#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
RAP1GAP	5909	broad.mit.edu	37	1	21936632	21936632	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr1:21936632G>A	ENST00000374765.4	-	14	1180	c.980C>T	c.(979-981)cCt>cTt	p.P327L	RAP1GAP_ENST00000374761.2_Missense_Mutation_p.P358L|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.P391L|RAP1GAP_ENST00000374763.2_Missense_Mutation_p.P327L|RAP1GAP_ENST00000374757.3_5'Flank|RAP1GAP_ENST00000542643.2_Missense_Mutation_p.P327L	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	327	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)	p.P358L(1)|p.P327L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GGGGCCATCAGGGCCCCCGCC	0.652																																																2	Substitution - Missense(2)	ovary(2)	1											44.0	38.0	40.0					1																	21936632		2203	4300	6503	21809219	SO:0001583	missense	5909			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.980C>T	1.37:g.21936632G>A	ENSP00000363897:p.Pro327Leu	Unknown		x	x	x	21809219	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	ENST00000374765.4	37	CCDS218.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957060	0.73902	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3	5.62	5.62	0.85841	Rap/ran-GAP (2);	0.338213	0.31872	N	0.006935	D	0.85936	0.5813	N	0.04116	-0.275	0.58432	D	0.999995	B;B;B;B	0.12013	0.0;0.005;0.0;0.003	B;B;B;B	0.12837	0.001;0.007;0.003;0.008	T	0.81129	-0.1073	10	0.56958	D	0.05	-12.5829	17.5203	0.87784	0.0:0.0:1.0:0.0	.	327;327;357;327	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	L	391;358;327;327;357;327	ENSP00000290101:P391L;ENSP00000363893:P358L;ENSP00000441661:P327L;ENSP00000363897:P327L	ENSP00000290101:P391L	P	-	2	0	RAP1GAP	21809219	0.999000	0.42202	0.963000	0.40424	0.862000	0.49288	5.566000	0.67372	2.826000	0.97356	0.561000	0.74099	CCT		0.652	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885		Missense_Mutation
OR14C36	127066	broad.mit.edu	37	1	248512740	248512740	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr1:248512740A>C	ENST00000317861.1	+	1	664	c.664A>C	c.(664-666)Acc>Ccc	p.T222P		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T222P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						CATCTTTTCGACCGTGCTCGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											192.0	153.0	166.0					1																	248512740		2203	4300	6503	246579363	SO:0001583	missense	127066			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.664A>C	1.37:g.248512740A>C	ENSP00000324534:p.Thr222Pro	Unknown		x	x	x	246579363	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	10.40	1.340763	0.24339	.	.	ENSG00000177174	ENST00000317861	T	0.00207	8.55	3.91	1.5	0.22942	GPCR, rhodopsin-like superfamily (1);	0.280955	0.25247	N	0.032051	T	0.00666	0.0022	H	0.95816	3.725	0.09310	N	1	D	0.64830	0.994	D	0.71656	0.974	T	0.30001	-0.9993	10	0.87932	D	0	.	7.3069	0.26453	0.6291:0.0:0.3709:0.0	.	222	Q8NHC7	O14CZ_HUMAN	P	222	ENSP00000324534:T222P	ENSP00000324534:T222P	T	+	1	0	OR14C36	246579363	0.000000	0.05858	0.648000	0.29521	0.068000	0.16541	-0.142000	0.10311	0.592000	0.29728	0.324000	0.21423	ACC		0.498	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		Missense_Mutation
NDST2	8509	broad.mit.edu	37	10	75566216	75566216	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr10:75566216G>A	ENST00000309979.6	-	6	1821	c.1265C>T	c.(1264-1266)aCg>aTg	p.T422M	RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.T422M|NDST2_ENST00000299641.4_Missense_Mutation_p.T299M			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	422	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)	p.T422M(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					CCCCAGGTCCGTGGGAATCCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	10											31.0	32.0	31.0					10																	75566216		2203	4300	6503	75236222	SO:0001583	missense	8509			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1265C>T	10.37:g.75566216G>A	ENSP00000310657:p.Thr422Met	Unknown		x	x	x	75236222	Q2TB32|Q59H89	Missense_Mutation	SNP	ENST00000309979.6	37	CCDS7335.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324976	0.60634	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.47177	1.15;0.85	5.64	5.64	0.86602	.	0.099887	0.64402	D	0.000002	T	0.65333	0.2681	M	0.75777	2.31	0.80722	D	1	D;D;D	0.59767	0.973;0.975;0.986	P;D;P	0.63113	0.885;0.911;0.833	T	0.67726	-0.5596	10	0.62326	D	0.03	.	12.9657	0.58483	0.0739:0.0:0.9261:0.0	.	299;92;422	B4E139;B4DQU1;P52849	.;.;NDST2_HUMAN	M	422;299	ENSP00000310657:T422M;ENSP00000299641:T299M	ENSP00000299641:T299M	T	-	2	0	NDST2	75236222	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.973000	0.63763	2.675000	0.91044	0.591000	0.81541	ACG		0.592	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635		Missense_Mutation
FAM45A	404636	broad.mit.edu	37	10	120892035	120892035	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr10:120892035G>A	ENST00000361432.2	+	8	837	c.811G>A	c.(811-813)Gca>Aca	p.A271T	FAM45A_ENST00000489988.1_3'UTR|FAM45A_ENST00000544016.1_Missense_Mutation_p.A120T|FAM45A_ENST00000535029.1_3'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	271								p.A271T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		AGAGGCCATGGCAATGGGCAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											210.0	215.0	213.0					10																	120892035		2203	4300	6503	120882025	SO:0001583	missense	404636			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.811G>A	10.37:g.120892035G>A	ENSP00000354688:p.Ala271Thr	Unknown		x	x	x	120882025	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	5.812	0.334107	0.11013	.	.	ENSG00000119979	ENST00000361432;ENST00000544016	.	.	.	5.65	1.91	0.25777	.	0.319926	0.38663	N	0.001601	T	0.10465	0.0256	N	0.02225	-0.63	0.31399	N	0.676868	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.001;0.002;0.001	T	0.35992	-0.9766	9	0.02654	T	1	.	5.5851	0.17269	0.7032:0.144:0.1527:0.0	.	198;120;263;271	B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6	.;.;.;FA45A_HUMAN	T	271;120	.	ENSP00000354688:A271T	A	+	1	0	FAM45A	120882025	1.000000	0.71417	0.955000	0.39395	0.987000	0.75469	1.539000	0.36104	0.067000	0.16545	-0.302000	0.09304	GCA		0.423	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009		Missense_Mutation
ERC1	23085	broad.mit.edu	37	12	1481109	1481109	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr12:1481109A>G	ENST00000397203.2	+	16	3297	c.2891A>G	c.(2890-2892)gAg>gGg	p.E964G	ERC1_ENST00000360905.4_Missense_Mutation_p.E964G|ERC1_ENST00000355446.5_Missense_Mutation_p.E964G|ERC1_ENST00000543086.3_Missense_Mutation_p.E936G|ERC1_ENST00000589028.1_Missense_Mutation_p.E964G|ERC1_ENST00000546231.2_Missense_Mutation_p.E968G			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	964					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)	p.E964G(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CTGAAGCGGGAGAAGGATCGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											50.0	52.0	52.0					12																	1481109		2203	4300	6503	1351370	SO:0001583	missense	23085			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2891A>G	12.37:g.1481109A>G	ENSP00000380386:p.Glu964Gly	Unknown		x	x	x	1351370	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	27.5	4.838529	0.91117	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.994;0.994;1.0	T	0.72478	-0.4281	10	0.59425	D	0.04	-26.7732	15.8423	0.78857	1.0:0.0:0.0:0.0	.	672;940;936;964	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	G	896;964;940;896;668;936;940;668;964;964;964;940;672	ENSP00000340054:E896G;ENSP00000380386:E964G;ENSP00000438546:E936G;ENSP00000442976:E668G;ENSP00000347621:E964G;ENSP00000354158:E964G;ENSP00000410064:E940G	ENSP00000299183:E668G	E	+	2	0	ERC1	1351370	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.339000	0.96797	2.134000	0.65973	0.533000	0.62120	GAG		0.507	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064		Missense_Mutation
PLEKHG6	55200	broad.mit.edu	37	12	6424758	6424758	+	Silent	SNP	G	G	A			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr12:6424758G>A	ENST00000396988.3	+	5	728	c.498G>A	c.(496-498)ctG>ctA	p.L166L	PLEKHG6_ENST00000011684.7_Silent_p.L166L|PLEKHG6_ENST00000449001.2_Silent_p.L134L|PLEKHG6_ENST00000536531.1_Silent_p.L166L	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	166	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L166L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						AGGAGGCCCTGTGGGAGCTCC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	12											42.0	43.0	43.0					12																	6424758		2203	4300	6503	6295019	SO:0001819	synonymous_variant	55200			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.498G>A	12.37:g.6424758G>A		Unknown		x	x	x	6295019	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Silent	SNP	ENST00000396988.3	37	CCDS8541.1	SNP	48	Broad																																																																																				0.582	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1	NM_018173		Silent
CDKN1B	1027	broad.mit.edu	37	12	12871005	12871005	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr12:12871005G>A	ENST00000228872.4	+	1	948	c.232G>A	c.(232-234)Gag>Aag	p.E78K	CDKN1B_ENST00000396340.1_Missense_Mutation_p.E78K|CDKN1B_ENST00000477087.1_Intron	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	78					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.E78K(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		CGAGTGGCAAGAGGTGGAGAA	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											76.0	86.0	82.0					12																	12871005		2203	4300	6503	12762272	SO:0001583	missense	1027			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.232G>A	12.37:g.12871005G>A	ENSP00000228872:p.Glu78Lys	Unknown		x	x	x	12762272	Q16307|Q5U0H2|Q9BUS6	Missense_Mutation	SNP	ENST00000228872.4	37	CCDS8653.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108103	0.37242	.	.	ENSG00000111276	ENST00000228872;ENST00000535674;ENST00000396340	D;D	0.83335	-1.71;-1.71	5.4	4.49	0.54785	.	0.327017	0.29280	N	0.012602	T	0.65004	0.2650	N	0.10733	0.035	0.30028	N	0.813755	P	0.35124	0.485	B	0.36922	0.236	T	0.60342	-0.7282	10	0.08837	T	0.75	-22.9136	11.439	0.50086	0.0:0.1619:0.7193:0.1187	.	78	P46527	CDN1B_HUMAN	K	78;27;78	ENSP00000228872:E78K;ENSP00000379629:E78K	ENSP00000228872:E78K	E	+	1	0	CDKN1B	12762272	0.995000	0.38212	0.990000	0.47175	0.998000	0.95712	2.443000	0.44881	2.536000	0.85505	0.650000	0.86243	GAG		0.592	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064		Missense_Mutation
TEX26	122046	broad.mit.edu	37	13	31540436	31540436	+	Nonsense_Mutation	SNP	C	C	T	rs193234818	byFrequency	TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr13:31540436C>T	ENST00000380473.3	+	5	560	c.547C>T	c.(547-549)Cga>Tga	p.R183*	TEX26_ENST00000530916.1_Intron	NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	183								p.R183*(2)									CACTGAATTCCGAAGGAATTA	0.423													C|||	3	0.000599042	0.0	0.0014	5008	,	,		17160	0.0		0.0	False		,,,				2504	0.002															2	Substitution - Nonsense(2)	ovary(1)|lung(1)	13											80.0	77.0	78.0					13																	31540436		2203	4300	6503	30438436	SO:0001587	stop_gained	122046			BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.547C>T	13.37:g.31540436C>T	ENSP00000369840:p.Arg183*	Unknown		x	x	x	30438436		Nonsense_Mutation	SNP	ENST00000380473.3	37	CCDS9339.1	SNP	23	Broad	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	25.2	4.615390	0.87359	.	.	ENSG00000175664	ENST00000380473	.	.	.	5.41	3.58	0.41010	.	0.100459	0.42821	D	0.000658	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9032	7.5701	0.27902	0.1625:0.7485:0.0:0.089	.	.	.	.	X	183	.	ENSP00000369840:R183X	R	+	1	2	C13orf26	30438436	1.000000	0.71417	0.988000	0.46212	0.709000	0.40893	1.359000	0.34113	1.410000	0.46936	0.650000	0.86243	CGA		0.423	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325		Nonsense_Mutation
UACA	55075	broad.mit.edu	37	15	70959967	70959967	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr15:70959967C>G	ENST00000322954.6	-	16	3241	c.3056G>C	c.(3055-3057)aGt>aCt	p.S1019T	UACA_ENST00000560441.1_Missense_Mutation_p.S1004T|UACA_ENST00000539319.1_Missense_Mutation_p.S910T|UACA_ENST00000379983.2_Missense_Mutation_p.S1006T	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1019					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.S1006T(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTCTTCTTCACTGACACTATA	0.373																																																1	Substitution - Missense(1)	ovary(1)	15											104.0	97.0	100.0					15																	70959967		2199	4297	6496	68747021	SO:0001583	missense	55075			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3056G>C	15.37:g.70959967C>G	ENSP00000314556:p.Ser1019Thr	Unknown		x	x	x	68747021	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.245510	0.01481	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.33865	1.39;1.4;1.87	5.82	3.94	0.45596	.	0.499227	0.21524	N	0.073169	T	0.25717	0.0626	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.09377	0.002;0.001;0.001;0.004	T	0.20505	-1.0273	10	0.14252	T	0.57	-4.4818	10.3516	0.43939	0.0:0.791:0.0:0.209	.	910;1019;1019;1006	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	T	1019;1006;910	ENSP00000314556:S1019T;ENSP00000369319:S1006T;ENSP00000438667:S910T	ENSP00000314556:S1019T	S	-	2	0	UACA	68747021	0.000000	0.05858	0.042000	0.18584	0.082000	0.17680	0.130000	0.15850	0.810000	0.34279	0.561000	0.74099	AGT		0.373	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			Missense_Mutation
EFCAB5	374786	broad.mit.edu	37	17	28417568	28417568	+	Silent	SNP	C	C	A			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr17:28417568C>A	ENST00000394835.3	+	20	4005	c.3813C>A	c.(3811-3813)ggC>ggA	p.G1271G	RP11-1148O4.2_ENST00000582938.1_RNA|EFCAB5_ENST00000320856.5_Silent_p.G1147G|EFCAB5_ENST00000394832.2_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	1271							calcium ion binding (GO:0005509)	p.G1271G(1)		breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TTAACATCGGCCAAAATAGGA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	17											140.0	137.0	138.0					17																	28417568		1851	4094	5945	25441694	SO:0001819	synonymous_variant	374786			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.3813C>A	17.37:g.28417568C>A		Unknown		x	x	x	25441694	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	ENST00000394835.3	37	CCDS11254.2	SNP	26	Broad																																																																																				0.443	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529		Silent
KCNH6	81033	broad.mit.edu	37	17	61623121	61623121	+	Missense_Mutation	SNP	C	C	T	rs576892047		TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr17:61623121C>T	ENST00000583023.1	+	14	2854	c.2843C>T	c.(2842-2844)cCt>cTt	p.P948L	KCNH6_ENST00000581784.1_Missense_Mutation_p.P859L|KCNH6_ENST00000456941.2_Missense_Mutation_p.P859L|KCNH6_ENST00000314672.5_Missense_Mutation_p.P912L	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	948					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.P948L(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CTAGCCTCACCTCTACATCCC	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18129	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17											121.0	111.0	115.0					17																	61623121		2203	4300	6503	58976853	SO:0001583	missense	81033			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2843C>T	17.37:g.61623121C>T	ENSP00000463533:p.Pro948Leu	Unknown		x	x	x	58976853	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	10.60	1.395572	0.25205	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99277	-5.67	4.84	3.86	0.44501	.	0.527164	0.15422	N	0.263174	D	0.97093	0.9050	L	0.44542	1.39	0.42608	D	0.993301	B;B;B;B	0.33583	0.181;0.181;0.277;0.418	B;B;B;B	0.27380	0.051;0.054;0.079;0.069	D	0.96531	0.9393	10	0.41790	T	0.15	.	9.2975	0.37824	0.0:0.8383:0.0:0.1617	.	789;912;859;948	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	L	948;859	ENSP00000396900:P859L	ENSP00000318212:P948L	P	+	2	0	KCNH6	58976853	0.944000	0.32072	0.204000	0.23530	0.046000	0.14306	1.872000	0.39549	2.371000	0.80710	0.563000	0.77884	CCT		0.587	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779		Missense_Mutation
ABCA9	10350	broad.mit.edu	37	17	67028402	67028402	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr17:67028402C>T	ENST00000340001.4	-	10	1503	c.1292G>A	c.(1291-1293)cGa>cAa	p.R431Q	ABCA9_ENST00000370732.2_Missense_Mutation_p.R431Q|ABCA9_ENST00000453985.2_Missense_Mutation_p.R431Q	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	431					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R431Q(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGGAGAACATCGATGTCCATA	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											90.0	74.0	79.0					17																	67028402		2203	4300	6503	64539997	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1292G>A	17.37:g.67028402C>T	ENSP00000342216:p.Arg431Gln	Unknown		x	x	x	64539997	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584033	0.46110	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.88509	-2.21;-2.39	5.05	-2.27	0.06846	.	0.824963	0.09988	N	0.730167	T	0.77772	0.4180	L	0.28014	0.82	0.09310	N	1	B;B	0.23442	0.085;0.025	B;B	0.15870	0.014;0.01	T	0.60596	-0.7232	10	0.23302	T	0.38	.	7.561	0.27851	0.0:0.437:0.1092:0.4538	.	431;431	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	Q	431;414;431;426	ENSP00000342216:R431Q;ENSP00000359767:R431Q	ENSP00000342216:R431Q	R	-	2	0	ABCA9	64539997	0.000000	0.05858	0.001000	0.08648	0.675000	0.39556	-0.903000	0.04084	-0.277000	0.09193	0.609000	0.83330	CGA		0.438	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		Missense_Mutation
PRR19	284338	broad.mit.edu	37	19	42814000	42814000	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr19:42814000G>C	ENST00000499536.2	+	1	1075	c.264G>C	c.(262-264)agG>agC	p.R88S	PRR19_ENST00000341747.3_Missense_Mutation_p.R88S|PRR19_ENST00000598490.1_Missense_Mutation_p.R88S			A6NJB7	PRR19_HUMAN	proline rich 19	88								p.R88S(1)		NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				ATGTTGCAAGGCTGCTTAGCA	0.662																																																1	Substitution - Missense(1)	ovary(1)	19											69.0	83.0	78.0					19																	42814000		2203	4300	6503	47505840	SO:0001583	missense	284338			AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.264G>C	19.37:g.42814000G>C	ENSP00000445247:p.Arg88Ser	Unknown		x	x	x	47505840	A8K663|B3KW48|Q6P584	Missense_Mutation	SNP	ENST00000499536.2	37	CCDS33036.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310006	0.60414	.	.	ENSG00000188368	ENST00000341747;ENST00000499536	.	.	.	4.58	1.15	0.20763	.	0.000000	0.40222	N	0.001150	T	0.49167	0.1541	L	0.34521	1.04	0.32936	D	0.517809	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.57075	-0.7873	9	0.87932	D	0	0.0026	3.8929	0.09127	0.2216:0.2037:0.5747:0.0	.	88;88	A6NJB7;A6NJB7-2	PRR19_HUMAN;.	S	88	.	ENSP00000342709:R88S	R	+	3	2	PRR19	47505840	0.981000	0.34729	1.000000	0.80357	0.824000	0.46624	0.032000	0.13732	0.575000	0.29434	0.650000	0.86243	AGG		0.662	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285		Missense_Mutation
HES1	3280	broad.mit.edu	37	3	193855991	193855991	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr3:193855991C>T	ENST00000232424.3	+	4	1048	c.812C>T	c.(811-813)gCg>gTg	p.A271V		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)		p.A271V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		TCGCTTACGGCGGACTCCATG	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											15.0	17.0	16.0					3																	193855991		2191	4280	6471	195338685	SO:0001583	missense	3280			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.812C>T	3.37:g.193855991C>T	ENSP00000232424:p.Ala271Val	Unknown		x	x	x	195338685	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000232424.3	37	CCDS3305.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224069	0.58668	.	.	ENSG00000114315	ENST00000232424	T	0.60171	0.21	5.39	5.39	0.77823	.	0.583143	0.16604	N	0.207201	T	0.45935	0.1367	L	0.34521	1.04	0.36934	D	0.892057	P	0.36412	0.552	B	0.24006	0.05	T	0.54430	-0.8295	10	0.39692	T	0.17	-27.0657	18.5087	0.90907	0.0:1.0:0.0:0.0	.	271	Q14469	HES1_HUMAN	V	271	ENSP00000232424:A271V	ENSP00000232424:A271V	A	+	2	0	HES1	195338685	0.952000	0.32445	0.999000	0.59377	0.992000	0.81027	4.271000	0.58902	2.682000	0.91365	0.655000	0.94253	GCG		0.657	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342632.1			Missense_Mutation
RICTOR	253260	broad.mit.edu	37	5	38952518	38952518	+	Silent	SNP	T	T	C			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr5:38952518T>C	ENST00000357387.3	-	30	2937	c.2907A>G	c.(2905-2907)gtA>gtG	p.V969V	RICTOR_ENST00000296782.5_Silent_p.V969V|RICTOR_ENST00000503698.1_5'Flank	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.V969V(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CAAGTACATATACACAGGTCC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	5											61.0	62.0	62.0					5																	38952518		2203	4298	6501	38988275	SO:0001819	synonymous_variant	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2907A>G	5.37:g.38952518T>C		Unknown		x	x	x	38988275		Silent	SNP	ENST00000357387.3	37	CCDS34148.1	SNP	49	Broad																																																																																				0.378	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		Silent
PHF3	23469	broad.mit.edu	37	6	64416112	64416112	+	Silent	SNP	A	A	T			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr6:64416112A>T	ENST00000262043.3	+	12	3901	c.3561A>T	c.(3559-3561)ccA>ccT	p.P1187P	PHF3_ENST00000393387.1_Silent_p.P1187P			Q92576	PHF3_HUMAN	PHD finger protein 3	1187					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P1187P(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CTCCTGCTCCACGGTAATTTT	0.368																																					GBM(135;136 1820 29512 34071 46235)											1	Substitution - coding silent(1)	ovary(1)	6											55.0	52.0	53.0					6																	64416112		2203	4300	6503	64474071	SO:0001819	synonymous_variant	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.3561A>T	6.37:g.64416112A>T		Unknown		x	x	x	64474071	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Silent	SNP	ENST00000262043.3	37	CCDS4966.1	SNP	6	Broad																																																																																				0.368	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2			Silent
AIM1	202	broad.mit.edu	37	6	106968265	106968265	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2408-01	TCGA-25-2408-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-25-2408-01	TCGA-25-2408-10	g.chr6:106968265C>G	ENST00000369066.3	+	2	2445	c.1958C>G	c.(1957-1959)cCc>cGc	p.P653R		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.P653R(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ACCAACTCTCCCAGCAGCGGA	0.517																																																1	Substitution - Missense(1)	ovary(1)	6											54.0	52.0	53.0					6																	106968265		2203	4300	6503	107074958	SO:0001583	missense	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1958C>G	6.37:g.106968265C>G	ENSP00000358062:p.Pro653Arg	Unknown		x	x	x	107074958	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773998	0.49786	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.73152	-0.72	5.0	3.11	0.35812	.	0.095212	0.37857	N	0.001908	T	0.41673	0.1169	L	0.59436	1.845	0.22737	N	0.998792	P	0.40875	0.731	B	0.36719	0.231	T	0.19778	-1.0295	10	0.18710	T	0.47	.	6.6154	0.22774	0.1807:0.7213:0.0:0.0979	.	653	Q9Y4K1	AIM1_HUMAN	R	1061;653	ENSP00000358062:P653R	ENSP00000285105:P1061R	P	+	2	0	AIM1	107074958	0.001000	0.12720	0.247000	0.24249	0.093000	0.18481	0.860000	0.27871	2.325000	0.78763	0.655000	0.94253	CCC		0.517	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			Missense_Mutation
