#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PTPRF	5792	broad.mit.edu	37	1	44075159	44075159	+	Nonsense_Mutation	SNP	C	C	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr1:44075159C>G	ENST00000359947.4	+	22	4303	c.3963C>G	c.(3961-3963)taC>taG	p.Y1321*	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Nonsense_Mutation_p.Y1312*|PTPRF_ENST00000372414.3_Nonsense_Mutation_p.Y1321*|PTPRF_ENST00000438120.1_Nonsense_Mutation_p.Y1312*|PTPRF_ENST00000422171.2_Nonsense_Mutation_p.Y669*	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1321					cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Y1311*(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGCTCAACTACCAGACCCCAG	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	1											66.0	55.0	58.0					1																	44075159		2203	4300	6503	43847746	SO:0001587	stop_gained	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.3963C>G	1.37:g.44075159C>G	ENSP00000353030:p.Tyr1321*	Unknown		x	x	x	43847746	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Nonsense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	SNP	18	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	33|33|33	5.209559|5.209559|5.209559	0.95069|0.95069|0.95069	.|.|.	.|.|.	ENSG00000142949|ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407	.|.|.	.|.|.	.|.|.	4.81|4.81|4.81	3.9|3.9|3.9	0.45041|0.45041|0.45041	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.37758|0.37758|.	0.1015|0.1015|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.36187|0.36187|.	-0.9758|-0.9758|.	3|3|.	.|.|0.06891	.|.|T	.|.|0.86	.|.|.	13.546|13.546|13.546	0.61705|0.61705|0.61705	0.0:0.9235:0.0:0.0765|0.0:0.9235:0.0:0.0765|0.0:0.9235:0.0:0.0765	.|.|.	.|.|.	.|.|.	.|.|.	A|S|X	694;735|967|1321;1312;1321;1312;669;382	.|.|.	.|.|ENSP00000353030:Y1321X	P|T|Y	+|+|+	1|2|3	0|0|2	PTPRF|PTPRF|PTPRF	43847746|43847746|43847746	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.947000|0.947000|0.947000	0.59692|0.59692|0.59692	1.978000|1.978000|1.978000	0.40598|0.40598|0.40598	1.156000|1.156000|1.156000	0.42514|0.42514|0.42514	-0.448000|-0.448000|-0.448000	0.05591|0.05591|0.05591	CCA|ACC|TAC		0.612	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			Nonsense_Mutation
SYT11	23208	broad.mit.edu	37	1	155838356	155838356	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr1:155838356C>A	ENST00000368324.4	+	2	888	c.635C>A	c.(634-636)aCc>aAc	p.T212N	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	212	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.T212N(1)		breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CGGGTGAAGACCAGAGTGCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	90.0	95.0					1																	155838356		2203	4300	6503	154104980	SO:0001583	missense	23208			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.635C>A	1.37:g.155838356C>A	ENSP00000357307:p.Thr212Asn	Unknown		x	x	x	154104980	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	ENST00000368324.4	37	CCDS1122.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825013	0.90955	.	.	ENSG00000132718	ENST00000368324	T	0.28666	1.6	5.97	5.97	0.96955	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.74419	0.3714	H	0.99642	4.675	0.80722	D	1	D	0.71674	0.998	D	0.91635	0.999	D	0.85944	0.1460	10	0.87932	D	0	.	20.0189	0.97489	0.0:1.0:0.0:0.0	.	212	Q9BT88	SYT11_HUMAN	N	212	ENSP00000357307:T212N	ENSP00000357307:T212N	T	+	2	0	SYT11	154104980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.792000	0.85828	2.828000	0.97474	0.655000	0.94253	ACC		0.572	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1	NM_152280		Missense_Mutation
ARHGAP30	257106	broad.mit.edu	37	1	161024178	161024178	+	Missense_Mutation	SNP	C	C	A	rs200609833		TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr1:161024178C>A	ENST00000368013.3	-	5	834	c.514G>T	c.(514-516)Gtg>Ttg	p.V172L	ARHGAP30_ENST00000368016.3_Missense_Mutation_p.V172L|ARHGAP30_ENST00000368015.1_Intron	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	172	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.V172L(2)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GGAGCCCACACGATGGCCAGG	0.592																																																2	Substitution - Missense(2)	ovary(2)	1											92.0	76.0	81.0					1																	161024178		2202	4300	6502	159290802	SO:0001583	missense	257106			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.514G>T	1.37:g.161024178C>A	ENSP00000356992:p.Val172Leu	Unknown		x	x	x	159290802	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.522112	0.96416	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017	T;T	0.24908	1.83;1.83	5.47	5.47	0.80525	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.59155	0.2173	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.72437	-0.4294	10	0.87932	D	0	.	16.894	0.86095	0.0:1.0:0.0:0.0	.	172;172	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	L	172;172;24	ENSP00000356995:V172L;ENSP00000356992:V172L	ENSP00000356992:V172L	V	-	1	0	ARHGAP30	159290802	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	7.553000	0.82203	2.572000	0.86782	0.644000	0.83932	GTG		0.592	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		Missense_Mutation
NEBL	10529	broad.mit.edu	37	10	21134191	21134191	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr10:21134191C>T	ENST00000377122.4	-	12	1619	c.1223G>A	c.(1222-1224)aGg>aAg	p.R408K	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	408					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.R408K(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCGTACCTCCCTCAGAAGGTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	10											99.0	97.0	98.0					10																	21134191		2203	4300	6503	21174197	SO:0001583	missense	10529			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1223G>A	10.37:g.21134191C>T	ENSP00000366326:p.Arg408Lys	Unknown		x	x	x	21174197	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	37	CCDS7134.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062745	0.36373	.	.	ENSG00000078114	ENST00000377122	T	0.31247	1.5	5.99	4.95	0.65309	.	0.209202	0.49305	N	0.000151	T	0.09949	0.0244	N	0.01267	-0.92	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08229	-1.0732	10	0.48119	T	0.1	.	3.8039	0.08768	0.0:0.2297:0.0:0.7703	.	408	O76041	NEBL_HUMAN	K	408	ENSP00000366326:R408K	ENSP00000366326:R408K	R	-	2	0	NEBL	21174197	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	2.083000	0.41615	1.296000	0.44742	0.655000	0.94253	AGG		0.333	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393		Missense_Mutation
SVIL	6840	broad.mit.edu	37	10	29821009	29821009	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr10:29821009G>A	ENST00000355867.4	-	9	2683	c.1931C>T	c.(1930-1932)tCt>tTt	p.S644F	SVIL_ENST00000375398.2_Missense_Mutation_p.S644F|SVIL_ENST00000375400.3_Intron	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	644					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.S644F(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TTCACCAGGAGAAAAATAGCG	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											87.0	87.0	87.0					10																	29821009		2203	4300	6503	29861015	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1931C>T	10.37:g.29821009G>A	ENSP00000348128:p.Ser644Phe	Unknown		x	x	x	29861015	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997607	0.74818	.	.	ENSG00000197321	ENST00000375398;ENST00000355867	T;T	0.57107	0.42;0.42	5.41	5.41	0.78517	.	0.072399	0.56097	D	0.000023	T	0.67325	0.2881	M	0.71581	2.175	0.80722	D	1	D	0.64830	0.994	P	0.55161	0.77	T	0.67764	-0.5586	9	.	.	.	-15.2437	19.2036	0.93720	0.0:0.0:1.0:0.0	.	644	O95425	SVIL_HUMAN	F	644	ENSP00000364547:S644F;ENSP00000348128:S644F	.	S	-	2	0	SVIL	29861015	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.431000	0.52814	2.552000	0.86080	0.655000	0.94253	TCT		0.507	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			Missense_Mutation
IFIT2	3433	broad.mit.edu	37	10	91066305	91066305	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr10:91066305C>G	ENST00000371826.3	+	2	761	c.592C>G	c.(592-594)Ctg>Gtg	p.L198V	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	198					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)	p.L198V(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				CATTGACCCTCTGAGGCAAGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											51.0	52.0	52.0					10																	91066305		2008	4190	6198	91056285	SO:0001583	missense	3433			M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.592C>G	10.37:g.91066305C>G	ENSP00000360891:p.Leu198Val	Unknown		x	x	x	91056285	Q5T767	Missense_Mutation	SNP	ENST00000371826.3	37	CCDS41548.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688648	0.68271	.	.	ENSG00000119922	ENST00000371826	T	0.40756	1.02	4.58	3.61	0.41365	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.171749	0.39407	U	0.001370	T	0.68531	0.3011	M	0.90759	3.145	0.48975	D	0.999736	D	0.89917	1.0	D	0.87578	0.998	T	0.75869	-0.3165	10	0.87932	D	0	-4.8458	12.3288	0.55026	0.0:0.9123:0.0:0.0877	.	198	P09913	IFIT2_HUMAN	V	198	ENSP00000360891:L198V	ENSP00000360891:L198V	L	+	1	2	IFIT2	91056285	0.772000	0.28567	0.934000	0.37439	0.925000	0.55904	1.317000	0.33631	1.422000	0.47177	0.655000	0.94253	CTG		0.502	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049293.1	NM_001547		Missense_Mutation
TRPM5	29850	broad.mit.edu	37	11	2432730	2432730	+	Silent	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr11:2432730G>A	ENST00000155858.6	-	18	2642	c.2634C>T	c.(2632-2634)ttC>ttT	p.F878F	TRPM5_ENST00000452833.1_Silent_p.F880F|TRPM5_ENST00000528453.1_Silent_p.F878F|TRPM5_ENST00000533060.1_Silent_p.F878F	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5									p.F878F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGCTCAGAAAGAAGAGGAAGA	0.667																																					NSCLC(1;49 61 17205 18850 43201)											1	Substitution - coding silent(1)	ovary(1)	11											33.0	39.0	37.0					11																	2432730		2201	4289	6490	2389306	SO:0001819	synonymous_variant	29850			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2634C>T	11.37:g.2432730G>A		Unknown		x	x	x	2389306		Silent	SNP	ENST00000155858.6	37	CCDS31340.1	SNP	33	Broad																																																																																				0.667	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555		Silent
OR51B6	390058	broad.mit.edu	37	11	5373069	5373069	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr11:5373069G>A	ENST00000380219.1	+	1	332	c.332G>A	c.(331-333)gGt>gAt	p.G111D	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	111					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G111D(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGGAGTCAGGTGTCTTGCTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											136.0	128.0	131.0					11																	5373069		2201	4297	6498	5329645	SO:0001583	missense	390058				CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.332G>A	11.37:g.5373069G>A	ENSP00000369568:p.Gly111Asp	Unknown		x	x	x	5329645		Missense_Mutation	SNP	ENST00000380219.1	37	CCDS31379.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293437	0.23564	.	.	ENSG00000176239	ENST00000537299;ENST00000380219	T	0.37584	1.19	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000045	T	0.60573	0.2279	M	0.94021	3.485	0.33308	D	0.565727	P	0.40553	0.721	P	0.46940	0.532	T	0.78368	-0.2231	10	0.87932	D	0	.	17.0455	0.86501	0.0:0.0:1.0:0.0	.	111	Q9H340	O51B6_HUMAN	D	110;111	ENSP00000369568:G111D	ENSP00000369568:G111D	G	+	2	0	OR51B6	5329645	0.000000	0.05858	0.953000	0.39169	0.109000	0.19521	0.867000	0.27968	2.603000	0.88011	0.455000	0.32223	GGT		0.473	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142960.1	NM_001004750		Missense_Mutation
OAS2	4939	broad.mit.edu	37	12	113442957	113442957	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr12:113442957C>A	ENST00000342315.4	+	7	1612	c.1398C>A	c.(1396-1398)agC>agA	p.S466R	OAS2_ENST00000392583.2_Missense_Mutation_p.S466R|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	466	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.S466R(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GGGTGCTGAGCTTCTCTCTGA	0.507																																					Pancreas(199;709 2232 18410 33584 35052)											1	Substitution - Missense(1)	ovary(1)	12											87.0	73.0	78.0					12																	113442957		2203	4300	6503	111927340	SO:0001583	missense	4939			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.1398C>A	12.37:g.113442957C>A	ENSP00000342278:p.Ser466Arg	Unknown		x	x	x	111927340	A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	CCDS31906.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	10.21	1.286530	0.23478	.	.	ENSG00000111335	ENST00000342315;ENST00000392583	T;T	0.09073	3.02;3.02	4.43	1.55	0.23275	.	0.105180	0.41938	D	0.000781	T	0.25901	0.0631	M	0.81802	2.56	0.24352	N	0.994917	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.03706	-1.1011	10	0.72032	D	0.01	-19.9768	8.913	0.35565	0.0:0.7199:0.0:0.2801	.	466;466	P29728;P29728-2	OAS2_HUMAN;.	R	466	ENSP00000342278:S466R;ENSP00000376362:S466R	ENSP00000342278:S466R	S	+	3	2	OAS2	111927340	0.998000	0.40836	0.096000	0.21009	0.047000	0.14425	0.172000	0.16704	-0.009000	0.14296	-0.797000	0.03246	AGC		0.507	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1			Missense_Mutation
TM6SF1	53346	broad.mit.edu	37	15	83805360	83805360	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr15:83805360C>T	ENST00000322019.9	+	10	1323	c.1049C>T	c.(1048-1050)gCc>gTc	p.A350V	TM6SF1_ENST00000565774.1_Missense_Mutation_p.A319V|TM6SF1_ENST00000379386.4_Missense_Mutation_p.A353V|TM6SF1_ENST00000379390.6_3'UTR			Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1	350						integral component of membrane (GO:0016021)		p.A350V(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						CAGCTCTTGGCCTATCGTTGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	15											128.0	129.0	129.0					15																	83805360		2203	4300	6503	81596364	SO:0001583	missense	53346			AF255922	CCDS10323.1, CCDS45338.1	15q24-q26	2003-04-04			ENSG00000136404	ENSG00000136404			11860	protein-coding gene	gene with protein product		606562				11124529	Standard	NM_001144903		Approved		uc002bjp.3	Q9BZW5	OTTHUMG00000147365	ENST00000322019.9:c.1049C>T	15.37:g.83805360C>T	ENSP00000317000:p.Ala350Val	Unknown		x	x	x	81596364	A8K7T5|H3BU56|Q4U0U5	Missense_Mutation	SNP	ENST00000322019.9	37	CCDS10323.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858885	0.51376	.	.	ENSG00000136404	ENST00000322019;ENST00000379386;ENST00000379384	T;T	0.25912	1.77;1.77	5.49	3.61	0.41365	.	0.239940	0.43747	N	0.000525	T	0.46658	0.1404	M	0.68317	2.08	0.80722	D	1	D;B	0.55605	0.972;0.014	P;B	0.59595	0.86;0.015	T	0.52465	-0.8572	10	0.72032	D	0.01	-13.2447	17.2447	0.87025	0.0:0.9321:0.0:0.0679	.	319;350	E9PD04;Q9BZW5	.;TM6S1_HUMAN	V	350;353;319	ENSP00000317000:A350V;ENSP00000368696:A353V	ENSP00000317000:A350V	A	+	2	0	TM6SF1	81596364	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.081000	0.50120	0.690000	0.31570	-1.316000	0.01300	GCC		0.348	TM6SF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000304009.1	NM_023003		Missense_Mutation
ZP2	7783	broad.mit.edu	37	16	21222865	21222865	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr16:21222865C>A	ENST00000574002.1	-	2	486	c.4G>T	c.(4-6)Gcg>Tcg	p.A2S	ZP2_ENST00000574091.1_Missense_Mutation_p.A2S|ZP2_ENST00000219593.4_Missense_Mutation_p.A2S			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	2					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)	p.A2S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TGCCTGCACGCCATAGCAGAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	16											136.0	123.0	128.0					16																	21222865		2199	4300	6499	21130366	SO:0001583	missense	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.4G>T	16.37:g.21222865C>A	ENSP00000460971:p.Ala2Ser	Unknown		x	x	x	21130366	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	37	CCDS10596.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760034	0.49468	.	.	ENSG00000103310	ENST00000219593	T	0.28454	1.61	4.04	1.98	0.26296	.	0.784909	0.11290	N	0.579406	T	0.46034	0.1372	L	0.61218	1.895	0.20074	N	0.999934	D;D;D	0.67145	0.994;0.996;0.996	D;P;P	0.63703	0.917;0.907;0.907	T	0.20538	-1.0272	10	0.72032	D	0.01	-2.1203	6.8161	0.23831	0.2024:0.6019:0.1957:0.0	.	2;2;2	B4DEV1;Q4VAP1;Q05996	.;.;ZP2_HUMAN	S	2	ENSP00000219593:A2S	ENSP00000219593:A2S	A	-	1	0	ZP2	21130366	0.923000	0.31300	0.412000	0.26496	0.007000	0.05969	1.702000	0.37836	0.601000	0.29879	0.655000	0.94253	GCG		0.557	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578208	7578208	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr17:7578208T>C	ENST00000269305.4	-	6	830	c.641A>G	c.(640-642)cAt>cGt	p.H214R	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.H214R|TP53_ENST00000445888.2_Missense_Mutation_p.H214R|TP53_ENST00000413465.2_Missense_Mutation_p.H214R|TP53_ENST00000420246.2_Missense_Mutation_p.H214R|TP53_ENST00000455263.2_Missense_Mutation_p.H214R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	214	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> P (in a sporadic cancer; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H214R(61)|p.0?(8)|p.?(5)|p.H82R(4)|p.H214fs*33(4)|p.H121R(4)|p.H214fs*5(2)|p.D208fs*1(1)|p.H82fs*>9(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.H121fs*33(1)|p.T211_S215delTFRHS(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACCACACTATGTCGAAAAGT	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	98	Substitution - Missense(69)|Deletion - Frameshift(12)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(3)|Complex - deletion inframe(1)	lung(27)|liver(12)|ovary(8)|biliary_tract(6)|oesophagus(6)|upper_aerodigestive_tract(5)|central_nervous_system(5)|large_intestine(5)|urinary_tract(5)|prostate(4)|bone(4)|stomach(3)|breast(3)|haematopoietic_and_lymphoid_tissue(2)|soft_tissue(1)|skin(1)|pancreas(1)	17											127.0	114.0	119.0					17																	7578208		2203	4300	6503	7518933	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.641A>G	17.37:g.7578208T>C	ENSP00000269305:p.His214Arg	Unknown		x	x	x	7518933	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	35	5.548167	0.96488	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99755	-6.64;-6.64;-6.64;-6.64;-6.64;-6.64;-6.64;-6.64	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.052737	0.85682	D	0.000000	D	0.99664	0.9875	M	0.75615	2.305	0.80722	D	1	D;D;P;D;D;D;D	0.76494	0.999;0.992;0.733;0.999;0.994;0.994;0.999	D;D;B;D;D;D;D	0.74674	0.984;0.947;0.376;0.982;0.95;0.968;0.962	D	0.97475	1.0043	10	0.72032	D	0.01	-26.1151	13.4753	0.61306	0.0:0.0:0.0:1.0	.	175;214;214;121;214;214;214	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	214;214;214;214;214;214;203;121;82;121;82	ENSP00000410739:H214R;ENSP00000352610:H214R;ENSP00000269305:H214R;ENSP00000398846:H214R;ENSP00000391127:H214R;ENSP00000391478:H214R;ENSP00000425104:H82R;ENSP00000423862:H121R	ENSP00000269305:H214R	H	-	2	0	TP53	7518933	1.000000	0.71417	0.283000	0.24790	0.961000	0.63080	7.996000	0.88334	2.128000	0.65567	0.460000	0.39030	CAT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
SLC16A3	9123	broad.mit.edu	37	17	80195685	80195685	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr17:80195685G>C	ENST00000581287.1	+	3	3361	c.1039G>C	c.(1039-1041)Gtg>Ctg	p.V347L	SLC16A3_ENST00000392339.1_Missense_Mutation_p.V347L|SLC16A3_ENST00000392341.1_Missense_Mutation_p.V347L|SLC16A3_ENST00000582743.1_Missense_Mutation_p.V347L	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	347					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.V347L(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	CATGGCCATCGTGGGCACCCA	0.667																																					Pancreas(52;652 1135 19190 37282 52456)											1	Substitution - Missense(1)	ovary(1)	17											39.0	30.0	33.0					17																	80195685		2197	4296	6493	77788974	SO:0001583	missense	9123			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.1039G>C	17.37:g.80195685G>C	ENSP00000463978:p.Val347Leu	Unknown		x	x	x	77788974	B3KXG8|Q2M1P8	Missense_Mutation	SNP	ENST00000581287.1	37	CCDS11804.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785053	0.90282	.	.	ENSG00000141526	ENST00000392341;ENST00000392339	T;T	0.58797	0.31;0.31	5.95	3.97	0.46021	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.054244	0.64402	D	0.000001	T	0.71986	0.3405	M	0.71206	2.165	0.58432	D	0.999993	D;D	0.67145	0.996;0.982	D;P	0.72075	0.976;0.892	T	0.74708	-0.3574	10	0.62326	D	0.03	.	11.4523	0.50160	0.1439:0.0:0.8561:0.0	.	347;347	Q53G91;O15427	.;MOT4_HUMAN	L	347	ENSP00000376152:V347L;ENSP00000376150:V347L	ENSP00000376150:V347L	V	+	1	0	SLC16A3	77788974	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.943000	0.87716	1.537000	0.49254	0.563000	0.77884	GTG		0.667	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443498.1	NM_004207		Missense_Mutation
MBP	4155	broad.mit.edu	37	18	74729159	74729159	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr18:74729159G>A	ENST00000397860.3	-	4	419	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	MBP_ENST00000397865.5_5'Flank|MBP_ENST00000397875.3_5'Flank|MBP_ENST00000397869.3_5'Flank|MBP_ENST00000354542.4_5'UTR|MBP_ENST00000359645.3_5'Flank|MBP_ENST00000580402.1_Missense_Mutation_p.R69C|MBP_ENST00000487778.1_5'UTR|MBP_ENST00000579129.1_Missense_Mutation_p.R69C|MBP_ENST00000526111.1_5'Flank|MBP_ENST00000527041.1_5'Flank|MBP_ENST00000397863.1_Missense_Mutation_p.R69C|MBP_ENST00000528160.1_5'Flank|MBP_ENST00000355994.2_Missense_Mutation_p.R69C|MBP_ENST00000382582.3_5'Flank|MBP_ENST00000578193.1_5'Flank|MBP_ENST00000397866.4_5'Flank	NM_001025100.1	NP_001020271.1	P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)	p.R69C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	TCCGCTGTGCGCTTGGAGTCA	0.602																																					NSCLC(17;72 1131 19392)											1	Substitution - Missense(1)	ovary(1)	18											71.0	70.0	71.0					18																	74729159		2203	4300	6503	72858147	SO:0001583	missense	4155				CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397860.3:c.205C>T	18.37:g.74729159G>A	ENSP00000380958:p.Arg69Cys	Unknown		x	x	x	72858147	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	ENST00000397860.3	37	CCDS42450.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515842	0.64634	.	.	ENSG00000197971	ENST00000355994;ENST00000397863;ENST00000397860	.	.	.	4.88	0.564	0.17302	.	0.440596	0.25994	N	0.026998	T	0.22360	0.0539	N	0.14661	0.345	0.31396	N	0.677271	D;D	0.65815	0.991;0.995	B;P	0.46975	0.328;0.533	T	0.24905	-1.0147	9	0.59425	D	0.04	.	7.3148	0.26495	0.0:0.2503:0.2876:0.4621	.	69;69	P02686;P02686-2	MBP_HUMAN;.	C	69	.	ENSP00000348273:R69C	R	-	1	0	MBP	72858147	0.993000	0.37304	0.998000	0.56505	0.993000	0.82548	0.633000	0.24598	0.519000	0.28406	0.644000	0.83932	CGC		0.602	MBP-005	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267945.1	NM_001025081		Missense_Mutation
NLRP12	91662	broad.mit.edu	37	19	54301530	54301530	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr19:54301530A>T	ENST00000324134.6	-	8	3062	c.2894T>A	c.(2893-2895)cTg>cAg	p.L965Q	NLRP12_ENST00000345770.5_Missense_Mutation_p.L966Q|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000391773.1_Missense_Mutation_p.L966Q|NLRP12_ENST00000351894.4_Intron|NLRP12_ENST00000391775.3_Intron|NLRP12_ENST00000535162.1_Missense_Mutation_p.L965Q	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	965					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.L965Q(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGGATGTTGCAGCCCCTCAGC	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	59.0	60.0					19																	54301530		2203	4300	6503	58993342	SO:0001583	missense	91662			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2894T>A	19.37:g.54301530A>T	ENSP00000319377:p.Leu965Gln	Unknown		x	x	x	58993342	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399837	0.42512	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000391773;ENST00000345770	T;T;T	0.63096	-0.02;-0.02;-0.02	4.42	4.42	0.53409	.	0.000000	0.27284	U	0.020076	D	0.86075	0.5846	H	0.98721	4.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.89580	0.3820	10	0.87932	D	0	.	10.3073	0.43689	1.0:0.0:0.0:0.0	.	965;965	A8K407;P59046	.;NAL12_HUMAN	Q	965;965;966;966	ENSP00000319377:L965Q;ENSP00000438030:L965Q;ENSP00000375653:L966Q	ENSP00000319377:L965Q	L	-	2	0	NLRP12	58993342	0.987000	0.35691	0.592000	0.28758	0.001000	0.01503	6.008000	0.70739	2.010000	0.58986	0.519000	0.50382	CTG		0.602	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		Missense_Mutation
ALMS1	7840	broad.mit.edu	37	2	73677305	73677305	+	Silent	SNP	A	A	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr2:73677305A>G	ENST00000264448.6	+	8	3759	c.3648A>G	c.(3646-3648)aaA>aaG	p.K1216K	ALMS1_ENST00000377715.1_Silent_p.K1216K|ALMS1_ENST00000409009.1_Silent_p.K1174K	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1216	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.K1216K(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGGCACAGAAAGTTTCACCTG	0.453																																																1	Substitution - coding silent(1)	ovary(1)	2											107.0	108.0	107.0					2																	73677305		1891	4117	6008	73530813	SO:0001819	synonymous_variant	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.3648A>G	2.37:g.73677305A>G		Unknown		x	x	x	73530813	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	CCDS42697.1	SNP	3	Broad																																																																																				0.453	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		Silent
SLC4A10	57282	broad.mit.edu	37	2	162807307	162807307	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr2:162807307G>A	ENST00000446997.1	+	19	2583	c.2490G>A	c.(2488-2490)atG>atA	p.M830I	SLC4A10_ENST00000375514.5_Missense_Mutation_p.M811I|SLC4A10_ENST00000421911.1_Missense_Mutation_p.M830I|SLC4A10_ENST00000272716.5_Missense_Mutation_p.M800I|SLC4A10_ENST00000415876.2_Missense_Mutation_p.M800I	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	830					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)	p.M800I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TAATTTTTATGGACCAACAGA	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											73.0	69.0	70.0					2																	162807307		1846	4100	5946	162515553	SO:0001583	missense	57282				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2490G>A	2.37:g.162807307G>A	ENSP00000393066:p.Met830Ile	Unknown		x	x	x	162515553	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.233667	0.95207	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	5.98	5.98	0.97165	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90249	0.6951	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.97110	0.997;0.997;1.0	D	0.90149	0.4219	10	0.87932	D	0	.	20.452	0.99131	0.0:0.0:1.0:0.0	.	811;800;830	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	I	811;800;800;799;830;830;829	ENSP00000364664:M811I;ENSP00000395797:M800I;ENSP00000272716:M800I;ENSP00000393066:M830I;ENSP00000404486:M830I	ENSP00000272716:M800I	M	+	3	0	SLC4A10	162515553	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.838000	0.97847	0.591000	0.81541	ATG		0.358	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179510754	179510754	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr2:179510754G>A	ENST00000591111.1	-	167	35602	c.35378C>T	c.(35377-35379)cCt>cTt	p.P11793L	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.3_ENST00000605021.1_lincRNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P13434L|TTN_ENST00000342992.6_Missense_Mutation_p.P10866L|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11793	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P10866L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGGTTCAGGTTCTTGAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											61.0	55.0	57.0					2																	179510754		1817	4074	5891	179218999	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35378C>T	2.37:g.179510754G>A	ENSP00000465570:p.Pro11793Leu	Unknown		x	x	x	179218999	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446193	0.63178	.	.	ENSG00000155657	ENST00000342992;ENST00000429997;ENST00000446966;ENST00000434777	T	0.70164	-0.46	5.25	5.25	0.73442	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.77765	0.4179	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.79850	-0.1629	9	0.87932	D	0	.	17.0189	0.86428	0.0:0.0:1.0:0.0	.	11793;273	Q8WZ42;A2TKE4	TITIN_HUMAN;.	L	10866;273;273;93	ENSP00000343764:P10866L	ENSP00000343764:P10866L	P	-	2	0	TTN	179218999	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.354000	0.73036	2.441000	0.82636	0.462000	0.41574	CCT		0.333	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
SCG2	7857	broad.mit.edu	37	2	224462651	224462651	+	Silent	SNP	C	C	T	rs538546270		TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr2:224462651C>T	ENST00000305409.2	-	2	1582	c.1350G>A	c.(1348-1350)acG>acA	p.T450T		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.T450T(1)		NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GAAAATACGACGTTTTCTGAT	0.483													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19886	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2											105.0	106.0	106.0					2																	224462651		2203	4300	6503	224170895	SO:0001819	synonymous_variant	7857			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1350G>A	2.37:g.224462651C>T		Unknown		x	x	x	224170895	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000305409.2	37	CCDS2457.1	SNP	19	Broad																																																																																				0.483	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469		Silent
YWHAB	7529	broad.mit.edu	37	20	43532645	43532645	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr20:43532645C>G	ENST00000372839.3	+	4	586	c.312C>G	c.(310-312)gaC>gaG	p.D104E	YWHAB_ENST00000353703.4_Missense_Mutation_p.D104E|YWHAB_ENST00000479421.1_3'UTR	NM_003404.3	NP_003395.1	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta	104					activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cytoplasmic sequestering of protein (GO:0051220)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|MAPK cascade (GO:0000165)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of catalytic activity (GO:0043085)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein heterooligomerization (GO:0051291)|protein targeting (GO:0006605)|Ras protein signal transduction (GO:0007265)|RNA metabolic process (GO:0016070)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.D104E(1)		breast(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(1)	12		Myeloproliferative disorder(115;0.0122)				AGCTGTTGGACAAATATCTTA	0.323																																																1	Substitution - Missense(1)	ovary(1)	20											84.0	84.0	84.0					20																	43532645		2203	4299	6502	42966059	SO:0001583	missense	7529			X57346	CCDS13339.1	20q13.1	2013-12-03	2013-12-03		ENSG00000166913	ENSG00000166913			12849	protein-coding gene	gene with protein product	"""14-3-3 beta"", ""14-3-3 alpha"""	601289	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide"", ""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide"""	YWHAA		8617504, 7890696	Standard	NM_003404		Approved		uc002xmu.3	P31946	OTTHUMG00000032549	ENST00000372839.3:c.312C>G	20.37:g.43532645C>G	ENSP00000361930:p.Asp104Glu	Unknown		x	x	x	42966059	A8K9K2|E1P616	Missense_Mutation	SNP	ENST00000372839.3	37	CCDS13339.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933455	0.34096	.	.	ENSG00000166913	ENST00000353703;ENST00000372839	T;T	0.48522	0.81;0.81	5.74	2.76	0.32466	14-3-3 domain (4);	0.142424	0.64402	D	0.000008	T	0.39064	0.1064	L	0.58925	1.835	0.58432	D	0.999999	B	0.02656	0.0	B	0.12837	0.008	T	0.23013	-1.0200	10	0.36615	T	0.2	-25.3966	6.2123	0.20636	0.0:0.5566:0.0:0.4434	.	104	P31946	1433B_HUMAN	E	104	ENSP00000300161:D104E;ENSP00000361930:D104E	ENSP00000300161:D104E	D	+	3	2	YWHAB	42966059	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.256000	0.32921	0.896000	0.36366	0.563000	0.77884	GAC		0.323	YWHAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079386.3	NM_003404		Missense_Mutation
PPDPF	79144	broad.mit.edu	37	20	62152873	62152873	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr20:62152873G>T	ENST00000370179.3	+	3	260	c.64G>T	c.(64-66)Ggt>Tgt	p.G22C	PPDPF_ENST00000370177.1_Missense_Mutation_p.G22C|PPDPF_ENST00000473620.1_3'UTR	NM_024299.2	NP_077275.1	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and proliferation factor	22					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)			p.G22C(1)		kidney(1)|lung(2)|ovary(1)	4						AGGCCGCCTGGGTTCCACTTC	0.711																																																1	Substitution - Missense(1)	ovary(1)	20											41.0	45.0	44.0					20																	62152873		2202	4299	6501	61623317	SO:0001583	missense	79144			AL121829	CCDS13523.1	20q13.33	2013-07-23	2013-07-23	2009-06-04	ENSG00000125534	ENSG00000125534			16142	protein-coding gene	gene with protein product	"""exocrine differentiation and proliferation factor"""		"""chromosome 20 open reading frame 149"", ""pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)"""	C20orf149			Standard	NM_024299		Approved	dJ697K14.9, exdpf	uc002yff.3	Q9H3Y8	OTTHUMG00000032978	ENST00000370179.3:c.64G>T	20.37:g.62152873G>T	ENSP00000359198:p.Gly22Cys	Unknown		x	x	x	61623317	E1P5J2|Q4VXP1|Q9H3Y7	Missense_Mutation	SNP	ENST00000370179.3	37	CCDS13523.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	.	28.3	4.911782	0.92178	.	.	ENSG00000125534	ENST00000370179;ENST00000370178;ENST00000370177	.	.	.	4.83	4.83	0.62350	.	0.105288	0.64402	D	0.000004	T	0.78317	0.4264	M	0.80183	2.485	0.53688	D	0.999973	D	0.89917	1.0	D	0.74348	0.983	T	0.81484	-0.0912	9	0.87932	D	0	-3.0329	12.4102	0.55464	0.0838:0.0:0.9162:0.0	.	22	Q9H3Y8	PPDPF_HUMAN	C	22	.	ENSP00000359196:G22C	G	+	1	0	PPDPF	61623317	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	4.206000	0.58473	2.212000	0.71576	0.650000	0.86243	GGT		0.711	PPDPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080149.1			Missense_Mutation
IQCF3	401067	broad.mit.edu	37	3	51864486	51864486	+	Missense_Mutation	SNP	G	G	A	rs369325050		TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr3:51864486G>A	ENST00000456080.1	+	8	1299	c.134G>A	c.(133-135)cGt>cAt	p.R45H	IQCF3_ENST00000446775.1_Missense_Mutation_p.R45H|IQCF3_ENST00000440739.2_Missense_Mutation_p.R45H|IQCF3_ENST00000437810.2_Missense_Mutation_p.R45H|IQCF3_ENST00000444293.1_Intron|IQCF3_ENST00000462079.1_3'UTR			P0C7M6	IQCF3_HUMAN	IQ motif containing F3	45								p.R45H(2)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCCTGGTGGCGTGGGGTCCTG	0.602																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	3						G	HIS/ARG,HIS/ARG	0,4354		0,0,2177	56.0	64.0	61.0		134,134	4.7	1.0	3		61	1,8557		0,1,4278	no	missense,missense	IQCF3	NM_001085479.2,NM_001207023.1	29,29	0,1,6455	AA,AG,GG		0.0117,0.0,0.0077	probably-damaging,probably-damaging	45/155,45/155	51864486	1,12911	2177	4279	6456	51839526	SO:0001583	missense	401067			AK057432	CCDS46837.1	3p21.31	2008-06-12			ENSG00000229972	ENSG00000229972			31816	protein-coding gene	gene with protein product							Standard	NM_001085479		Approved		uc021wyz.1	P0C7M6	OTTHUMG00000156910	ENST00000456080.1:c.134G>A	3.37:g.51864486G>A	ENSP00000415609:p.Arg45His	Unknown		x	x	x	51839526	B2RUV0	Missense_Mutation	SNP	ENST00000456080.1	37	CCDS46837.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533708	0.85812	0.0	1.17E-4	ENSG00000229972	ENST00000456080;ENST00000437810;ENST00000446775;ENST00000440739	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	4.72	4.72	0.59763	.	.	.	.	.	D	0.85754	0.5770	M	0.62088	1.915	0.32883	D	0.510844	D	0.89917	1.0	D	0.91635	0.999	D	0.88191	0.2877	9	0.87932	D	0	.	13.3833	0.60780	0.0:0.0:1.0:0.0	.	45	P0C7M6	IQCF3_HUMAN	H	45	ENSP00000415609:R45H;ENSP00000409373:R45H;ENSP00000401767:R45H;ENSP00000402012:R45H	ENSP00000409373:R45H	R	+	2	0	IQCF3	51839526	0.998000	0.40836	0.981000	0.43875	0.971000	0.66376	4.324000	0.59228	2.626000	0.88956	0.655000	0.94253	CGT		0.602	IQCF3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346579.2	NM_001085479		Missense_Mutation
SNTN	132203	broad.mit.edu	37	3	63649708	63649708	+	Silent	SNP	C	C	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr3:63649708C>A	ENST00000343837.3	+	4	401	c.381C>A	c.(379-381)ctC>ctA	p.L127L	SNTN_ENST00000496807.1_Intron	NM_001080537.1	NP_001074006.1	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	127						cilium (GO:0005929)	calcium ion binding (GO:0005509)	p.L127L(1)		endometrium(2)|ovary(1)	3						TGATCTTGCTCTTAAGCATCA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	3											85.0	77.0	80.0					3																	63649708		2203	4300	6503	63624748	SO:0001819	synonymous_variant	132203			AK126350	CCDS33779.1	3p14.2	2009-03-10	2009-03-10		ENSG00000188817	ENSG00000188817			33706	protein-coding gene	gene with protein product	"""S100A-like protein"""					18829862	Standard	NM_001080537		Approved	FLJ44379, S100AL	uc003dlr.3	A6NMZ2	OTTHUMG00000158766	ENST00000343837.3:c.381C>A	3.37:g.63649708C>A		Unknown		x	x	x	63624748	B7FF65	Silent	SNP	ENST00000343837.3	37	CCDS33779.1	SNP	32	Broad																																																																																				0.338	SNTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352094.1	NM_001080537		Silent
GABRR3	200959	broad.mit.edu	37	3	97731370	97731370	+	RNA	SNP	G	G	A	rs368459164		TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr3:97731370G>A	ENST00000472788.1	-	0	349					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	AGAGCCTCTCGTCTTTCCAGT	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20974	0.0		0.0	False		,,,				2504	0.0															0			3						G		3,3681		0,3,1839	137.0	128.0	131.0		348	-1.0	1.0	3		131	0,8188		0,0,4094	no	coding-synonymous	GABRR3	NM_001105580.2		0,3,5933	AA,AG,GG		0.0,0.0814,0.0253		116/468	97731370	3,11869	1842	4094	5936	99214060			200959			Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97731370G>A		Unknown		x	x	x	99214060	Q9UIV9	Silent	SNP	ENST00000472788.1	37		SNP	40	Broad																																																																																				0.403	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000353445.2			Silent
AMBN	258	broad.mit.edu	37	4	71462743	71462743	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr4:71462743G>A	ENST00000322937.6	+	3	215	c.112G>A	c.(112-114)Ggt>Agt	p.G38S	AMBN_ENST00000449493.2_Missense_Mutation_p.G38S	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	38					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.G38S(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TGGAACACCGGGTATGGCTAG	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											113.0	114.0	114.0					4																	71462743		2203	4300	6503	71497332	SO:0001583	missense	258			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.112G>A	4.37:g.71462743G>A	ENSP00000313809:p.Gly38Ser	Unknown		x	x	x	71497332	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428610	0.83667	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.52754	0.65;0.65	5.43	5.43	0.79202	.	0.152448	0.45126	D	0.000390	T	0.67795	0.2931	M	0.71581	2.175	0.47183	D	0.999349	D	0.89917	1.0	D	0.97110	1.0	T	0.70321	-0.4904	10	0.87932	D	0	-9.7328	15.0885	0.72174	0.0:0.0:1.0:0.0	.	38	Q9NP70	AMBN_HUMAN	S	38	ENSP00000313809:G38S;ENSP00000391234:G38S	ENSP00000313809:G38S	G	+	1	0	AMBN	71497332	1.000000	0.71417	0.995000	0.50966	0.845000	0.48019	4.746000	0.62133	2.699000	0.92147	0.655000	0.94253	GGT		0.358	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519		Missense_Mutation
ETNPPL	64850	broad.mit.edu	37	4	109669170	109669170	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr4:109669170C>A	ENST00000296486.3	-	9	1227	c.1073G>T	c.(1072-1074)gGa>gTa	p.G358V	ETNPPL_ENST00000510706.1_Missense_Mutation_p.G318V|ETNPPL_ENST00000411864.2_Missense_Mutation_p.G352V|ETNPPL_ENST00000512646.1_Missense_Mutation_p.G300V	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	358						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.G358V(1)									CCTAATATCTCCTATCAAAGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											169.0	165.0	167.0					4																	109669170		2203	4300	6503	109888619	SO:0001583	missense	64850			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.1073G>T	4.37:g.109669170C>A	ENSP00000296486:p.Gly358Val	Unknown		x	x	x	109888619	B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	ENST00000296486.3	37	CCDS3682.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667640	0.67814	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	5.54	5.54	0.83059	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.049846	0.85682	D	0.000000	D	0.95564	0.8558	M	0.93550	3.43	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.995;0.993	D	0.96102	0.9070	9	.	.	.	-19.0954	19.8426	0.96695	0.0:1.0:0.0:0.0	.	300;352;358	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	V	358;352;300;318	ENSP00000296486:G358V;ENSP00000392269:G352V;ENSP00000427065:G300V;ENSP00000423240:G318V	.	G	-	2	0	AGXT2L1	109888619	1.000000	0.71417	0.967000	0.41034	0.316000	0.28119	7.729000	0.84864	2.775000	0.95449	0.655000	0.94253	GGA		0.348	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363508.1	NM_031279		Missense_Mutation
NDST1	3340	broad.mit.edu	37	5	149915300	149915300	+	Silent	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr5:149915300G>A	ENST00000261797.6	+	6	1792	c.1290G>A	c.(1288-1290)gcG>gcA	p.A430A	NDST1_ENST00000523767.1_Silent_p.A430A	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	430	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.A430A(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGCAGTGGCGCCCCACCACT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	5											79.0	68.0	72.0					5																	149915300		2203	4300	6503	149895493	SO:0001819	synonymous_variant	3340			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1290G>A	5.37:g.149915300G>A		Unknown		x	x	x	149895493	Q96E57	Silent	SNP	ENST00000261797.6	37	CCDS34277.1	SNP	38	Broad																																																																																				0.637	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543		Silent
KIF4B	285643	broad.mit.edu	37	5	154395241	154395241	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr5:154395241C>G	ENST00000435029.4	+	1	1982	c.1822C>G	c.(1822-1824)Caa>Gaa	p.Q608E		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	608					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCTGGAGGGTCAAATAGCTGA	0.453																																																0			5											106.0	104.0	104.0					5																	154395241		2203	4300	6503	154375434	SO:0001583	missense	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1822C>G	5.37:g.154395241C>G	ENSP00000387875:p.Gln608Glu	Unknown		x	x	x	154375434		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	13.78	2.339645	0.41398	.	.	ENSG00000226650	ENST00000435029	T	0.12672	2.66	2.14	2.14	0.27477	.	.	.	.	.	T	0.18964	0.0455	L	0.38692	1.165	0.58432	D	0.999997	D	0.69078	0.997	D	0.70016	0.967	T	0.06807	-1.0806	9	0.06099	T	0.92	.	10.3225	0.43775	0.0:1.0:0.0:0.0	.	608	Q2VIQ3	KIF4B_HUMAN	E	608	ENSP00000387875:Q608E	ENSP00000387875:Q608E	Q	+	1	0	KIF4B	154375434	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	3.520000	0.53465	1.138000	0.42230	0.563000	0.77884	CAA		0.453	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			Missense_Mutation
SYNGAP1	8831	broad.mit.edu	37	6	33411445	33411445	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr6:33411445T>C	ENST00000418600.2	+	15	3217	c.3116T>C	c.(3115-3117)aTt>aCt	p.I1039T	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.I980T|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.I1039T	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1039					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.I1024T(1)|p.I1039T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CAGATCACCATTGGTCCCCAG	0.662																																																2	Substitution - Missense(2)	ovary(2)	6											63.0	67.0	66.0					6																	33411445		2203	4300	6503	33519423	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3116T>C	6.37:g.33411445T>C	ENSP00000403636:p.Ile1039Thr	Unknown		x	x	x	33519423	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	6.322	0.427539	0.11987	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.11712	2.75;2.75;2.75	4.09	2.89	0.33648	.	0.635334	0.14758	N	0.300150	T	0.01835	0.0058	L	0.27053	0.805	0.29082	N	0.88262	B;P;P	0.42518	0.004;0.782;0.782	B;B;B	0.34779	0.008;0.189;0.189	T	0.45745	-0.9240	10	0.16896	T	0.51	.	7.9353	0.29927	0.1837:0.0:0.0:0.8163	.	1039;1039;1039	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	T	1039;1039;1025;980	ENSP00000293748:I1039T;ENSP00000403636:I1039T;ENSP00000412475:I980T	ENSP00000293748:I1039T	I	+	2	0	SYNGAP1	33519423	0.442000	0.25633	0.998000	0.56505	0.903000	0.53119	1.712000	0.37940	0.607000	0.29982	0.397000	0.26171	ATT		0.662	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		Missense_Mutation
KCTD20	222658	broad.mit.edu	37	6	36449514	36449514	+	Silent	SNP	A	A	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr6:36449514A>T	ENST00000373731.2	+	6	1225	c.834A>T	c.(832-834)ccA>ccT	p.P278P	KCTD20_ENST00000536244.1_Silent_p.P133P|KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000544295.1_Silent_p.P32P|KCTD20_ENST00000449081.2_Silent_p.P112P	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	278					protein homooligomerization (GO:0051260)			p.P278P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						ACCCTCCACCAATGGGGGAGG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	6											95.0	86.0	89.0					6																	36449514		2203	4300	6503	36557492	SO:0001819	synonymous_variant	222658			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.834A>T	6.37:g.36449514A>T		Unknown		x	x	x	36557492	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Silent	SNP	ENST00000373731.2	37	CCDS4821.1	SNP	5	Broad																																																																																				0.507	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562		Silent
ZNF318	24149	broad.mit.edu	37	6	43325309	43325309	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr6:43325309C>T	ENST00000361428.2	-	3	820	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	ZNF318_ENST00000318149.3_Missense_Mutation_p.R248Q	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	248					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R248Q(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TTCTGTTCCCCGCAACAGCTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	6											109.0	101.0	104.0					6																	43325309		2203	4300	6503	43433287	SO:0001583	missense	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.743G>A	6.37:g.43325309C>T	ENSP00000354964:p.Arg248Gln	Unknown		x	x	x	43433287	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810217	0.70797	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.03468	3.92;3.92	5.62	2.34	0.29019	.	0.436527	0.21782	N	0.069194	T	0.01523	0.0049	L	0.27053	0.805	0.09310	N	0.999996	D	0.56287	0.975	P	0.47891	0.56	T	0.46965	-0.9153	10	0.87932	D	0	0.0221	7.7731	0.29021	0.0:0.6915:0.0:0.3085	.	248	Q5VUA4	ZN318_HUMAN	Q	248	ENSP00000323032:R248Q;ENSP00000354964:R248Q	ENSP00000323032:R248Q	R	-	2	0	ZNF318	43433287	0.013000	0.17824	0.899000	0.35326	0.912000	0.54170	0.323000	0.19593	0.128000	0.18479	0.555000	0.69702	CGG		0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		Missense_Mutation
FAM83B	222584	broad.mit.edu	37	6	54806538	54806538	+	Silent	SNP	T	T	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr6:54806538T>G	ENST00000306858.7	+	5	2885	c.2769T>G	c.(2767-2769)ctT>ctG	p.L923L	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	923								p.L923L(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					CCAGTGAGCTTCTACGATCTC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	6											114.0	100.0	104.0					6																	54806538		2203	4300	6503	54914497	SO:0001819	synonymous_variant	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2769T>G	6.37:g.54806538T>G		Unknown		x	x	x	54914497	Q2M1P3|Q96DQ2	Silent	SNP	ENST00000306858.7	37	CCDS34479.1	SNP	62	Broad																																																																																				0.443	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		Silent
COL12A1	1303	broad.mit.edu	37	6	75833987	75833987	+	Silent	SNP	T	T	C			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr6:75833987T>C	ENST00000322507.8	-	41	7017	c.6708A>G	c.(6706-6708)aaA>aaG	p.K2236K	COL12A1_ENST00000416123.2_Silent_p.K2236K|COL12A1_ENST00000483888.2_Silent_p.K2236K|COL12A1_ENST00000345356.6_Silent_p.K1072K	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2236	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.K2236K(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAGGGCTTAGTTTTAGCCTGT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	6											62.0	60.0	61.0					6																	75833987		1843	4102	5945	75890707	SO:0001819	synonymous_variant	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6708A>G	6.37:g.75833987T>C		Unknown		x	x	x	75890707	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1	SNP	60	Broad																																																																																				0.378	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		Silent
MICALL2	79778	broad.mit.edu	37	7	1488302	1488302	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr7:1488302C>G	ENST00000297508.7	-	3	463	c.288G>C	c.(286-288)ttG>ttC	p.L96F	MICALL2_ENST00000405088.4_Intron	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	96	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.|Forms an intramolecular interaction with the C-terminal coiled coil domain keeping the protein in a closed conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)	p.L96F(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		ACACGTAGGTCAAGATGCTCA	0.662																																																1	Substitution - Missense(1)	ovary(1)	7											95.0	87.0	90.0					7																	1488302		2203	4300	6503	1454828	SO:0001583	missense	79778			BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.288G>C	7.37:g.1488302C>G	ENSP00000297508:p.Leu96Phe	Unknown		x	x	x	1454828	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Missense_Mutation	SNP	ENST00000297508.7	37	CCDS5324.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	16.55	3.155934	0.57259	.	.	ENSG00000164877	ENST00000297508	D	0.96774	-4.12	4.31	2.38	0.29361	Calponin homology domain (5);	0.000000	0.27976	U	0.017091	D	0.96433	0.8836	L	0.55990	1.75	0.80722	D	1	D	0.53619	0.961	P	0.62740	0.906	D	0.94804	0.7973	10	0.66056	D	0.02	.	9.1672	0.37058	0.2364:0.2826:0.4811:0.0	.	96	Q8IY33	MILK2_HUMAN	F	96	ENSP00000297508:L96F	ENSP00000297508:L96F	L	-	3	2	MICALL2	1454828	0.994000	0.37717	0.999000	0.59377	0.927000	0.56198	0.267000	0.18552	0.227000	0.20999	0.394000	0.25966	TTG		0.662	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924		Missense_Mutation
WIPI2	26100	broad.mit.edu	37	7	5239271	5239271	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr7:5239271G>C	ENST00000288828.4	+	3	425	c.193G>C	c.(193-195)Gaa>Caa	p.E65Q	WIPI2_ENST00000404704.3_Missense_Mutation_p.E65Q|WIPI2_ENST00000382384.2_Missense_Mutation_p.E47Q|WIPI2_ENST00000485854.1_3'UTR|WIPI2_ENST00000401525.3_Missense_Mutation_p.E47Q	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	65					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.E65Q(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		GGATAAGCTGGAACAGATCTA	0.338																																																1	Substitution - Missense(1)	ovary(1)	7											195.0	189.0	191.0					7																	5239271		2203	4300	6503	5205797	SO:0001583	missense	26100				CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.193G>C	7.37:g.5239271G>C	ENSP00000288828:p.Glu65Gln	Unknown		x	x	x	5205797	B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Missense_Mutation	SNP	ENST00000288828.4	37	CCDS5339.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	16.27	3.077273	0.55753	.	.	ENSG00000157954	ENST00000288828;ENST00000401525;ENST00000404704;ENST00000382384	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.65	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.104270	0.64402	D	0.000004	T	0.72534	0.3472	M	0.62266	1.93	0.80722	D	1	D;B;B;B	0.60160	0.987;0.125;0.125;0.157	P;B;B;B	0.57371	0.819;0.138;0.138;0.066	T	0.74203	-0.3741	10	0.45353	T	0.12	-16.6251	16.0954	0.81117	0.0:0.0:0.865:0.135	.	47;47;65;65	Q9Y4P8-2;Q9Y4P8-4;Q9Y4P8-6;Q9Y4P8	.;.;.;WIPI2_HUMAN	Q	65;47;65;47	ENSP00000288828:E65Q;ENSP00000384945:E47Q;ENSP00000385297:E65Q;ENSP00000371821:E47Q	ENSP00000288828:E65Q	E	+	1	0	WIPI2	5205797	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.671000	0.91174	1.524000	0.49035	0.650000	0.86243	GAA		0.338	WIPI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241669.2	NM_015610		Missense_Mutation
OGDH	4967	broad.mit.edu	37	7	44737812	44737812	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr7:44737812C>A	ENST00000222673.5	+	18	2422	c.2380C>A	c.(2380-2382)Cgc>Agc	p.R794S	OGDH_ENST00000449767.1_Missense_Mutation_p.R790S|OGDH_ENST00000444676.1_Missense_Mutation_p.R809S|OGDH_ENST00000439616.2_Missense_Mutation_p.R644S|OGDH_ENST00000543843.1_Missense_Mutation_p.R745S|OGDH_ENST00000447398.1_Missense_Mutation_p.R805S	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	794					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R794S(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	TTCCTCCGCCCGCCCAGAGCG	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											122.0	98.0	106.0					7																	44737812		2203	4300	6503	44704337	SO:0001583	missense	4967			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2380C>A	7.37:g.44737812C>A	ENSP00000222673:p.Arg794Ser	Unknown		x	x	x	44704337	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	37	CCDS34627.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176832	0.78564	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96	5.92	1.38	0.22167	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	H	0.96943	3.91	0.58432	D	0.999992	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	D	0.98323	1.0529	10	0.87932	D	0	-25.4671	18.8304	0.92137	0.2568:0.7432:0.0:0.0	.	589;644;790;805;794	B4E3E9;E9PFG7;E9PBM1;E9PDF2;Q02218	.;.;.;.;ODO1_HUMAN	S	644;790;805;809;794;745	ENSP00000398576:R644S;ENSP00000392878:R790S;ENSP00000388183:R805S;ENSP00000414662:R809S;ENSP00000222673:R794S;ENSP00000443821:R745S	ENSP00000222673:R794S	R	+	1	0	OGDH	44704337	0.663000	0.27448	0.995000	0.50966	0.999000	0.98932	0.594000	0.24014	0.007000	0.14760	0.655000	0.94253	CGC		0.557	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1			Missense_Mutation
UNC5D	137970	broad.mit.edu	37	8	35616908	35616908	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr8:35616908G>T	ENST00000404895.2	+	14	2562	c.2234G>T	c.(2233-2235)gGg>gTg	p.G745V	UNC5D_ENST00000416672.1_Missense_Mutation_p.G750V|UNC5D_ENST00000287272.2_Missense_Mutation_p.G676V|UNC5D_ENST00000449677.1_Missense_Mutation_p.G321V|UNC5D_ENST00000453357.2_Missense_Mutation_p.G740V|UNC5D_ENST00000420357.1_Missense_Mutation_p.G678V	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	745					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.G740V(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CATTTCAAAGGGAATACCTTT	0.418																																																1	Substitution - Missense(1)	ovary(1)	8											189.0	180.0	183.0					8																	35616908		2203	4300	6503	35736450	SO:0001583	missense	137970			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2234G>T	8.37:g.35616908G>T	ENSP00000385143:p.Gly745Val	Unknown		x	x	x	35736450	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338477	0.60963	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.56776	0.47;0.91;0.91;0.47;0.44;2.36	5.37	5.37	0.77165	.	0.095386	0.64402	D	0.000001	T	0.66982	0.2845	L	0.59436	1.845	0.80722	D	1	D;D;D	0.65815	0.995;0.983;0.995	P;P;P	0.57911	0.829;0.755;0.573	T	0.68842	-0.5302	10	0.66056	D	0.02	-23.6605	19.4816	0.95013	0.0:0.0:1.0:0.0	.	321;740;745	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	V	745;678;676;750;740;321	ENSP00000385143:G745V;ENSP00000392739:G678V;ENSP00000287272:G676V;ENSP00000412652:G750V;ENSP00000394303:G740V;ENSP00000397211:G321V	ENSP00000287272:G676V	G	+	2	0	UNC5D	35736450	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.984000	0.56923	2.667000	0.90743	0.561000	0.74099	GGG		0.418	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			Missense_Mutation
CHMP4C	92421	broad.mit.edu	37	8	82667605	82667605	+	Splice_Site	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr8:82667605G>A	ENST00000297265.4	+	3	562	c.369G>A	c.(367-369)atG>atA	p.M123I		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	123	Intramolecular interaction with C- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)	p.M123I(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						GATTTCCCAGGGATCTGAACA	0.308																																																1	Substitution - Missense(1)	ovary(1)	8											79.0	72.0	74.0					8																	82667605		2203	4299	6502	82830160	SO:0001630	splice_region_variant	92421			AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.369-1G>A	8.37:g.82667605G>A		Unknown		x	x	x	82830160	B2RBZ1	Missense_Mutation	SNP	ENST00000297265.4	37	CCDS6233.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622783	0.46840	.	.	ENSG00000164695	ENST00000297265	T	0.74106	-0.81	5.63	4.76	0.60689	.	0.070023	0.85682	D	0.000000	T	0.71392	0.3334	L	0.42744	1.35	0.80722	D	1	B	0.32382	0.368	B	0.40444	0.329	T	0.67440	-0.5670	9	.	.	.	.	14.5195	0.67842	0.0705:0.0:0.9295:0.0	.	123	Q96CF2	CHM4C_HUMAN	I	123	ENSP00000297265:M123I	.	M	+	3	0	CHMP4C	82830160	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	5.416000	0.66417	1.383000	0.46405	-0.229000	0.12294	ATG		0.308	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379927.1	NM_152284	Missense_Mutation	Missense_Mutation
VPS13B	157680	broad.mit.edu	37	8	100832313	100832313	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr8:100832313T>A	ENST00000358544.2	+	49	9143	c.9032T>A	c.(9031-9033)gTt>gAt	p.V3011D	VPS13B_ENST00000357162.2_Missense_Mutation_p.V2986D|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3011					protein transport (GO:0015031)			p.V3011D(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTTCTACAGGTTCCTGCTGGC	0.353																																					Colon(161;2205 2542 7338 31318)											1	Substitution - Missense(1)	ovary(1)	8											94.0	102.0	99.0					8																	100832313		2203	4300	6503	100901489	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9032T>A	8.37:g.100832313T>A	ENSP00000351346:p.Val3011Asp	Unknown		x	x	x	100901489	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008929	0.75046	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.80824	-1.42;-1.42	5.92	5.92	0.95590	.	0.138925	0.46442	D	0.000287	T	0.81805	0.4900	N	0.24115	0.695	0.80722	D	1	D;D	0.63880	0.993;0.979	P;P	0.59487	0.858;0.642	D	0.84607	0.0676	10	0.87932	D	0	.	16.3526	0.83220	0.0:0.0:0.0:1.0	.	2986;3011	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	D	2986;3011	ENSP00000349685:V2986D;ENSP00000351346:V3011D	ENSP00000349685:V2986D	V	+	2	0	VPS13B	100901489	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.289000	0.72696	2.255000	0.74692	0.533000	0.62120	GTT		0.353	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		Missense_Mutation
TOR4A	54863	broad.mit.edu	37	9	140173149	140173149	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr9:140173149G>A	ENST00000357503.2	+	2	204	c.8G>A	c.(7-9)cGc>cAc	p.R3H		NM_017723.2	NP_060193.2	Q9NXH8	TOR4A_HUMAN	torsin family 4, member A	3					chaperone mediated protein folding requiring cofactor (GO:0051085)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.R3H(1)									GACATGGACCGCGGCCAGCCC	0.756																																																1	Substitution - Missense(1)	ovary(1)	9											3.0	4.0	4.0					9																	140173149		1079	2406	3485	139292970	SO:0001583	missense	54863			AK023361	CCDS7041.1	9q34.3	2012-04-03	2012-04-03	2012-04-03	ENSG00000198113	ENSG00000198113			25981	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 167"""	C9orf167			Standard	NM_017723		Approved	FLJ20245	uc004cmn.3	Q9NXH8	OTTHUMG00000131779	ENST00000357503.2:c.8G>A	9.37:g.140173149G>A	ENSP00000350102:p.Arg3His	Unknown		x	x	x	139292970	A2BFA4	Missense_Mutation	SNP	ENST00000357503.2	37	CCDS7041.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598627	0.28445	.	.	ENSG00000198113	ENST00000357503	T	0.60672	0.17	3.67	-0.831	0.10789	.	1.955370	0.02700	U	0.111677	T	0.44850	0.1313	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.16482	-1.0401	10	0.49607	T	0.09	.	0.5086	0.00591	0.3296:0.1761:0.3148:0.1795	.	3	Q9NXH8	CI167_HUMAN	H	3	ENSP00000350102:R3H	ENSP00000350102:R3H	R	+	2	0	C9orf167	139292970	0.006000	0.16342	0.212000	0.23672	0.348000	0.29142	0.984000	0.29565	-0.417000	0.07461	-0.379000	0.06801	CGC		0.756	TOR4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254711.1	NM_017723		Missense_Mutation
CACNA1B	774	broad.mit.edu	37	9	140954191	140954191	+	Splice_Site	SNP	T	T	A			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chr9:140954191T>A	ENST00000371372.1	+	31	4813		c.e31+2		CACNA1B_ENST00000277549.5_Splice_Site|CACNA1B_ENST00000371355.4_Splice_Site|CACNA1B_ENST00000277551.2_Splice_Site|CACNA1B_ENST00000371363.1_Splice_Site|CACNA1B_ENST00000371357.1_Splice_Site	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit						calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.?(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGATTGCGGTAAGTAGCATT	0.468																																																1	Unknown(1)	ovary(1)	9											169.0	163.0	165.0					9																	140954191		1904	4117	6021	140074012	SO:0001630	splice_region_variant	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4668+2T>A	9.37:g.140954191T>A		Unknown		x	x	x	140074012	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	27.1	4.798799	0.90538	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9423	0.79768	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1B	140074012	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.884000	0.87274	2.231000	0.72958	0.454000	0.30748	.		0.468	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	Intron	Missense_Mutation
CXorf38	159013	broad.mit.edu	37	X	40496388	40496388	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chrX:40496388C>G	ENST00000327877.5	-	4	518	c.492G>C	c.(490-492)gaG>gaC	p.E164D	CXorf38_ENST00000440784.2_Missense_Mutation_p.E79D|CXorf38_ENST00000378421.1_Missense_Mutation_p.E45D|CXorf38_ENST00000378426.1_Missense_Mutation_p.E45D	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	164								p.E164D(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						AGTGCATGATCTCATTACGAC	0.348																																																1	Substitution - Missense(1)	ovary(1)	X											45.0	41.0	42.0					X																	40496388		2203	4298	6501	40381332	SO:0001583	missense	159013			AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.492G>C	X.37:g.40496388C>G	ENSP00000330488:p.Glu164Asp	Unknown		x	x	x	40381332	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	37	CCDS14253.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	9.350	1.065313	0.20067	.	.	ENSG00000185753	ENST00000378426;ENST00000327877;ENST00000378421;ENST00000440784	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	4.84	1.83	0.25207	.	0.227884	0.35151	N	0.003411	T	0.26557	0.0649	L	0.46157	1.445	0.80722	D	1	B;B	0.17465	0.022;0.006	B;B	0.17433	0.018;0.016	T	0.10177	-1.0641	10	0.22109	T	0.4	-20.0439	0.3578	0.00359	0.2014:0.323:0.1921:0.2835	.	79;164	E7EN46;Q8TB03	.;CX038_HUMAN	D	45;164;45;79	ENSP00000367683:E45D;ENSP00000330488:E164D;ENSP00000367677:E45D;ENSP00000400019:E79D	ENSP00000330488:E164D	E	-	3	2	CXorf38	40381332	0.846000	0.29590	0.997000	0.53966	0.743000	0.42351	-0.329000	0.07935	0.458000	0.26988	0.422000	0.28245	GAG		0.348	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970		Missense_Mutation
ZMYM3	9203	broad.mit.edu	37	X	70465872	70465872	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chrX:70465872G>T	ENST00000353904.2	-	16	2836	c.2649C>A	c.(2647-2649)tgC>tgA	p.C883*	ZMYM3_ENST00000373984.3_Nonsense_Mutation_p.C885*|ZMYM3_ENST00000373998.1_Nonsense_Mutation_p.C871*|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000314425.5_Nonsense_Mutation_p.C883*|ZMYM3_ENST00000373988.1_Nonsense_Mutation_p.C885*	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	883					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C883*(1)		breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GGACTTTCTGGCAGTACAGAT	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	X											129.0	105.0	113.0					X																	70465872		2203	4300	6503	70382597	SO:0001587	stop_gained	9203			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.2649C>A	X.37:g.70465872G>T	ENSP00000343909:p.Cys883*	Unknown		x	x	x	70382597	D3DVV3|O15089|Q96E26	Nonsense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	45	12.077040	0.99634	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	.	.	.	5.12	4.25	0.50352	.	0.145353	0.49916	D	0.000134	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-14.3745	9.2104	0.37316	0.1684:0.0:0.8316:0.0	.	.	.	.	X	883;871;883;885;885	.	ENSP00000322845:C883X	C	-	3	2	ZMYM3	70382597	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.403000	0.44530	1.147000	0.42369	0.525000	0.51046	TGC		0.562	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599		Nonsense_Mutation
POU3F4	5456	broad.mit.edu	37	X	82763969	82763969	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chrX:82763969G>T	ENST00000373200.2	+	1	701	c.637G>T	c.(637-639)Gcc>Tcc	p.A213S	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	213	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A213S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CTTCACGCAGGCCGACGTGGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	X											68.0	55.0	59.0					X																	82763969		2203	4300	6503	82650625	SO:0001583	missense	5456			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.637G>T	X.37:g.82763969G>T	ENSP00000362296:p.Ala213Ser	Unknown		x	x	x	82650625	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355440	0.82243	.	.	ENSG00000196767	ENST00000373200	D	0.84070	-1.8	4.99	4.99	0.66335	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.90017	0.6883	M	0.66439	2.03	0.80722	D	1	D	0.53619	0.961	D	0.69307	0.963	D	0.91255	0.5032	10	0.87932	D	0	.	17.333	0.87271	0.0:0.0:1.0:0.0	.	213	P49335	PO3F4_HUMAN	S	213	ENSP00000362296:A213S	ENSP00000362296:A213S	A	+	1	0	POU3F4	82650625	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.558000	0.98132	2.211000	0.71520	0.525000	0.51046	GCC		0.522	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		Missense_Mutation
NAA10	8260	broad.mit.edu	37	X	153195524	153195524	+	Missense_Mutation	SNP	G	G	T	rs553739759		TCGA-25-2404-01	TCGA-25-2404-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2404-01	TCGA-25-2404-10	g.chrX:153195524G>T	ENST00000464845.1	-	8	942	c.624C>A	c.(622-624)gaC>gaA	p.D208E	NAA10_ENST00000370009.1_Missense_Mutation_p.D193E|NAA10_ENST00000393712.3_3'UTR|NAA10_ENST00000393710.3_5'Flank|NAA10_ENST00000370015.4_3'UTR	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit	208					DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)	p.D208E(1)		breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						GGTCCTTGCTGTCCCCACCAC	0.617																																					Ovarian(94;1099 1433 38814 45882 51063)											1	Substitution - Missense(1)	ovary(1)	X											108.0	84.0	92.0					X																	153195524		2203	4300	6503	152848718	SO:0001583	missense	8260			BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.624C>A	X.37:g.153195524G>T	ENSP00000417763:p.Asp208Glu	Unknown		x	x	x	152848718	A6NM98	Missense_Mutation	SNP	ENST00000464845.1	37	CCDS14737.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162125	0.38217	.	.	ENSG00000102030	ENST00000464845;ENST00000370009	T;T	0.56941	0.43;0.44	5.35	4.49	0.54785	.	0.052011	0.85682	D	0.000000	T	0.33644	0.0870	N	0.19112	0.55	0.37546	D	0.918483	B;B	0.13594	0.008;0.008	B;B	0.11329	0.005;0.006	T	0.18587	-1.0332	10	0.20519	T	0.43	-39.9726	8.593	0.33699	0.1834:0.0:0.8166:0.0	.	193;208	A6NM98;P41227	.;NAA10_HUMAN	E	208;193	ENSP00000417763:D208E;ENSP00000359026:D193E	ENSP00000359026:D193E	D	-	3	2	NAA10	152848718	1.000000	0.71417	0.962000	0.40283	0.963000	0.63663	3.666000	0.54540	1.033000	0.39918	0.523000	0.50628	GAC		0.617	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061108.2	NM_003491		Missense_Mutation
