3264	c.2711G>C	c.(2710-2712)cGt>cCt	p.R904P	AP2B1_ENST00000537622.2_Missense_Mutation_p.R918P|AP2B1_ENST00000312678.8_Missense_Mutation_p.R918P|AP2B1_ENST00000589344.1_Missense_Mutation_p.R918P|AP2B1_ENST00000592545.1_Missense_Mutation_p.R880P|AP2B1_ENST00000538556.1_Missense_Mutation_p.R847P|AP2B1_ENST00000545922.2_3'UTR	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	904	Interaction with ARRB1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)	p.R918P(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GCCGAACTACGTATCCAGCCA	0.463																																																1	Substitution - Missense(1)	ovary(1)	17											117.0	102.0	107.0					17																	34044340		2203	4300	6503	31068453	SO:0001583	missense	163			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.2711G>C	17.37:g.34044340G>C	ENSP00000262325:p.Arg904Pro	Unknown		x	x	x	31068453	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.093315	0.94149	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.37058	1.48;1.5;1.22;1.5	5.72	5.72	0.89469	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50188	0.1601	L	0.47716	1.5	0.80722	D	1	D;D;P;D	0.64830	0.994;0.982;0.876;0.978	P;P;P;P	0.57468	0.709;0.821;0.647;0.801	T	0.30208	-0.9986	10	0.41790	T	0.15	-11.8752	19.2284	0.93827	0.0:0.0:1.0:0.0	.	655;880;904;918	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	P	904;918;847;918;655	ENSP00000262325:R904P;ENSP00000314414:R918P;ENSP00000440563:R847P;ENSP00000437413:R918P	ENSP00000262325:R904P	R	+	2	0	AP2B1	31068453	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.022000	0.88759	2.857000	0.98124	0.650000	0.86243	CGT		0.463	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1			Missense_Mutation
NOG	9241	broad.mit.edu	37	17	54672169	54672169	+	Silent	SNP	C	C	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:54672169C>T	ENST00000332822.4	+	1	1110	c.585C>T	c.(583-585)tcC>tcT	p.S195S		NM_005450.4	NP_005441.1	Q13253	NOGG_HUMAN	noggin	195					axial mesoderm development (GO:0048318)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal system development (GO:0048706)|endoderm formation (GO:0001706)|epithelial to mesenchymal transition (GO:0001837)|face morphogenesis (GO:0060325)|fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060825)|in utero embryonic development (GO:0001701)|limb development (GO:0060173)|lung morphogenesis (GO:0060425)|mesoderm formation (GO:0001707)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine activity (GO:0060302)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glomerulus development (GO:0090193)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostatic bud formation (GO:0060513)|regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000313)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|somite development (GO:0061053)|spinal cord development (GO:0021510)|ureteric bud formation (GO:0060676)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein homodimerization activity (GO:0042803)	p.S195S(1)		ovary(1)	1	Breast(9;5.24e-08)					GCAAGCCGTCCAAGTCCGTGC	0.667																																																1	Substitution - coding silent(1)	ovary(1)	17											31.0	30.0	31.0					17																	54672169		2203	4300	6503	52027168	SO:0001819	synonymous_variant	9241			U31202	CCDS11589.1	17q22	2006-04-25	2003-03-12		ENSG00000183691	ENSG00000183691			7866	protein-coding gene	gene with protein product		602991	"""synostoses (multiple) syndrome 1"", ""symphalangism 1 (proximal)"""	SYNS1, SYM1		7666191, 10080184, 11545688	Standard	NM_005450		Approved		uc002iup.2	Q13253	OTTHUMG00000151770	ENST00000332822.4:c.585C>T	17.37:g.54672169C>T		Unknown		x	x	x	52027168		Silent	SNP	ENST00000332822.4	37	CCDS11589.1	SNP	21	Broad																																																																																				0.667	NOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323857.1	NM_005450		Silent
HSF5	124535	broad.mit.edu	37	17	56557583	56557583	+	Missense_Mutation	SNP	C	C	G	rs139274199		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:56557583C>G	ENST00000323777.3	-	2	705	c.596G>C	c.(595-597)aGt>aCt	p.S199T		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	199					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S199T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGAGACAAACTATCTCGACG	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											87.0	79.0	82.0					17																	56557583		2203	4300	6503	53912582	SO:0001583	missense	124535			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.596G>C	17.37:g.56557583C>G	ENSP00000313243:p.Ser199Thr	Unknown		x	x	x	53912582	Q08EH7|Q8N7V2	Missense_Mutation	SNP	ENST00000323777.3	37	CCDS32690.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439881	0.43326	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	T	0.35421	1.31	5.62	3.5	0.40072	.	0.354463	0.27323	N	0.019893	T	0.19725	0.0474	N	0.19112	0.55	0.26653	N	0.972052	B	0.27559	0.181	B	0.21708	0.036	T	0.11470	-1.0586	10	0.25751	T	0.34	.	7.6031	0.28087	0.0:0.7425:0.1669:0.0906	.	199	Q4G112	HSF5_HUMAN	T	99;199	ENSP00000313243:S199T	ENSP00000313243:S199T	S	-	2	0	HSF5	53912582	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.496000	0.22499	1.344000	0.45657	0.655000	0.94253	AGT		0.438	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	XM_064190		Missense_Mutation
SEPT4	5414	broad.mit.edu	37	17	56604318	56604318	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:56604318T>G	ENST00000317268.3	-	2	258	c.82A>C	c.(82-84)Acc>Ccc	p.T28P	RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000393086.1_Missense_Mutation_p.T9P|SEPT4_ENST00000412945.3_Missense_Mutation_p.T20P|SEPT4_ENST00000580809.1_Intron|SEPT4_ENST00000457347.2_Missense_Mutation_p.T43P|SEPT4_ENST00000583114.1_5'UTR|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000579371.1_Intron|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000580844.1_Intron|SEPT4_ENST00000317256.6_Missense_Mutation_p.T9P|SEPT4_ENST00000580791.1_5'UTR|SEPT4_ENST00000426861.1_Missense_Mutation_p.T9P	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	28					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.T28P(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCATCCGTGGTGTCCTCCAGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	17											68.0	73.0	71.0					17																	56604318		2203	4300	6503	53959317	SO:0001583	missense	5414			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.82A>C	17.37:g.56604318T>G	ENSP00000321674:p.Thr28Pro	Unknown		x	x	x	53959317	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	ENST00000317268.3	37	CCDS11610.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	10.17	1.277070	0.23307	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086;ENST00000426861	T;T;T;T;T	0.66280	0.61;0.63;0.61;0.63;-0.2	5.01	1.27	0.21489	.	2.034470	0.01912	N	0.039917	T	0.33702	0.0872	N	0.08118	0	0.51012	D	0.9999	B;B;P;B;B	0.37864	0.022;0.104;0.61;0.006;0.004	B;B;B;B;B	0.26416	0.009;0.014;0.069;0.009;0.003	T	0.41556	-0.9502	10	0.22109	T	0.4	.	1.5708	0.02614	0.1723:0.096:0.1791:0.5527	.	20;43;9;9;28	O43236-3;O43236-4;O43236-6;O43236-2;O43236	.;.;.;.;SEPT4_HUMAN	P	20;42;9;28;9;9	ENSP00000414779:T20P;ENSP00000321071:T9P;ENSP00000321674:T28P;ENSP00000376801:T9P;ENSP00000402348:T9P	ENSP00000321071:T9P	T	-	1	0	SEPT4	53959317	1.000000	0.71417	0.733000	0.30861	0.990000	0.78478	1.333000	0.33816	0.250000	0.21479	0.459000	0.35465	ACC		0.572	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417		Missense_Mutation
KIAA0195	9772	broad.mit.edu	37	17	73491027	73491027	+	Silent	SNP	C	C	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:73491027C>G	ENST00000314256.7	+	20	3034	c.2640C>G	c.(2638-2640)tcC>tcG	p.S880S	AC100787.1_ENST00000579379.1_RNA|KIAA0195_ENST00000375248.5_Silent_p.S890S|KIAA0195_ENST00000579208.1_Silent_p.S531S	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	880						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.S880S(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCACATCTCCCTCACACCCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	17											77.0	82.0	80.0					17																	73491027		2203	4300	6503	71002622	SO:0001819	synonymous_variant	9772				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2640C>G	17.37:g.73491027C>G		Unknown		x	x	x	71002622	O75536|Q86XF1	Silent	SNP	ENST00000314256.7	37	CCDS32732.1	SNP	22	Broad																																																																																				0.582	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		Silent
MRPL38	64978	broad.mit.edu	37	17	73897323	73897323	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:73897323G>A	ENST00000309352.3	-	5	1160	c.623C>T	c.(622-624)gCa>gTa	p.A208V	MRPL38_ENST00000409963.3_Missense_Mutation_p.A24V|RP11-552F3.10_ENST00000587267.1_RNA|MRPL38_ENST00000585475.1_5'UTR	NM_032478.3	NP_115867.2	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38	208						mitochondrion (GO:0005739)|ribosome (GO:0005840)		p.A208V(1)		ovary(1)|pancreas(1)|prostate(2)|skin(1)	5			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCCTCTTCTGCCTCATAGGT	0.642																																																1	Substitution - Missense(1)	ovary(1)	17											91.0	63.0	73.0					17																	73897323		2203	4300	6503	71408918	SO:0001583	missense	64978			AB051345	CCDS11733.2	17q23-q25	2012-09-13			ENSG00000204316	ENSG00000204316		"""Mitochondrial ribosomal proteins / large subunits"""	14033	protein-coding gene	gene with protein product		611844				11543634	Standard	NM_032478		Approved	RPML3, MRP-L3, HSPC262, MGC4810	uc010wso.1	Q96DV4	OTTHUMG00000152977	ENST00000309352.3:c.623C>T	17.37:g.73897323G>A	ENSP00000308275:p.Ala208Val	Unknown		x	x	x	71408918	B3KN96|Q96Q66|Q9P0B9	Missense_Mutation	SNP	ENST00000309352.3	37	CCDS11733.2	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.415341	0.96092	.	.	ENSG00000204316	ENST00000309352;ENST00000409963	T;T	0.45276	1.93;0.9	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.64594	0.2612	M	0.62209	1.925	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.62751	-0.6788	10	0.56958	D	0.05	-5.6648	19.3319	0.94293	0.0:0.0:1.0:0.0	.	208	Q96DV4	RM38_HUMAN	V	208;24	ENSP00000308275:A208V;ENSP00000387085:A24V	ENSP00000308275:A208V	A	-	2	0	MRPL38	71408918	1.000000	0.71417	0.976000	0.42696	0.657000	0.38888	7.193000	0.77780	2.821000	0.97095	0.555000	0.69702	GCA		0.642	MRPL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328829.1	NM_032478		Missense_Mutation
ACTG1	71	broad.mit.edu	37	17	79478478	79478478	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:79478478G>C	ENST00000575842.1	-	3	964	c.538C>G	c.(538-540)Ctg>Gtg	p.L180V	AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.L180V|ACTG1_ENST00000573283.1_Missense_Mutation_p.L180V|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.L180V			P63261	ACTG_HUMAN	actin, gamma 1	180					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)	p.L180V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			CGGCCAGCCAGGTCCAGACGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											45.0	49.0	48.0					17																	79478478		2203	4300	6503	77093073	SO:0001583	missense	71				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.538C>G	17.37:g.79478478G>C	ENSP00000458162:p.Leu180Val	Unknown		x	x	x	77093073	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	g	13.00	2.107232	0.37145	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.95171	-3.63	4.56	3.35	0.38373	.	0.000000	0.56097	D	0.000040	D	0.96503	0.8859	M	0.74258	2.255	0.36401	D	0.863139	P	0.39665	0.682	D	0.67900	0.954	D	0.97896	1.0300	10	0.87932	D	0	.	9.1374	0.36883	0.1967:0.0:0.8033:0.0	.	180	P63261	ACTG_HUMAN	V	180;138	ENSP00000331514:L180V	ENSP00000331514:L180V	L	-	1	2	ACTG1	77093073	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	0.993000	0.29680	2.116000	0.64780	0.553000	0.69018	CTG		0.637	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614		Missense_Mutation
DSG4	147409	broad.mit.edu	37	18	28971095	28971095	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr18:28971095G>A	ENST00000308128.4	+	7	874	c.739G>A	c.(739-741)Gat>Aat	p.D247N	DSG4_ENST00000359747.4_Missense_Mutation_p.D247N|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	247	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D247N(1)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGGAGCTGCAGATGGACTGTC	0.398																																																1	Substitution - Missense(1)	ovary(1)	18											168.0	143.0	152.0					18																	28971095		2203	4300	6503	27225093	SO:0001583	missense	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.739G>A	18.37:g.28971095G>A	ENSP00000311859:p.Asp247Asn	Unknown		x	x	x	27225093	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	CCDS11897.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628057	0.87560	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.51071	0.72;0.72	5.99	5.99	0.97316	Cadherin (4);Cadherin-like (1);	0.000000	0.35903	N	0.002916	T	0.57446	0.2054	L	0.33093	0.98	0.36423	D	0.864445	D;P	0.89917	1.0;0.94	D;P	0.97110	1.0;0.823	T	0.48547	-0.9026	10	0.07482	T	0.82	.	20.4756	0.99175	0.0:0.0:1.0:0.0	.	247;247	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	N	247	ENSP00000311859:D247N;ENSP00000352785:D247N	ENSP00000311859:D247N	D	+	1	0	DSG4	27225093	1.000000	0.71417	0.955000	0.39395	0.979000	0.70002	4.374000	0.59543	2.847000	0.97988	0.655000	0.94253	GAT		0.398	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		Missense_Mutation
PEX11G	92960	broad.mit.edu	37	19	7550868	7550868	+	Silent	SNP	C	C	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr19:7550868C>G	ENST00000221480.1	-	2	113	c.105G>C	c.(103-105)ctG>ctC	p.L35L	PEX11G_ENST00000599519.1_5'Flank|PEX11G_ENST00000593942.1_5'UTR	NM_001270539.1|NM_080662.3	NP_001257468.1|NP_542393.1	Q96HA9	PX11C_HUMAN	peroxisomal biogenesis factor 11 gamma	35					peroxisome fission (GO:0016559)|regulation of peroxisome size (GO:0044375)	integral component of peroxisomal membrane (GO:0005779)|intrinsic component of peroxisomal membrane (GO:0031231)|peroxisome (GO:0005777)|protein complex (GO:0043234)		p.L35L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	7						ACTGTTCAACCAGAACTCCAC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	19											75.0	60.0	65.0					19																	7550868		2203	4300	6503	7456868	SO:0001819	synonymous_variant	92960			BC008780	CCDS12178.1	19p13.2	2008-02-05				ENSG00000104883			20208	protein-coding gene	gene with protein product		607583				12417726	Standard	NM_080662		Approved		uc002mgk.2	Q96HA9		ENST00000221480.1:c.105G>C	19.37:g.7550868C>G		Unknown		x	x	x	7456868	Q8NDM0	Silent	SNP	ENST00000221480.1	37	CCDS12178.1	SNP	21	Broad																																																																																				0.582	PEX11G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458965.1	NM_080662		Silent
MUC16	94025	broad.mit.edu	37	19	9060436	9060436	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr19:9060436G>C	ENST00000397910.4	-	3	27213	c.27010C>G	c.(27010-27012)Cca>Gca	p.P9004A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9006	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P4637A(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCTCCCTTGGTGTGGGGGTC	0.502																																																1	Substitution - Missense(1)	ovary(1)	19											140.0	134.0	136.0					19																	9060436		2091	4221	6312	8921436	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27010C>G	19.37:g.9060436G>C	ENSP00000381008:p.Pro9004Ala	Unknown		x	x	x	8921436	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	g	4.989	0.183745	0.09495	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	2.23	-2.0	0.07433	.	.	.	.	.	T	0.02610	0.0079	N	0.19112	0.55	.	.	.	B	0.30584	0.286	B	0.34301	0.179	T	0.43829	-0.9367	8	0.87932	D	0	.	2.9987	0.06007	0.3502:0.2351:0.4146:0.0	.	9004	B5ME49	.	A	9004	ENSP00000381008:P9004A	ENSP00000381008:P9004A	P	-	1	0	MUC16	8921436	0.000000	0.05858	0.000000	0.03702	0.161000	0.22273	-1.218000	0.02976	-0.362000	0.08113	0.197000	0.17608	CCA		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
ZNF14	7561	broad.mit.edu	37	19	19822497	19822497	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr19:19822497A>T	ENST00000344099.3	-	4	1731	c.1593T>A	c.(1591-1593)ttT>ttA	p.F531L		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F531L(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				GCTTACACTCAAAAGGCTTAT	0.398																																																1	Substitution - Missense(1)	ovary(1)	19											101.0	93.0	96.0					19																	19822497		2203	4300	6503	19683497	SO:0001583	missense	7561			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1593T>A	19.37:g.19822497A>T	ENSP00000340514:p.Phe531Leu	Unknown		x	x	x	19683497	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	10.68	1.419023	0.25552	.	.	ENSG00000105708	ENST00000344099	T	0.21932	1.98	1.87	1.87	0.25490	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21227	0.0511	L	0.45698	1.435	0.09310	N	1	B	0.32365	0.367	B	0.40702	0.338	T	0.32587	-0.9901	9	0.87932	D	0	.	3.6157	0.08077	0.7897:0.0:0.2102:0.0	.	531	P17017	ZNF14_HUMAN	L	531	ENSP00000340514:F531L	ENSP00000340514:F531L	F	-	3	2	ZNF14	19683497	0.000000	0.05858	0.003000	0.11579	0.030000	0.12068	-0.774000	0.04684	0.846000	0.35142	0.383000	0.25322	TTT		0.398	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030		Missense_Mutation
NLRP4	147945	broad.mit.edu	37	19	56370354	56370354	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr19:56370354A>G	ENST00000301295.6	+	3	2017	c.1595A>G	c.(1594-1596)cAc>cGc	p.H532R	NLRP4_ENST00000587891.1_Missense_Mutation_p.H457R|NLRP4_ENST00000346986.5_Missense_Mutation_p.H532R	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	532					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.H532R(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CAGCAAATTCACCAGTGCCTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	19											75.0	80.0	78.0					19																	56370354		2203	4300	6503	61062166	SO:0001583	missense	147945			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1595A>G	19.37:g.56370354A>G	ENSP00000301295:p.His532Arg	Unknown		x	x	x	61062166	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	7.135	0.580579	0.13686	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83673	-1.75;-1.75	4.15	-6.86	0.01676	.	.	.	.	.	T	0.60261	0.2255	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.08055	0.0;0.003;0.001	T	0.47749	-0.9093	9	0.52906	T	0.07	.	5.4401	0.16504	0.2184:0.0:0.169:0.6126	.	532;457;532	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	R	532	ENSP00000301295:H532R;ENSP00000344787:H532R	ENSP00000301295:H532R	H	+	2	0	NLRP4	61062166	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-0.462000	0.06704	-1.329000	0.02258	0.482000	0.46254	CAC		0.443	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		Missense_Mutation
LMAN2L	81562	broad.mit.edu	37	2	97369334	97369334	+	IGR	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr2:97369334G>A	ENST00000264963.4	-	0	2397				FER1L5_ENST00000457909.1_RNA	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like						ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)	p.S1958S(1)		NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						GAGGCCAGTCGGAACCCAACC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	2											74.0	83.0	80.0					2																	97369334		1986	4155	6141	96733061	SO:0001628	intergenic_variant	90342			AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453		2.37:g.97369334G>A		Unknown		x	x	x	96733061	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Silent	SNP	ENST00000264963.4	37	CCDS2023.1	SNP	39	Broad																																																																																				0.567	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805		Silent
IL37	27178	broad.mit.edu	37	2	113676282	113676282	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr2:113676282G>C	ENST00000263326.3	+	5	595	c.553G>C	c.(553-555)Gag>Cag	p.E185Q	IL37_ENST00000311328.2_Missense_Mutation_p.E159Q|IL37_ENST00000349806.3_Missense_Mutation_p.E124Q|IL37_ENST00000352179.3_Missense_Mutation_p.E164Q|IL37_ENST00000353225.3_Missense_Mutation_p.E145Q	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	185					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)	p.E185Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						CAATTGTAATGAGCCTGTTGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											74.0	79.0	78.0					2																	113676282		2203	4300	6503	113392753	SO:0001583	missense	27178			AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.553G>C	2.37:g.113676282G>C	ENSP00000263326:p.Glu185Gln	Unknown		x	x	x	113392753	B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Missense_Mutation	SNP	ENST00000263326.3	37	CCDS2103.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	g	4.337	0.061894	0.08339	.	.	ENSG00000125571	ENST00000263326;ENST00000352179;ENST00000349806;ENST00000353225;ENST00000311328	T;T;T;T;T	0.16324	2.35;2.35;2.98;2.98;2.35	3.81	1.8	0.24995	.	0.818896	0.10243	N	0.698115	T	0.07052	0.0179	N	0.10972	0.075	0.09310	N	1	B;B;B;B;B	0.32573	0.28;0.234;0.376;0.23;0.271	B;B;B;B;B	0.31547	0.132;0.099;0.115;0.065;0.107	T	0.34875	-0.9811	10	0.10636	T	0.68	-8.5173	4.6676	0.12673	0.1267:0.2266:0.6467:0.0	.	159;124;145;164;185	Q9NZH6-2;Q9NZH6-5;Q9NZH6-3;Q9NZH6-4;Q9NZH6	.;.;.;.;IL37_HUMAN	Q	185;164;124;145;159	ENSP00000263326:E185Q;ENSP00000263327:E164Q;ENSP00000263328:E124Q;ENSP00000309208:E145Q;ENSP00000309883:E159Q	ENSP00000263326:E185Q	E	+	1	0	IL37	113392753	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.517000	0.06275	0.948000	0.37687	0.556000	0.70494	GAG		0.502	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254126.1	NM_014439		Missense_Mutation
IL1RN	3557	broad.mit.edu	37	2	113888704	113888704	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr2:113888704G>T	ENST00000409930.3	+	3	352	c.288G>T	c.(286-288)aaG>aaT	p.K96N	IL1RN_ENST00000409052.1_Missense_Mutation_p.K62N|IL1RN_ENST00000354115.2_Missense_Mutation_p.K78N|IL1RN_ENST00000259206.5_Missense_Mutation_p.K99N|IL1RN_ENST00000361779.3_Missense_Mutation_p.K62N	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	96					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)	p.K62N(1)		breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	CCTGTGTCAAGTCTGGTGATG	0.463									Lichen Sclerosis et Atrophicus, Familial Clustering of																																							1	Substitution - Missense(1)	ovary(1)	2											129.0	114.0	119.0					2																	113888704		2203	4300	6503	113605175	SO:0001583	missense	3557	Familial Cancer Database	Lichen Sclerosis, Familial	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.288G>T	2.37:g.113888704G>T	ENSP00000387173:p.Lys96Asn	Unknown		x	x	x	113605175	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	ENST00000409930.3	37	CCDS46396.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859585	0.51376	.	.	ENSG00000136689	ENST00000409052;ENST00000361779;ENST00000259206;ENST00000354115;ENST00000409930	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	5.19	1.93	0.25924	.	0.412203	0.28482	N	0.015181	T	0.42607	0.1210	M	0.90595	3.13	0.34123	D	0.664378	D;D;D	0.76494	0.999;0.997;0.995	D;D;D	0.78314	0.991;0.964;0.981	T	0.55891	-0.8069	10	0.48119	T	0.1	-22.7477	7.6482	0.28334	0.3156:0.0:0.6844:0.0	.	96;78;99	P18510;P18510-2;Q53SC2	IL1RA_HUMAN;.;.	N	62;62;99;78;96	ENSP00000387210:K62N;ENSP00000354816:K62N;ENSP00000259206:K99N;ENSP00000329072:K78N;ENSP00000387173:K96N	ENSP00000259206:K99N	K	+	3	2	IL1RN	113605175	1.000000	0.71417	0.988000	0.46212	0.705000	0.40729	1.086000	0.30853	0.591000	0.29711	0.655000	0.94253	AAG		0.463	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330802.1	NM_173841		Missense_Mutation
NCKAP5	344148	broad.mit.edu	37	2	133540222	133540222	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr2:133540222G>C	ENST00000409261.1	-	14	4535	c.4162C>G	c.(4162-4164)Cag>Gag	p.Q1388E	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.Q1388E|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1388										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						AAGGCCTGCTGGTCTTCCTTT	0.597																																																0			2											48.0	51.0	50.0					2																	133540222		2000	4151	6151	133256692	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4162C>G	2.37:g.133540222G>C	ENSP00000387128:p.Gln1388Glu	Unknown		x	x	x	133256692	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	0.121	-1.125861	0.01770	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.09538	2.97;2.97	5.23	3.44	0.39384	.	0.685378	0.11892	N	0.519475	T	0.06554	0.0168	N	0.19112	0.55	0.09310	N	0.999998	B	0.09022	0.002	B	0.09377	0.004	T	0.43426	-0.9392	10	0.10377	T	0.69	.	8.4461	0.32843	0.0:0.1325:0.484:0.3835	.	1388	O14513	NCKP5_HUMAN	E	1388	ENSP00000387128:Q1388E;ENSP00000380603:Q1388E	ENSP00000380603:Q1388E	Q	-	1	0	NCKAP5	133256692	0.021000	0.18746	0.001000	0.08648	0.009000	0.06853	1.192000	0.32150	0.766000	0.33244	0.563000	0.77884	CAG		0.597	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		Missense_Mutation
NEUROD1	4760	broad.mit.edu	37	2	182543103	182543103	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr2:182543103C>G	ENST00000295108.3	-	2	942	c.485G>C	c.(484-486)aGc>aCc	p.S162T	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	162					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S162T(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CAGGTCTGGGCTTTTGCCTGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											78.0	75.0	76.0					2																	182543103		2203	4300	6503	182251348	SO:0001583	missense	4760			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.485G>C	2.37:g.182543103C>G	ENSP00000295108:p.Ser162Thr	Unknown		x	x	x	182251348	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	ENST00000295108.3	37	CCDS2283.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	4.142	0.024646	0.08054	.	.	ENSG00000162992	ENST00000295108	T	0.63744	-0.06	6.02	6.02	0.97574	Neurogenic differentiation factor, domain of unknown function (1);	0.085168	0.85682	D	0.000000	T	0.53094	0.1775	L	0.39085	1.19	0.49389	D	0.999781	B	0.25904	0.137	B	0.30401	0.115	T	0.49707	-0.8911	10	0.02654	T	1	-2.4381	19.1109	0.93315	0.0:1.0:0.0:0.0	.	162	Q13562	NDF1_HUMAN	T	162	ENSP00000295108:S162T	ENSP00000295108:S162T	S	-	2	0	NEUROD1	182251348	0.999000	0.42202	1.000000	0.80357	0.973000	0.67179	2.012000	0.40932	2.850000	0.98022	0.650000	0.86243	AGC		0.547	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		Missense_Mutation
MC3R	4159	broad.mit.edu	37	20	54824551	54824551	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr20:54824551G>A	ENST00000243911.2	+	1	764	c.652G>A	c.(652-654)Gtc>Atc	p.V218I		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	218					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.V255I(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			GCGGCTGCACGTCAAGCGCAT	0.577																																																1	Substitution - Missense(1)	ovary(1)	20											187.0	131.0	150.0					20																	54824551		2203	4300	6503	54257958	SO:0001583	missense	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.652G>A	20.37:g.54824551G>A	ENSP00000243911:p.Val218Ile	Unknown		x	x	x	54257958	Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	37	CCDS13449.2	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	5.111	0.206066	0.09704	.	.	ENSG00000124089	ENST00000243911	T	0.72835	-0.69	4.91	2.93	0.34026	GPCR, rhodopsin-like superfamily (1);	0.092048	0.41294	D	0.000914	T	0.52403	0.1732	L	0.28192	0.835	0.32424	N	0.548984	B	0.21606	0.058	B	0.20577	0.03	T	0.52953	-0.8506	10	0.16420	T	0.52	.	9.5261	0.39165	0.2356:0.0:0.7644:0.0	.	255	P41968	MC3R_HUMAN	I	218	ENSP00000243911:V218I	ENSP00000243911:V218I	V	+	1	0	MC3R	54257958	1.000000	0.71417	0.920000	0.36463	0.316000	0.28119	2.012000	0.40932	1.056000	0.40484	0.555000	0.69702	GTC		0.577	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			Missense_Mutation
GNAT1	2779	broad.mit.edu	37	3	50230598	50230598	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:50230598A>C	ENST00000433068.1	+	2	195	c.139A>C	c.(139-141)Aag>Cag	p.K47Q	GNAT1_ENST00000232461.3_Missense_Mutation_p.K47Q	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	47					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.K47Q(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CACCATCGTCAAGCAGATGAA	0.667											OREG0015579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	3											78.0	73.0	75.0					3																	50230598		2203	4300	6503	50205602	SO:0001583	missense	2779				CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.139A>C	3.37:g.50230598A>C	ENSP00000387555:p.Lys47Gln	Unknown	968	x	x	x	50205602	Q4VBN2	Missense_Mutation	SNP	ENST00000433068.1	37	CCDS2812.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	29.9	5.042885	0.93685	.	.	ENSG00000114349	ENST00000232461;ENST00000433068	D;D	0.91894	-2.93;-2.93	5.46	4.24	0.50183	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.96210	0.8764	M	0.92122	3.275	0.54753	D	0.999982	D	0.76494	0.999	D	0.64410	0.925	D	0.96619	0.9458	10	0.87932	D	0	.	11.2875	0.49230	0.8475:0.1525:0.0:0.0	.	47	P11488	GNAT1_HUMAN	Q	47	ENSP00000232461:K47Q;ENSP00000387555:K47Q	ENSP00000232461:K47Q	K	+	1	0	GNAT1	50205602	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.175000	0.77632	2.081000	0.62600	0.533000	0.62120	AAG		0.667	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	NM_000172		Missense_Mutation
ZNF654	55279	broad.mit.edu	37	3	88188865	88188865	+	Silent	SNP	T	T	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:88188865T>C	ENST00000309495.5	+	1	612	c.405T>C	c.(403-405)ccT>ccC	p.P135P	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L204L(1)|p.P96P(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		atgGCAGTCCTAATAATTCTT	0.343																																																2	Substitution - coding silent(2)	ovary(2)	3											29.0	28.0	28.0					3																	88188865		1840	4068	5908	88271555	SO:0001819	synonymous_variant	55279			AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.405T>C	3.37:g.88188865T>C		Unknown		x	x	x	88271555	Q9H791|Q9NV14	Silent	SNP	ENST00000309495.5	37	CCDS46874.1	SNP	53	Broad																																																																																				0.343	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2	NM_018293		Silent
CCDC80	151887	broad.mit.edu	37	3	112357631	112357631	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:112357631T>A	ENST00000206423.3	-	2	2075	c.1122A>T	c.(1120-1122)agA>agT	p.R374S	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.R374S	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	374	Thr-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.R374S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TGGTCATAGGTCTTGCAGCAA	0.642																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	71.0	75.0					3																	112357631		2203	4300	6503	113840321	SO:0001583	missense	151887			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1122A>T	3.37:g.112357631T>A	ENSP00000206423:p.Arg374Ser	Unknown		x	x	x	113840321	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	15.47	2.842707	0.51057	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.51071	0.72;0.72	5.03	1.02	0.19986	.	0.122583	0.56097	D	0.000029	T	0.35307	0.0927	L	0.29908	0.895	0.80722	D	1	P;D;D	0.56521	0.952;0.976;0.958	P;P;B	0.49799	0.591;0.622;0.386	T	0.14952	-1.0454	10	0.12430	T	0.62	-18.5584	7.5297	0.27677	0.0:0.6268:0.0:0.3732	.	385;374;374	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	S	374	ENSP00000206423:R374S;ENSP00000411814:R374S	ENSP00000206423:R374S	R	-	3	2	CCDC80	113840321	0.213000	0.23551	0.979000	0.43373	0.166000	0.22503	-0.625000	0.05534	0.308000	0.22923	0.454000	0.30748	AGA		0.642	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511		Missense_Mutation
GSK3B	2932	broad.mit.edu	37	3	119666118	119666118	+	Missense_Mutation	SNP	C	C	G	rs552038038		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:119666118C>G	ENST00000264235.8	-	3	1345	c.363G>C	c.(361-363)gaG>gaC	p.E121D	GSK3B_ENST00000316626.5_Missense_Mutation_p.E121D	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	121	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)	p.E121D(1)		endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	AACCTACCTTCTCACCACTGG	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											126.0	123.0	124.0					3																	119666118		2203	4300	6503	121148808	SO:0001583	missense	2932			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.363G>C	3.37:g.119666118C>G	ENSP00000264235:p.Glu121Asp	Unknown		x	x	x	121148808	D3DN89|Q9BWH3|Q9UL47	Missense_Mutation	SNP	ENST00000264235.8	37	CCDS54628.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	9.967	1.224434	0.22457	.	.	ENSG00000082701	ENST00000264235;ENST00000316626	T;T	0.44083	0.93;0.93	4.56	2.71	0.32032	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050254	0.85682	D	0.000000	T	0.25827	0.0629	L	0.28014	0.82	0.54753	D	0.999989	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.05273	-1.0895	10	0.19590	T	0.45	-12.0144	8.7207	0.34439	0.0:0.8027:0.0:0.1973	.	121;121	P49841;P49841-2	GSK3B_HUMAN;.	D	121	ENSP00000264235:E121D;ENSP00000324806:E121D	ENSP00000264235:E121D	E	-	3	2	GSK3B	121148808	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.944000	0.29043	0.520000	0.28426	0.585000	0.79938	GAG		0.373	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2			Missense_Mutation
KBTBD12	166348	broad.mit.edu	37	3	127642767	127642767	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:127642767G>C	ENST00000405109.1	+	2	1330	c.863G>C	c.(862-864)aGa>aCa	p.R288T	KBTBD12_ENST00000405256.1_Missense_Mutation_p.R288T|KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000343941.4_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	288								p.R288T(1)		endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						TCAGGAATCAGATCAAGACAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											135.0	129.0	131.0					3																	127642767		1926	4130	6056	129125457	SO:0001583	missense	166348				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.863G>C	3.37:g.127642767G>C	ENSP00000385957:p.Arg288Thr	Unknown		x	x	x	129125457	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	37	CCDS33848.2	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176193	0.38413	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.74526	-0.85;-0.85	5.47	4.6	0.57074	Kelch-type beta propeller (1);	.	.	.	.	T	0.69333	0.3099	M	0.61703	1.905	0.44432	D	0.99735	B	0.27559	0.181	B	0.28139	0.086	T	0.64445	-0.6406	9	0.09843	T	0.71	.	14.57	0.68205	0.0707:0.0:0.9293:0.0	.	288	Q3ZCT8	KBTBC_HUMAN	T	288	ENSP00000385957:R288T;ENSP00000385879:R288T	ENSP00000385957:R288T	R	+	2	0	KBTBD12	129125457	1.000000	0.71417	0.961000	0.40146	0.992000	0.81027	5.345000	0.65987	1.449000	0.47699	0.585000	0.79938	AGA		0.443	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335		Missense_Mutation
EFCAB12	90288	broad.mit.edu	37	3	129120635	129120635	+	Missense_Mutation	SNP	G	G	A	rs550703177		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:129120635G>A	ENST00000505956.1	-	9	1682	c.1520C>T	c.(1519-1521)cCg>cTg	p.P507L	EFCAB12_ENST00000326085.3_Missense_Mutation_p.P507L|RPL32P3_ENST00000514355.1_RNA	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	507							calcium ion binding (GO:0005509)	p.P507L(1)									AAGATGACCCGGCCAGAAGGA	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		20460	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	3											110.0	118.0	116.0					3																	129120635		2080	4222	6302	130603325	SO:0001583	missense	90288			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.1520C>T	3.37:g.129120635G>A	ENSP00000420854:p.Pro507Leu	Unknown		x	x	x	130603325	Q69YX4	Missense_Mutation	SNP	ENST00000505956.1	37	CCDS54638.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676982	0.88445	.	.	ENSG00000172771	ENST00000505956;ENST00000326085	T;T	0.69306	-0.39;-0.39	5.6	5.6	0.85130	.	0.000000	0.52532	D	0.000078	T	0.75671	0.3881	L	0.34521	1.04	0.50813	D	0.999892	D	0.89917	1.0	D	0.97110	1.0	T	0.77867	-0.2428	10	0.87932	D	0	-31.8631	18.3966	0.90501	0.0:0.0:1.0:0.0	.	507	Q6NXP0	CC025_HUMAN	L	507	ENSP00000420854:P507L;ENSP00000324241:P507L	ENSP00000324241:P507L	P	-	2	0	C3orf25	130603325	1.000000	0.71417	0.959000	0.39883	0.970000	0.65996	5.696000	0.68287	2.636000	0.89361	0.655000	0.94253	CCG		0.552	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307		Missense_Mutation
KLHL6	89857	broad.mit.edu	37	3	183217473	183217474	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:183217473_183217474GC>AA	ENST00000341319.3	-	4	1086_1087	c.1051_1052GC>TT	c.(1051-1053)GCc>TTc	p.A351F		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	351					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)			p.A351F(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CGGGAGCTTGGCCACCTCCAGG	0.55																																																1	Substitution - Missense(1)	ovary(1)	3																																								184700168	SO:0001583	missense	89857			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1051_1052delinsAA	3.37:g.183217473_183217474delinsAA	ENSP00000341342:p.Ala351Phe	Unknown		x	x	x	184700167	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	DNP	ENST00000341319.3	37	CCDS3245.2	DNP	42	Broad																																																																																				0.550	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		Missense_Mutation
LRRC15	131578	broad.mit.edu	37	3	194080481	194080481	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr3:194080481A>G	ENST00000347624.3	-	2	1377	c.1292T>C	c.(1291-1293)aTc>aCc	p.I431T	LRRC15_ENST00000439944.2_Missense_Mutation_p.I437T|LRRC15_ENST00000428839.1_Missense_Mutation_p.I437T	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	431	LRRCT.				negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.I431T(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GAGCGGAAGGATGTCTGAGTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	3											70.0	61.0	64.0					3																	194080481		2203	4300	6503	195561776	SO:0001583	missense	131578			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1292T>C	3.37:g.194080481A>G	ENSP00000306276:p.Ile431Thr	Unknown		x	x	x	195561776	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	CCDS3306.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230845	0.58777	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.26810	1.71;1.71;1.71	5.35	5.35	0.76521	Cysteine-rich flanking region, C-terminal (1);	0.473710	0.20906	N	0.083542	T	0.53318	0.1789	M	0.79926	2.475	0.48395	D	0.999645	D;D	0.76494	0.999;0.999	P;D	0.68943	0.878;0.961	T	0.59161	-0.7506	10	0.87932	D	0	.	15.6503	0.77088	1.0:0.0:0.0:0.0	.	431;437	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	T	431;437;437	ENSP00000306276:I431T;ENSP00000389128:I437T;ENSP00000413707:I437T	ENSP00000306276:I431T	I	-	2	0	LRRC15	195561776	1.000000	0.71417	0.997000	0.53966	0.696000	0.40369	6.233000	0.72320	2.165000	0.68154	0.533000	0.62120	ATC		0.577	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2			Missense_Mutation
SNCA	6622	broad.mit.edu	37	4	90756762	90756762	+	Silent	SNP	A	A	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr4:90756762A>T	ENST00000394986.1	-	2	478	c.57T>A	c.(55-57)gcT>gcA	p.A19A	SNCA_ENST00000502987.1_Silent_p.A19A|SNCA_ENST00000508895.1_Silent_p.A19A|SNCA_ENST00000336904.3_Silent_p.A19A|RP11-67M1.1_ENST00000501215.1_RNA|SNCA_ENST00000506244.1_Silent_p.A19A|SNCA_ENST00000505199.1_Silent_p.A19A|SNCA_ENST00000394989.2_Silent_p.A19A|SNCA_ENST00000345009.4_Silent_p.A19A|SNCA_ENST00000420646.2_Silent_p.A19A|RP11-67M1.1_ENST00000513653.1_RNA|SNCA_ENST00000394991.3_Silent_p.A19A			P37840	SYUA_HUMAN	synuclein, alpha (non A4 component of amyloid precursor)	19					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adult locomotory behavior (GO:0008344)|aging (GO:0007568)|behavioral response to cocaine (GO:0048148)|cellular response to copper ion (GO:0071280)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to oxidative stress (GO:0034599)|dopamine biosynthetic process (GO:0042416)|dopamine uptake involved in synaptic transmission (GO:0051583)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|long-term synaptic potentiation (GO:0060291)|microglial cell activation (GO:0001774)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrial membrane organization (GO:0007006)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of dopamine uptake involved in synaptic transmission (GO:0051585)|negative regulation of exocytosis (GO:0045920)|negative regulation of histone acetylation (GO:0035067)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of monooxygenase activity (GO:0032769)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of norepinephrine uptake (GO:0051622)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of serotonin uptake (GO:0051612)|negative regulation of thrombin receptor signaling pathway (GO:0070495)|negative regulation of transporter activity (GO:0032410)|neutral lipid metabolic process (GO:0006638)|oxidation-reduction process (GO:0055114)|phospholipid metabolic process (GO:0006644)|positive regulation of endocytosis (GO:0045807)|positive regulation of glutathione peroxidase activity (GO:1903284)|positive regulation of hydrogen peroxide catabolic process (GO:1903285)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of receptor recycling (GO:0001921)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein destabilization (GO:0031648)|receptor internalization (GO:0031623)|regulation of acyl-CoA biosynthetic process (GO:0050812)|regulation of dopamine secretion (GO:0014059)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glutamate secretion (GO:0014048)|regulation of locomotion (GO:0040012)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of macrophage activation (GO:0043030)|regulation of neuron death (GO:1901214)|regulation of phospholipase activity (GO:0010517)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|response to iron(II) ion (GO:0010040)|response to lipopolysaccharide (GO:0032496)|response to magnesium ion (GO:0032026)|synapse organization (GO:0050808)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular region (GO:0005576)|fibril (GO:0043205)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nuclear outer membrane (GO:0005640)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribosome (GO:0005840)|rough endoplasmic reticulum (GO:0005791)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	alpha-tubulin binding (GO:0043014)|calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dynein binding (GO:0045502)|ferrous iron binding (GO:0008198)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|oxidoreductase activity (GO:0016491)|phospholipid binding (GO:0005543)|phosphoprotein binding (GO:0051219)|tau protein binding (GO:0048156)|zinc ion binding (GO:0008270)	p.A19A(1)		kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)		TGGTTTTCTCAGCAGCAGCCA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	4											136.0	125.0	128.0					4																	90756762		2203	4300	6503	90975785	SO:0001819	synonymous_variant	6622			L08850	CCDS3634.1, CCDS43252.1	4q21.3-q22	2014-05-22			ENSG00000145335	ENSG00000145335		"""Parkinson disease"""	11138	protein-coding gene	gene with protein product		163890	"""Parkinson disease (autosomal dominant, Lewy body) 4"""	PARK1, PARK4		8248242, 14593171	Standard	NM_000345		Approved	NACP, PD1, alpha-synuclein	uc003hsr.3	P37840	OTTHUMG00000130948	ENST00000394986.1:c.57T>A	4.37:g.90756762A>T		Unknown		x	x	x	90975785	A8K2A4|Q13701|Q4JHI3|Q6IAU6	Silent	SNP	ENST00000394986.1	37	CCDS3634.1	SNP	7	Broad																																																																																				0.438	SNCA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253547.2			Silent
FBXW7	55294	broad.mit.edu	37	4	153244080	153244080	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr4:153244080C>T	ENST00000281708.4	-	12	3306	c.2077G>A	c.(2077-2079)Gaa>Aaa	p.E693K	FBXW7_ENST00000296555.5_Missense_Mutation_p.E575K|FBXW7_ENST00000263981.5_Missense_Mutation_p.E613K|FBXW7_ENST00000603548.1_Missense_Mutation_p.E693K|FBXW7_ENST00000393956.3_Missense_Mutation_p.E517K|FBXW7_ENST00000603841.1_Missense_Mutation_p.E693K|RP11-461L13.3_ENST00000603766.1_lincRNA	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	693					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.E693K(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TTGGTTTCTTCAGTCCCATTC	0.507			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	2	Substitution - Missense(1)|Unknown(1)	haematopoietic_and_lymphoid_tissue(1)|stomach(1)	4											164.0	160.0	161.0					4																	153244080		2203	4300	6503	153463530	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.2077G>A	4.37:g.153244080C>T	ENSP00000281708:p.Glu693Lys	Unknown		x	x	x	153463530	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056934	0.55325	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.55234	0.55;0.56;0.53;0.74	5.67	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.74458	0.3719	M	0.82923	2.615	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;1.0	T	0.79349	-0.1840	10	0.87932	D	0	-21.5342	15.0029	0.71489	0.0:0.9306:0.0:0.0694	.	517;693;575;613	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	K	693;575;613;517	ENSP00000281708:E693K;ENSP00000296555:E575K;ENSP00000263981:E613K;ENSP00000377528:E517K	ENSP00000263981:E613K	E	-	1	0	FBXW7	153463530	1.000000	0.71417	0.633000	0.29310	0.998000	0.95712	7.794000	0.85869	1.375000	0.46248	0.655000	0.94253	GAA		0.507	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1			Missense_Mutation
PDZD2	23037	broad.mit.edu	37	5	32061116	32061116	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr5:32061116A>T	ENST00000438447.1	+	14	2715	c.2327A>T	c.(2326-2328)gAt>gTt	p.D776V	PDZD2_ENST00000282493.3_Missense_Mutation_p.D776V			O15018	PDZD2_HUMAN	PDZ domain containing 2	776	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.D776V(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGCCGCGGGGATCAAATCCTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	82.0	87.0					5																	32061116		2203	4300	6503	32096873	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2327A>T	5.37:g.32061116A>T	ENSP00000402033:p.Asp776Val	Unknown		x	x	x	32096873	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110063	0.77210	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.74209	-0.82;-0.82	5.76	4.6	0.57074	PDZ/DHR/GLGF (4);	0.153090	0.31427	N	0.007674	D	0.89636	0.6772	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.90586	0.4533	10	0.87932	D	0	.	9.72	0.40297	0.9187:0.0:0.0813:0.0	.	602;776	B4E3P2;O15018	.;PDZD2_HUMAN	V	776;595;776	ENSP00000402033:D776V;ENSP00000282493:D776V	ENSP00000282493:D776V	D	+	2	0	PDZD2	32096873	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	8.654000	0.91092	1.023000	0.39654	0.528000	0.53228	GAT		0.498	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			Missense_Mutation
RASA1	5921	broad.mit.edu	37	5	86672296	86672296	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr5:86672296G>T	ENST00000274376.6	+	16	2662	c.2098G>T	c.(2098-2100)Ggt>Tgt	p.G700C	RASA1_ENST00000456692.2_Missense_Mutation_p.G523C|CTC-428H11.2_ENST00000607486.1_RNA|RASA1_ENST00000506290.1_Missense_Mutation_p.G534C|RASA1_ENST00000512763.1_Missense_Mutation_p.G533C	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	700					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)	p.G700C(1)		NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ACCATTAAAAGGTATTGAACC	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											100.0	96.0	98.0					5																	86672296		2203	4300	6503	86708052	SO:0001583	missense	5921				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2098G>T	5.37:g.86672296G>T	ENSP00000274376:p.Gly700Cys	Unknown		x	x	x	86708052	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	CCDS34200.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707241	0.89018	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	5.54	5.54	0.83059	C2 calcium/lipid-binding domain, CaLB (1);Ras GTPase-activating protein (1);	0.098719	0.64402	D	0.000001	T	0.79021	0.4376	L	0.53249	1.67	0.80722	D	1	D;P;D;D;D	0.65815	0.99;0.94;0.964;0.994;0.995	P;P;P;P;P	0.55999	0.711;0.502;0.502;0.789;0.784	T	0.80795	-0.1223	10	0.87932	D	0	.	19.4767	0.94992	0.0:0.0:1.0:0.0	.	534;533;534;523;700	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	C	700;733;523;533;534	ENSP00000274376:G700C;ENSP00000411221:G523C;ENSP00000422008:G533C;ENSP00000420905:G534C	ENSP00000274376:G700C	G	+	1	0	RASA1	86708052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.601000	0.87937	0.563000	0.77884	GGT		0.408	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890		Missense_Mutation
KCTD16	57528	broad.mit.edu	37	5	143586849	143586849	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr5:143586849G>A	ENST00000507359.3	+	2	1663	c.572G>A	c.(571-573)cGg>cAg	p.R191Q	KCTD16_ENST00000512467.1_Missense_Mutation_p.R191Q	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	191					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)		p.R191Q(2)		large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AGAGTTCCCCGGATTTTGGTT	0.512																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											58.0	62.0	60.0					5																	143586849		2203	4300	6503	143567042	SO:0001583	missense	57528			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.572G>A	5.37:g.143586849G>A	ENSP00000426548:p.Arg191Gln	Unknown		x	x	x	143567042	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	CCDS34260.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621679	0.87460	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.67865	-0.29;-0.29	5.69	5.69	0.88448	.	0.113744	0.64402	D	0.000017	T	0.74612	0.3739	M	0.85630	2.765	0.80722	D	1	D	0.59357	0.985	B	0.43331	0.416	T	0.81050	-0.1108	10	0.87932	D	0	.	19.8182	0.96579	0.0:0.0:1.0:0.0	.	191	Q68DU8	KCD16_HUMAN	Q	191	ENSP00000424151:R191Q;ENSP00000426548:R191Q	ENSP00000426548:R191Q	R	+	2	0	KCTD16	143567042	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.700000	0.92200	0.561000	0.74099	CGG		0.512	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368		Missense_Mutation
DSP	1832	broad.mit.edu	37	6	7575671	7575671	+	Silent	SNP	C	C	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr6:7575671C>T	ENST00000379802.3	+	18	2921	c.2580C>T	c.(2578-2580)gtC>gtT	p.V860V	DSP_ENST00000418664.2_Silent_p.V860V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	860	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.V860V(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GTGAAAAAGTCACACAGCTGA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	6											131.0	124.0	126.0					6																	7575671		2203	4300	6503	7520670	SO:0001819	synonymous_variant	1832			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2580C>T	6.37:g.7575671C>T		Unknown		x	x	x	7520670	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	CCDS4501.1	SNP	29	Broad																																																																																				0.488	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		Silent
ZBED9	114821	broad.mit.edu	37	6	28541351	28541351	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr6:28541351T>A	ENST00000452236.2	-	4	2932	c.2315A>T	c.(2314-2316)aAa>aTa	p.K772I	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.K772R(1)|p.K772I(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						ttttgatggtttcattgcttc	0.313																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	6											64.0	57.0	59.0					6																	28541351		2202	4298	6500	28649330	SO:0001583	missense	114821																														ENST00000452236.2:c.2315A>T	6.37:g.28541351T>A	ENSP00000395259:p.Lys772Ile	Unknown		x	x	x	28649330		Missense_Mutation	SNP	ENST00000452236.2	37	CCDS34355.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	14.37	2.516020	0.44763	.	.	ENSG00000232040	ENST00000452236	T	0.02709	4.19	2.14	2.14	0.27477	.	0.000000	0.50627	U	0.000107	T	0.04407	0.0121	L	0.61036	1.89	0.26951	N	0.966036	D	0.64830	0.994	D	0.76071	0.987	T	0.18840	-1.0324	10	0.87932	D	0	.	6.286	0.21033	0.0:0.0:0.0:1.0	.	772	Q6R2W3	SCND3_HUMAN	I	772	ENSP00000395259:K772I	ENSP00000395259:K772I	K	-	2	0	SCAND3	28649330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.824000	0.39072	1.238000	0.43771	0.460000	0.39030	AAA		0.313	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			Missense_Mutation
MRPS18B	28973	broad.mit.edu	37	6	30592684	30592684	+	Missense_Mutation	SNP	G	G	A	rs141114241	byFrequency	TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr6:30592684G>A	ENST00000259873.4	+	6	603	c.446G>A	c.(445-447)cGg>cAg	p.R149Q	ATAT1_ENST00000318999.7_5'Flank|MRPS18B_ENST00000506373.2_3'UTR|ATAT1_ENST00000319027.5_5'Flank|ATAT1_ENST00000376483.4_5'Flank|ATAT1_ENST00000376478.2_5'Flank|ATAT1_ENST00000376485.4_5'Flank|ATAT1_ENST00000329992.8_5'Flank|MRPS18B_ENST00000472229.1_3'UTR|ATAT1_ENST00000330083.5_5'Flank	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	149					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)	p.R149Q(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						CAGCACAAGCGGTTGACCCAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	6						G	GLN/ARG	2,3018		0,2,1508	92.0	83.0	86.0		446	0.5	1.0	6	dbSNP_134	86	0,5416		0,0,2708	no	missense	MRPS18B	NM_014046.3	43	0,2,4216	AA,AG,GG		0.0,0.0662,0.0237	benign	149/259	30592684	2,8434	1510	2708	4218	30700663	SO:0001583	missense	28973			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.446G>A	6.37:g.30592684G>A	ENSP00000259873:p.Arg149Gln	Unknown		x	x	x	30700663	A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	ENST00000259873.4	37	CCDS4682.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804056	0.31869	6.62E-4	0.0	ENSG00000204568	ENST00000259873	T	0.39406	1.08	5.85	0.529	0.17095	.	0.411999	0.26116	N	0.026257	T	0.05502	0.0145	N	0.04260	-0.245	0.80722	D	1	B	0.18461	0.028	B	0.10450	0.005	T	0.21314	-1.0249	10	0.20046	T	0.44	.	3.4923	0.07642	0.5617:0.0:0.1592:0.2791	.	149	Q9Y676	RT18B_HUMAN	Q	149	ENSP00000259873:R149Q	ENSP00000259873:R149Q	R	+	2	0	MRPS18B	30700663	0.604000	0.26932	0.994000	0.49952	0.823000	0.46562	0.006000	0.13152	-0.128000	0.11641	-0.471000	0.05019	CGG		0.463	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076584.2			Missense_Mutation
TIAM2	26230	broad.mit.edu	37	6	155451255	155451255	+	Missense_Mutation	SNP	C	C	T	rs373788314		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr6:155451255C>T	ENST00000461783.3	+	6	2171	c.898C>T	c.(898-900)Cgg>Tgg	p.R300W	TIAM2_ENST00000360366.4_Missense_Mutation_p.R300W|TIAM2_ENST00000529824.2_Missense_Mutation_p.R300W|TIAM2_ENST00000456144.1_Missense_Mutation_p.R300W|TIAM2_ENST00000318981.5_Missense_Mutation_p.R300W|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	300					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R300W(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTCCTCCCTCCGGGAACTGTA	0.592																																																1	Substitution - Missense(1)	ovary(1)	6						C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	54.0	56.0		898	5.0	0.9	6		56	0,8600		0,0,4300	no	missense	TIAM2	NM_012454.3	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	300/1702	155451255	1,13005	2203	4300	6503	155492947	SO:0001583	missense	26230				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.898C>T	6.37:g.155451255C>T	ENSP00000437188:p.Arg300Trp	Unknown		x	x	x	155492947	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653145	0.67472	2.27E-4	0.0	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.06218	3.45;3.33;3.4;3.45;3.47;3.4	4.99	4.99	0.66335	.	0.152719	0.45361	D	0.000369	T	0.15565	0.0375	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.66847	0.947	T	0.00448	-1.1733	10	0.66056	D	0.02	.	16.8516	0.85995	0.0:1.0:0.0:0.0	.	300	Q8IVF5	TIAM2_HUMAN	W	300;546;300;300;300;300;300	ENSP00000437188:R300W;ENSP00000434901:R300W;ENSP00000407746:R300W;ENSP00000327315:R300W;ENSP00000353528:R300W;ENSP00000433348:R300W	ENSP00000327315:R300W	R	+	1	2	TIAM2	155492947	0.968000	0.33430	0.869000	0.34112	0.288000	0.27193	2.230000	0.42999	2.489000	0.83994	0.655000	0.94253	CGG		0.592	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		Missense_Mutation
IQCE	23288	broad.mit.edu	37	7	2629721	2629721	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr7:2629721G>A	ENST00000402050.2	+	14	1409	c.1225G>A	c.(1225-1227)Gag>Aag	p.E409K	IQCE_ENST00000438376.2_Missense_Mutation_p.E393K|IQCE_ENST00000404984.1_Missense_Mutation_p.E358K|IQCE_ENST00000325979.7_Missense_Mutation_p.E344K	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	409						mitochondrion (GO:0005739)		p.E409K(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CGCGCTGCAGGAGCAGCTGCT	0.672																																																1	Substitution - Missense(1)	ovary(1)	7											24.0	29.0	28.0					7																	2629721		2021	4157	6178	2596247	SO:0001583	missense	23288			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1225G>A	7.37:g.2629721G>A	ENSP00000385597:p.Glu409Lys	Unknown		x	x	x	2596247	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	37	CCDS43542.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	8.990	0.977428	0.18812	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.54	-2.11	0.07187	.	1.833220	0.02515	N	0.091931	T	0.28200	0.0696	L	0.34521	1.04	0.09310	N	1	P;P;P;B;P;B	0.38020	0.615;0.615;0.491;0.304;0.615;0.372	B;B;B;B;B;B	0.30495	0.116;0.116;0.108;0.033;0.116;0.053	T	0.18429	-1.0337	10	0.11794	T	0.64	0.1071	10.7603	0.46261	0.4528:0.0:0.5472:0.0	.	344;393;344;409;409;393	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	K	409;358;393;344	ENSP00000385597:E409K;ENSP00000385945:E358K;ENSP00000396178:E393K;ENSP00000313772:E344K	ENSP00000313772:E344K	E	+	1	0	IQCE	2596247	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.132000	0.10467	-0.275000	0.09219	-0.136000	0.14681	GAG		0.672	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558		Missense_Mutation
ACTR3B	57180	broad.mit.edu	37	7	152551587	152551587	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr7:152551587G>T	ENST00000256001.8	+	12	1340	c.1206G>T	c.(1204-1206)gaG>gaT	p.E402D	ACTR3B_ENST00000397282.2_Missense_Mutation_p.E314D|ACTR3B_ENST00000537264.1_Missense_Mutation_p.E314D|ACTR3B_ENST00000377776.3_Missense_Mutation_p.E332D	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	402						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.E402D(1)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		ACTATGAAGAGTACGGGCCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	7											137.0	110.0	119.0					7																	152551587		2203	4300	6503	152182520	SO:0001583	missense	57180				CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.1206G>T	7.37:g.152551587G>T	ENSP00000256001:p.Glu402Asp	Unknown		x	x	x	152182520	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Missense_Mutation	SNP	ENST00000256001.8	37	CCDS5934.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556401	0.45487	.	.	ENSG00000133627	ENST00000377776;ENST00000256001;ENST00000397282;ENST00000537264	T;D;D;D	0.97480	2.31;-4.4;-4.4;-4.4	4.83	-0.253	0.12996	.	0.000000	0.64402	U	0.000018	D	0.98099	0.9373	M	0.88241	2.94	0.24595	N	0.993809	D;D	0.65815	0.974;0.995	D;D	0.79108	0.953;0.992	D	0.94362	0.7588	10	0.87932	D	0	.	10.0581	0.42257	0.4792:0.0:0.5207:0.0	.	332;402	Q9P1U1-3;Q9P1U1	.;ARP3B_HUMAN	D	332;402;314;314	ENSP00000367007:E332D;ENSP00000256001:E402D;ENSP00000380452:E314D;ENSP00000446157:E314D	ENSP00000256001:E402D	E	+	3	2	ACTR3B	152182520	0.998000	0.40836	0.255000	0.24374	0.963000	0.63663	1.048000	0.30379	0.087000	0.17167	0.603000	0.83216	GAG		0.532	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1	NM_020445		Missense_Mutation
GPR124	25960	broad.mit.edu	37	8	37672441	37672441	+	Silent	SNP	G	G	T			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr8:37672441G>T	ENST00000412232.2	+	2	307	c.294G>T	c.(292-294)ggG>ggT	p.G98G	GPR124_ENST00000315215.7_Silent_p.G98G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	98					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G91G(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			AGATCACGGGGCTCCGCAATG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	8											140.0	125.0	130.0					8																	37672441		2203	4300	6503	37791599	SO:0001819	synonymous_variant	25960			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.294G>T	8.37:g.37672441G>T		Unknown		x	x	x	37791599	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	SNP	42	Broad																																																																																				0.577	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			Silent
TSNARE1	203062	broad.mit.edu	37	8	143413137	143413137	+	Silent	SNP	G	G	A	rs374507590		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr8:143413137G>A	ENST00000307180.3	-	5	918	c.801C>T	c.(799-801)aaC>aaT	p.N267N	TSNARE1_ENST00000524325.1_Silent_p.N267N|TSNARE1_ENST00000519651.1_Silent_p.N48N|TSNARE1_ENST00000520166.1_Silent_p.N267N	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	267					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)	p.N267N(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TTCGGAAGACGTTGGCCGACA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	8						G		0,4404		0,0,2202	181.0	126.0	145.0		801	-3.4	0.0	8		145	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TSNARE1	NM_145003.3		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		267/514	143413137	1,13003	2202	4300	6502	143411044	SO:0001819	synonymous_variant	203062					8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.801C>T	8.37:g.143413137G>A		Unknown		x	x	x	143411044	B7ZLB0|Q14D03	Silent	SNP	ENST00000307180.3	37	CCDS6384.1	SNP	40	Broad																																																																																				0.607	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003		Silent
SMC2	10592	broad.mit.edu	37	9	106858434	106858434	+	Silent	SNP	G	G	A			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr9:106858434G>A	ENST00000286398.7	+	3	462	c.174G>A	c.(172-174)cgG>cgA	p.R58R	SMC2_ENST00000303219.8_Silent_p.R58R|SMC2_ENST00000374793.3_Silent_p.R58R|SMC2_ENST00000374787.3_Silent_p.R58R	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	58					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.R58R(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TTTAGGTTCGGGCTTCTAATT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	9											64.0	70.0	68.0					9																	106858434		2202	4300	6502	105898255	SO:0001819	synonymous_variant	10592			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.174G>A	9.37:g.106858434G>A		Unknown		x	x	x	105898255	Q6IEE0|Q9P1P2	Silent	SNP	ENST00000286398.7	37	CCDS35086.1	SNP	43	Broad																																																																																				0.368	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1			Silent
NBPF10	100132406	broad.mit.edu	37	1	145362099	145362100	+	Frame_Shift_Ins	INS	-	-	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:145362099_145362100insC	ENST00000342960.5	+	76	9442_9443	c.9407_9408insC	c.(9406-9411)cttagcfs	p.S3137fs	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	695						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S3137fs*1(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTTTCCAGGCTTAGCAGGGAGC	0.436																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								144073457	SO:0001589	frameshift_variant	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	Exception_encountered	1.37:g.145362099_145362100insC	ENSP00000345684:p.Ser3137fs	Unknown		Capture	Illumina GAIIx	Phase_I	144073456	Q5RHC0|Q9NWN6	Frame_Shift_Ins	INS	ENST00000342960.5	37	CCDS53355.1	INS	56	Broad																																																																																				0.436	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		Frame_Shift_Ins
YOD1	55432	broad.mit.edu	37	1	207222733	207222741	+	In_Frame_Del	DEL	TCGATATCT	TCGATATCT	-	rs141568066		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr1:207222733_207222741delTCGATATCT	ENST00000315927.4	-	2	717_725	c.671_679delAGATATCGA	c.(670-681)gagatatcgatt>gtt	p.224_227EISI>V	YOD1_ENST00000391927.1_In_Frame_Del_p.180_183EISI>V|PFKFB2_ENST00000411990.2_5'Flank|YOD1_ENST00000367084.1_In_Frame_Del_p.180_183EISI>V	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	224	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.E224_I227>V(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					TTGGACAAAATCGATATCTCTATTGCTCC	0.407																																																1	Complex - deletion inframe(1)	ovary(1)	1																																								205289364	SO:0001651	inframe_deletion	55432				CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.671_679delAGATATCGA	1.37:g.207222733_207222741delTCGATATCT	ENSP00000326813:p.Glu224_Ile227delinsVal	Unknown		Capture	Illumina GAIIx	Phase_I	205289356	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	In_Frame_Del	DEL	ENST00000315927.4	37	CCDS31002.1	DEL	50	Broad																																																																																				0.407	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566		In_Frame_Del
TP53	7157	broad.mit.edu	37	17	7579535	7579536	+	Frame_Shift_Ins	INS	-	-	C			TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:7579535_7579536insC	ENST00000269305.4	-	4	340_341	c.151_152insG	c.(151-153)gaafs	p.E51fs	TP53_ENST00000420246.2_Frame_Shift_Ins_p.E51fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.E51fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.E51fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.E51fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.E51fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	51	Interaction with HRMT1L2.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.E51*(6)|p.E51fs*6(3)|p.E51fs*59(1)|p.I50fs*4(1)|p.D48fs*55(1)|p.E51fs*72(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAACCATTGTTCAATATCGTCC	0.594		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	23	Whole gene deletion(8)|Substitution - Nonsense(6)|Deletion - Frameshift(6)|Insertion - Frameshift(3)	ovary(5)|bone(4)|skin(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|kidney(1)|breast(1)|prostate(1)|pancreas(1)	17																																								7520261	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.152dupG	17.37:g.7579536_7579536dupC	ENSP00000269305:p.Glu51fs	Unknown		Capture	Illumina GAIIx	Phase_I	7520260	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1	INS	62	Broad																																																																																				0.594	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Ins
AKAP10	11216	broad.mit.edu	37	17	19861389	19861390	+	Frame_Shift_Ins	INS	-	-	T	rs572962512		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr17:19861389_19861390insT	ENST00000225737.6	-	4	971_972	c.814_815insA	c.(814-816)acafs	p.T272fs	AKAP10_ENST00000572155.1_5'Flank|AKAP10_ENST00000395536.3_Frame_Shift_Ins_p.T272fs	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	272	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)		p.T272fs*5(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					ACTGGCTACTGTAAGTGTAGAG	0.426																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								19801982	SO:0001589	frameshift_variant	11216			AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.815dupA	17.37:g.19861390_19861390dupT	ENSP00000225737:p.Thr272fs	Unknown		Capture	Illumina GAIIx	Phase_I	19801981	B2R650|Q96AJ7	Frame_Shift_Ins	INS	ENST00000225737.6	37	CCDS11214.1	INS	48	Broad																																																																																				0.426	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202		Frame_Shift_Ins
ANKRD7	56311	broad.mit.edu	37	7	117864925	117864931	+	Frame_Shift_Del	DEL	CCCGCAG	CCCGCAG	-	rs376379560		TCGA-25-2391-01	TCGA-25-2391-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2391-01	TCGA-25-2391-10	g.chr7:117864925_117864931delCCCGCAG	ENST00000265224.4	+	1	196_202	c.41_47delCCCGCAG	c.(40-48)acccgcagcfs	p.TRS14fs	ANKRD7_ENST00000417525.1_5'UTR|ANKRD7_ENST00000477532.1_Intron|ANKRD7_ENST00000433239.1_5'Flank|ANKRD7_ENST00000357099.4_Frame_Shift_Del_p.TRS14fs	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	14					male gonad development (GO:0008584)	nucleus (GO:0005634)		p.S16fs*9(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						AAGAATGAGACCCGCAGCCAGGGCTAC	0.483																																																1	Deletion - Frameshift(1)	ovary(1)	7																																								117652167	SO:0001589	frameshift_variant	56311			D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.41_47delCCCGCAG	7.37:g.117864925_117864931delCCCGCAG	ENSP00000265224:p.Thr14fs	Unknown		Capture	Illumina GAIIx	Phase_I	117652161	B4DYF5|Q96QN1|Q9UDM3	Frame_Shift_Del	DEL	ENST00000265224.4	37	CCDS43638.1	DEL	18	Broad																																																																																				0.483	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708		Frame_Shift_Del
