#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SYNC	81493	broad.mit.edu	37	1	33160554	33160554	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:33160554G>A	ENST00000409190.3	-	2	1603	c.1145C>T	c.(1144-1146)gCc>gTc	p.A382V	SYNC_ENST00000373484.3_Missense_Mutation_p.A382V	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	382	Coil 2.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)	p.A51V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						GAGCTGCCGGGCCTCTGCTTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											140.0	145.0	143.0					1																	33160554		2203	4300	6503	32933141	SO:0001583	missense	81493			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.1145C>T	1.37:g.33160554G>A	ENSP00000386439:p.Ala382Val	Unknown		x	x	x	32933141	B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	ENST00000409190.3	37	CCDS367.2	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	0.017	-1.490831	0.01018	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	D;D	0.87491	-2.26;-2.26	4.0	2.08	0.27032	Filament (1);	0.592265	0.17165	N	0.184514	T	0.63331	0.2502	N	0.02539	-0.55	0.21064	N	0.999794	P;P	0.42785	0.565;0.79	B;B	0.37833	0.107;0.259	T	0.60737	-0.7204	10	0.11182	T	0.66	-0.0101	7.0432	0.25031	0.304:0.0:0.696:0.0	.	382;382	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	V	382	ENSP00000362583:A382V;ENSP00000386439:A382V	ENSP00000362583:A382V	A	-	2	0	SYNC	32933141	1.000000	0.71417	0.976000	0.42696	0.032000	0.12392	1.983000	0.40648	0.830000	0.34757	-0.320000	0.08662	GCC		0.572	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022129.3	NM_030786		Missense_Mutation
FOXJ3	22887	broad.mit.edu	37	1	42671457	42671457	+	Silent	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:42671457C>T	ENST00000372572.1	-	8	917	c.606G>A	c.(604-606)ctG>ctA	p.L202L	FOXJ3_ENST00000545068.1_Silent_p.L202L|FOXJ3_ENST00000372573.1_Silent_p.L202L|FOXJ3_ENST00000361776.1_Intron|FOXJ3_ENST00000361346.1_Silent_p.L202L	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	202					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L202L(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGTTGATTGCCAGAGTTGGAG	0.313																																																1	Substitution - coding silent(1)	ovary(1)	1											90.0	85.0	87.0					1																	42671457		2203	4300	6503	42444044	SO:0001819	synonymous_variant	22887			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.606G>A	1.37:g.42671457C>T		Unknown		x	x	x	42444044	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Silent	SNP	ENST00000372572.1	37	CCDS30689.1	SNP	21	Broad																																																																																				0.313	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018310.1	NM_014947		Silent
ZMYND12	84217	broad.mit.edu	37	1	42915696	42915696	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:42915696T>G	ENST00000372565.3	-	2	414	c.145A>C	c.(145-147)Atc>Ctc	p.I49L	ZMYND12_ENST00000433602.2_5'UTR	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12	49						intracellular (GO:0005622)	metal ion binding (GO:0046872)	p.I49L(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTCTCATGGATGCTGTCCCAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											149.0	130.0	136.0					1																	42915696		2203	4300	6503	42688283	SO:0001583	missense	84217			AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.145A>C	1.37:g.42915696T>G	ENSP00000361646:p.Ile49Leu	Unknown		x	x	x	42688283	Q5VUS6|Q8TC87|Q96M51	Missense_Mutation	SNP	ENST00000372565.3	37	CCDS467.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	22.1	4.249746	0.80024	.	.	ENSG00000066185	ENST00000372565	T	0.52295	0.67	5.47	5.47	0.80525	Zinc finger, MYND-type (2);	0.000000	0.85682	D	0.000000	T	0.63046	0.2478	L	0.55481	1.735	0.80722	D	1	D	0.58620	0.983	D	0.73708	0.981	T	0.64313	-0.6437	10	0.54805	T	0.06	-17.6194	13.4904	0.61390	0.0:0.0:0.0:1.0	.	49	Q9H0C1	ZMY12_HUMAN	L	49	ENSP00000361646:I49L	ENSP00000361646:I49L	I	-	1	0	ZMYND12	42688283	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	4.193000	0.58385	2.081000	0.62600	0.260000	0.18958	ATC		0.468	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019170.1	NM_032257		Missense_Mutation
C1orf50	79078	broad.mit.edu	37	1	43240417	43240417	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:43240417G>T	ENST00000372525.5	+	4	335	c.292G>T	c.(292-294)Gat>Tat	p.D98Y	C1orf50_ENST00000468913.2_3'UTR|RP5-994D16.9_ENST00000447572.1_RNA|C1orf50_ENST00000536543.1_5'UTR	NM_024097.3	NP_077002.2	Q9BV19	CA050_HUMAN	chromosome 1 open reading frame 50	98								p.D98Y(1)		large_intestine(2)|ovary(1)|pancreas(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGTACTGGAAGATGCTCACAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											140.0	136.0	137.0					1																	43240417		2203	4300	6503	43013004	SO:0001583	missense	79078			BC001711	CCDS473.1	1p34.2	2012-06-25			ENSG00000164008	ENSG00000164008			28795	protein-coding gene	gene with protein product						12477932	Standard	NM_024097		Approved	MGC955	uc001cia.4	Q9BV19	OTTHUMG00000007568	ENST00000372525.5:c.292G>T	1.37:g.43240417G>T	ENSP00000361603:p.Asp98Tyr	Unknown		x	x	x	43013004		Missense_Mutation	SNP	ENST00000372525.5	37	CCDS473.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096790	0.76870	.	.	ENSG00000164008	ENST00000372525	T	0.49720	0.77	6.17	6.17	0.99709	.	0.153836	0.56097	D	0.000025	T	0.69106	0.3074	M	0.72118	2.19	0.22066	N	0.999381	D	0.76494	0.999	D	0.71184	0.972	T	0.69499	-0.5129	9	0.87932	D	0	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	98	Q9BV19	CA050_HUMAN	Y	98	ENSP00000361603:D98Y	ENSP00000361603:D98Y	D	+	1	0	C1orf50	43013004	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	9.219000	0.95173	2.941000	0.99782	0.655000	0.94253	GAT		0.393	C1orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020001.2	NM_024097		Missense_Mutation
IPP	3652	broad.mit.edu	37	1	46180037	46180037	+	Missense_Mutation	SNP	T	T	C	rs572992251		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:46180037T>C	ENST00000396478.3	-	8	1513	c.1411A>G	c.(1411-1413)Atg>Gtg	p.M471V	IPP_ENST00000495072.1_5'Flank	NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	471						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)	p.M471V(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					CTGGTTCCCATTGGAGGAAGT	0.428													T|||	1	0.000199681	0.0	0.0	5008	,	,		19080	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	1											112.0	95.0	101.0					1																	46180037		2203	4300	6503	45952625	SO:0001583	missense	3652			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1411A>G	1.37:g.46180037T>C	ENSP00000379739:p.Met471Val	Unknown		x	x	x	45952625	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	37	CCDS30702.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	19.65	3.866507	0.72065	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	D;D	0.84146	-1.81;-1.81	4.92	4.92	0.64577	Galactose oxidase, beta-propeller (1);	0.075290	0.85682	D	0.000000	D	0.93006	0.7774	M	0.89601	3.045	0.80722	D	1	D;P	0.60575	0.988;0.897	D;P	0.65573	0.936;0.816	D	0.94424	0.7643	10	0.87932	D	0	.	14.5442	0.68017	0.0:0.0:0.0:1.0	.	471;471	Q9Y573;A2A6V3	IPP_HUMAN;.	V	471	ENSP00000353024:M471V;ENSP00000379739:M471V	ENSP00000353024:M471V	M	-	1	0	IPP	45952625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.063000	0.76714	1.825000	0.53177	0.454000	0.30748	ATG		0.428	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897		Missense_Mutation
MAST2	23139	broad.mit.edu	37	1	46290198	46290198	+	Missense_Mutation	SNP	C	C	G	rs369038713		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:46290198C>G	ENST00000361297.2	+	2	554	c.271C>G	c.(271-273)Ctg>Gtg	p.L91V	MAST2_ENST00000372009.2_Missense_Mutation_p.L91V	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.L91V(2)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TCAGCGACAACTGAGTCAGGA	0.408																																																2	Substitution - Missense(2)	ovary(2)	1											165.0	148.0	153.0					1																	46290198		1852	4092	5944	46062785	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.271C>G	1.37:g.46290198C>G	ENSP00000354671:p.Leu91Val	Unknown		x	x	x	46062785		Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	23.7	4.444289	0.83993	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.78707	-1.03;-1.2	5.39	5.39	0.77823	.	0.000000	0.40728	N	0.001023	D	0.83889	0.5352	L	0.49778	1.585	0.35009	D	0.756725	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.991	D	0.87162	0.2215	10	0.45353	T	0.12	-4.4784	13.4612	0.61229	0.0:0.925:0.0:0.075	.	91;91	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	V	91	ENSP00000354671:L91V;ENSP00000361079:L91V	ENSP00000354671:L91V	L	+	1	2	MAST2	46062785	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.203000	0.51075	2.532000	0.85374	0.655000	0.94253	CTG		0.408	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112		Missense_Mutation
JAK1	3716	broad.mit.edu	37	1	65323363	65323363	+	Silent	SNP	G	G	A	rs55788790		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:65323363G>A	ENST00000342505.4	-	10	1682	c.1434C>T	c.(1432-1434)acC>acT	p.T478T		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	478	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.T478T(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	AGCAGGTGACGGTCATGAGGA	0.542			Mis		ALL								G|||	1	0.000199681	0.0	0.0	5008	,	,		20480	0.001		0.0	False		,,,				2504	0.0						Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	1	Substitution - coding silent(1)	ovary(1)	1											105.0	107.0	107.0					1																	65323363		2103	4233	6336	65095951	SO:0001819	synonymous_variant	3716			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1434C>T	1.37:g.65323363G>A		Unknown		x	x	x	65095951	Q59GQ2|Q9UD26	Silent	SNP	ENST00000342505.4	37	CCDS41346.1	SNP	39	Broad																																																																																				0.542	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227		Silent
PTGFR	5737	broad.mit.edu	37	1	78959186	78959186	+	Missense_Mutation	SNP	C	C	T	rs145816454		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:78959186C>T	ENST00000370757.3	+	2	995	c.758C>T	c.(757-759)gCg>gTg	p.A253V	PTGFR_ENST00000370758.1_Missense_Mutation_p.A253V|PTGFR_ENST00000370756.3_Missense_Mutation_p.A253V	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	253					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.A253V(2)|p.A253E(2)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	CAGCTCCTGGCGATAATGTGT	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		20042	0.0		0.0	False		,,,				2504	0.001															4	Substitution - Missense(4)	ovary(2)|lung(2)	1						C	VAL/ALA,VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	52.0	50.0	51.0		758,758	4.8	0.9	1	dbSNP_134	51	0,8600		0,0,4300	no	missense,missense	PTGFR	NM_000959.3,NM_001039585.1	64,64	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	253/360,253/298	78959186	2,13004	2203	4300	6503	78731774	SO:0001583	missense	5737			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.758C>T	1.37:g.78959186C>T	ENSP00000359793:p.Ala253Val	Unknown		x	x	x	78731774	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433742	0.25813	4.54E-4	0.0	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.33654	1.4;1.4;1.4	5.7	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.177888	0.49305	D	0.000145	T	0.10637	0.0260	L	0.31065	0.9	0.42019	D	0.990974	P;P	0.46987	0.749;0.888	B;B	0.34138	0.108;0.176	T	0.05632	-1.0873	10	0.08837	T	0.75	-5.1067	17.0929	0.86627	0.0:0.866:0.134:0.0	.	253;253	P43088;P43088-2	PF2R_HUMAN;.	V	253	ENSP00000359794:A253V;ENSP00000359793:A253V;ENSP00000359792:A253V	ENSP00000359792:A253V	A	+	2	0	PTGFR	78731774	0.978000	0.34361	0.901000	0.35422	0.251000	0.25915	2.473000	0.45145	1.532000	0.49169	0.655000	0.94253	GCG		0.393	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959		Missense_Mutation
SYPL2	284612	broad.mit.edu	37	1	110019431	110019431	+	Silent	SNP	C	C	T	rs193098034	byFrequency	TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:110019431C>T	ENST00000369872.3	+	4	504	c.288C>T	c.(286-288)tgC>tgT	p.C96C	SYPL2_ENST00000401021.3_Silent_p.C96C|SYPL2_ENST00000475497.1_3'UTR	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	96	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)	p.C96C(1)		breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		TGCCCCTCTGCGATGAAGAGT	0.567													C|||	6	0.00119808	0.0	0.0	5008	,	,		17381	0.006		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											69.0	74.0	72.0					1																	110019431		2043	4184	6227	109820954	SO:0001819	synonymous_variant	284612			AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.288C>T	1.37:g.110019431C>T		Unknown		x	x	x	109820954	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Silent	SNP	ENST00000369872.3	37	CCDS41365.1	SNP	27	Broad																																																																																				0.567	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030191.1	NM_001006603		Silent
PLEKHA6	22874	broad.mit.edu	37	1	204236637	204236637	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:204236637G>C	ENST00000272203.3	-	5	562	c.246C>G	c.(244-246)ttC>ttG	p.F82L	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.F82L	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	82	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.							p.F82L(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CCACCAGGACGAACCAGCGCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	87.0	97.0					1																	204236637		2203	4300	6503	202503260	SO:0001583	missense	22874			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.246C>G	1.37:g.204236637G>C	ENSP00000272203:p.Phe82Leu	Unknown		x	x	x	202503260	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076770	0.55753	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.21191	2.02;2.02	5.51	0.667	0.17907	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.49064	0.1535	M	0.91612	3.225	0.58432	D	0.999995	D	0.60575	0.988	D	0.76575	0.988	T	0.53739	-0.8396	10	0.62326	D	0.03	-25.6828	9.9346	0.41543	0.5696:0.0:0.4304:0.0	.	82	Q9Y2H5	PKHA6_HUMAN	L	82	ENSP00000272203:F82L;ENSP00000402046:F82L	ENSP00000272203:F82L	F	-	3	2	PLEKHA6	202503260	0.477000	0.25909	1.000000	0.80357	0.990000	0.78478	-0.335000	0.07873	0.208000	0.20626	0.549000	0.68633	TTC		0.587	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935		Missense_Mutation
PROX1	5629	broad.mit.edu	37	1	214171443	214171443	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:214171443C>G	ENST00000366958.4	+	2	2173	c.1565C>G	c.(1564-1566)aCg>aGg	p.T522R	PROX1_ENST00000498508.2_Missense_Mutation_p.T522R|PROX1_ENST00000435016.1_Missense_Mutation_p.T522R|PROX1_ENST00000261454.4_Missense_Mutation_p.T522R	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	522					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.T522R(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGGGATACCACGAGTCTGAGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	100.0	99.0					1																	214171443		2203	4300	6503	212238066	SO:0001583	missense	5629			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1565C>G	1.37:g.214171443C>G	ENSP00000355925:p.Thr522Arg	Unknown		x	x	x	212238066	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191507	0.58017	.	.	ENSG00000117707	ENST00000541470;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.46819	0.87;0.86;0.87;0.87	5.71	5.71	0.89125	.	0.045241	0.85682	D	0.000000	T	0.61714	0.2369	M	0.61703	1.905	0.80722	D	1	P	0.43519	0.809	P	0.51701	0.677	T	0.59643	-0.7416	10	0.49607	T	0.09	-3.8498	19.8546	0.96752	0.0:1.0:0.0:0.0	.	522	Q92786	PROX1_HUMAN	R	94;522;522;522;522	ENSP00000420283:T522R;ENSP00000355925:T522R;ENSP00000400694:T522R;ENSP00000261454:T522R	ENSP00000261454:T522R	T	+	2	0	PROX1	212238066	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	6.070000	0.71220	2.697000	0.92050	0.655000	0.94253	ACG		0.552	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763		Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	215932065	215932065	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:215932065C>G	ENST00000307340.3	-	58	11647	c.11261G>C	c.(11260-11262)gGa>gCa	p.G3754A	USH2A_ENST00000366943.2_Missense_Mutation_p.G3754A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3754	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G3754A(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTGCCACCTCCAGTTTTGAC	0.353										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											132.0	130.0	131.0					1																	215932065		2203	4300	6503	213998688	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11261G>C	1.37:g.215932065C>G	ENSP00000305941:p.Gly3754Ala	Unknown		x	x	x	213998688	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	4.821	0.152725	0.09185	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52983	0.64;0.64	5.58	0.413	0.16401	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.185290	0.26321	U	0.025049	T	0.26376	0.0644	L	0.28556	0.865	0.27627	N	0.948167	P	0.44690	0.841	B	0.35182	0.197	T	0.30446	-0.9978	10	0.16896	T	0.51	.	9.8896	0.41283	0.0:0.6058:0.0:0.3942	.	3754	O75445	USH2A_HUMAN	A	3754	ENSP00000305941:G3754A;ENSP00000355910:G3754A	ENSP00000305941:G3754A	G	-	2	0	USH2A	213998688	0.768000	0.28519	0.928000	0.36995	0.950000	0.60333	0.131000	0.15870	0.056000	0.16144	0.586000	0.80456	GGA		0.353	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
ZBTB18	10472	broad.mit.edu	37	1	244218271	244218271	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr1:244218271A>T	ENST00000358704.4	+	2	1344	c.1195A>T	c.(1195-1197)Agc>Tgc	p.S399C		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	390	Interaction with DNMT3A.				cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S390C(1)									GATCCACCTGAGCACGCACTT	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											54.0	53.0	53.0					1																	244218271		2203	4300	6503	242284894	SO:0001583	missense	10472			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1195A>T	1.37:g.244218271A>T	ENSP00000351539:p.Ser399Cys	Unknown		x	x	x	242284894	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	17.81	3.480083	0.63849	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.36878	1.23	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.56877	0.2015	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.993	T	0.58634	-0.7602	10	0.72032	D	0.01	.	16.2159	0.82217	1.0:0.0:0.0:0.0	.	390;399	Q99592;Q99592-2	ZN238_HUMAN;.	C	399	ENSP00000351539:S399C	ENSP00000351539:S399C	S	+	1	0	ZNF238	242284894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.243000	0.73865	0.533000	0.62120	AGC		0.627	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768		Missense_Mutation
LRRC18	474354	broad.mit.edu	37	10	50121865	50121865	+	Silent	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:50121865C>T	ENST00000374160.3	-	1	412	c.336G>A	c.(334-336)ggG>ggA	p.G112G	WDFY4_ENST00000325239.5_Intron|RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000413659.2_Intron|LRRC18_ENST00000298124.3_Silent_p.G112G	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	112						cytoplasm (GO:0005737)		p.G112G(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CCACGGGCAGCCCGTTGCTGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	10											81.0	75.0	77.0					10																	50121865		2203	4300	6503	49791871	SO:0001819	synonymous_variant	474354			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.336G>A	10.37:g.50121865C>T		Unknown		x	x	x	49791871	Q6UY02	Silent	SNP	ENST00000374160.3	37	CCDS31197.1	SNP	26	Broad																																																																																				0.592	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939		Silent
ANK3	288	broad.mit.edu	37	10	61829385	61829385	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:61829385A>T	ENST00000280772.2	-	37	11445	c.11254T>A	c.(11254-11256)Tgt>Agt	p.C3752S	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3752					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.C3752S(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AATCCCTGACAACTGGTCATC	0.398																																																1	Substitution - Missense(1)	ovary(1)	10											131.0	141.0	137.0					10																	61829385		2203	4300	6503	61499391	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.11254T>A	10.37:g.61829385A>T	ENSP00000280772:p.Cys3752Ser	Unknown		x	x	x	61499391	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.457243	0.01071	.	.	ENSG00000151150	ENST00000280772	T	0.15952	2.38	5.3	-0.774	0.10991	.	0.813546	0.10352	N	0.684994	T	0.07234	0.0183	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43702	-0.9375	10	0.06365	T	0.9	.	15.9271	0.79628	0.4587:0.5413:0.0:0.0	.	3752	Q12955	ANK3_HUMAN	S	3752	ENSP00000280772:C3752S	ENSP00000280772:C3752S	C	-	1	0	ANK3	61499391	0.985000	0.35326	0.997000	0.53966	0.999000	0.98932	0.620000	0.24403	-0.009000	0.14296	0.533000	0.62120	TGT		0.398	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		Missense_Mutation
PLA2G12B	84647	broad.mit.edu	37	10	74701081	74701081	+	Silent	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:74701081G>A	ENST00000373032.3	-	3	404	c.312C>T	c.(310-312)ggC>ggT	p.G104G		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	104					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.G104G(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					TTGCTGGAATGCCCAAGTCCA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	10											145.0	138.0	140.0					10																	74701081		2203	4300	6503	74371087	SO:0001819	synonymous_variant	84647			AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.312C>T	10.37:g.74701081G>A		Unknown		x	x	x	74371087	B7ZL23|Q52LB2|Q96Q99	Silent	SNP	ENST00000373032.3	37	CCDS7319.1	SNP	46	Broad																																																																																				0.473	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048598.1	NM_032562		Silent
TSPAN14	81619	broad.mit.edu	37	10	82269140	82269140	+	Silent	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:82269140C>T	ENST00000429989.3	+	5	586	c.363C>T	c.(361-363)gaC>gaT	p.D121D	TSPAN14_ENST00000341863.6_Intron|TSPAN14_ENST00000372156.1_Silent_p.D121D|TSPAN14_ENST00000372158.1_Silent_p.D121D|TSPAN14_ENST00000372164.3_Silent_p.D104D|TSPAN14_ENST00000481124.1_Intron	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14	121					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)	p.D121D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			GGGTGAGGGACCGGTTCCGGG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	10											114.0	95.0	102.0					10																	82269140		2203	4300	6503	82259120	SO:0001819	synonymous_variant	81619			AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.363C>T	10.37:g.82269140C>T		Unknown		x	x	x	82259120	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	Silent	SNP	ENST00000429989.3	37	CCDS7369.1	SNP	18	Broad																																																																																				0.577	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049081.2	NM_030927		Silent
NOC3L	64318	broad.mit.edu	37	10	96099617	96099617	+	Missense_Mutation	SNP	C	C	T	rs149958947		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:96099617C>T	ENST00000371361.3	-	17	1941	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	NOC3L_ENST00000371350.1_Missense_Mutation_p.R614H|NOC3L_ENST00000543788.1_Missense_Mutation_p.R352H	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	614					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.R614H(2)		endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TTGCTTTCTGCGCTTAGTTAG	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		20274	0.0		0.001	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|endometrium(1)	10						C	HIS/ARG	0,4406		0,0,2203	107.0	98.0	101.0		1841	5.5	1.0	10	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	missense	NOC3L	NM_022451.9	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	614/801	96099617	1,13005	2203	4300	6503	96089607	SO:0001583	missense	64318			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1841G>A	10.37:g.96099617C>T	ENSP00000360412:p.Arg614His	Unknown		x	x	x	96089607	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	37	CCDS7433.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.257284	0.95368	0.0	1.16E-4	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.25085	1.82;1.82;1.82	5.5	5.5	0.81552	CCAAT-binding factor (1);	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64659	-0.6355	10	0.52906	T	0.07	-7.1078	19.7571	0.96298	0.0:1.0:0.0:0.0	.	614	Q8WTT2	NOC3L_HUMAN	H	352;614;614	ENSP00000437838:R352H;ENSP00000360412:R614H;ENSP00000360401:R614H	ENSP00000360401:R614H	R	-	2	0	NOC3L	96089607	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.758000	0.94735	0.561000	0.74099	CGC		0.428	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451		Missense_Mutation
PDLIM1	9124	broad.mit.edu	37	10	97023642	97023642	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:97023642C>A	ENST00000329399.6	-	4	620	c.512G>T	c.(511-513)gGg>gTg	p.G171V	PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	171					regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.G171V(1)		endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CGCCTCCACCCCGCTGGCAGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	10											75.0	73.0	74.0					10																	97023642		2203	4300	6503	97013632	SO:0001583	missense	9124			U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.512G>T	10.37:g.97023642C>A	ENSP00000360305:p.Gly171Val	Unknown		x	x	x	97013632	B2RBS6|Q5VZH5|Q9BPZ9	Missense_Mutation	SNP	ENST00000329399.6	37	CCDS7441.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994913	0.35226	.	.	ENSG00000107438	ENST00000329399	T	0.41400	1.0	5.32	2.24	0.28232	.	0.757174	0.13522	N	0.381593	T	0.16085	0.0387	N	0.02802	-0.49	0.24533	N	0.994107	B	0.16802	0.019	B	0.14578	0.011	T	0.27226	-1.0080	10	0.11485	T	0.65	-6.0596	7.352	0.26697	0.2972:0.6238:0.0:0.079	.	171	O00151	PDLI1_HUMAN	V	171	ENSP00000360305:G171V	ENSP00000360305:G171V	G	-	2	0	PDLIM1	97013632	0.003000	0.15002	0.636000	0.29352	0.333000	0.28666	1.097000	0.30988	0.888000	0.36160	0.563000	0.77884	GGG		0.567	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049508.1			Missense_Mutation
LCOR	84458	broad.mit.edu	37	10	98714825	98714825	+	Nonsense_Mutation	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr10:98714825A>T	ENST00000371097.4	+	8	994	c.448A>T	c.(448-450)Aaa>Taa	p.K150*	LCOR_ENST00000498444.1_Intron|LCOR_ENST00000371103.3_Nonsense_Mutation_p.K150*|LCOR_ENST00000540664.1_Nonsense_Mutation_p.K150*|LCOR_ENST00000356016.3_Nonsense_Mutation_p.K150*			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	150					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K150*(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		CACATCACTCAAAGTTCCACT	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	10											76.0	67.0	70.0					10																	98714825		2203	4300	6503	98704815	SO:0001587	stop_gained	84458				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.448A>T	10.37:g.98714825A>T	ENSP00000360138:p.Lys150*	Unknown		x	x	x	98704815	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Nonsense_Mutation	SNP	ENST00000371097.4	37	CCDS7451.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	39	7.419156	0.98272	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.43	5.43	0.79202	.	0.096682	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-0.2287	15.7667	0.78131	1.0:0.0:0.0:0.0	.	.	.	.	X	150	.	ENSP00000348298:K150X	K	+	1	0	LCOR	98704815	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.905000	0.92613	2.178000	0.69098	0.528000	0.53228	AAA		0.522	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2			Nonsense_Mutation
ABCC8	6833	broad.mit.edu	37	11	17418522	17418522	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr11:17418522C>A	ENST00000389817.3	-	33	4128	c.4060G>T	c.(4060-4062)Gac>Tac	p.D1354Y	ABCC8_ENST00000302539.4_Missense_Mutation_p.D1355Y			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1354	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.D1354N(1)|p.D1354Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	AGGGAGCTGTCGTAGCGCACG	0.632																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	11											130.0	104.0	113.0					11																	17418522		2200	4293	6493	17375098	SO:0001583	missense	6833			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4060G>T	11.37:g.17418522C>A	ENSP00000374467:p.Asp1354Tyr	Unknown		x	x	x	17375098	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	SNP	31	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.3|28.3	4.903985|4.903985	0.92035|0.92035	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000389817;ENST00000302539|ENST00000528374	D;D|.	0.91011|.	-2.77;-2.77|.	4.83|4.83	4.83|4.83	0.62350|0.62350	ABC transporter-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65974|0.65974	0.2743|0.2743	L|L	0.41236|0.41236	1.265|1.265	0.80722|0.80722	D|D	1|1	D|.	0.56746|.	0.977|.	P|.	0.50537|.	0.643|.	T|T	0.62704|0.62704	-0.6798|-0.6798	10|5	0.66056|.	D|.	0.02|.	.|.	18.2867|18.2867	0.90117|0.90117	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1354|.	Q09428|.	ABCC8_HUMAN|.	Y|L	1354;1355|181	ENSP00000374467:D1354Y;ENSP00000303960:D1355Y|.	ENSP00000303960:D1355Y|.	D|R	-|-	1|2	0|0	ABCC8|ABCC8	17375098|17375098	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.924000|0.924000	0.55760|0.55760	5.983000|5.983000	0.70540|0.70540	2.386000|2.386000	0.81285|0.81285	0.555000|0.555000	0.69702|0.69702	GAC|CGA		0.632	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352		Missense_Mutation
DLG2	1740	broad.mit.edu	37	11	83770481	83770481	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr11:83770481C>A	ENST00000532653.1	-	6	783	c.481G>T	c.(481-483)Gtt>Ttt	p.V161F	DLG2_ENST00000398309.2_Missense_Mutation_p.V161F|DLG2_ENST00000524982.1_Missense_Mutation_p.V161F|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000330014.6_Missense_Mutation_p.V100F|DLG2_ENST00000537455.1_5'UTR|DLG2_ENST00000418306.2_Missense_Mutation_p.V110F|DLG2_ENST00000531015.1_Missense_Mutation_p.V128F|DLG2_ENST00000398301.2_Missense_Mutation_p.V200F|DLG2_ENST00000376104.2_Missense_Mutation_p.V266F|DLG2_ENST00000543673.1_Missense_Mutation_p.V266F|DLG2_ENST00000280241.8_Missense_Mutation_p.V200F			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.V161F(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CTGTGGGAAACCTCTGACACA	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	81.0	84.0					11																	83770481		1916	4151	6067	83448129	SO:0001583	missense	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.481G>T	11.37:g.83770481C>A	ENSP00000435849:p.Val161Phe	Unknown		x	x	x	83448129	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37		SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.200660	0.94997	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301;ENST00000398299	T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61	5.17	5.17	0.71159	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000019	T	0.57681	0.2070	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.997;1.0;0.999;0.999;0.998;1.0	T	0.58233	-0.7672	9	.	.	.	.	18.6643	0.91483	0.0:1.0:0.0:0.0	.	128;161;161;100;200;266;161;110	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	F	161;266;110;266;200;100;161;161;266;128;200;78	ENSP00000381355:V161F;ENSP00000365272:V266F;ENSP00000402275:V110F;ENSP00000441994:V266F;ENSP00000280241:V200F;ENSP00000381353:V100F;ENSP00000432894:V161F;ENSP00000435849:V161F;ENSP00000433848:V128F;ENSP00000381346:V200F;ENSP00000381344:V78F	.	V	-	1	0	DLG2	83448129	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.420000	0.82092	0.460000	0.39030	GTT		0.468	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364		Missense_Mutation
C11orf65	160140	broad.mit.edu	37	11	108277875	108277875	+	Splice_Site	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr11:108277875G>C	ENST00000529391.1	-	3	185	c.176C>G	c.(175-177)gCa>gGa	p.A59G	C11orf65_ENST00000526725.1_5'Flank|C11orf65_ENST00000393084.1_Splice_Site_p.A59G|C11orf65_ENST00000525729.1_Intron			Q8NCR3	CK065_HUMAN	chromosome 11 open reading frame 65	59								p.A59G(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(2)	10		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		TAGAAGCTCTGCCTATAAGAA	0.289																																																1	Substitution - Missense(1)	ovary(1)	11											27.0	27.0	27.0					11																	108277875		2201	4296	6497	107783085	SO:0001630	splice_region_variant	160140			BC059411	CCDS8340.1	11q22.3	2012-05-30			ENSG00000166323	ENSG00000166323			28519	protein-coding gene	gene with protein product						12477932	Standard	NM_152587		Approved	MGC33948	uc001pkh.3	Q8NCR3	OTTHUMG00000166489	ENST00000529391.1:c.175-1C>G	11.37:g.108277875G>C		Unknown		x	x	x	107783085	B4DZU4|Q6PCA8	Missense_Mutation	SNP	ENST00000529391.1	37	CCDS8340.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154486	0.78114	.	.	ENSG00000166323	ENST00000529391;ENST00000393084	T;T	0.52754	0.65;0.65	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	M	0.78049	2.395	0.48901	D	0.999726	D	0.76494	0.999	D	0.83275	0.996	T	0.74262	-0.3722	10	0.66056	D	0.02	-19.2414	17.5251	0.87798	0.0:0.0:1.0:0.0	.	59	Q8NCR3	CK065_HUMAN	G	59	ENSP00000436400:A59G;ENSP00000376799:A59G	ENSP00000376799:A59G	A	-	2	0	C11orf65	107783085	1.000000	0.71417	0.998000	0.56505	0.874000	0.50279	7.191000	0.77763	2.476000	0.83614	0.650000	0.86243	GCA		0.289	C11orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390010.3	NM_152587	Missense_Mutation	Missense_Mutation
NXPE4	54827	broad.mit.edu	37	11	114451019	114451019	+	Missense_Mutation	SNP	T	T	A	rs527913953		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr11:114451019T>A	ENST00000375478.3	-	5	1114	c.934A>T	c.(934-936)Aca>Tca	p.T312S	NXPE4_ENST00000424261.2_Missense_Mutation_p.T28S	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	312						extracellular vesicular exosome (GO:0070062)		p.T312S(1)									ATTGTGGATGTCATTCCAAAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											162.0	148.0	153.0					11																	114451019		1881	4117	5998	113956229	SO:0001583	missense	54827			AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.934A>T	11.37:g.114451019T>A	ENSP00000364627:p.Thr312Ser	Unknown		x	x	x	113956229	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	CCDS41718.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	11.54	1.667780	0.29604	.	.	ENSG00000137634	ENST00000424261;ENST00000375478	T;T	0.13307	2.6;2.83	5.31	-0.465	0.12157	.	1.492970	0.03874	N	0.276132	T	0.11067	0.0270	L	0.38531	1.155	0.09310	N	0.999999	B	0.09022	0.002	B	0.09377	0.004	T	0.37033	-0.9723	10	0.10636	T	0.68	.	8.4556	0.32897	0.0:0.4415:0.0:0.5585	.	312	Q6UWF7	FA55D_HUMAN	S	28;312	ENSP00000401503:T28S;ENSP00000364627:T312S	ENSP00000364627:T312S	T	-	1	0	FAM55D	113956229	0.002000	0.14202	0.007000	0.13788	0.961000	0.63080	-0.574000	0.05868	-0.259000	0.09432	0.533000	0.62120	ACA		0.413	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678		Missense_Mutation
DSCAML1	57453	broad.mit.edu	37	11	117329487	117329487	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr11:117329487A>G	ENST00000321322.6	-	19	3732	c.3731T>C	c.(3730-3732)aTc>aCc	p.I1244T	DSCAML1_ENST00000527706.1_Missense_Mutation_p.I974T	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1184	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.I1244T(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTTGGTCTGGATGTAGAGCAC	0.657																																																1	Substitution - Missense(1)	ovary(1)	11											90.0	73.0	79.0					11																	117329487		2201	4296	6497	116834697	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3731T>C	11.37:g.117329487A>G	ENSP00000315465:p.Ile1244Thr	Unknown		x	x	x	116834697	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348766	0.24426	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.54479	0.57;0.57	4.21	4.21	0.49690	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.36744	0.0978	N	0.26042	0.785	0.58432	D	0.999995	B	0.06786	0.001	B	0.10450	0.005	T	0.15065	-1.0450	9	0.08599	T	0.76	.	13.765	0.62990	1.0:0.0:0.0:0.0	.	1184	Q8TD84	DSCL1_HUMAN	T	974;1244;951	ENSP00000434335:I974T;ENSP00000315465:I1244T	ENSP00000315465:I1244T	I	-	2	0	DSCAML1	116834697	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.115000	0.71566	1.919000	0.55581	0.454000	0.30748	ATC		0.657	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		Missense_Mutation
LRMP	4033	broad.mit.edu	37	12	25256980	25256980	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:25256980G>A	ENST00000354454.3	+	18	1863	c.1034G>A	c.(1033-1035)aGg>aAg	p.R345K	LRMP_ENST00000547044.1_Missense_Mutation_p.R345K|LRMP_ENST00000548766.1_Missense_Mutation_p.R345K	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	401					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R345K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					TTCAGTAGAAGGTCAAGCAGT	0.318																																																1	Substitution - Missense(1)	ovary(1)	12											139.0	150.0	146.0					12																	25256980		2203	4300	6503	25148247	SO:0001583	missense	4033				CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.1034G>A	12.37:g.25256980G>A	ENSP00000346442:p.Arg345Lys	Unknown		x	x	x	25148247	A0AVM2|B4E077|Q8N301	Missense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029006	0.93518	.	.	ENSG00000118308	ENST00000354454;ENST00000536173;ENST00000548766;ENST00000547044	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.82	5.82	0.92795	.	0.242930	0.41001	D	0.000966	T	0.24586	0.0596	M	0.75264	2.295	0.46437	D	0.999049	B	0.34329	0.449	B	0.38921	0.285	T	0.01087	-1.1456	10	0.62326	D	0.03	-14.2647	16.8121	0.85724	0.0:0.0:1.0:0.0	.	401	Q12912	LRMP_HUMAN	K	345;292;345;345	ENSP00000346442:R345K;ENSP00000444056:R292K;ENSP00000446496:R345K;ENSP00000450246:R345K	ENSP00000346442:R345K	R	+	2	0	LRMP	25148247	1.000000	0.71417	0.962000	0.40283	0.993000	0.82548	6.326000	0.72905	2.744000	0.94065	0.650000	0.86243	AGG		0.318	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152		Missense_Mutation
RPAP3	79657	broad.mit.edu	37	12	48091436	48091436	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:48091436A>C	ENST00000005386.3	-	4	476	c.361T>G	c.(361-363)Tcg>Gcg	p.S121A	RPAP3_ENST00000432584.3_5'UTR|RPAP3_ENST00000380650.4_Missense_Mutation_p.S121A	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	121								p.S121A(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					TCTTCTTCCGACTCTGATTCT	0.373																																																1	Substitution - Missense(1)	ovary(1)	12											110.0	110.0	110.0					12																	48091436		2203	4300	6503	46377703	SO:0001583	missense	79657			AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.361T>G	12.37:g.48091436A>C	ENSP00000005386:p.Ser121Ala	Unknown		x	x	x	46377703	B4DRW9|Q6PHR5	Missense_Mutation	SNP	ENST00000005386.3	37	CCDS8753.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.160251	0.78226	.	.	ENSG00000005175	ENST00000005386;ENST00000380650	T;T	0.10192	2.9;2.92	5.49	5.49	0.81192	.	0.227351	0.30227	N	0.010114	T	0.22322	0.0538	L	0.56769	1.78	0.46279	D	0.998968	D;D	0.54964	0.969;0.969	P;P	0.55087	0.768;0.472	T	0.01280	-1.1397	10	0.25106	T	0.35	.	15.0654	0.71989	1.0:0.0:0.0:0.0	.	121;121	Q9H6T3-2;Q9H6T3	.;RPAP3_HUMAN	A	121	ENSP00000005386:S121A;ENSP00000370024:S121A	ENSP00000005386:S121A	S	-	1	0	RPAP3	46377703	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	6.755000	0.74914	2.209000	0.71365	0.459000	0.35465	TCG		0.373	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405340.1	NM_024604		Missense_Mutation
TFCP2	7024	broad.mit.edu	37	12	51512474	51512474	+	Missense_Mutation	SNP	T	T	A	rs146119086		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:51512474T>A	ENST00000257915.5	-	2	662	c.204A>T	c.(202-204)caA>caT	p.Q68H	TFCP2_ENST00000549867.1_Missense_Mutation_p.Q68H|TFCP2_ENST00000548115.1_Missense_Mutation_p.Q68H|TFCP2_ENST00000307660.4_Missense_Mutation_p.Q68H	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	68					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q68H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						AAAGCACATATTGAAAAGGCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											185.0	175.0	179.0					12																	51512474		2203	4300	6503	49798741	SO:0001583	missense	7024			U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.204A>T	12.37:g.51512474T>A	ENSP00000257915:p.Gln68His	Unknown		x	x	x	49798741	A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	ENST00000257915.5	37	CCDS8808.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	22.6	4.315801	0.81469	.	.	ENSG00000135457	ENST00000257915;ENST00000307660;ENST00000549867;ENST00000548115	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.66	-7.64	0.01286	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.34919	0.0914	M	0.78916	2.43	0.53005	D	0.999962	D;P;B;P	0.64830	0.994;0.503;0.258;0.749	D;B;B;P	0.78314	0.991;0.29;0.316;0.632	T	0.54938	-0.8218	10	0.72032	D	0.01	-14.1802	15.1832	0.72975	0.0931:0.7124:0.0:0.1945	.	68;68;68;68	Q12800-2;F8VX55;Q12800;Q12800-4	.;.;TFCP2_HUMAN;.	H	68	ENSP00000257915:Q68H;ENSP00000304411:Q68H;ENSP00000449742:Q68H;ENSP00000447991:Q68H	ENSP00000257915:Q68H	Q	-	3	2	TFCP2	49798741	0.929000	0.31497	0.865000	0.33974	0.974000	0.67602	0.102000	0.15272	-1.173000	0.02758	-0.326000	0.08463	CAA		0.383	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653		Missense_Mutation
OR10A7	121364	broad.mit.edu	37	12	55615509	55615509	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:55615509G>T	ENST00000326258.1	+	1	701	c.701G>T	c.(700-702)cGc>cTc	p.R234L		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R234L(1)		endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						GCCACTGGCCGCCAGAAGGCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											112.0	94.0	100.0					12																	55615509		2203	4300	6503	53901776	SO:0001583	missense	121364			BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.701G>T	12.37:g.55615509G>T	ENSP00000326718:p.Arg234Leu	Unknown		x	x	x	53901776	Q6IFD5|Q96R19	Missense_Mutation	SNP	ENST00000326258.1	37	CCDS31815.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	9.168	1.020441	0.19433	.	.	ENSG00000179919	ENST00000326258	T	0.00330	8.08	4.08	1.21	0.21127	GPCR, rhodopsin-like superfamily (1);	0.346305	0.20666	N	0.087929	T	0.00724	0.0024	M	0.84846	2.72	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.37430	-0.9706	10	0.87932	D	0	.	8.4721	0.32991	0.3398:0.0:0.6602:0.0	.	234	Q8NGE5	O10A7_HUMAN	L	234	ENSP00000326718:R234L	ENSP00000326718:R234L	R	+	2	0	OR10A7	53901776	0.001000	0.12720	0.034000	0.17996	0.042000	0.13812	0.855000	0.27805	0.148000	0.19059	-0.154000	0.13518	CGC		0.493	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1			Missense_Mutation
RASAL1	8437	broad.mit.edu	37	12	113565957	113565957	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:113565957C>A	ENST00000261729.5	-	4	464	c.149G>T	c.(148-150)gGc>gTc	p.G50V	RASAL1_ENST00000546530.1_Missense_Mutation_p.G50V|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_Missense_Mutation_p.G50V|RASAL1_ENST00000548055.1_Missense_Mutation_p.G50V			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	50	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.G50V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CCAGAAGGGGCCCAGGCTCCT	0.627																																																1	Substitution - Missense(1)	ovary(1)	12											150.0	153.0	152.0					12																	113565957		2203	4300	6503	112050340	SO:0001583	missense	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.149G>T	12.37:g.113565957C>A	ENSP00000261729:p.Gly50Val	Unknown		x	x	x	112050340	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.20	2.463352	0.43736	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	5.12	2.86	0.33363	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.198474	0.50627	D	0.000101	T	0.47838	0.1467	N	0.14661	0.345	0.39220	D	0.963483	B;B;B;B;B;B;B	0.29590	0.25;0.25;0.21;0.25;0.03;0.076;0.21	B;B;B;B;B;B;B	0.36719	0.231;0.231;0.148;0.231;0.085;0.139;0.148	T	0.40001	-0.9586	10	0.42905	T	0.14	.	5.394	0.16259	0.0:0.5221:0.0:0.4779	.	50;50;50;62;50;50;50	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	V	50	ENSP00000450244:G50V;ENSP00000261729:G50V;ENSP00000395920:G50V;ENSP00000448510:G50V	ENSP00000261729:G50V	G	-	2	0	RASAL1	112050340	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.876000	0.48498	0.559000	0.29153	0.491000	0.48974	GGC		0.627	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		Missense_Mutation
IQCD	115811	broad.mit.edu	37	12	113645574	113645574	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:113645574G>C	ENST00000416617.2	-	2	588	c.398C>G	c.(397-399)tCc>tGc	p.S133C	IQCD_ENST00000299732.2_Missense_Mutation_p.S133C|IQCD_ENST00000546692.1_Missense_Mutation_p.S133C			Q96DY2	IQCD_HUMAN	IQ motif containing D	133								p.S133C(1)		endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CAGCTCTATGGAAAGGAGGCG	0.527																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	102.0	104.0					12																	113645574		2203	4300	6503	112129957	SO:0001583	missense	115811			BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.398C>G	12.37:g.113645574G>C	ENSP00000400669:p.Ser133Cys	Unknown		x	x	x	112129957	Q6ZSU0	Missense_Mutation	SNP	ENST00000416617.2	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	14.39	2.519938	0.44866	.	.	ENSG00000166578	ENST00000299732;ENST00000416617;ENST00000546692;ENST00000392574	T;T;T	0.11385	2.78;2.78;2.78	4.7	-0.371	0.12525	.	1.169890	0.06241	N	0.690511	T	0.21347	0.0514	L	0.56769	1.78	0.09310	N	1	D;D	0.71674	0.998;0.99	D;P	0.64776	0.929;0.723	T	0.20107	-1.0285	10	0.66056	D	0.02	-5.3077	1.0721	0.01623	0.2354:0.1281:0.3806:0.256	.	133;133	F8VZV9;Q96DY2-2	.;.	C	133	ENSP00000299732:S133C;ENSP00000400669:S133C;ENSP00000446623:S133C	ENSP00000299732:S133C	S	-	2	0	IQCD	112129957	0.000000	0.05858	0.001000	0.08648	0.104000	0.19210	0.295000	0.19065	0.185000	0.20105	0.462000	0.41574	TCC		0.527	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405327.1	NM_138451		Missense_Mutation
FBXW8	26259	broad.mit.edu	37	12	117461994	117461994	+	Silent	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:117461994G>T	ENST00000309909.5	+	9	1492	c.1410G>T	c.(1408-1410)tcG>tcT	p.S470S	FBXW8_ENST00000455858.2_Silent_p.S404S			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	470					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)		p.S470S(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		TCGCCCTGTCGCTCTCCGCCC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	12											147.0	117.0	127.0					12																	117461994		2203	4300	6503	115946377	SO:0001819	synonymous_variant	26259			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1410G>T	12.37:g.117461994G>T		Unknown		x	x	x	115946377	Q9UK95	Silent	SNP	ENST00000309909.5	37	CCDS9182.1	SNP	38	Broad																																																																																				0.572	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174		Silent
TEP1	7011	broad.mit.edu	37	14	20846616	20846616	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr14:20846616C>G	ENST00000262715.5	-	38	5471	c.5431G>C	c.(5431-5433)Gag>Cag	p.E1811Q	TEP1_ENST00000545983.1_Missense_Mutation_p.E149Q|TEP1_ENST00000556935.1_Missense_Mutation_p.E1703Q	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1811					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.E1811Q(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		ACCTGCCCCTCTGGGTGGAAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	14											77.0	74.0	75.0					14																	20846616		2203	4300	6503	19916456	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.5431G>C	14.37:g.20846616C>G	ENSP00000262715:p.Glu1811Gln	Unknown		x	x	x	19916456	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919540	0.73098	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000545983	T;T;T	0.51574	0.7;1.6;1.6	5.59	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.361046	0.31495	N	0.007546	T	0.51924	0.1703	L	0.43701	1.375	0.36681	D	0.879036	P;D;D;D	0.62365	0.896;0.971;0.977;0.991	P;P;P;P	0.59825	0.673;0.714;0.691;0.864	T	0.58864	-0.7561	10	0.54805	T	0.06	-12.1726	7.6379	0.28277	0.0:0.8352:0.0:0.1648	.	149;1703;1154;1811	B4E0B6;G3V5X7;G3V2A4;Q99973	.;.;.;TEP1_HUMAN	Q	1811;1811;1703;149	ENSP00000262715:E1811Q;ENSP00000452574:E1703Q;ENSP00000438849:E149Q	ENSP00000262715:E1811Q	E	-	1	0	TEP1	19916456	0.737000	0.28175	0.870000	0.34147	0.901000	0.52897	1.402000	0.34600	2.638000	0.89438	0.557000	0.71058	GAG		0.582	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		Missense_Mutation
ACIN1	22985	broad.mit.edu	37	14	23547402	23547402	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr14:23547402T>G	ENST00000262710.1	-	8	2582	c.2255A>C	c.(2254-2256)cAg>cCg	p.Q752P	ACIN1_ENST00000605057.1_Missense_Mutation_p.Q694P|ACIN1_ENST00000555352.1_5'UTR|ACIN1_ENST00000457657.1_Missense_Mutation_p.Q712P|ACIN1_ENST00000555053.1_Missense_Mutation_p.Q752P	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	752					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q752P(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		ATGAGAGGTCTGAGTCTCTGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	14											235.0	224.0	228.0					14																	23547402		2203	4300	6503	22617242	SO:0001583	missense	22985			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2255A>C	14.37:g.23547402T>G	ENSP00000262710:p.Gln752Pro	Unknown		x	x	x	22617242	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	14.50	2.555014	0.45487	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.06068	3.42;3.42;3.35	5.99	2.12	0.27331	.	0.207707	0.24379	N	0.039027	T	0.05502	0.0145	L	0.43152	1.355	0.49582	D	0.999809	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.09377	0.004;0.002;0.003	T	0.35674	-0.9779	10	0.25751	T	0.34	-2.314	6.7215	0.23332	0.1396:0.0:0.367:0.4934	.	752;752;712	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	P	752;712;752	ENSP00000262710:Q752P;ENSP00000405677:Q712P;ENSP00000451328:Q752P	ENSP00000262710:Q752P	Q	-	2	0	ACIN1	22617242	1.000000	0.71417	0.983000	0.44433	0.987000	0.75469	0.208000	0.17415	0.480000	0.27534	0.533000	0.62120	CAG		0.488	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977		Missense_Mutation
GZMH	2999	broad.mit.edu	37	14	25076888	25076888	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr14:25076888G>T	ENST00000216338.4	-	3	313	c.269C>A	c.(268-270)cCt>cAt	p.P90H	GZMH_ENST00000382548.4_Missense_Mutation_p.P90H|RP11-104E19.1_ENST00000557736.1_RNA|GZMH_ENST00000557220.2_Intron|RP11-104E19.1_ENST00000555300.1_RNA	NM_033423.4	NP_219491.1	P20718	GRAH_HUMAN	granzyme H (cathepsin G-like 2, protein h-CCPX)	90	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)	membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)	p.P90H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)	12				GBM - Glioblastoma multiforme(265;0.0267)		TCTTTTCACAGGGATAAACTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	14											209.0	199.0	202.0					14																	25076888		2203	4300	6503	24146728	SO:0001583	missense	2999			M72150	CCDS9632.1, CCDS59243.1	14q11.2	2003-10-20			ENSG00000100450	ENSG00000100450			4710	protein-coding gene	gene with protein product		116831		CTSGL2		2049336	Standard	NM_033423		Approved	CGL-2, CCP-X, CTLA1, CSP-C	uc001wpr.2	P20718	OTTHUMG00000140185	ENST00000216338.4:c.269C>A	14.37:g.25076888G>T	ENSP00000216338:p.Pro90His	Unknown		x	x	x	24146728	G3V2C5|Q6XGZ0|Q6XGZ1	Missense_Mutation	SNP	ENST00000216338.4	37	CCDS9632.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	g	10.22	1.290628	0.23564	.	.	ENSG00000100450	ENST00000216338;ENST00000382548	D;D	0.88509	-2.39;-2.39	4.7	-2.86	0.05717	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.84999	0.5597	N	0.25094	0.71	0.09310	N	1	B;B	0.30021	0.089;0.265	P;B	0.44897	0.463;0.209	T	0.78555	-0.2159	9	0.66056	D	0.02	.	9.731	0.40361	0.0:0.4795:0.2496:0.2709	.	90;90	Q6XGZ1;P20718	.;GRAH_HUMAN	H	90	ENSP00000216338:P90H;ENSP00000371988:P90H	ENSP00000216338:P90H	P	-	2	0	GZMH	24146728	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.058000	0.03482	-0.664000	0.05324	-0.397000	0.06425	CCT		0.527	GZMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276538.2	NM_033423		Missense_Mutation
EXOC5	10640	broad.mit.edu	37	14	57710915	57710915	+	Silent	SNP	A	A	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr14:57710915A>G	ENST00000413566.2	-	4	792	c.433T>C	c.(433-435)Ttg>Ctg	p.L145L	EXOC5_ENST00000556911.1_5'UTR|EXOC5_ENST00000340918.7_Intron	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	145					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.L145L(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TCAGATTTCAATTCTCCATCT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	14											92.0	84.0	86.0					14																	57710915		1841	4079	5920	56780668	SO:0001819	synonymous_variant	10640			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.433T>C	14.37:g.57710915A>G		Unknown		x	x	x	56780668	B2R6C5	Silent	SNP	ENST00000413566.2	37	CCDS45111.1	SNP	4	Broad																																																																																				0.393	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544		Silent
DIS3L	115752	broad.mit.edu	37	15	66625341	66625341	+	Splice_Site	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr15:66625341G>C	ENST00000319212.4	+	17	2906		c.e17-1		DIS3L_ENST00000319194.5_Splice_Site|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease						RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.?(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTCTATGCTAGGTAAGAATAT	0.284																																																1	Unknown(1)	ovary(1)	15											38.0	40.0	39.0					15																	66625341		2199	4297	6496	64412395	SO:0001630	splice_region_variant	115752				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2857-1G>C	15.37:g.66625341G>C		Unknown		x	x	x	64412395	Q8N1N8|Q8WTU9|Q96CM7	Splice_Site_SNP	SNP	ENST00000319212.4	37	CCDS45286.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584742	0.65992	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	.	.	.	5.64	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8272	0.63357	0.0734:0.0:0.9266:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DIS3L	64412395	1.000000	0.71417	0.751000	0.31187	0.892000	0.51952	7.761000	0.85260	1.381000	0.46364	0.655000	0.94253	.		0.284	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	Intron	Splice_Site_SNP
ADAMTS17	170691	broad.mit.edu	37	15	100802570	100802570	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr15:100802570A>C	ENST00000268070.4	-	5	965	c.860T>G	c.(859-861)cTa>cGa	p.L287R	ADAMTS17_ENST00000559976.1_5'Flank	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	287	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L287R(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		ACGTTGTCGTAGCAGGACAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											156.0	149.0	152.0					15																	100802570		2203	4300	6503	98620093	SO:0001583	missense	170691			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.860T>G	15.37:g.100802570A>C	ENSP00000268070:p.Leu287Arg	Unknown		x	x	x	98620093	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	19.63	3.864345	0.71949	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	D	0.87491	-2.26	5.6	5.6	0.85130	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (1);	0.179793	0.36066	N	0.002806	D	0.93993	0.8076	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	D	0.94864	0.8024	10	0.87932	D	0	.	15.7961	0.78412	1.0:0.0:0.0:0.0	.	44;287	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	R	287;44	ENSP00000268070:L287R	ENSP00000268070:L287R	L	-	2	0	ADAMTS17	98620093	1.000000	0.71417	0.910000	0.35882	0.552000	0.35366	7.460000	0.80816	2.131000	0.65755	0.533000	0.62120	CTA		0.453	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057		Missense_Mutation
FAHD1	81889	broad.mit.edu	37	16	1877673	1877673	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr16:1877673T>G	ENST00000427358.2	+	1	449	c.443T>G	c.(442-444)cTc>cGc	p.L148R	FAHD1_ENST00000382668.4_Missense_Mutation_p.L148R|HAGH_ENST00000455446.2_5'Flank|FAHD1_ENST00000382666.4_Missense_Mutation_p.L148R|HAGH_ENST00000397356.3_5'Flank|HAGH_ENST00000566709.1_5'Flank|HAGH_ENST00000397353.2_5'Flank	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	148						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)	p.L148R(1)		NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						AAGCTGAAGCTCTGGCTCAAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											59.0	47.0	51.0					16																	1877673		2199	4300	6499	1817674	SO:0001583	missense	81889			BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	ENST00000427358.2:c.443T>G	16.37:g.1877673T>G	ENSP00000398053:p.Leu148Arg	Unknown		x	x	x	1817674	B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Missense_Mutation	SNP	ENST00000427358.2	37	CCDS10448.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	29.2	4.982719	0.93044	.	.	ENSG00000180185	ENST00000382668;ENST00000382666;ENST00000427358	T;T;T	0.53640	0.61;0.61;0.61	4.65	4.65	0.58169	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.265230	0.31847	N	0.006979	T	0.79476	0.4452	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.86872	0.2036	10	0.87932	D	0	-24.4195	13.4354	0.61082	0.0:0.0:0.0:1.0	.	148;148;148	Q6P587-2;B1AK40;Q6P587	.;.;FAHD1_HUMAN	R	148	ENSP00000372114:L148R;ENSP00000372112:L148R;ENSP00000398053:L148R	ENSP00000372112:L148R	L	+	2	0	FAHD1	1817674	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	5.987000	0.70571	1.961000	0.56991	0.533000	0.62120	CTC		0.552	FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250550.2	NM_001018104		Missense_Mutation
SH2B1	25970	broad.mit.edu	37	16	28880331	28880331	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr16:28880331A>C	ENST00000322610.8	+	6	1485	c.1046A>C	c.(1045-1047)gAa>gCa	p.E349A	SH2B1_ENST00000359285.5_Missense_Mutation_p.E349A|SH2B1_ENST00000395532.4_Missense_Mutation_p.E349A|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000545570.1_Missense_Mutation_p.E39A|SH2B1_ENST00000337120.5_Missense_Mutation_p.E349A|SH2B1_ENST00000538342.1_Missense_Mutation_p.E13A			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	349	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|PH.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.E349A(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CTGTAGGTGGAAGGTCCATCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											125.0	114.0	118.0					16																	28880331		2197	4300	6497	28787832	SO:0001583	missense	25970			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1046A>C	16.37:g.28880331A>C	ENSP00000321221:p.Glu349Ala	Unknown		x	x	x	28787832	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	CCDS53996.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	14.63	2.591774	0.46214	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000538342;ENST00000395532;ENST00000337120	T;T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95;-0.95	4.83	4.83	0.62350	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.342731	0.26272	N	0.025321	T	0.76835	0.4043	L	0.31578	0.945	0.44579	D	0.997547	D;D;P;P;B	0.76494	0.97;0.999;0.95;0.95;0.309	P;D;D;D;P	0.83275	0.681;0.996;0.927;0.927;0.565	T	0.76063	-0.3096	10	0.41790	T	0.15	-15.0559	10.1466	0.42767	0.8323:0.1677:0.0:0.0	.	13;39;349;349;349	B4DLN5;F5GXU7;Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;.;.;SH2B1_HUMAN	A	349;39;349;13;349;349	ENSP00000321221:E349A;ENSP00000440354:E39A;ENSP00000352232:E349A;ENSP00000438784:E13A;ENSP00000378903:E349A;ENSP00000337163:E349A	ENSP00000321221:E349A	E	+	2	0	SH2B1	28787832	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	3.534000	0.53568	2.025000	0.59659	0.383000	0.25322	GAA		0.542	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		Missense_Mutation
NFATC2IP	84901	broad.mit.edu	37	16	28967617	28967617	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr16:28967617A>G	ENST00000320805.4	+	5	880	c.805A>G	c.(805-807)Atc>Gtc	p.I269V	MIR4517_ENST00000578855.1_RNA|NFATC2IP_ENST00000562977.1_Intron|RP11-264B17.2_ENST00000568057.1_RNA|NFATC2IP_ENST00000564978.1_Intron|NFATC2IP_ENST00000568148.1_5'Flank|RP11-264B17.2_ENST00000569974.1_RNA	NM_032815.3	NP_116204.3	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein	269					cytokine production (GO:0001816)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I269V(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(2)	11						CCCACTCAAAATCCGTTGCCG	0.607																																																1	Substitution - Missense(1)	ovary(1)	16											45.0	43.0	44.0					16																	28967617		2197	4300	6497	28875118	SO:0001583	missense	84901			AK074761	CCDS10645.1	16p11.2	2010-09-13			ENSG00000176953	ENSG00000176953			25906	protein-coding gene	gene with protein product		614525				15698469	Standard	NM_032815		Approved	FLJ14639, NIP45, RAD60, ESC2	uc002dru.3	Q8NCF5	OTTHUMG00000097763	ENST00000320805.4:c.805A>G	16.37:g.28967617A>G	ENSP00000324792:p.Ile269Val	Unknown		x	x	x	28875118	B7Z4G5|Q66K34|Q6NVK1|Q8NFR2|Q96ST9	Missense_Mutation	SNP	ENST00000320805.4	37	CCDS10645.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	7.664	0.685535	0.14973	.	.	ENSG00000176953	ENST00000320805	T	0.12569	2.67	5.49	3.19	0.36642	Ubiquitin (1);	0.456661	0.20131	N	0.098600	T	0.05502	0.0145	N	0.14661	0.345	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.25082	-1.0142	10	0.02654	T	1	-12.5623	4.803	0.13307	0.7184:0.0:0.2816:0.0	.	269	Q8NCF5	NF2IP_HUMAN	V	269	ENSP00000324792:I269V	ENSP00000324792:I269V	I	+	1	0	NFATC2IP	28875118	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	0.836000	0.27545	0.925000	0.37094	0.533000	0.62120	ATC		0.607	NFATC2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214999.2	NM_032815		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Unknown		x	x	x	7517846	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CDK12	51755	broad.mit.edu	37	17	37665993	37665993	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr17:37665993G>T	ENST00000447079.4	+	7	2678	c.2645G>T	c.(2644-2646)cGg>cTg	p.R882L	CDK12_ENST00000430627.2_Missense_Mutation_p.R882L	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	882	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.R882L(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GGACTTGCTCGGCTCTATAAC	0.348			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	1	Substitution - Missense(1)	ovary(1)	17											126.0	127.0	126.0					17																	37665993		2203	4300	6503	34919519	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2645G>T	17.37:g.37665993G>T	ENSP00000398880:p.Arg882Leu	Unknown		x	x	x	34919519	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498622	0.85069	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.66995	-0.24;-0.24	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40640	N	0.001044	D	0.85435	0.5696	M	0.89353	3.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.87786	0.2615	10	0.87932	D	0	-9.067	19.4455	0.94844	0.0:0.0:1.0:0.0	.	881;882;882	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	L	882	ENSP00000407720:R882L;ENSP00000398880:R882L	ENSP00000407720:R882L	R	+	2	0	CDK12	34919519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.666000	0.90696	0.650000	0.86243	CGG		0.348	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		Missense_Mutation
EZH1	2145	broad.mit.edu	37	17	40870052	40870052	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr17:40870052T>C	ENST00000428826.2	-	10	1086	c.965A>G	c.(964-966)aAg>aGg	p.K322R	EZH1_ENST00000590078.1_Missense_Mutation_p.K252R|EZH1_ENST00000592743.1_Missense_Mutation_p.K322R|EZH1_ENST00000415827.2_Missense_Mutation_p.K313R|EZH1_ENST00000435174.1_Missense_Mutation_p.K183R|EZH1_ENST00000585893.1_Missense_Mutation_p.K282R			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	322					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)	p.K322R(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		TTCTTTATTCTTGCGTTTATA	0.398																																																1	Substitution - Missense(1)	ovary(1)	17											130.0	120.0	123.0					17																	40870052		2203	4300	6503	38123578	SO:0001583	missense	2145				CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.965A>G	17.37:g.40870052T>C	ENSP00000404658:p.Lys322Arg	Unknown		x	x	x	38123578	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	37	CCDS32659.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	16.99	3.274346	0.59649	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	T;T	0.79653	-1.29;-1.29	4.64	2.42	0.29668	.	0.137072	0.64402	N	0.000003	T	0.75997	0.3926	L	0.35854	1.095	0.45464	D	0.998433	B;B;B;B	0.28512	0.214;0.054;0.054;0.032	B;B;B;B	0.43508	0.422;0.096;0.096;0.044	T	0.66626	-0.5876	10	0.33141	T	0.24	.	7.3386	0.26623	0.0:0.2506:0.0:0.7494	.	183;282;328;322	Q92800-5;Q92800-3;Q92800-2;Q92800	.;.;.;EZH1_HUMAN	R	325;322;282;183	ENSP00000404658:K322R;ENSP00000404071:K183R	ENSP00000264646:K325R	K	-	2	0	EZH1	38123578	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.035000	0.57297	0.398000	0.25338	0.533000	0.62120	AAG		0.398	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991		Missense_Mutation
HEXIM1	10614	broad.mit.edu	37	17	43226606	43226606	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr17:43226606A>T	ENST00000332499.2	+	1	1923	c.49A>T	c.(49-51)Aac>Tac	p.N17Y	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	17					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)	p.N17Y(1)		breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TCAAACTAGCAACTGTACAGG	0.547											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17											88.0	100.0	96.0					17																	43226606		2203	4299	6502	40582389	SO:0001583	missense	10614			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.49A>T	17.37:g.43226606A>T	ENSP00000328773:p.Asn17Tyr	Unknown	914	x	x	x	40582389	B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	37	CCDS11495.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	13.20	2.166014	0.38217	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.27	4.27	0.50696	.	0.432432	0.17098	U	0.187090	T	0.60209	0.2251	L	0.44542	1.39	0.33771	D	0.623085	D	0.64830	0.994	P	0.62740	0.906	T	0.70371	-0.4890	9	0.72032	D	0.01	-17.6156	9.716	0.40274	1.0:0.0:0.0:0.0	.	17	O94992	HEXI1_HUMAN	Y	17	.	ENSP00000328773:N17Y	N	+	1	0	HEXIM1	40582389	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	1.596000	0.36718	1.805000	0.52779	0.533000	0.62120	AAC		0.547	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460		Missense_Mutation
STRADA	92335	broad.mit.edu	37	17	61784669	61784669	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr17:61784669G>C	ENST00000336174.6	-	9	803	c.691C>G	c.(691-693)Cac>Gac	p.H231D	RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000447001.3_Missense_Mutation_p.H187D|STRADA_ENST00000582137.1_Missense_Mutation_p.H202D|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000392950.4_Missense_Mutation_p.H194D|STRADA_ENST00000579340.1_Intron|STRADA_ENST00000245865.5_Missense_Mutation_p.H173D|STRADA_ENST00000375840.4_Missense_Mutation_p.H173D	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	231	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.H231D(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						GGAAAATCGTGGACCACTCGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											107.0	95.0	99.0					17																	61784669		2203	4300	6503	59138401	SO:0001583	missense	92335			AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.691C>G	17.37:g.61784669G>C	ENSP00000336655:p.His231Asp	Unknown		x	x	x	59138401	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	37	CCDS32703.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	g	31	5.065578	0.93898	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74145	0.3678	L	0.41906	1.305	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.998;0.999;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.991;0.986;0.966;0.991;0.972;0.943;0.999	T	0.74791	-0.3545	10	0.59425	D	0.04	.	19.6867	0.95982	0.0:0.0:1.0:0.0	.	202;187;173;173;194;194;231	B4DW17;B4DDE3;Q5JPI2;Q86YC8;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;.;STRAA_HUMAN	D	231;173;187;194;193	ENSP00000336655:H231D;ENSP00000365000:H173D;ENSP00000398841:H187D;ENSP00000376677:H194D	ENSP00000245865:H193D	H	-	1	0	STRADA	59138401	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.417000	0.97391	2.720000	0.93068	0.556000	0.70494	CAC		0.592	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1			Missense_Mutation
OSBPL1A	114876	broad.mit.edu	37	18	21746586	21746586	+	Silent	SNP	G	G	A	rs555122944		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr18:21746586G>A	ENST00000319481.3	-	26	2822	c.2616C>T	c.(2614-2616)tgC>tgT	p.C872C	OSBPL1A_ENST00000399443.3_Silent_p.C359C|OSBPL1A_ENST00000357041.4_Silent_p.C490C	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	872					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)	p.C872C(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					GCCGTAACCTGCAGTCTGTCT	0.428													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19522	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	18											215.0	188.0	197.0					18																	21746586		2203	4300	6503	20000584	SO:0001819	synonymous_variant	114876			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2616C>T	18.37:g.21746586G>A		Unknown		x	x	x	20000584	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	37	CCDS11884.1	SNP	46	Broad																																																																																				0.428	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597		Silent
GALNT1	2589	broad.mit.edu	37	18	33243591	33243591	+	Splice_Site	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr18:33243591G>C	ENST00000269195.5	+	2	242		c.e2-1		GALNT1_ENST00000591081.1_Splice_Site|GALNT1_ENST00000537549.1_Splice_Site	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.?(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						CCTATTCTTAGTTCTAGAGCC	0.348																																																1	Unknown(1)	ovary(1)	18											64.0	64.0	64.0					18																	33243591		2203	4300	6503	31497589	SO:0001630	splice_region_variant	2589				CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.140-1G>C	18.37:g.33243591G>C		Unknown		x	x	x	31497589	Q86TJ7|Q9UM86	Splice_Site_SNP	SNP	ENST00000269195.5	37	CCDS11915.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	16.65	3.183325	0.57800	.	.	ENSG00000141429	ENST00000537748;ENST00000269195	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.09	0.64982	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT1	31497589	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	2.765000	0.47621	2.407000	0.81776	0.563000	0.77884	.		0.348	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474	Intron	Splice_Site_SNP
CELF4	56853	broad.mit.edu	37	18	34853005	34853005	+	Missense_Mutation	SNP	G	G	A	rs372830155		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr18:34853005G>A	ENST00000591282.1	-	7	922	c.923C>T	c.(922-924)gCg>gTg	p.A308V	CELF4_ENST00000588597.1_Missense_Mutation_p.A297V|RP11-797E24.3_ENST00000586610.1_RNA|CELF4_ENST00000601019.1_Missense_Mutation_p.A306V|CELF4_ENST00000412753.1_Missense_Mutation_p.A307V|CELF4_ENST00000361795.5_Missense_Mutation_p.A306V|CELF4_ENST00000591287.1_Missense_Mutation_p.A307V|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000334919.5_Missense_Mutation_p.A298V|CELF4_ENST00000420428.2_Missense_Mutation_p.A308V|CELF4_ENST00000603232.1_Missense_Mutation_p.A307V			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	308	Ala-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.A308V(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						AGGTGCGGCCGCCAGGCCATT	0.652																																																1	Substitution - Missense(1)	ovary(1)	18						G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	28.0	31.0	30.0		920,917,893,923	5.2	1.0	18		30	2,8594		0,2,4296	no	missense,missense,missense,missense	CELF4	NM_001025087.1,NM_001025088.1,NM_001025089.1,NM_020180.3	64,64,64,64	0,2,6499	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign,benign	307/486,306/485,298/449,308/487	34853005	2,13000	2203	4298	6501	33107003	SO:0001583	missense	56853			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.923C>T	18.37:g.34853005G>A	ENSP00000464794:p.Ala308Val	Unknown		x	x	x	33107003	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	ENST00000591282.1	37	CCDS32818.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905577	0.33628	0.0	2.33E-4	ENSG00000101489	ENST00000361795;ENST00000412753;ENST00000420428;ENST00000334919	T;T;T	0.75260	-0.92;-0.87;-0.92	5.22	5.22	0.72569	Nucleotide-binding, alpha-beta plait (1);	0.160554	0.56097	D	0.000030	T	0.56016	0.1957	N	0.03948	-0.315	0.47778	D	0.999515	B;B;B;B;B;B	0.28998	0.0;0.001;0.23;0.172;0.0;0.001	B;B;B;B;B;B	0.30495	0.002;0.0;0.116;0.023;0.002;0.002	T	0.55444	-0.8140	10	0.27785	T	0.31	-7.6448	18.9627	0.92682	0.0:0.0:1.0:0.0	.	306;297;33;298;307;308	Q9BZC1-3;B4DHA8;A0PK06;Q9BZC1-5;Q9BZC1-2;Q9BZC1	.;.;.;.;.;CELF4_HUMAN	V	308;307;306;298	ENSP00000355089:A308V;ENSP00000406823:A307V;ENSP00000335631:A298V	ENSP00000335631:A298V	A	-	2	0	CELF4	33107003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.336000	0.59304	2.715000	0.92844	0.655000	0.94253	GCG		0.652	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180		Missense_Mutation
KIAA1683	80726	broad.mit.edu	37	19	18376230	18376230	+	Missense_Mutation	SNP	G	G	A	rs375526476		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr19:18376230G>A	ENST00000600328.3	-	3	2313	c.2120C>T	c.(2119-2121)gCc>gTc	p.A707V	KIAA1683_ENST00000600359.3_Missense_Mutation_p.A661V|KIAA1683_ENST00000392413.4_Missense_Mutation_p.A707V			Q9H0B3	K1683_HUMAN	KIAA1683	707						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.A707V(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GTCCAGATGGGCCAGGGATGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											61.0	61.0	61.0					19																	18376230		2203	4300	6503	18237230	SO:0001583	missense	80726			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2120C>T	19.37:g.18376230G>A	ENSP00000470780:p.Ala707Val	Unknown		x	x	x	18237230	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875015	0.33162	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000411671	T;T;T	0.03689	3.91;3.92;3.84	4.81	-6.77	0.01727	.	0.960292	0.08445	N	0.944795	T	0.03608	0.0103	L	0.50333	1.59	0.09310	N	1	P;B	0.47106	0.89;0.062	B;B	0.43413	0.419;0.022	T	0.26815	-1.0092	10	0.49607	T	0.09	-0.6991	3.4305	0.07426	0.0801:0.2308:0.2314:0.4577	.	707;707	E9PDE0;Q9H0B3	.;K1683_HUMAN	V	707;707;661;321	ENSP00000376213:A707V;ENSP00000352774:A707V;ENSP00000404501:A661V	ENSP00000352774:A707V	A	-	2	0	KIAA1683	18237230	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.220000	0.02971	-0.461000	0.06993	-1.383000	0.01170	GCC		0.622	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3			Missense_Mutation
ZNF208	7757	broad.mit.edu	37	19	22155997	22155997	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr19:22155997T>G	ENST00000397126.4	-	4	1987	c.1839A>C	c.(1837-1839)gaA>gaC	p.E613D	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	613					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E513D(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTTGCCACATTCTTCACATT	0.368																																																1	Substitution - Missense(1)	ovary(1)	19											64.0	68.0	67.0					19																	22155997		2110	4245	6355	21947837	SO:0001583	missense	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1839A>C	19.37:g.22155997T>G	ENSP00000380315:p.Glu613Asp	Unknown		x	x	x	21947837		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	9.418	1.082163	0.20309	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.35973	1.28	2.8	-1.92	0.07618	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42223	0.1193	.	.	.	0.20403	N	0.999904	D	0.57257	0.979	P	0.54889	0.763	T	0.38779	-0.9645	8	0.49607	T	0.09	.	9.0934	0.36625	0.0:0.7813:0.0:0.2187	.	513	O43345	ZN208_HUMAN	D	613;513	ENSP00000380315:E613D	ENSP00000380315:E613D	E	-	3	2	ZNF208	21947837	0.000000	0.05858	0.129000	0.21949	0.112000	0.19704	-5.922000	0.00090	-0.354000	0.08212	0.254000	0.18369	GAA		0.368	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		Missense_Mutation
DPY19L3	147991	broad.mit.edu	37	19	32959703	32959703	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr19:32959703C>G	ENST00000342179.5	+	16	1896	c.1681C>G	c.(1681-1683)Ctg>Gtg	p.L561V	DPY19L3_ENST00000586987.1_Missense_Mutation_p.L561V|DPY19L3_ENST00000392250.2_Missense_Mutation_p.L561V|DPY19L3_ENST00000590651.1_3'UTR	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	561						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L561V(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					TACAGTGGAGCTGATGAACTG	0.333																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	72.0	70.0					19																	32959703		2203	4300	6503	37651543	SO:0001583	missense	147991				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1681C>G	19.37:g.32959703C>G	ENSP00000344937:p.Leu561Val	Unknown		x	x	x	37651543	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066772	0.76301	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.69926	-0.44;-0.44	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	T	0.82181	0.4981	M	0.82823	2.61	0.48288	D	0.999624	D	0.89917	1.0	D	0.87578	0.998	D	0.84003	0.0344	10	0.66056	D	0.02	-6.5755	13.0761	0.59087	0.0:0.9268:0.0:0.0732	.	561	Q6ZPD9	D19L3_HUMAN	V	561	ENSP00000376081:L561V;ENSP00000344937:L561V	ENSP00000344937:L561V	L	+	1	2	DPY19L3	37651543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.614000	0.67695	2.676000	0.91093	0.563000	0.77884	CTG		0.333	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325		Missense_Mutation
ZNF671	79891	broad.mit.edu	37	19	58232979	58232979	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr19:58232979C>A	ENST00000317398.6	-	4	570	c.475G>T	c.(475-477)Gca>Tca	p.A159S	AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Missense_Mutation_p.A61S|AC003006.7_ENST00000599221.1_Intron|ZNF671_ENST00000594803.1_5'Flank	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A159S(1)		kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCCAGCTCTGCCATGAGAGTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	19											127.0	123.0	124.0					19																	58232979		2203	4300	6503	62924791	SO:0001583	missense	79891				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.475G>T	19.37:g.58232979C>A	ENSP00000321848:p.Ala159Ser	Unknown		x	x	x	62924791	A6NF07|Q9H5E9	Missense_Mutation	SNP	ENST00000317398.6	37	CCDS12961.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	6.445	0.450220	0.12223	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.06218	3.46;3.33	1.59	0.522	0.17053	.	.	.	.	.	T	0.02610	0.0079	N	0.13098	0.295	0.09310	N	1	B	0.24576	0.106	B	0.14578	0.011	T	0.45323	-0.9269	9	0.06099	T	0.92	.	3.9329	0.09293	0.0:0.7641:0.0:0.2359	.	159	Q8TAW3	ZN671_HUMAN	S	159;61	ENSP00000321848:A159S;ENSP00000338670:A61S	ENSP00000321848:A159S	A	-	1	0	ZNF671	62924791	0.000000	0.05858	0.017000	0.16124	0.096000	0.18686	-0.038000	0.12144	0.233000	0.21120	0.205000	0.17691	GCA		0.478	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466817.1	NM_024833		Missense_Mutation
OTOF	9381	broad.mit.edu	37	2	26705427	26705427	+	Missense_Mutation	SNP	G	G	A	rs573354216		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:26705427G>A	ENST00000272371.2	-	14	1552	c.1426C>T	c.(1426-1428)Ccc>Tcc	p.P476S	OTOF_ENST00000403946.3_Missense_Mutation_p.P476S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	476	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.P476S(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCACAGGGGCTCATAGCTG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		24157	0.0		0.0	False		,,,				2504	0.001				GBM(102;732 1451 20652 24062 31372)											1	Substitution - Missense(1)	ovary(1)	2											92.0	89.0	90.0					2																	26705427		2203	4300	6503	26558931	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1426C>T	2.37:g.26705427G>A	ENSP00000272371:p.Pro476Ser	Unknown		x	x	x	26558931	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950684	0.92660	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	D;D	0.95853	-3.83;-3.83	5.13	5.13	0.70059	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99589	1.0975	10	0.62326	D	0.03	-15.1964	18.1792	0.89772	0.0:0.0:1.0:0.0	.	476	Q9HC10	OTOF_HUMAN	S	476	ENSP00000272371:P476S;ENSP00000385255:P476S	ENSP00000272371:P476S	P	-	1	0	OTOF	26558931	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.807000	0.99171	2.396000	0.81511	0.561000	0.74099	CCC		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			Missense_Mutation
EMILIN1	11117	broad.mit.edu	37	2	27305239	27305239	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:27305239G>A	ENST00000380320.4	+	4	1299	c.800G>A	c.(799-801)gGc>gAc	p.G267D		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	267					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.G267D(1)		breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCATGGCGGCAGCAGCAGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	2											17.0	18.0	18.0					2																	27305239		2194	4279	6473	27158743	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.800G>A	2.37:g.27305239G>A	ENSP00000369677:p.Gly267Asp	Unknown		x	x	x	27158743	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	37	CCDS1733.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	7.711	0.695079	0.15039	.	.	ENSG00000138080	ENST00000380320	T	0.16324	2.35	4.81	3.92	0.45320	.	0.153445	0.40908	D	0.000994	T	0.10423	0.0255	N	0.24115	0.695	0.09310	N	1	B	0.30482	0.281	B	0.25405	0.06	T	0.24048	-1.0171	10	0.26408	T	0.33	-1.5621	10.3254	0.43790	0.0:0.0:0.8029:0.1971	.	267	Q9Y6C2	EMIL1_HUMAN	D	267	ENSP00000369677:G267D	ENSP00000369677:G267D	G	+	2	0	EMILIN1	27158743	0.477000	0.25909	0.004000	0.12327	0.003000	0.03518	3.598000	0.54038	0.997000	0.38969	0.462000	0.41574	GGC		0.672	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1	NM_007046		Missense_Mutation
ERLEC1	27248	broad.mit.edu	37	2	54035462	54035462	+	Silent	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:54035462G>A	ENST00000185150.4	+	9	1037	c.906G>A	c.(904-906)gaG>gaA	p.E302E	ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ERLEC1_ENST00000378239.5_Intron|ERLEC1_ENST00000405123.3_Silent_p.E302E	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1	302					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)	p.E302E(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						CTAAAGAAGAGAGATTTCCAG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	2											90.0	90.0	90.0					2																	54035462		2203	4300	6503	53888966	SO:0001819	synonymous_variant	27248			AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.906G>A	2.37:g.54035462G>A		Unknown		x	x	x	53888966	B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Silent	SNP	ENST00000185150.4	37	CCDS1848.1	SNP	33	Broad																																																																																				0.383	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251404.1	NM_015701		Silent
ADD2	119	broad.mit.edu	37	2	70905961	70905961	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:70905961G>A	ENST00000264436.4	-	11	1702	c.1258C>T	c.(1258-1260)Cga>Tga	p.R420*	ADD2_ENST00000355733.3_Nonsense_Mutation_p.R420*|ADD2_ENST00000407644.2_Nonsense_Mutation_p.R420*|ADD2_ENST00000413157.2_Nonsense_Mutation_p.R420*|ADD2_ENST00000430656.1_Nonsense_Mutation_p.R436*	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	420					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.R420*(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GCATGCTGTCGCAGGGCGGGC	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	2											137.0	137.0	137.0					2																	70905961		2203	4300	6503	70759469	SO:0001587	stop_gained	119			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1258C>T	2.37:g.70905961G>A	ENSP00000264436:p.Arg420*	Unknown		x	x	x	70759469	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Nonsense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	40	8.433140	0.98808	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	.	.	.	5.23	1.04	0.20106	.	0.062929	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-20.4455	13.2583	0.60091	0.0:0.0:0.4622:0.5378	.	.	.	.	X	420;420;420;420;420;436	.	ENSP00000264436:R420X	R	-	1	2	ADD2	70759469	1.000000	0.71417	0.989000	0.46669	0.792000	0.44763	2.365000	0.44196	0.306000	0.22856	0.655000	0.94253	CGA		0.577	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617		Nonsense_Mutation
IL36A	27179	broad.mit.edu	37	2	113764288	113764288	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:113764288G>A	ENST00000259211.6	+	3	649	c.238G>A	c.(238-240)Ggg>Agg	p.G80R		NM_014440.1	NP_055255.1	Q9UHA7	IL36A_HUMAN	interleukin 36, alpha	80					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)	p.G80R(1)|p.G80W(1)		large_intestine(1)|lung(3)|ovary(2)|skin(1)|stomach(2)	9						TGCTAAAGTCGGGGACCAGCC	0.483																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2											140.0	146.0	144.0					2																	113764288		1964	4133	6097	113480759	SO:0001583	missense	27179			AF201831	CCDS42734.1	2q12-q14.1	2011-07-14	2011-06-06	2011-06-06	ENSG00000136694	ENSG00000136694		"""Interleukins and interleukin receptors"""	15562	protein-coding gene	gene with protein product		605509	"""interleukin 1 family, member 6 (epsilon)"""	IL1F6		10625660	Standard	XM_005263639		Approved	FIL1, FIL1E, IL-1F6, IL1(EPSILON), MGC129553, MGC129552	uc010yxr.2	Q9UHA7	OTTHUMG00000153320	ENST00000259211.6:c.238G>A	2.37:g.113764288G>A	ENSP00000259211:p.Gly80Arg	Unknown		x	x	x	113480759	B2RAD9|Q53SR7|Q5BLR4|Q7RTZ8	Missense_Mutation	SNP	ENST00000259211.6	37	CCDS42734.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307607	0.23821	.	.	ENSG00000136694	ENST00000259211	T	0.20598	2.06	5.11	-8.41	0.00961	.	0.828332	0.10780	N	0.634986	T	0.14960	0.0361	M	0.66560	2.04	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.26155	-1.0111	10	0.48119	T	0.1	-5.7903	2.8285	0.05492	0.4451:0.3027:0.1499:0.1023	.	80	Q9UHA7	IL36A_HUMAN	R	80	ENSP00000259211:G80R	ENSP00000259211:G80R	G	+	1	0	IL36A	113480759	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.585000	0.05794	-1.749000	0.01330	0.591000	0.81541	GGG		0.483	IL36A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330711.1	NM_014440		Missense_Mutation
TANC1	85461	broad.mit.edu	37	2	160086628	160086628	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:160086628G>C	ENST00000263635.6	+	27	4928	c.4691G>C	c.(4690-4692)aGt>aCt	p.S1564T	TANC1_ENST00000454300.1_Missense_Mutation_p.S1458T	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1564					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.S1564T(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CCTCCTCCAAGTCCCATGCCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	2											51.0	56.0	54.0					2																	160086628		1936	4144	6080	159794874	SO:0001583	missense	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4691G>C	2.37:g.160086628G>C	ENSP00000263635:p.Ser1564Thr	Unknown		x	x	x	159794874	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027731	0.54790	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.72167	-0.63;-0.63	6.07	6.07	0.98685	.	0.083071	0.85682	D	0.000000	T	0.64136	0.2571	M	0.62723	1.935	0.80722	D	1	P	0.38535	0.635	B	0.27608	0.081	T	0.64980	-0.6279	9	.	.	.	.	15.155	0.72733	0.0:0.1404:0.8595:0.0	.	1564	Q9C0D5	TANC1_HUMAN	T	1458;1564	ENSP00000396339:S1458T;ENSP00000263635:S1564T	.	S	+	2	0	TANC1	159794874	1.000000	0.71417	0.704000	0.30370	0.178000	0.23041	6.437000	0.73421	2.882000	0.98803	0.655000	0.94253	AGT		0.542	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Missense_Mutation
LRP2	4036	broad.mit.edu	37	2	170070332	170070332	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:170070332G>T	ENST00000263816.3	-	36	6160	c.5875C>A	c.(5875-5877)Cag>Aag	p.Q1959K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1959					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.Q1959K(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGGGAAAGCTGGTGTACCAGG	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											84.0	83.0	83.0					2																	170070332		2203	4300	6503	169778578	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5875C>A	2.37:g.170070332G>T	ENSP00000263816:p.Gln1959Lys	Unknown		x	x	x	169778578	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	2.054	-0.416959	0.04766	.	.	ENSG00000081479	ENST00000263816	D	0.90900	-2.75	5.96	2.21	0.28008	Six-bladed beta-propeller, TolB-like (1);	0.320644	0.38778	N	0.001567	T	0.76140	0.3946	N	0.11201	0.11	0.37474	D	0.915714	B	0.02656	0.0	B	0.01281	0.0	T	0.63937	-0.6524	10	0.06625	T	0.88	.	9.1396	0.36894	0.1196:0.2266:0.6538:0.0	.	1959	P98164	LRP2_HUMAN	K	1959	ENSP00000263816:Q1959K	ENSP00000263816:Q1959K	Q	-	1	0	LRP2	169778578	0.997000	0.39634	0.301000	0.25044	0.612000	0.37316	2.644000	0.46613	0.135000	0.18707	-0.156000	0.13503	CAG		0.403	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179476535	179476535	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:179476535A>C	ENST00000591111.1	-	218	45802	c.45578T>G	c.(45577-45579)gTt>gGt	p.V15193G	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V7961G|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V16834G|TTN_ENST00000342992.6_Missense_Mutation_p.V14266G|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V7894G|TTN_ENST00000460472.2_Missense_Mutation_p.V7769G|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15193	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V7769G(1)|p.V14266G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGTGGCCAACTCCAGCTTC	0.443																																																2	Substitution - Missense(2)	ovary(2)	2											141.0	135.0	137.0					2																	179476535		1940	4145	6085	179184780	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45578T>G	2.37:g.179476535A>C	ENSP00000465570:p.Val15193Gly	Unknown		x	x	x	179184780	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	9.964	1.223509	0.22457	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.97	4.77	0.60923	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53997	0.1831	M	0.76170	2.325	0.58432	D	0.999998	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.57952	-0.7722	9	0.87932	D	0	.	13.2553	0.60074	0.7487:0.2513:0.0:0.0	.	7769;7894;7961;15193	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	14266;7769;7961;7894;7769	ENSP00000343764:V14266G;ENSP00000434586:V7769G;ENSP00000340554:V7961G;ENSP00000352154:V7894G	ENSP00000340554:V7961G	V	-	2	0	TTN	179184780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.903000	0.56318	2.281000	0.76405	0.528000	0.53228	GTT		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
CCDC141	285025	broad.mit.edu	37	2	179701598	179701598	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:179701598G>A	ENST00000295723.5	-	13	2679	c.2623C>T	c.(2623-2625)Cca>Tca	p.P875S	CCDC141_ENST00000420890.2_Intron|CCDC141_ENST00000480419.1_Intron			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1450								p.P875S(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCCATTTATGGCTTGTCATTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	62.0	63.0					2																	179701598		2203	4300	6503	179409843	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000295723.5:c.2623C>T	2.37:g.179701598G>A	ENSP00000295723:p.Pro875Ser	Unknown		x	x	x	179409843	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000295723.5	37		SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449248	0.63178	.	.	ENSG00000163492	ENST00000343876;ENST00000295723	T;T	0.33654	1.4;1.41	6.08	-4.54	0.03452	Immunoglobulin-like (1);	1.372040	0.04497	N	0.380585	T	0.27524	0.0676	.	.	.	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.41752	-0.9491	9	0.87932	D	0	.	9.2007	0.37256	0.5894:0.0:0.2782:0.1325	.	875	Q6ZP82	CC141_HUMAN	S	894;875	ENSP00000344627:P894S;ENSP00000295723:P875S	ENSP00000295723:P875S	P	-	1	0	CCDC141	179409843	0.007000	0.16637	0.023000	0.16930	0.339000	0.28857	-0.522000	0.06237	-0.935000	0.03728	-0.469000	0.05056	CCA		0.393	CCDC141-201	KNOWN	basic	protein_coding	protein_coding		NM_173648		Missense_Mutation
ITGAV	3685	broad.mit.edu	37	2	187516813	187516813	+	Missense_Mutation	SNP	C	C	A	rs559278598		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:187516813C>A	ENST00000261023.3	+	15	1776	c.1502C>A	c.(1501-1503)tCc>tAc	p.S501Y	ITGAV_ENST00000374907.3_Missense_Mutation_p.S465Y|ITGAV_ENST00000433736.2_Missense_Mutation_p.S455Y|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	501					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.S501Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CTCAAAGTTTCCTGGTAAGGG	0.358																																					Melanoma(58;108 1995 6081)											1	Substitution - Missense(1)	ovary(1)	2											59.0	62.0	61.0					2																	187516813		2203	4300	6503	187225058	SO:0001583	missense	3685				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1502C>A	2.37:g.187516813C>A	ENSP00000261023:p.Ser501Tyr	Unknown		x	x	x	187225058	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	37	CCDS2292.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735190	0.69189	.	.	ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.49720	0.77;0.77;0.77	5.19	5.19	0.71726	Integrin alpha-2 (1);	0.112314	0.64402	D	0.000007	T	0.71871	0.3391	M	0.80332	2.49	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.79108	0.973;0.992;0.985	T	0.76069	-0.3094	10	0.87932	D	0	.	19.0799	0.93178	0.0:1.0:0.0:0.0	.	455;465;501	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	Y	501;465;455	ENSP00000261023:S501Y;ENSP00000364042:S465Y;ENSP00000404291:S455Y	ENSP00000261023:S501Y	S	+	2	0	ITGAV	187225058	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.180000	0.71981	2.565000	0.86533	0.561000	0.74099	TCC		0.358	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210		Missense_Mutation
UNC80	285175	broad.mit.edu	37	2	210654289	210654289	+	Missense_Mutation	SNP	G	G	A	rs547993640		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:210654289G>A	ENST00000439458.1	+	6	838	c.758G>A	c.(757-759)cGg>cAg	p.R253Q	UNC80_ENST00000478701.1_3'UTR|UNC80_ENST00000272845.6_Missense_Mutation_p.R253Q	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	253					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R253Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGTCAAAGCCGGACCTGTGAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											111.0	117.0	115.0					2																	210654289		2203	4300	6503	210362534	SO:0001583	missense	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.758G>A	2.37:g.210654289G>A	ENSP00000391088:p.Arg253Gln	Unknown		x	x	x	210362534	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	g	0.852	-0.738409	0.03111	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.28255	1.62;1.62	5.29	2.81	0.32909	.	0.508541	0.19936	N	0.102755	T	0.07999	0.0200	N	0.00707	-1.245	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34354	-0.9832	10	0.02654	T	1	.	10.9522	0.47336	0.9061:0.0:0.0939:0.0	.	253;253	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	Q	253	ENSP00000391088:R253Q;ENSP00000272845:R253Q	ENSP00000272845:R253Q	R	+	2	0	UNC80	210362534	0.866000	0.29940	1.000000	0.80357	0.333000	0.28666	1.090000	0.30902	0.283000	0.22279	-0.320000	0.08662	CGG		0.368	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587		Missense_Mutation
PRKAG3	53632	broad.mit.edu	37	2	219691981	219691981	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr2:219691981G>C	ENST00000529249.1	-	9	1306	c.991C>G	c.(991-993)Ctg>Gtg	p.L331V	PRKAG3_ENST00000545803.1_Missense_Mutation_p.L147V|PRKAG3_ENST00000439262.2_Missense_Mutation_p.L306V|PRKAG3_ENST00000392098.3_Silent_p.S315S			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	331	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)	p.L331V(1)		large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	AAGATGTGCAGGAACTTGAGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	77.0	78.0					2																	219691981		2203	4300	6503	219400225	SO:0001583	missense	53632			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.991C>G	2.37:g.219691981G>C	ENSP00000436068:p.Leu331Val	Unknown		x	x	x	219400225	Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	ENST00000529249.1	37	CCDS2424.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	22.9	4.343831	0.82022	.	.	ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249	D;D;D	0.93366	-3.21;-3.21;-3.21	5.24	5.24	0.73138	Cystathionine beta-synthase, core (3);	0.000000	0.85682	D	0.000000	D	0.96549	0.8874	M	0.79343	2.45	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.95875	0.8894	10	0.44086	T	0.13	-12.4945	17.9976	0.89188	0.0:0.0:1.0:0.0	.	331	Q9UGI9	AAKG3_HUMAN	V	306;147;331	ENSP00000397133:L306V;ENSP00000444536:L147V;ENSP00000436068:L331V	ENSP00000233944:L331V	L	-	1	2	PRKAG3	219400225	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.947000	0.56652	2.729000	0.93468	0.655000	0.94253	CTG		0.587	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385992.1			Missense_Mutation
TRIB3	57761	broad.mit.edu	37	20	368679	368679	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr20:368679C>G	ENST00000217233.3	+	2	578	c.25C>G	c.(25-27)Cct>Gct	p.P9A	TRIB3_ENST00000422053.2_Missense_Mutation_p.P36A|TRIB3_ENST00000485293.1_3'UTR	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	9	Interaction with DDIT3/CHOP.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)	p.P9A(1)		breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		TCTGGCTGCTCCTGCGGGTTC	0.582																																					Melanoma(101;421 2374 19538)											1	Substitution - Missense(1)	ovary(1)	20											51.0	57.0	55.0					20																	368679		2203	4300	6503	316679	SO:0001583	missense	57761			AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.25C>G	20.37:g.368679C>G	ENSP00000217233:p.Pro9Ala	Unknown		x	x	x	316679	Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Missense_Mutation	SNP	ENST00000217233.3	37	CCDS12997.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	0.048	-1.259321	0.01445	.	.	ENSG00000101255	ENST00000217233;ENST00000449710;ENST00000422053	T;T;T	0.60548	0.92;0.18;0.78	4.05	-0.648	0.11464	.	.	.	.	.	T	0.22820	0.0551	N	0.03115	-0.41	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.26985	-1.0087	9	0.02654	T	1	-0.7313	3.2588	0.06842	0.0:0.3725:0.2151:0.4123	.	36;9	B4DMM9;Q96RU7	.;TRIB3_HUMAN	A	9;9;36	ENSP00000217233:P9A;ENSP00000391873:P9A;ENSP00000415416:P36A	ENSP00000217233:P9A	P	+	1	0	TRIB3	316679	0.000000	0.05858	0.096000	0.21009	0.076000	0.17211	-0.832000	0.04400	0.029000	0.15352	0.561000	0.74099	CCT		0.582	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077441.2	NM_021158		Missense_Mutation
SRC	6714	broad.mit.edu	37	20	36030925	36030925	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr20:36030925G>T	ENST00000373578.2	+	12	1553	c.1204G>T	c.(1204-1206)Gtg>Ttg	p.V402L	SRC_ENST00000373567.2_Missense_Mutation_p.V402L|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000360723.4_Missense_Mutation_p.V408L|SRC_ENST00000445403.1_Missense_Mutation_p.V402L|SRC_ENST00000373558.2_Missense_Mutation_p.V408L|SRC_ENST00000358208.4_Missense_Mutation_p.V402L	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	402	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	AGAGAACCTGGTGTGCAAAGT	0.617																																																0			20											66.0	59.0	61.0					20																	36030925		2203	4300	6503	35464339	SO:0001583	missense	6714			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1204G>T	20.37:g.36030925G>T	ENSP00000362680:p.Val402Leu	Unknown		x	x	x	35464339	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645337	0.67358	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76	4.99	4.02	0.46733	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.119454	0.56097	D	0.000028	T	0.08403	0.0209	N	0.25201	0.72	0.80722	D	1	B	0.27416	0.178	B	0.25506	0.061	T	0.18618	-1.0331	10	0.52906	T	0.07	.	12.3925	0.55366	0.0:0.0:0.8308:0.1692	.	402	P12931	SRC_HUMAN	L	402;402;408;402;402;408	ENSP00000408503:V402L;ENSP00000362680:V402L;ENSP00000353950:V408L;ENSP00000350941:V402L;ENSP00000362668:V402L;ENSP00000362659:V408L	ENSP00000350941:V402L	V	+	1	0	SRC	35464339	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.597000	0.74118	1.281000	0.44480	0.561000	0.74099	GTG		0.617	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417		Missense_Mutation
CTNNBL1	56259	broad.mit.edu	37	20	36488708	36488708	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr20:36488708G>A	ENST00000361383.6	+	15	1682	c.1565G>A	c.(1564-1566)cGa>cAa	p.R522Q	CTNNBL1_ENST00000373469.1_Missense_Mutation_p.R270Q|CTNNBL1_ENST00000373473.1_Missense_Mutation_p.R335Q|CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000405275.2_Missense_Mutation_p.R495Q	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	522					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)	p.R522Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CTAAACATGCGAGGAAGCTCC	0.443																																					Ovarian(184;582 2038 3273 4106 42608)											1	Substitution - Missense(1)	ovary(1)	20											194.0	169.0	177.0					20																	36488708		2203	4300	6503	35922122	SO:0001583	missense	56259			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1565G>A	20.37:g.36488708G>A	ENSP00000355050:p.Arg522Gln	Unknown		x	x	x	35922122	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	ENST00000361383.6	37	CCDS13298.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990438	0.93106	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473;ENST00000373469	T;T;T;T	0.47528	0.84;0.86;0.87;0.88	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.61464	0.2349	L	0.42529	1.33	0.80722	D	1	P;D	0.89917	0.919;1.0	B;D	0.71414	0.402;0.973	T	0.58301	-0.7660	10	0.38643	T	0.18	-5.3226	18.0467	0.89335	0.0:0.0:1.0:0.0	.	522;335	Q8WYA6;Q8WYA6-2	CTBL1_HUMAN;.	Q	522;495;335;270	ENSP00000355050:R522Q;ENSP00000384355:R495Q;ENSP00000362572:R335Q;ENSP00000362568:R270Q	ENSP00000355050:R522Q	R	+	2	0	CTNNBL1	35922122	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.375000	0.97178	2.488000	0.83962	0.655000	0.94253	CGA		0.443	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877		Missense_Mutation
PABPC1L	80336	broad.mit.edu	37	20	43550371	43550371	+	Splice_Site	SNP	A	A	C	rs367561929		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr20:43550371A>C	ENST00000217073.2	+	6	875	c.875A>C	c.(874-876)cAg>cCg	p.Q292P	PABPC1L_ENST00000217074.4_Splice_Site_p.Q292P|PABPC1L_ENST00000537323.1_Splice_Site_p.Q292P|PABPC1L_ENST00000490798.1_3'UTR|PABPC1L_ENST00000255136.3_Splice_Site_p.Q292P			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	292					mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.Q292P(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						AGGCGTTACCAGGTGAGGTCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											60.0	67.0	65.0					20																	43550371		1568	3582	5150	42983785	SO:0001630	splice_region_variant	80336			AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.876+1A>C	20.37:g.43550371A>C		Unknown		x	x	x	42983785	Q4VY17	Missense_Mutation	SNP	ENST00000217073.2	37	CCDS42878.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	13.98	2.397747	0.42512	.	.	ENSG00000101104	ENST00000217074;ENST00000255136;ENST00000537323;ENST00000217073	T;T;T;T	0.05258	3.47;3.47;3.47;3.47	4.98	3.89	0.44902	Nucleotide-binding, alpha-beta plait (1);	0.165081	0.56097	D	0.000033	T	0.30355	0.0762	M	0.93978	3.48	0.80722	D	1	D	0.69078	0.997	D	0.69654	0.965	T	0.17837	-1.0356	10	0.87932	D	0	.	10.3031	0.43663	0.9212:0.0:0.0788:0.0	.	292	Q4VXU2	PAP1L_HUMAN	P	292	ENSP00000217074:Q292P;ENSP00000255136:Q292P;ENSP00000445661:Q292P;ENSP00000217073:Q292P	ENSP00000217073:Q292P	Q	+	2	0	PABPC1L	42983785	1.000000	0.71417	1.000000	0.80357	0.478000	0.33099	7.475000	0.81041	0.865000	0.35603	0.460000	0.39030	CAG		0.602	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2		Missense_Mutation	Missense_Mutation
CECR1	51816	broad.mit.edu	37	22	17684504	17684504	+	Missense_Mutation	SNP	C	C	A	rs528271447		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr22:17684504C>A	ENST00000399839.1	-	4	972	c.702G>T	c.(700-702)gaG>gaT	p.E234D	CECR1_ENST00000399837.2_Missense_Mutation_p.E234D|CECR1_ENST00000262607.3_Missense_Mutation_p.E234D|CECR1_ENST00000449907.2_Missense_Mutation_p.E192D	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	234					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)	p.E234D(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CCTCGTAGAACTCCTGCATGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	22											136.0	111.0	119.0					22																	17684504		2203	4300	6503	16064504	SO:0001583	missense	51816			AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.702G>T	22.37:g.17684504C>A	ENSP00000382733:p.Glu234Asp	Unknown		x	x	x	16064504	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	37	CCDS13742.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912778	0.52439	.	.	ENSG00000093072	ENST00000399839;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	3.37	1.15	0.20763	Adenosine/AMP deaminase (1);	0.058283	0.64402	U	0.000003	D	0.86003	0.5829	M	0.64630	1.985	0.39301	D	0.964919	D	0.71674	0.998	D	0.66602	0.945	D	0.84470	0.0599	10	0.72032	D	0.01	.	6.9635	0.24610	0.0:0.7704:0.0:0.2296	.	234	Q9NZK5	CECR1_HUMAN	D	234;234;192;234	ENSP00000382733:E234D;ENSP00000262607:E234D;ENSP00000406443:E192D;ENSP00000382731:E234D	ENSP00000262607:E234D	E	-	3	2	CECR1	16064504	1.000000	0.71417	0.980000	0.43619	0.327000	0.28475	2.116000	0.41930	0.377000	0.24735	0.650000	0.86243	GAG		0.527	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1			Missense_Mutation
LIMK2	3985	broad.mit.edu	37	22	31658653	31658653	+	Silent	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr22:31658653C>T	ENST00000331728.4	+	7	844	c.730C>T	c.(730-732)Ctg>Ttg	p.L244L	LIMK2_ENST00000444929.2_Intron|LIMK2_ENST00000333611.4_Silent_p.L223L|LIMK2_ENST00000406516.1_Silent_p.L166L|LIMK2_ENST00000340552.4_Silent_p.L223L	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	244					phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.L244L(1)		endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						CTCCCAACGCCTGGACCAGCT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	22											67.0	72.0	70.0					22																	31658653		2203	4300	6503	29988653	SO:0001819	synonymous_variant	3985			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.730C>T	22.37:g.31658653C>T		Unknown		x	x	x	29988653	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Silent	SNP	ENST00000331728.4	37	CCDS13891.1	SNP	24	Broad																																																																																				0.607	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733		Silent
ENTHD1	150350	broad.mit.edu	37	22	40283742	40283742	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr22:40283742C>T	ENST00000325157.6	-	2	261	c.11G>A	c.(10-12)aGg>aAg	p.R4K		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	4								p.R4K(1)		breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					CACTTGTCTCCTGAACGCCAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	22											56.0	55.0	55.0					22																	40283742		2203	4300	6503	38613688	SO:0001583	missense	150350			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.11G>A	22.37:g.40283742C>T	ENSP00000317431:p.Arg4Lys	Unknown		x	x	x	38613688	B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	37	CCDS13998.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018050	0.75275	.	.	ENSG00000176177	ENST00000325157	T	0.43688	0.94	5.82	3.75	0.43078	ENTH/VHS (1);	0.140299	0.47852	N	0.000219	T	0.38268	0.1034	L	0.60067	1.865	0.43734	D	0.996226	P	0.35226	0.491	B	0.34418	0.182	T	0.31752	-0.9932	10	0.42905	T	0.14	-13.3498	11.513	0.50504	0.0:0.855:0.0:0.145	.	4	Q8IYW4	ENTD1_HUMAN	K	4	ENSP00000317431:R4K	ENSP00000317431:R4K	R	-	2	0	ENTHD1	38613688	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	0.878000	0.28126	1.472000	0.48140	0.655000	0.94253	AGG		0.393	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512		Missense_Mutation
SETD5	55209	broad.mit.edu	37	3	9517427	9517427	+	Silent	SNP	T	T	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr3:9517427T>C	ENST00000406341.1	+	22	4171	c.3981T>C	c.(3979-3981)tcT>tcC	p.S1327S	SETD5_ENST00000402466.1_Silent_p.S1229S|SETD5_ENST00000402198.1_Silent_p.S1327S|SETD5_ENST00000302463.6_Silent_p.S1229S|SETD5_ENST00000407969.1_Silent_p.S1346S			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1327	Ser-rich.							p.S1229S(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AGCCACATTCTGGAAACAGCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	3											34.0	35.0	35.0					3																	9517427		1977	4175	6152	9492427	SO:0001819	synonymous_variant	55209			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3981T>C	3.37:g.9517427T>C		Unknown		x	x	x	9492427	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	37	CCDS46741.1	SNP	55	Broad																																																																																				0.577	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614		Silent
NEK10	152110	broad.mit.edu	37	3	27387690	27387690	+	Missense_Mutation	SNP	G	G	C	rs56125830	byFrequency	TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr3:27387690G>C	ENST00000429845.2	-	5	512	c.150C>G	c.(148-150)ttC>ttG	p.F50L	NEK10_ENST00000341435.5_Missense_Mutation_p.F50L			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	50			F -> L (in dbSNP:rs56125830). {ECO:0000269|PubMed:17344846}.		positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.F50L(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGGCACTATCGAAGTTAATGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											118.0	108.0	111.0					3																	27387690		1568	3582	5150	27362694	SO:0001583	missense	152110			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.150C>G	3.37:g.27387690G>C	ENSP00000395849:p.Phe50Leu	Unknown		x	x	x	27362694	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37		SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995853	0.54147	.	.	ENSG00000163491	ENST00000341435;ENST00000396636;ENST00000435750;ENST00000429845	T;T;T	0.72167	-0.52;1.28;-0.63	5.47	0.676	0.17958	.	0.557136	0.19988	N	0.101633	T	0.52549	0.1741	L	0.36672	1.1	0.80722	D	1	P	0.35328	0.495	B	0.29267	0.1	T	0.40232	-0.9574	10	0.38643	T	0.18	.	7.7761	0.29037	0.7634:0.0:0.2366:0.0	.	50	Q6ZWH5	NEK10_HUMAN	L	50	ENSP00000343847:F50L;ENSP00000395338:F50L;ENSP00000395849:F50L	ENSP00000343847:F50L	F	-	3	2	NEK10	27362694	0.991000	0.36638	0.999000	0.59377	0.991000	0.79684	0.480000	0.22244	0.205000	0.20568	0.655000	0.94253	TTC		0.478	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		Missense_Mutation
CSRNP1	64651	broad.mit.edu	37	3	39188082	39188082	+	Missense_Mutation	SNP	C	C	G	rs142952358		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr3:39188082C>G	ENST00000273153.5	-	2	269	c.92G>C	c.(91-93)cGc>cCc	p.R31P	CSRNP1_ENST00000514182.1_Missense_Mutation_p.R31P	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	31	Ser-rich.				apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R31P(1)		central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						GGAGCAGGAGCGAGACTGGCA	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18583	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											50.0	31.0	37.0					3																	39188082		2197	4291	6488	39163086	SO:0001583	missense	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.92G>C	3.37:g.39188082C>G	ENSP00000273153:p.Arg31Pro	Unknown		x	x	x	39163086	Q69YY5	Missense_Mutation	SNP	ENST00000273153.5	37	CCDS2682.1	SNP	27	Broad	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	2.364	-0.345831	0.05208	.	.	ENSG00000144655	ENST00000273153;ENST00000514182	T;T	0.44083	0.93;0.93	3.53	-5.91	0.02269	.	0.947731	0.08946	N	0.870794	T	0.14917	0.0360	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17623	-1.0363	10	0.23891	T	0.37	-0.0354	4.1505	0.10235	0.2406:0.1859:0.4818:0.0917	.	31	Q96S65	CSRN1_HUMAN	P	31	ENSP00000273153:R31P;ENSP00000422532:R31P	ENSP00000273153:R31P	R	-	2	0	CSRNP1	39163086	0.000000	0.05858	0.000000	0.03702	0.406000	0.30931	-1.243000	0.02905	-1.553000	0.01702	-0.336000	0.08194	CGC		0.617	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027		Missense_Mutation
ATP6V1A	523	broad.mit.edu	37	3	113517281	113517281	+	Silent	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr3:113517281G>A	ENST00000273398.3	+	12	1590	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	ATP6V1A_ENST00000538620.1_Silent_p.Q461Q	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	494					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.Q494Q(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	AAATTGTACAGCTTGTGGGAA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	3											75.0	76.0	76.0					3																	113517281		2203	4300	6503	114999971	SO:0001819	synonymous_variant	523			L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1482G>A	3.37:g.113517281G>A		Unknown		x	x	x	114999971	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Silent	SNP	ENST00000273398.3	37	CCDS2976.1	SNP	34	Broad																																																																																				0.423	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690		Silent
DNAJB11	51726	broad.mit.edu	37	3	186295492	186295492	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr3:186295492C>A	ENST00000439351.1	+	5	1288	c.359C>A	c.(358-360)aCc>aAc	p.T120N	DNAJB11_ENST00000265028.3_Missense_Mutation_p.T120N			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	120					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T120N(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TTTGGAGGAACCCCTCGTCAG	0.343																																																1	Substitution - Missense(1)	ovary(1)	3											90.0	93.0	92.0					3																	186295492		2203	4300	6503	187778186	SO:0001583	missense	51726			AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.359C>A	3.37:g.186295492C>A	ENSP00000414398:p.Thr120Asn	Unknown		x	x	x	187778186	Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	ENST00000439351.1	37	CCDS3277.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	8.879	0.951220	0.18431	.	.	ENSG00000090520	ENST00000439351;ENST00000265028	T;T	0.73047	-0.71;-0.71	6.01	2.73	0.32206	.	0.135059	0.64402	N	0.000003	T	0.34019	0.0883	N	0.00483	-1.445	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18681	-1.0329	10	0.35671	T	0.21	-3.8104	8.4258	0.32729	0.4784:0.3922:0.1294:0.0	.	120	Q9UBS4	DJB11_HUMAN	N	120	ENSP00000414398:T120N;ENSP00000265028:T120N	ENSP00000265028:T120N	T	+	2	0	DNAJB11	187778186	0.972000	0.33761	1.000000	0.80357	0.997000	0.91878	1.197000	0.32211	1.483000	0.48342	0.655000	0.94253	ACC		0.343	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344779.1			Missense_Mutation
BLOC1S4	55330	broad.mit.edu	37	4	6718293	6718293	+	Silent	SNP	G	G	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:6718293G>C	ENST00000320776.3	+	1	452	c.357G>C	c.(355-357)ccG>ccC	p.P119P		NM_018366.2	NP_060836.1	Q9NUP1	BL1S4_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino	119					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|platelet aggregation (GO:0070527)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.P119P(1)									AGGGCGTGCCGCGCATCCACG	0.677																																																1	Substitution - coding silent(1)	ovary(1)	4											13.0	9.0	10.0					4																	6718293		2139	4210	6349	6769194	SO:0001819	synonymous_variant	55330			BC001818	CCDS3393.1	4p16.1	2012-08-01	2012-08-01	2012-08-01	ENSG00000186222	ENSG00000186222		"""Biogenesis of lysosomal organelles complex-1 subunits"""	24206	protein-coding gene	gene with protein product		605695	"""cappuccino homolog (mouse)"""	CNO		12576321, 11110696	Standard	NM_018366		Approved	FLJ11230, BCAS4L	uc003gjp.1	Q9NUP1	OTTHUMG00000125510	ENST00000320776.3:c.357G>C	4.37:g.6718293G>C		Unknown		x	x	x	6769194	Q6NVY6|Q96G84	Silent	SNP	ENST00000320776.3	37	CCDS3393.1	SNP	38	Broad																																																																																				0.677	BLOC1S4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246837.1	NM_018366		Silent
KLF3	51274	broad.mit.edu	37	4	38691419	38691419	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:38691419C>T	ENST00000261438.5	+	4	919	c.614C>T	c.(613-615)cCa>cTa	p.P205L	KLF3_ENST00000514033.1_Missense_Mutation_p.P205L	NM_016531.5	NP_057615.3	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	205	Pro-rich.				cellular response to peptide (GO:1901653)|multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P205L(1)		endometrium(5)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18						GGGATCGAACCACAGAGGACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											110.0	110.0	110.0					4																	38691419		2203	4300	6503	38367814	SO:0001583	missense	51274			AF285837	CCDS3444.1	4p16.1-p15.2	2013-01-08			ENSG00000109787	ENSG00000109787		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16516	protein-coding gene	gene with protein product	"""basic Kruppel-like factor"""	609392				18391014	Standard	NM_016531		Approved	BKLF	uc003gth.4	P57682	OTTHUMG00000097821	ENST00000261438.5:c.614C>T	4.37:g.38691419C>T	ENSP00000261438:p.Pro205Leu	Unknown		x	x	x	38367814	Q6PIR1|Q86TN0|Q9P2X6	Missense_Mutation	SNP	ENST00000261438.5	37	CCDS3444.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	18.74	3.687678	0.68157	.	.	ENSG00000109787	ENST00000261438;ENST00000514033	T;T	0.48201	0.82;0.82	6.03	6.03	0.97812	.	0.146147	0.48767	D	0.000161	T	0.34513	0.0900	N	0.14661	0.345	0.58432	D	0.999992	P	0.37781	0.608	B	0.34180	0.177	T	0.25676	-1.0125	10	0.56958	D	0.05	.	18.7374	0.91761	0.0:1.0:0.0:0.0	.	205	P57682	KLF3_HUMAN	L	205	ENSP00000261438:P205L;ENSP00000421252:P205L	ENSP00000261438:P205L	P	+	2	0	KLF3	38367814	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.371000	0.52379	2.861000	0.98227	0.655000	0.94253	CCA		0.363	KLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215093.2			Missense_Mutation
LIMCH1	22998	broad.mit.edu	37	4	41694371	41694371	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:41694371A>C	ENST00000313860.7	+	26	3250	c.3196A>C	c.(3196-3198)Aac>Cac	p.N1066H	LIMCH1_ENST00000503057.1_Missense_Mutation_p.N1450H|LIMCH1_ENST00000512632.1_Missense_Mutation_p.N963H|RP11-227F19.5_ENST00000506475.1_RNA|LIMCH1_ENST00000513024.1_Missense_Mutation_p.N893H|LIMCH1_ENST00000511496.1_Missense_Mutation_p.N880H|LIMCH1_ENST00000396595.3_Missense_Mutation_p.N885H|LIMCH1_ENST00000508501.1_Missense_Mutation_p.N1039H|LIMCH1_ENST00000509277.1_Missense_Mutation_p.N899H|LIMCH1_ENST00000514096.1_Missense_Mutation_p.N880H|LIMCH1_ENST00000381753.4_Missense_Mutation_p.N873H|LIMCH1_ENST00000512820.1_Missense_Mutation_p.N1052H|LIMCH1_ENST00000512946.1_Missense_Mutation_p.N1040H	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	1066	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)	p.N1066H(1)		central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						TGGTCTCCTGAACTGTAATGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	4											198.0	172.0	181.0					4																	41694371		2203	4300	6503	41389128	SO:0001583	missense	22998			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.3196A>C	4.37:g.41694371A>C	ENSP00000316891:p.Asn1066His	Unknown		x	x	x	41389128	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	SNP	9	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.97|15.97	2.990676|2.990676	0.54041|0.54041	.|.	.|.	ENSG00000064042|ENSG00000064042	ENST00000513024;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000396595;ENST00000381753;ENST00000537405|ENST00000508466	D;D;D;D;D;D;D;D;D;D;D;D|.	0.87179|.	-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22|.	4.99|4.99	4.99|4.99	0.66335|0.66335	Zinc finger, LIM-type (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.38665|.	0.1049|.	N|N	0.10685|0.10685	0.025|0.025	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D;D;D|.	0.89917|.	0.997;1.0;0.999;1.0;1.0;1.0;0.999;1.0;0.997;0.998;0.997;0.999|.	D;D;D;D;D;D;D;D;D;D;D;D|.	0.97110|.	0.995;1.0;0.996;0.989;0.999;0.999;0.999;0.997;0.987;0.998;0.997;0.999|.	T|.	0.30621|.	-0.9972|.	10|.	0.42905|.	T|.	0.14|.	-22.2006|-22.2006	14.8506|14.8506	0.70295|0.70295	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	880;816;899;963;873;885;1450;893;1052;1039;1040;1066|.	E7EPK0;B7Z3G0;E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0|.	.;.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN|.	H|C	893;1039;1040;1066;963;1052;1450;880;1449;880;899;885;873;392|899	ENSP00000425222:N893H;ENSP00000424825:N1039H;ENSP00000424645:N1040H;ENSP00000316891:N1066H;ENSP00000427045:N963H;ENSP00000424437:N1052H;ENSP00000425631:N1450H;ENSP00000421242:N880H;ENSP00000426334:N880H;ENSP00000422864:N899H;ENSP00000379840:N885H;ENSP00000371172:N873H|.	ENSP00000316891:N1066H|.	N|X	+|+	1|3	0|0	LIMCH1|LIMCH1	41389128|41389128	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.094000|0.094000	0.18550|0.18550	8.529000|8.529000	0.90602|0.90602	2.094000|2.094000	0.63399|0.63399	0.455000|0.455000	0.32223|0.32223	AAC|TGA		0.438	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988		Missense_Mutation
CXCL9	4283	broad.mit.edu	37	4	76924817	76924817	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:76924817T>A	ENST00000264888.5	-	4	350	c.312A>T	c.(310-312)aaA>aaT	p.K104N	RP11-630D6.5_ENST00000501239.2_RNA	NM_002416.1	NP_002407.1	Q07325	CXCL9_HUMAN	chemokine (C-X-C motif) ligand 9	104					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|defense response (GO:0006952)|defense response to virus (GO:0051607)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|regulation of cell proliferation (GO:0042127)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|cytokine activity (GO:0005125)	p.K104N(1)		large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(1)	11			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTTTTGATGTTTTTTCCCAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	4											160.0	149.0	153.0					4																	76924817		2202	4299	6501	77143841	SO:0001583	missense	4283			X72755	CCDS34014.1	4q21	2013-02-25	2002-08-22	2002-08-23		ENSG00000138755		"""Endogenous ligands"""	7098	protein-coding gene	gene with protein product		601704	"""monokine induced by gamma interferon"""	CMK, MIG		8476424, 9730616	Standard	NM_002416		Approved	SCYB9, Humig, crg-10	uc003hjh.1	Q07325		ENST00000264888.5:c.312A>T	4.37:g.76924817T>A	ENSP00000354901:p.Lys104Asn	Unknown		x	x	x	77143841	Q503B4	Missense_Mutation	SNP	ENST00000264888.5	37	CCDS34014.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	11.33	1.605517	0.28623	.	.	ENSG00000138755	ENST00000264888	T	0.49720	0.77	5.35	4.14	0.48551	.	0.316084	0.23062	N	0.052372	T	0.25827	0.0629	N	0.19112	0.55	0.31060	N	0.71427	B	0.29627	0.252	B	0.26614	0.071	T	0.26430	-1.0103	10	0.02654	T	1	-1.0925	9.6207	0.39719	0.0:0.0:0.1751:0.8249	.	104	Q07325	CXCL9_HUMAN	N	104	ENSP00000354901:K104N	ENSP00000354901:K104N	K	-	3	2	CXCL9	77143841	0.956000	0.32656	0.925000	0.36789	0.759000	0.43091	1.264000	0.33015	1.118000	0.41863	0.533000	0.62120	AAA		0.338	CXCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362819.1			Missense_Mutation
LARP7	51574	broad.mit.edu	37	4	113570806	113570806	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:113570806G>A	ENST00000344442.5	+	9	1536	c.1258G>A	c.(1258-1260)Gga>Aga	p.G420R	MIR302B_ENST00000362188.1_RNA|MIR302B_ENST00000509938.1_RNA|MIR302A_ENST00000385192.1_RNA|LARP7_ENST00000324052.6_Missense_Mutation_p.G420R|MIR302C_ENST00000362232.1_RNA|MIR367_ENST00000362299.1_RNA|MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000505215.1_RNA|LARP7_ENST00000509061.1_Missense_Mutation_p.G427R|MIR302B_ENST00000510655.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	420					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G420R(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		AACAGACAGTGGAGTACCTCA	0.299																																																1	Substitution - Missense(1)	ovary(1)	4											61.0	59.0	59.0					4																	113570806		2202	4299	6501	113790255	SO:0001583	missense	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1258G>A	4.37:g.113570806G>A	ENSP00000344950:p.Gly420Arg	Unknown		x	x	x	113790255	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	37	CCDS3701.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	14.54	2.564729	0.45694	.	.	ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000513553;ENST00000324052	T;T;T	0.18960	2.18;2.18;2.18	5.64	2.39	0.29439	.	0.871215	0.10024	N	0.725632	T	0.17704	0.0425	M	0.65975	2.015	0.09310	N	1	P	0.43431	0.807	B	0.33521	0.165	T	0.16928	-1.0386	10	0.15952	T	0.53	-17.9781	7.5224	0.27635	0.1114:0.0:0.6407:0.2479	.	420	Q4G0J3	LARP7_HUMAN	R	420;427;88;420	ENSP00000344950:G420R;ENSP00000422626:G427R;ENSP00000314311:G420R	ENSP00000314311:G420R	G	+	1	0	LARP7	113790255	0.007000	0.16637	0.012000	0.15200	0.089000	0.18198	0.581000	0.23819	0.546000	0.28920	0.591000	0.81541	GGA		0.299	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648		Missense_Mutation
FSTL5	56884	broad.mit.edu	37	4	162508708	162508708	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:162508708G>T	ENST00000306100.5	-	8	1350	c.914C>A	c.(913-915)tCc>tAc	p.S305Y	FSTL5_ENST00000511170.1_5'UTR|FSTL5_ENST00000536695.1_Missense_Mutation_p.S304Y|FSTL5_ENST00000379164.4_Missense_Mutation_p.S304Y|FSTL5_ENST00000427802.2_Missense_Mutation_p.S304Y	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	305	Ig-like 1.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.S305Y(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AATATACAAGGACCCATCATC	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											89.0	84.0	85.0					4																	162508708		2203	4300	6503	162728158	SO:0001583	missense	56884			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.914C>A	4.37:g.162508708G>T	ENSP00000305334:p.Ser305Tyr	Unknown		x	x	x	162728158	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477524	0.84640	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	5.34	5.34	0.76211	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91175	0.7220	M	0.93150	3.385	0.80722	D	1	D;D;D	0.76494	0.999;0.981;0.999	D;P;D	0.72338	0.977;0.845;0.972	D	0.93329	0.6699	10	0.87932	D	0	.	18.0942	0.89483	0.0:0.0:1.0:0.0	.	304;304;305	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	Y	305;304;304;304	ENSP00000305334:S305Y;ENSP00000368462:S304Y;ENSP00000389270:S304Y;ENSP00000440409:S304Y	ENSP00000305334:S305Y	S	-	2	0	FSTL5	162728158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.506000	0.81665	2.498000	0.84270	0.650000	0.86243	TCC		0.333	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		Missense_Mutation
SPCS3	60559	broad.mit.edu	37	4	177243374	177243374	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr4:177243374T>C	ENST00000503362.1	+	2	310	c.197T>C	c.(196-198)aTc>aCc	p.I66T	RP11-87F15.2_ENST00000512634.1_RNA	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)	66					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)	p.I66T(1)		ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		CTGGGATTTATCACATTTGAT	0.308																																																1	Substitution - Missense(1)	ovary(1)	4											122.0	111.0	114.0					4																	177243374		1808	4074	5882	177480368	SO:0001583	missense	60559			AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.197T>C	4.37:g.177243374T>C	ENSP00000427463:p.Ile66Thr	Unknown		x	x	x	177480368	P12280|Q9H0S7	Missense_Mutation	SNP	ENST00000503362.1	37	CCDS54823.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039551	0.75732	.	.	ENSG00000129128	ENST00000503362	.	.	.	5.09	5.09	0.68999	.	0.165190	0.56097	D	0.000037	T	0.67961	0.2949	M	0.63843	1.955	0.58432	D	0.999994	B	0.30686	0.29	B	0.41946	0.371	T	0.70107	-0.4963	9	0.56958	D	0.05	-9.1567	15.1617	0.72791	0.0:0.0:0.0:1.0	.	66	P61009	SPCS3_HUMAN	T	66	.	ENSP00000427463:I66T	I	+	2	0	SPCS3	177480368	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.317000	0.79018	2.047000	0.60756	0.528000	0.53228	ATC		0.308	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362329.1	NM_021928		Missense_Mutation
TRIO	7204	broad.mit.edu	37	5	14419940	14419940	+	Missense_Mutation	SNP	C	C	G	rs202028325		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr5:14419940C>G	ENST00000344204.4	+	34	5037	c.5013C>G	c.(5011-5013)aaC>aaG	p.N1671K	TRIO_ENST00000537187.1_Missense_Mutation_p.N1671K	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1671	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N1671K(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CCGCTTGCAACAGCAACGAGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	5											58.0	50.0	53.0					5																	14419940		2203	4300	6503	14472940	SO:0001583	missense	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5013C>G	5.37:g.14419940C>G	ENSP00000339299:p.Asn1671Lys	Unknown		x	x	x	14472940	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053774	0.36277	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.15487	2.42;2.42	5.03	3.23	0.37069	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.14787	0.0357	L	0.47716	1.5	0.47441	D	0.999425	P;P	0.37914	0.458;0.611	B;B	0.41271	0.352;0.138	T	0.05784	-1.0864	10	0.11182	T	0.66	.	8.2346	0.31618	0.0:0.7591:0.0:0.2409	.	1671;1671	O75962-5;O75962	.;TRIO_HUMAN	K	1671;1671;1358	ENSP00000339299:N1671K;ENSP00000446348:N1671K	ENSP00000339299:N1671K	N	+	3	2	TRIO	14472940	0.992000	0.36948	1.000000	0.80357	0.898000	0.52572	0.429000	0.21412	1.119000	0.41883	0.491000	0.48974	AAC		0.607	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		Missense_Mutation
OTULIN	90268	broad.mit.edu	37	5	14690252	14690252	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr5:14690252A>T	ENST00000284274.4	+	6	777	c.699A>T	c.(697-699)aaA>aaT	p.K233N		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		233	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.K233N(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					AAGCTGTAAAATTTCTAATGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	5											78.0	75.0	76.0					5																	14690252		1833	4093	5926	14743252	SO:0001583	missense	90268																														ENST00000284274.4:c.699A>T	5.37:g.14690252A>T	ENSP00000284274:p.Lys233Asn	Unknown		x	x	x	14743252	D3DTD3|Q8NAS0|Q96IA3	Missense_Mutation	SNP	ENST00000284274.4	37	CCDS43302.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202227	0.79127	.	.	ENSG00000154124	ENST00000284274	T	0.18810	2.19	5.53	0.495	0.16890	.	0.000000	0.85682	D	0.000000	T	0.41766	0.1173	M	0.78049	2.395	0.53005	D	0.999967	D	0.89917	1.0	D	0.91635	0.999	T	0.20907	-1.0261	10	0.87932	D	0	-31.0815	8.7985	0.34894	0.7046:0.0:0.2954:0.0	.	233	Q96BN8	F105B_HUMAN	N	233	ENSP00000284274:K233N	ENSP00000284274:K233N	K	+	3	2	FAM105B	14743252	0.998000	0.40836	0.726000	0.30738	0.998000	0.95712	0.619000	0.24388	-0.073000	0.12842	0.460000	0.39030	AAA		0.393	FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366012.1			Missense_Mutation
CMYA5	202333	broad.mit.edu	37	5	79029373	79029373	+	Silent	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr5:79029373A>T	ENST00000446378.2	+	2	4816	c.4785A>T	c.(4783-4785)gcA>gcT	p.A1595A		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1595					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.A1595A(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACAAACCGGCAGTGGAGGTAT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	5											123.0	123.0	123.0					5																	79029373		1875	4118	5993	79065129	SO:0001819	synonymous_variant	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4785A>T	5.37:g.79029373A>T		Unknown		x	x	x	79065129	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	CCDS47238.1	SNP	7	Broad																																																																																				0.448	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		Silent
GPRIN1	114787	broad.mit.edu	37	5	176026590	176026590	+	Silent	SNP	G	G	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr5:176026590G>T	ENST00000303991.4	-	2	423	c.246C>A	c.(244-246)tcC>tcA	p.S82S		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	82					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.S82S(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGTCAGAGCAGGAGGCCCCTT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	5											33.0	39.0	37.0					5																	176026590		2203	4300	6503	175959196	SO:0001819	synonymous_variant	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.246C>A	5.37:g.176026590G>T		Unknown		x	x	x	175959196	C9JM70|Q8ND74|Q96PZ4	Silent	SNP	ENST00000303991.4	37	CCDS4405.1	SNP	35	Broad																																																																																				0.652	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899		Silent
FGFR4	2264	broad.mit.edu	37	5	176523292	176523292	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr5:176523292G>A	ENST00000292408.4	+	15	2194	c.1949G>A	c.(1948-1950)cGc>cAc	p.R650H	FGFR4_ENST00000393648.2_Missense_Mutation_p.R582H|FGFR4_ENST00000502906.1_Missense_Mutation_p.R650H|FGFR4_ENST00000393637.1_Missense_Mutation_p.R610H|FGFR4_ENST00000292410.3_Missense_Mutation_p.R610H	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	650	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)	p.R650H(1)|p.R610H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CTCCAGGGCCGCCTGCCTGTG	0.677										TSP Lung(9;0.080)																																						2	Substitution - Missense(2)	ovary(2)	5											61.0	65.0	64.0					5																	176523292		2203	4300	6503	176455898	SO:0001583	missense	2264			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1949G>A	5.37:g.176523292G>A	ENSP00000292408:p.Arg650His	Unknown		x	x	x	176455898	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	37	CCDS4410.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	25.3	4.625045	0.87560	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94152	0.8124	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.94534	0.7739	10	0.56958	D	0.05	.	17.1688	0.86824	0.0:0.0:1.0:0.0	.	582;610;650	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	H	650;582;650;610;610;878	ENSP00000292408:R650H;ENSP00000377259:R582H;ENSP00000424960:R650H;ENSP00000292410:R610H;ENSP00000377254:R610H	ENSP00000292408:R650H	R	+	2	0	FGFR4	176455898	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	9.866000	0.99616	2.142000	0.66516	0.556000	0.70494	CGC		0.677	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1			Missense_Mutation
HIST1H2AM	8336	broad.mit.edu	37	6	27860907	27860907	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr6:27860907C>G	ENST00000359611.2	-	1	56	c.21G>C	c.(19-21)caG>caC	p.Q7H	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2BO_ENST00000303806.4_5'Flank	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	7						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.Q7H(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						CCTTGCCGCCCTGCTTGCCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											39.0	40.0	40.0					6																	27860907		2203	4300	6503	27968886	SO:0001583	missense	8336			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.21G>C	6.37:g.27860907C>G	ENSP00000352627:p.Gln7His	Unknown		x	x	x	27968886	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359611.2	37	CCDS4639.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	4.190	0.033908	0.08101	.	.	ENSG00000233224	ENST00000359611	T	0.42900	0.96	3.92	-0.0386	0.13879	.	0.000000	0.29028	U	0.013370	T	0.14657	0.0354	N	0.24115	0.695	0.25215	N	0.989941	.	.	.	.	.	.	T	0.15378	-1.0439	8	0.66056	D	0.02	.	8.2238	0.31558	0.0:0.5294:0.0:0.4706	.	.	.	.	H	7	ENSP00000352627:Q7H	ENSP00000352627:Q7H	Q	-	3	2	HIST1H2AM	27968886	0.764000	0.28473	0.997000	0.53966	0.252000	0.25951	-0.186000	0.09670	-0.036000	0.13669	-0.254000	0.11334	CAG		0.582	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040162.1	NM_003514		Missense_Mutation
MDN1	23195	broad.mit.edu	37	6	90383053	90383053	+	Missense_Mutation	SNP	A	A	G	rs371257592		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr6:90383053A>G	ENST00000369393.3	-	80	13491	c.13376T>C	c.(13375-13377)cTa>cCa	p.L4459P	MDN1_ENST00000428876.1_Missense_Mutation_p.L4459P|MDN1_ENST00000468568.1_5'Flank|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4459					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.L4459P(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ACTTTCAACTAGTGCCATTTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	6						A	PRO/LEU	0,4406		0,0,2203	106.0	100.0	102.0		13376	5.9	1.0	6		102	1,8599	1.2+/-3.3	0,1,4299	no	missense	MDN1	NM_014611.1	98	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging	4459/5597	90383053	1,13005	2203	4300	6503	90439774	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13376T>C	6.37:g.90383053A>G	ENSP00000358400:p.Leu4459Pro	Unknown		x	x	x	90439774	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	15.57	2.872517	0.51695	0.0	1.16E-4	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.04360	3.64;3.64	5.95	5.95	0.96441	.	0.355098	0.24613	N	0.037021	T	0.10680	0.0261	M	0.74258	2.255	0.80722	D	1	D	0.61080	0.989	P	0.55087	0.768	T	0.00792	-1.1564	10	0.62326	D	0.03	.	16.4159	0.83738	1.0:0.0:0.0:0.0	.	4459	Q9NU22	MDN1_HUMAN	P	4459	ENSP00000358400:L4459P;ENSP00000413970:L4459P	ENSP00000358400:L4459P	L	-	2	0	MDN1	90439774	1.000000	0.71417	0.992000	0.48379	0.468000	0.32798	7.470000	0.80973	2.279000	0.76181	0.533000	0.62120	CTA		0.458	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			Missense_Mutation
KLHL32	114792	broad.mit.edu	37	6	97562044	97562044	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr6:97562044A>G	ENST00000369261.4	+	7	1376	c.1013A>G	c.(1012-1014)cAc>cGc	p.H338R	KLHL32_ENST00000536676.1_Missense_Mutation_p.H302R|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.H269R	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	338								p.H338R(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GGAAGGAGCCACCATTGTGTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	6											94.0	89.0	91.0					6																	97562044		2203	4300	6503	97668765	SO:0001583	missense	114792			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1013A>G	6.37:g.97562044A>G	ENSP00000358265:p.His338Arg	Unknown		x	x	x	97668765	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.260894	0.80246	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.66099	-0.19;-0.19;-0.19	5.36	5.36	0.76844	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.52565	0.1742	L	0.29908	0.895	0.80722	D	1	D;D;P;D	0.89917	0.988;0.997;0.647;1.0	P;D;P;D	0.87578	0.875;0.994;0.621;0.998	T	0.55774	-0.8088	10	0.02654	T	1	.	15.522	0.75874	1.0:0.0:0.0:0.0	.	269;302;338;338	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	R	338;302;269	ENSP00000358265:H338R;ENSP00000440382:H302R;ENSP00000441527:H269R	ENSP00000358265:H338R	H	+	2	0	KLHL32	97668765	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.725000	0.91468	2.231000	0.72958	0.533000	0.62120	CAC		0.557	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904		Missense_Mutation
RFX6	222546	broad.mit.edu	37	6	117198482	117198482	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr6:117198482A>T	ENST00000332958.2	+	1	60	c.44A>T	c.(43-45)cAg>cTg	p.Q15L		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	15					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)	p.Q15L(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CTGCAGGCGCAGCCTGCGCCC	0.682																																																1	Substitution - Missense(1)	ovary(1)	6											18.0	20.0	19.0					6																	117198482		2201	4298	6499	117305175	SO:0001583	missense	222546			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.44A>T	6.37:g.117198482A>T	ENSP00000332208:p.Gln15Leu	Unknown		x	x	x	117305175	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	37	CCDS5113.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	10.62	1.400290	0.25291	.	.	ENSG00000185002	ENST00000332958	T	0.56776	0.44	5.35	4.18	0.49190	.	0.254610	0.28021	N	0.016918	T	0.17534	0.0421	N	0.24115	0.695	0.27587	N	0.949381	B	0.15930	0.015	B	0.10450	0.005	T	0.11792	-1.0573	10	0.66056	D	0.02	-7.9467	6.2027	0.20585	0.6649:0.1825:0.0:0.1526	.	15	Q8HWS3	RFX6_HUMAN	L	15	ENSP00000332208:Q15L	ENSP00000332208:Q15L	Q	+	2	0	RFX6	117305175	0.554000	0.26522	0.646000	0.29493	0.070000	0.16714	2.963000	0.49184	1.024000	0.39682	-0.468000	0.05107	CAG		0.682	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560		Missense_Mutation
LFNG	3955	broad.mit.edu	37	7	2566516	2566517	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:2566516_2566517AC>CA	ENST00000222725.5	+	7	1054_1055	c.1034_1035AC>CA	c.(1033-1035)cAC>cCA	p.H345P	LFNG_ENST00000402506.1_Missense_Mutation_p.H274P|LFNG_ENST00000338732.3_Missense_Mutation_p.H216P|MIR4648_ENST00000580107.1_RNA|LFNG_ENST00000402045.1_Missense_Mutation_p.H216P|LFNG_ENST00000359574.3_Missense_Mutation_p.H345P	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	345					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)	p.H216P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		AACGCCGTCCACGTGAAGGGGC	0.678																																																1	Substitution - Missense(1)	ovary(1)	7																																								2533043	SO:0001583	missense	3955			BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	Exception_encountered	7.37:g.2566516_2566517delinsCA	ENSP00000222725:p.His345Pro	Unknown		x	x	x	2533042	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation	DNP	ENST00000222725.5	37	CCDS34587.1	DNP	6	Broad																																																																																				0.678	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325021.1	NM_002304		Missense_Mutation
FBXL18	80028	broad.mit.edu	37	7	5540156	5540156	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:5540156C>G	ENST00000382368.3	-	3	1867	c.1744G>C	c.(1744-1746)Gac>Cac	p.D582H	FBXL18_ENST00000453700.3_Missense_Mutation_p.D582H	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	582								p.D582H(1)	FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		TTCAACATGTCTGAGAGCGCG	0.657																																																1	Substitution - Missense(1)	ovary(1)	7											44.0	49.0	48.0					7																	5540156		2045	4172	6217	5506682	SO:0001583	missense	80028			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1744G>C	7.37:g.5540156C>G	ENSP00000371805:p.Asp582His	Unknown		x	x	x	5506682	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	ENST00000382368.3	37	CCDS43546.1	SNP	32	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.74|15.74|15.74	2.922807|2.922807|2.922807	0.52653|0.52653|0.52653	.|.|.	.|.|.	ENSG00000155034|ENSG00000155034|ENSG00000155034	ENST00000382368;ENST00000312577;ENST00000453700|ENST00000458142|ENST00000297035	T;T|.|.	0.01005|.|.	5.45;5.45|.|.	5.35|5.35|5.35	4.47|4.47|4.47	0.54385|0.54385|0.54385	.|.|.	0.092833|.|.	0.64402|.|.	D|.|.	0.000001|.|.	T|T|T	0.54549|0.54549|0.54549	0.1865|0.1865|0.1865	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.46874|0.46874|0.46874	D|D|D	0.999239|0.999239|0.999239	D;D|.|.	0.76494|.|.	0.999;0.975|.|.	D;P|.|.	0.65874|.|.	0.939;0.81|.|.	T|T|T	0.59690|0.59690|0.59690	-0.7407|-0.7407|-0.7407	10|5|6	0.72032|.|0.87932	D|.|D	0.01|.|0	.|.|.	12.9571|12.9571|12.9571	0.58434|0.58434|0.58434	0.0:0.9218:0.0:0.0782|0.0:0.9218:0.0:0.0782|0.0:0.9218:0.0:0.0782	.|.|.	582;582|.|.	F5H4Z4;Q96ME1-4|.|.	.;.|.|.	H|H|T	582|465|141	ENSP00000371805:D582H;ENSP00000444797:D582H|.|.	ENSP00000311990:D582H|.|ENSP00000297035:R141T	D|Q|R	-|-|-	1|3|2	0|2|0	FBXL18|FBXL18|FBXL18	5506682|5506682|5506682	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.818000|0.818000|0.818000	0.32626|0.32626|0.32626	0.685000|0.685000|0.685000	0.39939|0.39939|0.39939	7.775000|7.775000|7.775000	0.85489|0.85489|0.85489	1.278000|1.278000|1.278000	0.44430|0.44430|0.44430	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GAC|CAG|AGA		0.657	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963		Missense_Mutation
RELN	5649	broad.mit.edu	37	7	103234215	103234215	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:103234215C>T	ENST00000428762.1	-	27	3985	c.3826G>A	c.(3826-3828)Gca>Aca	p.A1276T	RELN_ENST00000343529.5_Missense_Mutation_p.A1276T|RELN_ENST00000424685.2_Missense_Mutation_p.A1276T	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1276					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.A1276T(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AATATCATTGCTGATGGTGTG	0.403																																					NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7											169.0	154.0	159.0					7																	103234215		2203	4300	6503	103021451	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3826G>A	7.37:g.103234215C>T	ENSP00000392423:p.Ala1276Thr	Unknown		x	x	x	103021451	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.166963	0.94768	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.29142	1.58;1.58;1.58	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	L	0.59436	1.845	0.80722	D	1	P;D	0.69078	0.529;0.997	B;D	0.73380	0.152;0.98	T	0.51647	-0.8679	10	0.72032	D	0.01	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1276;1276	P78509-2;P78509	.;RELN_HUMAN	T	1276	ENSP00000392423:A1276T;ENSP00000345694:A1276T;ENSP00000388446:A1276T	ENSP00000345694:A1276T	A	-	1	0	RELN	103021451	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.270000	0.78493	2.885000	0.99019	0.655000	0.94253	GCA		0.403	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
AASS	10157	broad.mit.edu	37	7	121756700	121756700	+	Missense_Mutation	SNP	C	C	G	rs370266183		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:121756700C>G	ENST00000393376.1	-	7	976	c.881G>C	c.(880-882)cGt>cCt	p.R294P	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.R294P			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	294	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						AGTATTAAAACGACTTATGTA	0.383																																																0			7											87.0	76.0	80.0					7																	121756700		2203	4300	6503	121543936	SO:0001583	missense	10157			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.881G>C	7.37:g.121756700C>G	ENSP00000377040:p.Arg294Pro	Unknown		x	x	x	121543936	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.59	3.426609	0.62733	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	D;D	0.82803	-1.65;-1.65	5.82	5.82	0.92795	Alanine dehydrogenase/PNT, C-terminal (1);	0.215608	0.46442	D	0.000294	D	0.88276	0.6393	L	0.59436	1.845	0.48571	D	0.999677	D	0.63880	0.993	P	0.59288	0.855	D	0.85239	0.1037	10	0.30078	T	0.28	-18.4129	20.0953	0.97838	0.0:1.0:0.0:0.0	.	294	Q9UDR5	AASS_HUMAN	P	294	ENSP00000377040:R294P;ENSP00000403768:R294P	ENSP00000351834:R294P	R	-	2	0	AASS	121543936	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.460000	0.60108	2.767000	0.95098	0.655000	0.94253	CGT		0.383	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763		Missense_Mutation
CPA1	1357	broad.mit.edu	37	7	130023569	130023569	+	Silent	SNP	C	C	T	rs377138792		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:130023569C>T	ENST00000011292.3	+	6	780	c.630C>T	c.(628-630)ctC>ctT	p.L210L	CPA1_ENST00000484324.1_Silent_p.L122L	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	210					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.L210L(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CCGCCATTCTCGACACCTTGG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	7						C		0,4406		0,0,2203	187.0	158.0	168.0		630	-9.0	0.0	7		168	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CPA1	NM_001868.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		210/420	130023569	1,13005	2203	4300	6503	129810805	SO:0001819	synonymous_variant	1357				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.630C>T	7.37:g.130023569C>T		Unknown		x	x	x	129810805	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Silent	SNP	ENST00000011292.3	37	CCDS5820.1	SNP	31	Broad																																																																																				0.607	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868		Silent
OR2F2	135948	broad.mit.edu	37	7	143632336	143632336	+	Missense_Mutation	SNP	A	A	G	rs202173407		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:143632336A>G	ENST00000408955.2	+	1	78	c.11A>G	c.(10-12)gAt>gGt	p.D4G		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D4G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					ATGGAAATAGATAACCAGACG	0.368																																																1	Substitution - Missense(1)	ovary(1)	7						A	GLY/ASP	0,4392		0,0,2196	73.0	78.0	76.0		11	0.9	0.0	7		76	1,8599		0,1,4299	no	missense	OR2F2	NM_001004685.1	94	0,1,6495	GG,GA,AA		0.0116,0.0,0.0077	benign	4/318	143632336	1,12991	2196	4300	6496	143263269	SO:0001583	missense	135948				CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.11A>G	7.37:g.143632336A>G	ENSP00000386222:p.Asp4Gly	Unknown		x	x	x	143263269	A4D2G0|Q6IFP8	Missense_Mutation	SNP	ENST00000408955.2	37	CCDS43666.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	8.915	0.959637	0.18507	0.0	1.16E-4	ENSG00000221910	ENST00000408955	T	0.00438	7.42	3.49	0.897	0.19258	.	1.593700	0.03651	N	0.240997	T	0.00210	0.0006	N	0.03891	-0.335	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31052	-0.9957	10	0.23302	T	0.38	5.6348	4.7579	0.13093	0.6996:0.1906:0.1099:0.0	.	4	O95006	OR2F2_HUMAN	G	4	ENSP00000386222:D4G	ENSP00000386222:D4G	D	+	2	0	OR2F2	143263269	0.000000	0.05858	0.001000	0.08648	0.373000	0.29922	0.330000	0.19715	0.064000	0.16427	0.402000	0.26972	GAT		0.368	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			Missense_Mutation
DNAJB6	10049	broad.mit.edu	37	7	157178322	157178322	+	Intron	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr7:157178322G>A	ENST00000262177.4	+	8	896				DNAJB6_ENST00000452797.2_Intron|DNAJB6_ENST00000443280.1_Intron|DNAJB6_ENST00000429029.2_Silent_p.L236L	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AGCAGCTGCTGCGCTTGGATA	0.368																																					Esophageal Squamous(46;195 967 1350 20350 43814)											0			7											102.0	100.0	101.0					7																	157178322		2203	4300	6503	156871083	SO:0001627	intron_variant	10049			AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.691+17G>A	7.37:g.157178322G>A		Unknown		x	x	x	156871083	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Silent	SNP	ENST00000262177.4	37	CCDS5946.1	SNP	46	Broad																																																																																				0.368	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2			Silent
GPR124	25960	broad.mit.edu	37	8	37690582	37690582	+	Silent	SNP	C	C	T			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr8:37690582C>T	ENST00000412232.2	+	9	1165	c.1152C>T	c.(1150-1152)ccC>ccT	p.P384P	GPR124_ENST00000315215.7_Silent_p.P384P	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	384					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P377P(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGCAGTATCCCTTCACCTCAG	0.687																																																1	Substitution - coding silent(1)	ovary(1)	8											92.0	102.0	99.0					8																	37690582		2203	4300	6503	37809740	SO:0001819	synonymous_variant	25960			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1152C>T	8.37:g.37690582C>T		Unknown		x	x	x	37809740	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	SNP	24	Broad																																																																																				0.687	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			Silent
EYA1	2138	broad.mit.edu	37	8	72234085	72234085	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr8:72234085G>A	ENST00000340726.3	-	6	941	c.302C>T	c.(301-303)cCt>cTt	p.P101L	EYA1_ENST00000419131.1_Missense_Mutation_p.P101L|EYA1_ENST00000388741.2_Missense_Mutation_p.P67L|EYA1_ENST00000388743.2_Missense_Mutation_p.P100L|EYA1_ENST00000388742.4_Missense_Mutation_p.P101L|EYA1_ENST00000388740.3_Missense_Mutation_p.P68L|EYA1_ENST00000303824.7_Missense_Mutation_p.P100L	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	101					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TTGTGAGGAAGGGGTAGGGAG	0.463																																																0			8											188.0	166.0	173.0					8																	72234085		2203	4300	6503	72396639	SO:0001583	missense	2138			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.302C>T	8.37:g.72234085G>A	ENSP00000342626:p.Pro101Leu	Unknown		x	x	x	72396639	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	CCDS34906.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	30	5.050945	0.93740	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.92928	0.7750	M	0.68593	2.085	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0	D	0.93059	0.6472	10	0.59425	D	0.04	-9.4244	19.0782	0.93171	0.0:0.0:1.0:0.0	.	100;28;68;101;101	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	L	101;101;69;68;100;67;100;101	ENSP00000373394:P101L;ENSP00000342626:P101L;ENSP00000373392:P68L;ENSP00000303221:P100L;ENSP00000373393:P67L;ENSP00000373395:P100L;ENSP00000410176:P101L	ENSP00000303221:P100L	P	-	2	0	EYA1	72396639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.576000	0.86940	0.650000	0.86243	CCT		0.463	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		Missense_Mutation
TRPM3	80036	broad.mit.edu	37	9	73168117	73168117	+	Silent	SNP	C	C	A	rs376251043		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr9:73168117C>A	ENST00000377111.2	-	22	3540	c.3297G>T	c.(3295-3297)gtG>gtT	p.V1099V	TRPM3_ENST00000357533.2_Silent_p.V1103V|TRPM3_ENST00000423814.3_Silent_p.V1126V|TRPM3_ENST00000377106.1_Silent_p.V971V|TRPM3_ENST00000360823.2_Silent_p.V961V|TRPM3_ENST00000408909.2_Silent_p.V958V|TRPM3_ENST00000358082.3_Silent_p.V961V|TRPM3_ENST00000377110.3_Silent_p.V1099V|TRPM3_ENST00000377105.1_Silent_p.V958V|TRPM3_ENST00000396292.4_Silent_p.V971V|TRPM3_ENST00000396280.5_Silent_p.V948V|TRPM3_ENST00000396285.1_Silent_p.V958V	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1124					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.V971V(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGATGTTTGCCACTAAGAGGT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	9						C	,,,,,,	0,4406		0,0,2203	97.0	73.0	81.0		3297,2838,2874,2808,2844,2913,2883	4.0	1.0	9		81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TRPM3	NM_001007471.2,NM_020952.4,NM_024971.5,NM_206944.3,NM_206945.3,NM_206946.3,NM_206947.3	,,,,,,	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	,,,,,,	1099/1708,946/1555,958/1567,936/1545,948/1557,971/1580,961/1570	73168117	1,13005	2203	4300	6503	72357937	SO:0001819	synonymous_variant	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.3297G>T	9.37:g.73168117C>A		Unknown		x	x	x	72357937	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	8.655	0.899267	0.17686	0.0	1.16E-4	ENSG00000083067	ENST00000396280	.	.	.	5.81	3.96	0.45880	.	.	.	.	.	T	0.53981	0.1830	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48917	-0.8992	4	.	.	.	-23.9194	5.0358	0.14434	0.2495:0.5348:0.0:0.2157	.	.	.	.	C	948	.	.	G	-	1	0	TRPM3	72357937	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	0.799000	0.27028	0.780000	0.33566	0.655000	0.94253	GGC		0.537	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		Silent
CNTRL	11064	broad.mit.edu	37	9	123877463	123877463	+	Silent	SNP	T	T	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr9:123877463T>C	ENST00000373855.1	+	11	1700	c.1440T>C	c.(1438-1440)gcT>gcC	p.A480A	CNTRL_ENST00000238341.5_Silent_p.A480A|CNTRL_ENST00000373865.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	480					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.A480A(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TGGAAGAAGCTATACAACTAA	0.318																																																1	Substitution - coding silent(1)	ovary(1)	9											71.0	73.0	72.0					9																	123877463		2202	4297	6499	122917284	SO:0001819	synonymous_variant	11064			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1440T>C	9.37:g.123877463T>C		Unknown		x	x	x	122917284	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	ENST00000373855.1	37	CCDS35118.1	SNP	53	Broad																																																																																				0.318	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018		Silent
RALGPS1	9649	broad.mit.edu	37	9	129928470	129928470	+	Missense_Mutation	SNP	G	G	C	rs530706814		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr9:129928470G>C	ENST00000259351.5	+	9	1000	c.733G>C	c.(733-735)Gtt>Ctt	p.V245L	RALGPS1_ENST00000424082.2_Missense_Mutation_p.V245L|RALGPS1_ENST00000373436.1_Missense_Mutation_p.V245L|RALGPS1_ENST00000394022.3_Missense_Mutation_p.V245L|RALGPS1_ENST00000373434.1_Missense_Mutation_p.V245L	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	245	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)			kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TGATTTACAAGTTTCCTGCAG	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		20046	0.001		0.0	False		,,,				2504	0.0															0			9											108.0	105.0	106.0					9																	129928470		2202	4300	6502	128968291	SO:0001583	missense	9649			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.733G>C	9.37:g.129928470G>C	ENSP00000259351:p.Val245Leu	Unknown		x	x	x	128968291	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Missense_Mutation	SNP	ENST00000259351.5	37	CCDS35143.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056722	0.36277	.	.	ENSG00000136828	ENST00000259351;ENST00000424082;ENST00000394022;ENST00000373436;ENST00000373434	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15	5.36	5.36	0.76844	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.059065	0.64402	D	0.000002	T	0.26774	0.0655	N	0.13198	0.31	0.52501	D	0.999952	B;B;B;B	0.12013	0.001;0.005;0.001;0.002	B;B;B;B	0.12156	0.003;0.007;0.007;0.004	T	0.03493	-1.1031	10	0.37606	T	0.19	.	19.0894	0.93221	0.0:0.0:1.0:0.0	.	245;245;245;245	E9PBQ5;Q5JS13-3;Q5JS13-2;Q5JS13	.;.;.;RGPS1_HUMAN	L	245	ENSP00000259351:V245L;ENSP00000415630:V245L;ENSP00000377590:V245L;ENSP00000362535:V245L;ENSP00000362533:V245L	ENSP00000259351:V245L	V	+	1	0	RALGPS1	128968291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.356000	0.59430	2.515000	0.84797	0.650000	0.86243	GTT		0.368	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054133.1	NM_014636		Missense_Mutation
QSOX2	169714	broad.mit.edu	37	9	139101049	139101049	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr9:139101049T>C	ENST00000358701.5	-	12	1659	c.1622A>G	c.(1621-1623)gAg>gGg	p.E541G		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	541					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.E541G(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		CTTAATTTCCTCATGGCAGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	9											86.0	99.0	95.0					9																	139101049		2203	4300	6503	138240870	SO:0001583	missense	169714			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1622A>G	9.37:g.139101049T>C	ENSP00000351536:p.Glu541Gly	Unknown		x	x	x	138240870	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	CCDS35178.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833153	0.32421	.	.	ENSG00000165661	ENST00000358701	T	0.17528	2.27	4.91	4.91	0.64330	.	0.060204	0.64402	D	0.000003	T	0.14141	0.0342	L	0.43152	1.355	0.41381	D	0.987558	P	0.35612	0.512	B	0.35859	0.212	T	0.09164	-1.0687	10	0.25106	T	0.35	-35.8082	8.4873	0.33078	0.0:0.0877:0.0:0.9123	.	541	Q6ZRP7	QSOX2_HUMAN	G	541	ENSP00000351536:E541G	ENSP00000351536:E541G	E	-	2	0	QSOX2	138240870	0.489000	0.26004	0.999000	0.59377	0.897000	0.52465	2.245000	0.43133	1.831000	0.53308	0.456000	0.33151	GAG		0.572	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701		Missense_Mutation
RPS6KA3	6197	broad.mit.edu	37	X	20194459	20194459	+	Silent	SNP	T	T	C			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chrX:20194459T>C	ENST00000379565.3	-	13	1218	c.1011A>G	c.(1009-1011)agA>agG	p.R337R	RPS6KA3_ENST00000540702.1_Silent_p.R309R|RPS6KA3_ENST00000544447.1_Silent_p.R309R|RPS6KA3_ENST00000379548.4_Silent_p.R308R	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	337	AGC-kinase C-terminal.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R337R(1)		breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GAATTTCTCTTCTATACAGTT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	X											63.0	60.0	61.0					X																	20194459		2203	4300	6503	20104380	SO:0001819	synonymous_variant	6197			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1011A>G	X.37:g.20194459T>C		Unknown		x	x	x	20104380	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Silent	SNP	ENST00000379565.3	37	CCDS14197.1	SNP	62	Broad																																																																																				0.343	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586		Silent
MAGEA3	4102	broad.mit.edu	37	X	151935390	151935390	+	Silent	SNP	C	C	A			TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chrX:151935390C>A	ENST00000393902.3	-	3	1344	c.777G>T	c.(775-777)cgG>cgT	p.R259R	MAGEA3_ENST00000370278.3_Silent_p.R259R			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	259	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.R259R(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CGGGGACCTGCCGGTACTCCA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	X											113.0	114.0	114.0					X																	151935390		2202	4294	6496	151686046	SO:0001819	synonymous_variant	4102				CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.777G>T	X.37:g.151935390C>A		Unknown		x	x	x	151686046	Q6FHI6	Silent	SNP	ENST00000393902.3	37	CCDS14715.1	SNP	26	Broad																																																																																				0.522	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	NM_005362		Silent
USP44	84101	broad.mit.edu	37	12	95912070	95912087	+	In_Frame_Del	DEL	TGCATACTTCATCCATAG	TGCATACTTCATCCATAG	-	rs17852817|rs372247671		TCGA-25-2392-01	TCGA-25-2392-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2392-01	TCGA-25-2392-10	g.chr12:95912070_95912087delTGCATACTTCATCCATAG	ENST00000258499.3	-	6	2270_2287	c.1982_1999delCTATGGATGAAGTATGCA	c.(1981-2001)actatggatgaagtatgcaag>aag	p.TMDEVC661del	USP44_ENST00000537435.2_In_Frame_Del_p.TMDEVC661del|USP44_ENST00000393091.2_In_Frame_Del_p.TMDEVC661del|USP44_ENST00000552440.1_3'UTR	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	661	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.T661_C666delTMDEVC(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						GCTTGAGCCTTGCATACTTCATCCATAGTGCACATGCT	0.404																																																1	Deletion - In frame(1)	ovary(1)	12																																								94436218	SO:0001651	inframe_deletion	84101			AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.1982_1999delCTATGGATGAAGTATGCA	12.37:g.95912070_95912087delTGCATACTTCATCCATAG	ENSP00000258499:p.Thr661_Cys666del	Unknown		Capture	Illumina GAIIx	Phase_I	94436201	B2RDW3	In_Frame_Del	DEL	ENST00000258499.3	37	CCDS9053.1	DEL	63	Broad																																																																																				0.404	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147		In_Frame_Del
