#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SMAP2	64744	broad.mit.edu	37	1	40878768	40878768	+	Silent	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:40878768G>A	ENST00000539317.1	+	5	436	c.243G>A	c.(241-243)gtG>gtA	p.V81V		NM_001198980.1	NP_001185909.1	Q8WU79	SMAP2_HUMAN	small ArfGAP2	161	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.V161V(1)		central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			TTGAGAAGGTGAAAATGGTAA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	1											87.0	85.0	86.0					1																	40878768		2203	4300	6503	40651355	SO:0001819	synonymous_variant	64744			AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	ENST00000539317.1:c.243G>A	1.37:g.40878768G>A		Unknown		x	x	x	40651355	B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Silent	SNP	ENST00000539317.1	37	CCDS55593.1	SNP	45	Broad																																																																																				0.393	SMAP2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022733		Silent
KLF17	128209	broad.mit.edu	37	1	44595154	44595154	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:44595154C>A	ENST00000372299.3	+	2	269	c.211C>A	c.(211-213)Cct>Act	p.P71T	KLF17_ENST00000476802.1_3'UTR	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	71					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P71T(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					GCTGGGGTCCCCTTTGGTGTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											69.0	64.0	66.0					1																	44595154		2203	4300	6503	44367741	SO:0001583	missense	128209			BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.211C>A	1.37:g.44595154C>A	ENSP00000361373:p.Pro71Thr	Unknown		x	x	x	44367741	Q86VQ7|Q8N805	Missense_Mutation	SNP	ENST00000372299.3	37	CCDS508.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441683	0.43326	.	.	ENSG00000171872	ENST00000372299	T	0.08720	3.06	4.58	0.65	0.17812	.	0.514439	0.17000	N	0.190947	T	0.05868	0.0153	L	0.29908	0.895	0.09310	N	1	P	0.46912	0.886	B	0.42771	0.397	T	0.39583	-0.9607	10	0.19147	T	0.46	.	7.1348	0.25523	0.0:0.6469:0.0:0.3531	.	71	Q5JT82	KLF17_HUMAN	T	71	ENSP00000361373:P71T	ENSP00000361373:P71T	P	+	1	0	KLF17	44367741	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-0.101000	0.10973	0.133000	0.18654	0.650000	0.86243	CCT		0.567	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026646.1	NM_173484		Missense_Mutation
BCAN	63827	broad.mit.edu	37	1	156621440	156621440	+	Missense_Mutation	SNP	C	C	G	rs564111183		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:156621440C>G	ENST00000329117.5	+	7	1592	c.1256C>G	c.(1255-1257)tCc>tGc	p.S419C	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.S419C	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	419	Glu-rich.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.S419C(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGTGGAAGCTCCACTCCAGAA	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	87.0	87.0					1																	156621440		2203	4300	6503	154888064	SO:0001583	missense	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1256C>G	1.37:g.156621440C>G	ENSP00000331210:p.Ser419Cys	Unknown		x	x	x	154888064	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875448	0.72180	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.16324	2.35;3.04	4.84	4.84	0.62591	.	0.129993	0.33217	N	0.005147	T	0.14227	0.0344	L	0.32530	0.975	0.35026	D	0.758351	D;D	0.58970	0.979;0.984	P;P	0.53360	0.514;0.724	T	0.01276	-1.1398	10	0.52906	T	0.07	-24.575	14.7943	0.69865	0.0:1.0:0.0:0.0	.	419;419	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	C	358;419;419	ENSP00000331210:S419C;ENSP00000354925:S419C	ENSP00000255029:S358C	S	+	2	0	BCAN	154888064	0.936000	0.31750	1.000000	0.80357	0.982000	0.71751	2.121000	0.41977	2.509000	0.84616	0.655000	0.94253	TCC		0.567	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		Missense_Mutation
DUSP27	92235	broad.mit.edu	37	1	167096825	167096825	+	Silent	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:167096825C>A	ENST00000361200.2	+	6	2623	c.2457C>A	c.(2455-2457)acC>acA	p.T819T	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Silent_p.T819T|DUSP27_ENST00000271385.5_Silent_p.T819T			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	819					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.T819T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TGAGGGGGACCAGCAAGCCCA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	1											88.0	81.0	84.0					1																	167096825		2203	4300	6503	165363449	SO:0001819	synonymous_variant	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2457C>A	1.37:g.167096825C>A		Unknown		x	x	x	165363449	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1	SNP	21	Broad																																																																																				0.547	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		Silent
MYOC	4653	broad.mit.edu	37	1	171605462	171605462	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:171605462C>A	ENST00000037502.6	-	3	1189	c.1118G>T	c.(1117-1119)tGg>tTg	p.W373L		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	373	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)	p.W373L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GTAGCCACCCCAAGAATACGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	87.0	88.0					1																	171605462		2203	4300	6503	169872085	SO:0001583	missense	4653			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1118G>T	1.37:g.171605462C>A	ENSP00000037502:p.Trp373Leu	Unknown		x	x	x	169872085	B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	37	CCDS1297.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220746	0.79464	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591	D	0.88509	-2.39	5.46	5.46	0.80206	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.93494	0.7924	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93727	0.7038	10	0.87932	D	0	.	18.2451	0.89982	0.0:1.0:0.0:0.0	.	315;373	B4DV44;Q99972	.;MYOC_HUMAN	L	373;326;306	ENSP00000037502:W373L	ENSP00000037502:W373L	W	-	2	0	MYOC	169872085	1.000000	0.71417	0.997000	0.53966	0.553000	0.35397	7.734000	0.84928	2.719000	0.93026	0.555000	0.69702	TGG		0.522	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261		Missense_Mutation
IL24	11009	broad.mit.edu	37	1	207075388	207075388	+	Missense_Mutation	SNP	T	T	A	rs79685336		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:207075388T>A	ENST00000294984.2	+	6	782	c.508T>A	c.(508-510)Ttt>Att	p.F170I	FAIM3_ENST00000528654.1_5'Flank|IL24_ENST00000367093.3_Missense_Mutation_p.F118I|IL24_ENST00000491169.1_3'UTR|IL24_ENST00000391929.3_Missense_Mutation_p.F171I	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	170					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)		p.F170I(1)		endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					ACACAGGCGGTTTCTGCTATT	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	98.0	98.0					1																	207075388		2203	4300	6503	205142011	SO:0001583	missense	11009			U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.508T>A	1.37:g.207075388T>A	ENSP00000294984:p.Phe170Ile	Unknown		x	x	x	205142011	Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Missense_Mutation	SNP	ENST00000294984.2	37	CCDS1471.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	16.80	3.222754	0.58668	.	.	ENSG00000162892	ENST00000391929;ENST00000294984;ENST00000367093	T;T;T	0.16457	2.34;2.34;2.34	4.86	4.86	0.63082	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.236326	0.36628	N	0.002497	T	0.38188	0.1031	.	.	.	0.41420	D	0.987791	D;D;D	0.89917	1.0;0.997;0.997	D;D;D	0.87578	0.998;0.96;0.96	T	0.13255	-1.0516	9	0.44086	T	0.13	.	10.8091	0.46535	0.0:0.0:0.0:1.0	.	118;171;170	Q2YHE5;Q53XZ7;Q13007	.;.;IL24_HUMAN	I	171;170;118	ENSP00000375795:F171I;ENSP00000294984:F170I;ENSP00000356060:F118I	ENSP00000294984:F170I	F	+	1	0	IL24	205142011	0.996000	0.38824	0.734000	0.30879	0.154000	0.21943	3.218000	0.51192	2.054000	0.61138	0.533000	0.62120	TTT		0.468	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088680.2	NM_006850		Missense_Mutation
YOD1	55432	broad.mit.edu	37	1	207222580	207222580	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:207222580G>T	ENST00000315927.4	-	2	878	c.832C>A	c.(832-834)Cca>Aca	p.P278T	YOD1_ENST00000391927.1_Missense_Mutation_p.P234T|PFKFB2_ENST00000411990.2_5'Flank|YOD1_ENST00000367084.1_Missense_Mutation_p.P234T	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	278					cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.P278T(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					GGTGTATCTGGATCAGGGAAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											194.0	189.0	191.0					1																	207222580		2203	4300	6503	205289203	SO:0001583	missense	55432				CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.832C>A	1.37:g.207222580G>T	ENSP00000326813:p.Pro278Thr	Unknown		x	x	x	205289203	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	ENST00000315927.4	37	CCDS31002.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080350	0.36662	.	.	ENSG00000180667	ENST00000367084;ENST00000315927;ENST00000391927	.	.	.	6.17	6.17	0.99709	.	0.201722	0.52532	D	0.000077	T	0.47637	0.1456	L	0.42245	1.32	0.44627	D	0.997607	P;P	0.45126	0.617;0.851	B;B	0.41946	0.242;0.371	T	0.48175	-0.9058	9	0.54805	T	0.06	-23.233	12.9895	0.58610	0.0801:0.0:0.9199:0.0	.	234;278	Q5VVQ6-2;Q5VVQ6	.;OTU1_HUMAN	T	234;278;234	.	ENSP00000326813:P278T	P	-	1	0	YOD1	205289203	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.324000	0.65863	2.941000	0.99782	0.655000	0.94253	CCA		0.408	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566		Missense_Mutation
YOD1	55432	broad.mit.edu	37	1	207224218	207224218	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:207224218G>C	ENST00000315927.4	-	1	204	c.158C>G	c.(157-159)gCc>gGc	p.A53G	YOD1_ENST00000391927.1_Intron|PFKFB2_ENST00000411990.2_Intron|PFKFB2_ENST00000367080.3_5'Flank|PFKFB2_ENST00000367079.2_5'Flank|YOD1_ENST00000367084.1_Intron	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	53	UBX-like.				cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.A53G(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					GCCGTCCTTGGCCTTGCAGCG	0.716																																																1	Substitution - Missense(1)	ovary(1)	1											10.0	13.0	12.0					1																	207224218		2186	4272	6458	205290841	SO:0001583	missense	55432				CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.158C>G	1.37:g.207224218G>C	ENSP00000326813:p.Ala53Gly	Unknown		x	x	x	205290841	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	ENST00000315927.4	37	CCDS31002.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631553	0.87660	.	.	ENSG00000180667	ENST00000315927	.	.	.	5.56	5.56	0.83823	.	0.105646	0.64402	D	0.000003	T	0.39279	0.1072	N	0.26042	0.785	0.80722	D	1	P	0.49090	0.919	B	0.37015	0.239	T	0.25641	-1.0126	8	.	.	.	-11.6919	18.0826	0.89445	0.0:0.0:1.0:0.0	.	53	Q5VVQ6	OTU1_HUMAN	G	53	.	.	A	-	2	0	YOD1	205290841	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.554000	0.73923	2.600000	0.87896	0.563000	0.77884	GCC		0.716	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566		Missense_Mutation
RYR2	6262	broad.mit.edu	37	1	237880587	237880587	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr1:237880587G>C	ENST00000366574.2	+	72	10730	c.10413G>C	c.(10411-10413)aaG>aaC	p.K3471N	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.K3469N|RYR2_ENST00000542537.1_Missense_Mutation_p.K3455N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3471					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.K3469N(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGCTCTGAAGCGGTTACTGC	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											85.0	89.0	87.0					1																	237880587		1911	4115	6026	235947210	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10413G>C	1.37:g.237880587G>C	ENSP00000355533:p.Lys3471Asn	Unknown		x	x	x	235947210	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109218	0.37242	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.98666	-0.23;-5.06;-0.23	5.34	3.47	0.39725	.	0.000000	0.64402	D	0.000006	D	0.98343	0.9450	M	0.88241	2.94	0.80722	D	1	P	0.49696	0.927	P	0.48488	0.579	D	0.97496	1.0057	10	0.87932	D	0	-16.0255	8.3499	0.32297	0.2982:0.0:0.7018:0.0	.	3471	Q92736	RYR2_HUMAN	N	3471;3469;3455;426	ENSP00000355533:K3471N;ENSP00000353174:K3469N;ENSP00000443798:K3455N	ENSP00000353174:K3469N	K	+	3	2	RYR2	235947210	1.000000	0.71417	0.989000	0.46669	0.068000	0.16541	2.000000	0.40816	0.749000	0.32854	0.655000	0.94253	AAG		0.488	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
UNC5B	219699	broad.mit.edu	37	10	73047481	73047481	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr10:73047481G>A	ENST00000335350.6	+	6	1276	c.860G>A	c.(859-861)gGc>gAc	p.G287D	UNC5B_ENST00000373192.4_Missense_Mutation_p.G287D	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	287	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.G287D(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						TTCTGCGAGGGCCAGGCATTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	10											67.0	63.0	64.0					10																	73047481		2203	4300	6503	72717487	SO:0001583	missense	219699			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.860G>A	10.37:g.73047481G>A	ENSP00000334329:p.Gly287Asp	Unknown		x	x	x	72717487	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	26.8	4.768989	0.90020	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.22134	1.97;1.97	4.88	3.97	0.46021	.	0.054132	0.85682	N	0.000000	T	0.58566	0.2131	H	0.96269	3.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71915	-0.4448	10	0.87932	D	0	-33.0159	13.0087	0.58720	0.0783:0.0:0.9217:0.0	.	287;287	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	D	287	ENSP00000334329:G287D;ENSP00000362288:G287D	ENSP00000334329:G287D	G	+	2	0	UNC5B	72717487	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.856000	0.99531	1.061000	0.40601	0.537000	0.68136	GGC		0.647	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		Missense_Mutation
CFAP58	159686	broad.mit.edu	37	10	106152147	106152147	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr10:106152147G>T	ENST00000369704.3	+	10	1656	c.1522G>T	c.(1522-1524)Gct>Tct	p.A508S		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		508						extracellular space (GO:0005615)		p.A508S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TCTGGTTGAGGCTCAGGTAAA	0.294																																																1	Substitution - Missense(1)	ovary(1)	10											37.0	42.0	41.0					10																	106152147		2200	4293	6493	106142137	SO:0001583	missense	159686																														ENST00000369704.3:c.1522G>T	10.37:g.106152147G>T	ENSP00000358718:p.Ala508Ser	Unknown		x	x	x	106142137	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	CCDS31282.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554262	0.65425	.	.	ENSG00000120051	ENST00000369704	T	0.39406	1.08	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	L	0.33137	0.985	0.80722	D	1	B	0.25521	0.128	B	0.31390	0.129	T	0.14448	-1.0472	10	0.10111	T	0.7	-8.0472	19.8101	0.96543	0.0:0.0:1.0:0.0	.	508	Q5T655	CC147_HUMAN	S	508	ENSP00000358718:A508S	ENSP00000358718:A508S	A	+	1	0	CCDC147	106142137	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.408000	0.73285	2.696000	0.92011	0.655000	0.94253	GCT		0.294	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1			Missense_Mutation
PAOX	196743	broad.mit.edu	37	10	135193944	135193944	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr10:135193944T>C	ENST00000278060.5	+	2	706	c.623T>C	c.(622-624)tTt>tCt	p.F208S	AL360181.1_ENST00000597657.1_5'Flank|PAOX_ENST00000357296.3_Missense_Mutation_p.F208S|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000368539.4_Intron|PAOX_ENST00000480071.2_Missense_Mutation_p.F208S	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	346					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.F208S(2)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CTGGCACCCTTTGGGGAGTAT	0.642																																																2	Substitution - Missense(2)	ovary(2)	10											30.0	35.0	33.0					10																	135193944		2200	4299	6499	135043934	SO:0001583	missense	196743			BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.623T>C	10.37:g.135193944T>C	ENSP00000278060:p.Phe208Ser	Unknown		x	x	x	135043934	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Missense_Mutation	SNP	ENST00000278060.5	37	CCDS7683.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	15.11	2.735981	0.49045	.	.	ENSG00000148832	ENST00000368542;ENST00000278060;ENST00000357296;ENST00000480071	T;T;T	0.10477	2.87;2.87;2.87	4.74	4.74	0.60224	.	0.156736	0.56097	D	0.000028	T	0.24005	0.0581	M	0.62723	1.935	0.80722	D	1	D;D;D	0.69078	0.997;0.995;0.993	D;D;P	0.63113	0.911;0.911;0.854	T	0.00754	-1.1580	10	0.49607	T	0.09	-16.8962	8.6053	0.33769	0.0:0.0:0.1943:0.8057	.	208;208;208	Q6QHF9-5;Q6QHF9-4;Q6QHF9-2	.;.;.	S	208	ENSP00000278060:F208S;ENSP00000349847:F208S;ENSP00000435514:F208S	ENSP00000278060:F208S	F	+	2	0	PAOX	135043934	0.999000	0.42202	0.076000	0.20297	0.345000	0.29048	2.088000	0.41663	1.765000	0.52091	0.460000	0.39030	TTT		0.642	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	NM_152911		Missense_Mutation
LRRC4C	57689	broad.mit.edu	37	11	40136958	40136958	+	Silent	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr11:40136958C>T	ENST00000278198.2	-	2	2848	c.885G>A	c.(883-885)cgG>cgA	p.R295R	LRRC4C_ENST00000527150.1_Silent_p.R295R|LRRC4C_ENST00000528697.1_Silent_p.R295R|LRRC4C_ENST00000530763.1_Silent_p.R295R			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	295					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.R295R(2)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTAAATGTATCCGCTCTAGAT	0.473																																																2	Substitution - coding silent(2)	ovary(1)|skin(1)	11											193.0	156.0	169.0					11																	40136958		2203	4300	6503	40093534	SO:0001819	synonymous_variant	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.885G>A	11.37:g.40136958C>T		Unknown		x	x	x	40093534	A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	CCDS31464.1	SNP	30	Broad																																																																																				0.473	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		Silent
DDIAS	220042	broad.mit.edu	37	11	82644445	82644445	+	Missense_Mutation	SNP	A	A	T	rs201671760		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr11:82644445A>T	ENST00000533655.1	+	6	2277	c.2065A>T	c.(2065-2067)Att>Ttt	p.I689F	C11orf82_ENST00000329143.3_Missense_Mutation_p.I388F|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000430323.2_Missense_Mutation_p.I689F|C11orf82_ENST00000525361.1_Intron	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		689					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I689F(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						AGAAATGGACATTGCAACTGA	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											145.0	140.0	142.0					11																	82644445		2203	4300	6503	82322093	SO:0001583	missense	220042																														ENST00000533655.1:c.2065A>T	11.37:g.82644445A>T	ENSP00000435421:p.Ile689Phe	Unknown		x	x	x	82322093	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	37	CCDS8263.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	11.69	1.712687	0.30413	.	.	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.24908	2.13;2.13;1.83	5.31	-1.23	0.09465	.	1.011240	0.07925	N	0.976544	T	0.22003	0.0530	L	0.60455	1.87	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.31971	-0.9924	9	.	.	.	-9.0E-4	5.6537	0.17631	0.4829:0.0:0.3864:0.1307	.	689	Q8IXT1	NOXIN_HUMAN	F	689;689;388	ENSP00000414687:I689F;ENSP00000435421:I689F;ENSP00000329930:I388F	.	I	+	1	0	C11orf82	82322093	0.359000	0.24955	0.001000	0.08648	0.703000	0.40648	0.839000	0.27586	-0.278000	0.09180	0.528000	0.53228	ATT		0.363	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1			Missense_Mutation
CTSC	1075	broad.mit.edu	37	11	88042468	88042468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr11:88042468G>T	ENST00000227266.5	-	4	618	c.504C>A	c.(502-504)taC>taA	p.Y168*		NM_001814.4	NP_001805	P53634	CATC_HUMAN	cathepsin C	168					aging (GO:0007568)|immune response (GO:0006955)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of proteolysis involved in cellular protein catabolic process (GO:1903052)|proteolysis (GO:0006508)|response to organic substance (GO:0010033)|T cell mediated cytotoxicity (GO:0001913)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	chaperone binding (GO:0051087)|chloride ion binding (GO:0031404)|cysteine-type peptidase activity (GO:0008234)|peptidase activator activity involved in apoptotic process (GO:0016505)|phosphatase binding (GO:0019902)|serine-type endopeptidase activity (GO:0004252)	p.Y168*(1)		large_intestine(7)|lung(8)|ovary(2)|prostate(3)|skin(2)	22		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GATCATACTTGTAGAGCCTAT	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	11											143.0	126.0	132.0					11																	88042468		2201	4299	6500	87682116	SO:0001587	stop_gained	1075			AK223038	CCDS8282.1, CCDS31654.1, CCDS44693.1	11q14.2	2014-09-17			ENSG00000109861	ENSG00000109861	3.4.14.1	"""Cathepsins"""	2528	protein-coding gene	gene with protein product	"""dipeptidyl peptidase 1"""	602365		PLS, PALS		7649281, 9092576	Standard	NM_148170		Approved	DPP1	uc001pck.4	P53634	OTTHUMG00000167290	ENST00000227266.5:c.504C>A	11.37:g.88042468G>T	ENSP00000227266:p.Tyr168*	Unknown		x	x	x	87682116	A8K7V2|B5MDD5|Q2HIY8|Q53G93|Q71E75|Q71E76|Q7M4N9|Q7Z3G7|Q7Z5U7|Q8WY99|Q8WYA7|Q8WYA8	Nonsense_Mutation	SNP	ENST00000227266.5	37	CCDS8282.1	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.73|10.73	1.433875|1.433875	0.25813|0.25813	.|.	.|.	ENSG00000109861|ENSG00000109861	ENST00000527018|ENST00000393302;ENST00000227266	.|.	.|.	.|.	6.02|6.02	4.15|4.15	0.48705|0.48705	.|.	.|0.115907	.|0.64402	.|D	.|0.000011	T|.	0.59432|.	0.2193|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.55270|.	-0.8167|.	4|.	.|.	.|.	.|.	.|.	9.3382|9.3382	0.38062|0.38062	0.266:0.0:0.734:0.0|0.266:0.0:0.734:0.0	.|.	.|.	.|.	.|.	K|X	125|151;168	.|.	.|.	T|Y	-|-	2|3	0|2	CTSC|CTSC	87682116|87682116	0.989000|0.989000	0.36119|0.36119	0.863000|0.863000	0.33907|0.33907	0.193000|0.193000	0.23685|0.23685	1.396000|1.396000	0.34531|0.34531	0.864000|0.864000	0.35578|0.35578	0.650000|0.650000	0.86243|0.86243	ACA|TAC		0.363	CTSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394019.2	NM_001814		Nonsense_Mutation
C11orf70	85016	broad.mit.edu	37	11	101937354	101937354	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr11:101937354C>T	ENST00000434758.2	+	4	435	c.407C>T	c.(406-408)cCa>cTa	p.P136L	C11orf70_ENST00000534360.1_Intron|C11orf70_ENST00000526781.1_Missense_Mutation_p.P136L	NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	136								p.P98L(1)		breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		TTTTGTGATCCATTTCTCATT	0.318																																																1	Substitution - Missense(1)	ovary(1)	11											106.0	99.0	101.0					11																	101937354		2201	4291	6492	101442564	SO:0001583	missense	85016			AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.407C>T	11.37:g.101937354C>T	ENSP00000414390:p.Pro136Leu	Unknown		x	x	x	101442564	E9PJU1	Missense_Mutation	SNP	ENST00000434758.2	37	CCDS8313.2	SNP	21	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.79|14.79	2.640267|2.640267	0.47153|0.47153	.|.	.|.	ENSG00000137691|ENSG00000137691	ENST00000529204|ENST00000434758;ENST00000526781;ENST00000423732	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.370806	.|0.31010	.|N	.|0.008430	T|T	0.48352|0.48352	0.1495|0.1495	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|P	.|0.38078	.|0.617	.|B	.|0.33960	.|0.173	T|T	0.53655|0.53655	-0.8408|-0.8408	5|9	.|0.62326	.|D	.|0.03	-5.8032|-5.8032	12.8872|12.8872	0.58051|0.58051	0.2681:0.7319:0.0:0.0|0.2681:0.7319:0.0:0.0	.|.	.|136	.|Q9BRQ4	.|CK070_HUMAN	Y|L	28|136;136;98	.|.	.|ENSP00000392150:P98L	H|P	+|+	1|2	0|0	C11orf70|C11orf70	101442564|101442564	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.280000|2.280000	0.43443|0.43443	2.766000|2.766000	0.95052|0.95052	0.557000|0.557000	0.71058|0.71058	CAT|CCA		0.318	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394144.1	NM_032930		Missense_Mutation
WNK1	65125	broad.mit.edu	37	12	1005549	1005549	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr12:1005549A>G	ENST00000315939.6	+	24	6539	c.5896A>G	c.(5896-5898)Aag>Gag	p.K1966E	WNK1_ENST00000535572.1_Missense_Mutation_p.K1718E|WNK1_ENST00000537687.1_Missense_Mutation_p.K2226E|WNK1_ENST00000530271.2_Missense_Mutation_p.K2464E|WNK1_ENST00000340908.4_Missense_Mutation_p.K1559E	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1966					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.K1966E(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AACTGAGGACAAGATCACTGA	0.458																																					Colon(19;451 567 6672 12618 28860)											1	Substitution - Missense(1)	ovary(1)	12											139.0	138.0	138.0					12																	1005549		2203	4300	6503	875810	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.5896A>G	12.37:g.1005549A>G	ENSP00000313059:p.Lys1966Glu	Unknown		x	x	x	875810	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	7.521	0.656590	0.14580	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908	T;T;T;T;T	0.68479	-0.33;-0.3;-0.31;-0.31;0.83	5.92	0.8	0.18672	.	0.285709	0.30510	N	0.009479	T	0.40670	0.1126	L	0.28274	0.84	0.26934	N	0.966398	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.26573	-1.0099	10	0.02654	T	1	-0.8435	4.7185	0.12906	0.4164:0.1758:0.4078:0.0	.	1719;1718;1966	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	E	1718;1966;2226;1139;2464;1559	ENSP00000441972:K1718E;ENSP00000313059:K1966E;ENSP00000444465:K2226E;ENSP00000433548:K2464E;ENSP00000341292:K1559E	ENSP00000252477:K1139E	K	+	1	0	WNK1	875810	0.806000	0.28996	0.763000	0.31416	0.672000	0.39443	1.000000	0.29770	0.110000	0.17919	0.533000	0.62120	AAG		0.458	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		Missense_Mutation
OR6C75	390323	broad.mit.edu	37	12	55758973	55758973	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr12:55758973A>G	ENST00000343399.3	+	1	79	c.79A>G	c.(79-81)Ata>Gta	p.I27V		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I27V(1)		endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TGTACTTTTCATATTTCTTCT	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											133.0	132.0	132.0					12																	55758973		2203	4300	6503	54045240	SO:0001583	missense	390323				CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.79A>G	12.37:g.55758973A>G	ENSP00000368987:p.Ile27Val	Unknown		x	x	x	54045240		Missense_Mutation	SNP	ENST00000343399.3	37	CCDS31820.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	4.807	0.150087	0.09185	.	.	ENSG00000187857	ENST00000343399	T	0.00565	6.56	5.18	-10.4	0.00318	.	1.990120	0.02993	N	0.147130	T	0.00271	0.0008	N	0.02765	-0.5	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44847	-0.9301	10	0.21014	T	0.42	.	9.0963	0.36640	0.1165:0.3786:0.4296:0.0753	.	27	A6NL08	O6C75_HUMAN	V	27	ENSP00000368987:I27V	ENSP00000368987:I27V	I	+	1	0	OR6C75	54045240	0.000000	0.05858	0.000000	0.03702	0.961000	0.63080	-3.857000	0.00349	-3.409000	0.00169	0.478000	0.44815	ATA		0.383	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1			Missense_Mutation
ARHGAP9	64333	broad.mit.edu	37	12	57873157	57873157	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr12:57873157C>A	ENST00000356411.2	-	2	171	c.33G>T	c.(31-33)tgG>tgT	p.W11C	ARHGAP9_ENST00000393797.2_Missense_Mutation_p.W82C|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.W11C|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.W11C|ARHGAP9_ENST00000430041.2_5'Flank|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.W90C|ARHGAP9_ENST00000550454.1_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	11					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.W11C(1)		endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			CTAGGATCCCCCAGGAACTTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											30.0	31.0	31.0					12																	57873157		2203	4300	6503	56159424	SO:0001583	missense	64333			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.33G>T	12.37:g.57873157C>A	ENSP00000348782:p.Trp11Cys	Unknown		x	x	x	56159424	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	37		SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703632	0.48412	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423	T;T;T;T	0.27256	3.03;3.01;1.68;2.89	4.26	4.26	0.50523	.	0.458667	0.20166	N	0.097850	T	0.26412	0.0645	N	0.19112	0.55	0.47214	D	0.999358	D;D;P;D;P	0.58620	0.983;0.983;0.947;0.969;0.947	P;B;B;P;B	0.52710	0.707;0.339;0.436;0.54;0.339	T	0.03673	-1.1014	10	0.72032	D	0.01	.	12.3724	0.55261	0.0:1.0:0.0:0.0	.	11;90;11;11;11	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9	.;.;RHG09_HUMAN;.;.	C	11;11;11;82;60	ENSP00000377380:W11C;ENSP00000348782:W11C;ENSP00000394307:W11C;ENSP00000377386:W82C	ENSP00000344852:W60C	W	-	3	0	ARHGAP9	56159424	0.928000	0.31464	0.997000	0.53966	0.994000	0.84299	1.855000	0.39378	2.357000	0.79964	0.655000	0.94253	TGG		0.597	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496		Missense_Mutation
CENPJ	55835	broad.mit.edu	37	13	25487017	25487017	+	Silent	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr13:25487017G>A	ENST00000381884.4	-	2	332	c.147C>T	c.(145-147)gaC>gaT	p.D49D	CENPJ_ENST00000545981.1_Silent_p.D49D	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	49					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.D49D(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TGGTAGAAATGTCCACAGCTG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	13											95.0	96.0	96.0					13																	25487017		2203	4300	6503	24385017	SO:0001819	synonymous_variant	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.147C>T	13.37:g.25487017G>A		Unknown		x	x	x	24385017	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Silent	SNP	ENST00000381884.4	37	CCDS9310.1	SNP	48	Broad																																																																																				0.413	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		Silent
ERCC5	2073	broad.mit.edu	37	13	103527925	103527925	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr13:103527925C>T	ENST00000355739.4	+	15	4656	c.3233C>T	c.(3232-3234)tCt>tTt	p.S1078F	ERCC5_ENST00000375954.1_Missense_Mutation_p.S311F|ERCC5_ENST00000472247.1_3'UTR	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	1078					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)	p.S1078F(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CTTTCAGATTCTAAAGGAAAG	0.398			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	1	Substitution - Missense(1)	ovary(1)	13											84.0	90.0	88.0					13																	103527925		2203	4300	6503	102325926	SO:0001583	missense	2073	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.3233C>T	13.37:g.103527925C>T	ENSP00000347978:p.Ser1078Phe	Unknown		x	x	x	102325926	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627404	0.66901	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.07800	3.44;3.16	4.51	4.51	0.55191	.	0.515494	0.19212	N	0.119905	T	0.18173	0.0436	L	0.57536	1.79	0.30556	N	0.76496	D	0.54397	0.966	P	0.50440	0.641	T	0.01810	-1.1269	10	0.72032	D	0.01	-0.859	17.6093	0.88048	0.0:1.0:0.0:0.0	.	1078	P28715	ERCC5_HUMAN	F	1503;1078;910;311	ENSP00000347978:S1078F;ENSP00000365121:S311F	ENSP00000347978:S1078F	S	+	2	0	ERCC5	102325926	0.002000	0.14202	0.019000	0.16419	0.488000	0.33401	1.540000	0.36115	2.235000	0.73313	0.650000	0.86243	TCT		0.398	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			Missense_Mutation
LTB4R2	56413	broad.mit.edu	37	14	24779909	24779909	+	Silent	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr14:24779909G>A	ENST00000528054.1	+	1	1749	c.132G>A	c.(130-132)ctG>ctA	p.L44L	CIDEB_ENST00000258807.5_5'UTR|LTB4R2_ENST00000533293.1_Silent_p.L13L|CIDEB_ENST00000554411.1_5'Flank|LTB4R_ENST00000396789.4_5'Flank|LTB4R2_ENST00000543919.1_Silent_p.L13L|CIDEB_ENST00000555817.1_5'Flank|CIDEB_ENST00000336557.5_5'UTR|LTB4R_ENST00000345363.3_5'Flank			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	44					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)	p.L44L(1)		endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		ACGAGACACTGCTGAGCTGGA	0.667																																																1	Substitution - coding silent(1)	ovary(1)	14											49.0	47.0	47.0					14																	24779909		2203	4300	6503	23849749	SO:0001819	synonymous_variant	56413			AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.132G>A	14.37:g.24779909G>A		Unknown		x	x	x	23849749	Q5KU28|Q9NPE5	Silent	SNP	ENST00000528054.1	37		SNP	46	Broad																																																																																				0.667	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000073194.4			Silent
ADAM10	102	broad.mit.edu	37	15	58933092	58933092	+	Missense_Mutation	SNP	T	T	A	rs201478118		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr15:58933092T>A	ENST00000260408.3	-	8	1339	c.896A>T	c.(895-897)aAg>aTg	p.K299M	ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000396140.2_Intron|ADAM10_ENST00000561288.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	299	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)	p.K299M(1)		breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		TTCCAGAAACTTCTCCACACC	0.388																																																1	Substitution - Missense(1)	ovary(1)	15											92.0	88.0	90.0					15																	58933092		2192	4292	6484	56720384	SO:0001583	missense	102			AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.896A>T	15.37:g.58933092T>A	ENSP00000260408:p.Lys299Met	Unknown		x	x	x	56720384	B4DU28|Q10742|Q92650	Missense_Mutation	SNP	ENST00000260408.3	37	CCDS10167.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	22.8	4.332032	0.81801	.	.	ENSG00000137845	ENST00000260408;ENST00000396136	D	0.86694	-2.16	5.56	5.56	0.83823	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.91683	0.7371	L	0.58101	1.795	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	D	0.91009	0.4848	10	0.39692	T	0.17	-21.5732	16.0048	0.80354	0.0:0.0:0.0:1.0	.	299	O14672	ADA10_HUMAN	M	299;118	ENSP00000260408:K299M	ENSP00000260408:K299M	K	-	2	0	ADAM10	56720384	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.199000	0.72112	2.237000	0.73441	0.528000	0.53228	AAG		0.388	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255880.2	NM_001110		Missense_Mutation
DNAH3	55567	broad.mit.edu	37	16	21031122	21031122	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr16:21031122A>T	ENST00000261383.3	-	41	5845	c.5846T>A	c.(5845-5847)cTc>cAc	p.L1949H	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1949					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.L1949H(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTGGAGCCAGAGAAAGATCTG	0.463																																																2	Substitution - Missense(2)	ovary(2)	16											105.0	96.0	99.0					16																	21031122		2201	4300	6501	20938623	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5846T>A	16.37:g.21031122A>T	ENSP00000261383:p.Leu1949His	Unknown		x	x	x	20938623	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.66	2.304881	0.40795	.	.	ENSG00000158486	ENST00000261383	T	0.27890	1.64	5.49	5.49	0.81192	.	0.183356	0.34986	N	0.003528	T	0.40979	0.1139	L	0.58428	1.81	0.80722	D	1	D	0.63880	0.993	P	0.52856	0.711	T	0.23332	-1.0191	10	0.44086	T	0.13	.	11.5584	0.50761	0.9284:0.0:0.0716:0.0	.	1949	Q8TD57	DYH3_HUMAN	H	1949	ENSP00000261383:L1949H	ENSP00000261383:L1949H	L	-	2	0	DNAH3	20938623	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	6.647000	0.74354	2.109000	0.64355	0.456000	0.33151	CTC		0.463	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
USP31	57478	broad.mit.edu	37	16	23080857	23080857	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr16:23080857C>T	ENST00000219689.7	-	16	2568	c.2569G>A	c.(2569-2571)Gcc>Acc	p.A857T	USP31_ENST00000567975.1_Missense_Mutation_p.A150T	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.A857T(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TCATTGACGGCCAAGGGGCTG	0.483																																																1	Substitution - Missense(1)	ovary(1)	16											42.0	37.0	39.0					16																	23080857		2197	4300	6497	22988358	SO:0001583	missense	57478			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2569G>A	16.37:g.23080857C>T	ENSP00000219689:p.Ala857Thr	Unknown		x	x	x	22988358	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925209	0.73213	.	.	ENSG00000103404	ENST00000219689;ENST00000381162	T	0.09445	2.98	6.04	6.04	0.98038	.	0.305128	0.30011	N	0.010633	T	0.19005	0.0456	L	0.40543	1.245	0.58432	D	0.999999	D;P;D	0.56521	0.976;0.605;0.975	P;B;P	0.53266	0.722;0.278;0.648	T	0.01081	-1.1458	10	0.20519	T	0.43	-3.6201	19.5772	0.95449	0.0:1.0:0.0:0.0	.	160;857;150	Q70CQ4-2;Q70CQ4;B3KS48	.;UBP31_HUMAN;.	T	857;160	ENSP00000219689:A857T	ENSP00000219689:A857T	A	-	1	0	USP31	22988358	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	7.468000	0.80943	2.876000	0.98609	0.650000	0.86243	GCC		0.483	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718		Missense_Mutation
SULT1A1	6817	broad.mit.edu	37	16	28619665	28619665	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr16:28619665T>C	ENST00000395607.1	-	4	592	c.319A>G	c.(319-321)Aca>Gca	p.T107A	SULT1A1_ENST00000569554.1_Missense_Mutation_p.T107A|SULT1A1_ENST00000314752.7_Missense_Mutation_p.T107A|SULT1A1_ENST00000350842.4_Intron|SULT1A1_ENST00000395609.1_Missense_Mutation_p.T107A	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	107	Substrate binding.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)	p.T107A(1)		endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	GGCAGGTGTGTCTTCAGGAGT	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											190.0	147.0	161.0					16																	28619665		2197	4300	6497	28527166	SO:0001583	missense	6817			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.319A>G	16.37:g.28619665T>C	ENSP00000378971:p.Thr107Ala	Unknown		x	x	x	28527166	Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	CCDS32420.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	.	14.91	2.677910	0.47886	.	.	ENSG00000196502	ENST00000314752;ENST00000395609;ENST00000395607	D;D;D	0.85861	-2.04;-2.04;-2.04	2.21	2.21	0.28008	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.89911	0.6852	M	0.93550	3.43	0.29164	N	0.877545	B	0.26041	0.14	B	0.40741	0.339	D	0.87086	0.2169	10	0.87932	D	0	.	8.3655	0.32385	0.0:0.0:0.0:1.0	.	107	P50225	ST1A1_HUMAN	A	107	ENSP00000321988:T107A;ENSP00000378972:T107A;ENSP00000378971:T107A	ENSP00000321988:T107A	T	-	1	0	SULT1A1	28527166	1.000000	0.71417	0.132000	0.22025	0.058000	0.15608	3.619000	0.54196	1.282000	0.44496	0.254000	0.18369	ACA		0.587	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2	NM_001055		Missense_Mutation
ITGAM	3684	broad.mit.edu	37	16	31332675	31332675	+	Silent	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr16:31332675G>T	ENST00000287497.8	+	15	1896	c.1821G>T	c.(1819-1821)ggG>ggT	p.G607G	ITGAM_ENST00000544665.3_Silent_p.G608G			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	607					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.G607G(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GAGCCCAGGGGCACGTGCTGC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	16											102.0	109.0	106.0					16																	31332675		2100	4241	6341	31240176	SO:0001819	synonymous_variant	3684			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1821G>T	16.37:g.31332675G>T		Unknown		x	x	x	31240176	Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	ENST00000287497.8	37	CCDS45470.1	SNP	42	Broad																																																																																				0.542	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		Silent
MT1B	4490	broad.mit.edu	37	16	56686494	56686494	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr16:56686494G>T	ENST00000334346.2	+	2	95	c.40G>T	c.(40-42)Gcc>Tcc	p.A14S	MT1B_ENST00000562399.1_Missense_Mutation_p.A14S|RP11-249C24.11_ENST00000568608.1_RNA	NM_005947.2	NP_005938.1	P07438	MT1B_HUMAN	metallothionein 1B	14	Beta.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.A14S(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TGGCTCCTGTGCCTGCGCCGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											122.0	107.0	112.0					16																	56686494		2198	4300	6498	55243995	SO:0001583	missense	4490			AY168638	CCDS10765.1	16q13	2008-02-05	2007-03-02		ENSG00000169688	ENSG00000169688		"""Metallothioneins"""	7394	protein-coding gene	gene with protein product		156349	"""metallothionein 1Q"""	MT1, MT1Q		6089206, 3785191	Standard	NM_005947		Approved		uc002ejs.3	P07438	OTTHUMG00000133277	ENST00000334346.2:c.40G>T	16.37:g.56686494G>T	ENSP00000334998:p.Ala14Ser	Unknown		x	x	x	55243995	Q86YX0	Missense_Mutation	SNP	ENST00000334346.2	37	CCDS10765.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	5.291	0.239092	0.10023	.	.	ENSG00000169688	ENST00000334346	T	0.09163	3.01	2.61	-5.22	0.02806	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	0.625774	0.13226	U	0.404034	T	0.05090	0.0136	.	.	.	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	9	0.28530	T	0.3	.	4.8143	0.13358	0.4665:0.1615:0.372:0.0	.	14	P07438	MT1B_HUMAN	S	14	ENSP00000334998:A14S	ENSP00000334998:A14S	A	+	1	0	MT1B	55243995	0.004000	0.15560	0.037000	0.18230	0.001000	0.01503	-0.006000	0.12833	-1.725000	0.01371	-2.125000	0.00346	GCC		0.552	MT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257057.2	NM_005947		Missense_Mutation
KCTD19	146212	broad.mit.edu	37	16	67335749	67335749	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr16:67335749T>G	ENST00000304372.5	-	5	775	c.720A>C	c.(718-720)gaA>gaC	p.E240D	KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	240					protein homooligomerization (GO:0051260)			p.E240D(1)		endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TTTCCAGAATTTCCACTTCTG	0.453																																																1	Substitution - Missense(1)	ovary(1)	16											153.0	154.0	154.0					16																	67335749		1877	4115	5992	65893250	SO:0001583	missense	146212			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.720A>C	16.37:g.67335749T>G	ENSP00000305702:p.Glu240Asp	Unknown		x	x	x	65893250	B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	37	CCDS42179.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	12.50	1.955279	0.34471	.	.	ENSG00000168676	ENST00000304372	T	0.60672	0.17	6.17	3.8	0.43715	BTB/POZ fold (2);	0.407680	0.26279	N	0.025294	T	0.28001	0.0690	N	0.03608	-0.345	0.25805	N	0.984465	B	0.12630	0.006	B	0.06405	0.002	T	0.16276	-1.0408	10	0.11485	T	0.65	-16.4359	8.2165	0.31514	0.0:0.077:0.1446:0.7783	.	240	Q17RG1	KCD19_HUMAN	D	240	ENSP00000305702:E240D	ENSP00000305702:E240D	E	-	3	2	KCTD19	65893250	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.860000	0.27871	1.165000	0.42670	0.533000	0.62120	GAA		0.453	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367		Missense_Mutation
YWHAE	7531	broad.mit.edu	37	17	1268287	1268287	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:1268287G>A	ENST00000264335.8	-	2	397	c.130C>T	c.(130-132)Ctc>Ttc	p.L44F	YWHAE_ENST00000571732.1_Missense_Mutation_p.L22F|YWHAE_ENST00000575977.1_Missense_Mutation_p.L44F|YWHAE_ENST00000573026.1_Intron	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon	44					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)	p.L44F(1)		kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		ACAGATAGGAGGTTTCTTTCT	0.413			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome																																Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	1	Substitution - Missense(1)	ovary(1)	17											130.0	122.0	125.0					17																	1268287		2203	4300	6503	1215037	SO:0001583	missense	7531			U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.130C>T	17.37:g.1268287G>A	ENSP00000264335:p.Leu44Phe	Unknown		x	x	x	1215037	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Missense_Mutation	SNP	ENST00000264335.8	37	CCDS11001.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335936	0.81801	.	.	ENSG00000108953	ENST00000264335;ENST00000414131	T	0.63417	-0.04	5.28	4.31	0.51392	14-3-3 protein, conserved site (1);14-3-3 domain (4);	0.000000	0.64402	U	0.000006	T	0.79707	0.4492	H	0.96080	3.765	0.80722	D	1	D	0.53619	0.961	P	0.56343	0.796	D	0.83427	0.0036	10	0.87932	D	0	-14.1269	7.1132	0.25403	0.184:0.0:0.816:0.0	.	44	P62258	1433E_HUMAN	F	44;22	ENSP00000264335:L44F	ENSP00000264335:L44F	L	-	1	0	YWHAE	1215037	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.778000	0.68940	2.469000	0.83416	0.557000	0.71058	CTC		0.413	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259354.3	NM_006761		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:7578268A>C	ENST00000269305.4	-	6	770	c.581T>G	c.(580-582)cTt>cGt	p.L194R	TP53_ENST00000420246.2_Missense_Mutation_p.L194R|TP53_ENST00000455263.2_Missense_Mutation_p.L194R|TP53_ENST00000359597.4_Missense_Mutation_p.L194R|TP53_ENST00000445888.2_Missense_Mutation_p.L194R|TP53_ENST00000413465.2_Missense_Mutation_p.L194R|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTCGGATAAGATGCTGAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)	17											97.0	87.0	90.0					17																	7578268		2203	4300	6503	7518993	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.581T>G	17.37:g.7578268A>C	ENSP00000269305:p.Leu194Arg	Unknown		x	x	x	7518993	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029856	0.54790	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.984;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194R;ENSP00000352610:L194R;ENSP00000269305:L194R;ENSP00000398846:L194R;ENSP00000391127:L194R;ENSP00000391478:L194R;ENSP00000425104:L62R;ENSP00000423862:L101R	ENSP00000269305:L194R	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
PER1	5187	broad.mit.edu	37	17	8047120	8047120	+	Nonsense_Mutation	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:8047120G>A	ENST00000317276.4	-	19	2773	c.2536C>T	c.(2536-2538)Cag>Tag	p.Q846*	PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Nonsense_Mutation_p.Q823*	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	846					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.Q846*(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CGAGGGTTCTGGTGGTGGCGT	0.682			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																															Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	1	Substitution - Nonsense(1)	ovary(1)	17											43.0	51.0	48.0					17																	8047120		2203	4300	6503	7987845	SO:0001587	stop_gained	5187			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2536C>T	17.37:g.8047120G>A	ENSP00000314420:p.Gln846*	Unknown		x	x	x	7987845	B2RPA8|B4DI49|D3DTR3	Nonsense_Mutation	SNP	ENST00000317276.4	37	CCDS11131.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	40	8.056967	0.98632	.	.	ENSG00000179094	ENST00000317276	.	.	.	5.24	5.24	0.73138	.	0.306795	0.32769	N	0.005676	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-14.7005	12.0932	0.53739	0.0:0.1736:0.8264:0.0	.	.	.	.	X	846	.	ENSP00000314420:Q846X	Q	-	1	0	PER1	7987845	0.997000	0.39634	1.000000	0.80357	0.950000	0.60333	1.661000	0.37408	2.450000	0.82876	0.563000	0.77884	CAG		0.682	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2			Nonsense_Mutation
MYH13	8735	broad.mit.edu	37	17	10227413	10227413	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:10227413G>C	ENST00000418404.3	-	22	3023	c.2860C>G	c.(2860-2862)Ctc>Gtc	p.L954V	RP11-401O9.3_ENST00000577743.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.L954V			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	954					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.L954V(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TCTCTCTTGAGAGAGGAGCAT	0.468																																																2	Substitution - Missense(2)	ovary(2)	17											121.0	123.0	122.0					17																	10227413		2188	4300	6488	10168138	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2860C>G	17.37:g.10227413G>C	ENSP00000404570:p.Leu954Val	Unknown		x	x	x	10168138	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.96	3.922812	0.73213	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.95001	-3.58	4.37	4.37	0.52481	.	.	.	.	.	D	0.97958	0.9328	H	0.94808	3.585	0.38886	D	0.957006	D;D	0.71674	0.998;0.998	D;D	0.70935	0.96;0.971	D	0.99925	1.1281	9	0.87932	D	0	.	17.4708	0.87646	0.0:0.0:1.0:0.0	.	580;954	B4DFX9;Q9UKX3	.;MYH13_HUMAN	V	954;580	ENSP00000252172:L954V	ENSP00000252172:L954V	L	-	1	0	MYH13	10168138	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.835000	0.55805	2.407000	0.81776	0.655000	0.94253	CTC		0.468	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		Missense_Mutation
KRT12	3859	broad.mit.edu	37	17	39019539	39019539	+	Silent	SNP	C	C	G			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:39019539C>G	ENST00000251643.4	-	6	1175	c.1152G>C	c.(1150-1152)ctG>ctC	p.L384L	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	384	Coil 2.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.L384L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GCACCTGGGACAGCTGCGCGC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	17											22.0	20.0	21.0					17																	39019539		2197	4295	6492	36273065	SO:0001819	synonymous_variant	3859				CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1152G>C	17.37:g.39019539C>G		Unknown		x	x	x	36273065	B2R9E0	Silent	SNP	ENST00000251643.4	37	CCDS11378.1	SNP	17	Broad																																																																																				0.617	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223		Silent
HAP1	9001	broad.mit.edu	37	17	39884453	39884453	+	Splice_Site	SNP	C	C	G			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:39884453C>G	ENST00000310778.5	-	7	1209	c.1200G>C	c.(1198-1200)atG>atC	p.M400I	JUP_ENST00000540235.1_Intron|RN7SL399P_ENST00000471648.2_RNA|HAP1_ENST00000347901.4_Splice_Site_p.M400I|HAP1_ENST00000341193.5_Splice_Site_p.M408I|HAP1_ENST00000393939.2_Splice_Site_p.M400I			P54257	HAP1_HUMAN	huntingtin-associated protein 1	400	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)	p.M400I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CCCGACTCACCATCCGGCAGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											41.0	41.0	41.0					17																	39884453		2203	4300	6503	37137979	SO:0001630	splice_region_variant	9001			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1200+1G>C	17.37:g.39884453C>G		Unknown		x	x	x	37137979	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	4.712	0.132478	0.08981	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	4.14	0.82	0.18793	.	0.794140	0.10412	N	0.677759	T	0.08313	0.0207	N	0.14661	0.345	0.20563	N	0.999887	B;B;B;B	0.09022	0.0;0.001;0.001;0.002	B;B;B;B	0.17433	0.0;0.0;0.006;0.018	T	0.41052	-0.9530	9	.	.	.	-0.0237	3.8802	0.09074	0.1953:0.5889:0.0:0.2158	.	400;408;400;400	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	I	400;400;400;408	ENSP00000377513:M400I;ENSP00000309392:M400I;ENSP00000334002:M400I;ENSP00000343170:M408I	.	M	-	3	0	HAP1	37137979	0.727000	0.28069	0.661000	0.29709	0.003000	0.03518	1.135000	0.31454	0.379000	0.24794	-0.309000	0.09137	ATG		0.637	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949	Missense_Mutation	Missense_Mutation
RUNDC3A	10900	broad.mit.edu	37	17	42390852	42390852	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr17:42390852C>T	ENST00000426726.3	+	4	713	c.439C>T	c.(439-441)Cgt>Tgt	p.R147C	AC003102.3_ENST00000588097.1_RNA|RUNDC3A_ENST00000590941.1_Missense_Mutation_p.R142C|RUNDC3A_ENST00000225441.7_Missense_Mutation_p.R147C	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	147	Interaction with RAP2A. {ECO:0000250}.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)	p.R147C(1)		large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CACGGCTCTGCGTGACACCCG	0.562																																					Pancreas(82;1061 1416 11136 20771 23901)											1	Substitution - Missense(1)	ovary(1)	17											58.0	62.0	61.0					17																	42390852		2097	4229	6326	39746378	SO:0001583	missense	10900			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.439C>T	17.37:g.42390852C>T	ENSP00000410862:p.Arg147Cys	Unknown		x	x	x	39746378	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	ENST00000426726.3	37	CCDS45698.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	18.24	3.580728	0.65992	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.31769	1.48;1.48	4.65	3.6	0.41247	RUN (3);	0.061283	0.64402	D	0.000009	T	0.53254	0.1785	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.998	T	0.58244	-0.7670	10	0.87932	D	0	-23.0784	10.7136	0.46000	0.3209:0.6791:0.0:0.0	.	147;147;142;147	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	C	147	ENSP00000410862:R147C;ENSP00000225441:R147C	ENSP00000225441:R147C	R	+	1	0	RUNDC3A	39746378	0.998000	0.40836	1.000000	0.80357	0.952000	0.60782	0.605000	0.24179	2.147000	0.66899	0.448000	0.29417	CGT		0.562	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403173.2	NM_006695		Missense_Mutation
FARSA	2193	broad.mit.edu	37	19	13035065	13035065	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr19:13035065C>A	ENST00000314606.4	-	12	1306	c.1288G>T	c.(1288-1290)Gtg>Ttg	p.V430L	FARSA_ENST00000423140.2_Missense_Mutation_p.V399L|FARSA_ENST00000588025.1_Missense_Mutation_p.V470L	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	430					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.V430L(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CCGACCTCCACCCACTTCTTC	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											73.0	76.0	75.0					19																	13035065		2203	4300	6503	12896065	SO:0001583	missense	2193			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.1288G>T	19.37:g.13035065C>A	ENSP00000320309:p.Val430Leu	Unknown		x	x	x	12896065	B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	37	CCDS12287.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	20.6	4.009594	0.75046	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	T;T	0.61742	0.08;0.08	5.1	5.1	0.69264	Aminoacyl-tRNA synthetase, class II (1);Phenylalanyl-tRNA synthetase (1);	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	L	0.33710	1.025	0.80722	D	1	P;P;P	0.52316	0.952;0.709;0.709	B;B;B	0.44133	0.442;0.268;0.268	T	0.59778	-0.7390	10	0.72032	D	0.01	-4.894	17.309	0.87204	0.0:1.0:0.0:0.0	.	399;430;430	B4E363;Q6IBR2;Q9Y285	.;.;SYFA_HUMAN	L	430;399	ENSP00000320309:V430L;ENSP00000396548:V399L	ENSP00000320309:V430L	V	-	1	0	FARSA	12896065	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.296000	0.78790	2.376000	0.81061	0.655000	0.94253	GTG		0.612	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461		Missense_Mutation
FKBP8	23770	broad.mit.edu	37	19	18650469	18650469	+	Silent	SNP	G	G	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr19:18650469G>C	ENST00000596558.2	-	3	463	c.354C>G	c.(352-354)gtC>gtG	p.V118V	FKBP8_ENST00000453489.2_Silent_p.V147V|FKBP8_ENST00000610101.1_Intron|FKBP8_ENST00000222308.4_Silent_p.V118V|FKBP8_ENST00000597960.3_Silent_p.V118V|FKBP8_ENST00000608443.1_Silent_p.V118V			Q14318	FKBP8_HUMAN	FK506 binding protein 8, 38kDa	118					apoptotic process (GO:0006915)|camera-type eye development (GO:0043010)|cell fate specification (GO:0001708)|chaperone-mediated protein folding (GO:0061077)|dorsal/ventral neural tube patterning (GO:0021904)|intracellular signal transduction (GO:0035556)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|positive regulation of BMP signaling pathway (GO:0030513)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of gene expression (GO:0010468)|smoothened signaling pathway (GO:0007224)|viral process (GO:0016032)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	FK506 binding (GO:0005528)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.V118V(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	15						CCTGGCCCTTGACCGGGCGGC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											139.0	146.0	143.0					19																	18650469		2203	4300	6503	18511469	SO:0001819	synonymous_variant	23770			L37033	CCDS32961.1	19p12	2013-01-10	2002-08-29		ENSG00000105701	ENSG00000105701		"""Tetratricopeptide (TTC) repeat domain containing"""	3724	protein-coding gene	gene with protein product	"""FK506-binding protein 8 (38kD)"""	604840	"""FK506-binding protein 8 (38kD)"""			7543869	Standard	NM_012181		Approved	FKBP38, FKBPr38	uc002njj.1	Q14318		ENST00000596558.2:c.354C>G	19.37:g.18650469G>C		Unknown		x	x	x	18511469	C8C9T5|Q53GU3|Q7Z349|Q86YK6	Silent	SNP	ENST00000596558.2	37		SNP	45	Broad																																																																																				0.652	FKBP8-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000466374.3	NM_012181		Silent
MAPRE3	22924	broad.mit.edu	37	2	27248876	27248876	+	Silent	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr2:27248876C>T	ENST00000233121.2	+	6	951	c.753C>T	c.(751-753)atC>atT	p.I251I	MAPRE3_ENST00000405074.3_Silent_p.I236I|MAPRE3_ENST00000402218.1_Silent_p.I236I			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	251	APC-binding.|DCTN1-binding.|EB1 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00576}.				mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)	p.I251I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCAGGCATCATTGGCATCC	0.557																																																1	Substitution - coding silent(1)	ovary(1)	2											96.0	87.0	90.0					2																	27248876		2203	4300	6503	27102380	SO:0001819	synonymous_variant	22924			Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.753C>T	2.37:g.27248876C>T		Unknown		x	x	x	27102380	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	37	CCDS1731.1	SNP	29	Broad																																																																																				0.557	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326		Silent
FAM161A	84140	broad.mit.edu	37	2	62067491	62067491	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr2:62067491A>C	ENST00000405894.3	-	3	749	c.648T>G	c.(646-648)gaT>gaG	p.D216E	FAM161A_ENST00000404929.1_Missense_Mutation_p.D216E	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	216					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)		p.D107E(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGAAGCCAGTATCTTTACAGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											187.0	167.0	173.0					2																	62067491		1870	4095	5965	61920995	SO:0001583	missense	84140				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.648T>G	2.37:g.62067491A>C	ENSP00000385893:p.Asp216Glu	Unknown		x	x	x	61920995	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	CCDS42687.2	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	3.047	-0.196265	0.06259	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.21734	2.8;1.99	5.55	1.93	0.25924	.	0.702099	0.14746	N	0.300891	T	0.17831	0.0428	L	0.39633	1.23	0.09310	N	1	B;D	0.57257	0.085;0.979	B;P	0.53224	0.013;0.721	T	0.09840	-1.0656	10	0.06625	T	0.88	-7.2789	1.7519	0.02973	0.5244:0.1274:0.2248:0.1234	.	216;216	Q3B820;Q3B820-3	F161A_HUMAN;.	E	216	ENSP00000385158:D216E;ENSP00000385893:D216E	ENSP00000385158:D216E	D	-	3	2	FAM161A	61920995	0.002000	0.14202	0.000000	0.03702	0.095000	0.18619	1.093000	0.30939	0.092000	0.17331	0.533000	0.62120	GAT		0.393	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180		Missense_Mutation
SOWAHC	65124	broad.mit.edu	37	2	110373153	110373153	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr2:110373153G>A	ENST00000356454.3	+	1	1243	c.1087G>A	c.(1087-1089)Gcc>Acc	p.A363T	SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	363								p.A363T(1)									GCTGGTGGGGGCCTACGACGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											45.0	52.0	49.0					2																	110373153		2203	4300	6503	109730442	SO:0001583	missense	65124			AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.1087G>A	2.37:g.110373153G>A	ENSP00000365830:p.Ala363Thr	Unknown		x	x	x	109730442	Q8NE15|Q9H6U1	Missense_Mutation	SNP	ENST00000356454.3	37	CCDS33270.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355621	0.82243	.	.	ENSG00000198142	ENST00000356454	T	0.64085	-0.08	4.42	3.55	0.40652	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000001	T	0.53238	0.1784	L	0.31371	0.925	0.46260	D	0.998955	P	0.41624	0.757	P	0.45794	0.493	T	0.46707	-0.9172	10	0.27082	T	0.32	-19.0736	11.4114	0.49927	0.0877:0.0:0.9123:0.0	.	363	Q53LP3	ANR57_HUMAN	T	363	ENSP00000365830:A363T	ENSP00000365830:A363T	A	+	1	0	ANKRD57	109730442	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	7.409000	0.80053	1.088000	0.41272	0.650000	0.86243	GCC		0.637	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016		Missense_Mutation
TANC1	85461	broad.mit.edu	37	2	160086600	160086600	+	Nonsense_Mutation	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr2:160086600C>T	ENST00000263635.6	+	27	4900	c.4663C>T	c.(4663-4665)Cag>Tag	p.Q1555*	TANC1_ENST00000454300.1_Nonsense_Mutation_p.Q1449*	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1555					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.Q1555*(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TATGAAAGTTCAGATCTCTTC	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	2											49.0	54.0	52.0					2																	160086600		1934	4139	6073	159794846	SO:0001587	stop_gained	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4663C>T	2.37:g.160086600C>T	ENSP00000263635:p.Gln1555*	Unknown		x	x	x	159794846	C9JD88|Q49AI8	Nonsense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	41	8.844070	0.98974	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	.	.	.	6.07	5.18	0.71444	.	0.468598	0.24891	N	0.034778	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8315	0.35087	0.1626:0.7639:0.0:0.0736	.	.	.	.	X	1449;1555	.	.	Q	+	1	0	TANC1	159794846	0.033000	0.19621	0.003000	0.11579	0.103000	0.19146	2.903000	0.48711	1.505000	0.48720	0.655000	0.94253	CAG		0.567	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Nonsense_Mutation
TTN	7273	broad.mit.edu	37	2	179425591	179425591	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr2:179425591C>A	ENST00000591111.1	-	276	80569	c.80345G>T	c.(80344-80346)cGa>cTa	p.R26782L	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R25855L|TTN_ENST00000342175.6_Missense_Mutation_p.R19550L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R28423L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R19483L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R19358L			Q8WZ42	TITIN_HUMAN	titin	26782	Ig-like 128.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R19550L(1)|p.R25853L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCAGTGTCTCGTCTTATACA	0.428																																																2	Substitution - Missense(2)	ovary(2)	2											115.0	99.0	104.0					2																	179425591		1931	4144	6075	179133837	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80345G>T	2.37:g.179425591C>A	ENSP00000465570:p.Arg26782Leu	Unknown		x	x	x	179133837	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255590	0.39896	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.97	5.09	0.68999	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45397	0.1340	N	0.26130	0.795	0.42123	D	0.991433	P;P;P;P	0.52842	0.956;0.956;0.956;0.922	P;P;P;P	0.53912	0.737;0.737;0.737;0.655	T	0.50558	-0.8814	9	0.87932	D	0	.	15.5833	0.76462	0.0:0.9335:0.0:0.0665	.	19358;19483;19550;26782	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	25855;19358;19550;19483;19356	ENSP00000343764:R25855L;ENSP00000434586:R19358L;ENSP00000340554:R19550L;ENSP00000352154:R19483L	ENSP00000340554:R19550L	R	-	2	0	TTN	179133837	0.992000	0.36948	1.000000	0.80357	0.990000	0.78478	3.335000	0.52105	1.508000	0.48769	0.655000	0.94253	CGA		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
PROKR2	128674	broad.mit.edu	37	20	5294722	5294722	+	Silent	SNP	G	G	A	rs146061254		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr20:5294722G>A	ENST00000217270.3	-	1	293	c.294C>T	c.(292-294)tcC>tcT	p.S98S	PROKR2_ENST00000546004.1_Silent_p.S98S	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	98					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.S98S(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						CCAGGAAGTCGGAGATGGCCA	0.572										HNSCC(71;0.22)																																						1	Substitution - coding silent(1)	ovary(1)	20						G		0,4406		0,0,2203	173.0	133.0	146.0		294	-10.2	0.4	20	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PROKR2	NM_144773.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		98/385	5294722	1,13005	2203	4300	6503	5242722	SO:0001819	synonymous_variant	128674			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.294C>T	20.37:g.5294722G>A		Unknown		x	x	x	5242722	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Silent	SNP	ENST00000217270.3	37	CCDS13089.1	SNP	39	Broad																																																																																				0.572	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773		Silent
PHF20	51230	broad.mit.edu	37	20	34526765	34526765	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr20:34526765T>A	ENST00000374012.3	+	16	2576	c.2447T>A	c.(2446-2448)gTg>gAg	p.V816E	PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	816					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V816E(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AACGGGGCAGTGGAGAAGCCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	20											44.0	46.0	45.0					20																	34526765		2203	4300	6503	33990179	SO:0001583	missense	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.2447T>A	20.37:g.34526765T>A	ENSP00000363124:p.Val816Glu	Unknown		x	x	x	33990179	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	10.65	1.408861	0.25378	.	.	ENSG00000025293	ENST00000374012	T	0.32023	1.47	5.91	4.81	0.61882	.	0.505775	0.23404	N	0.048549	T	0.19685	0.0473	N	0.24115	0.695	0.58432	D	0.999997	B	0.31153	0.31	B	0.24974	0.057	T	0.05886	-1.0858	10	0.56958	D	0.05	.	10.3333	0.43835	0.0:0.1281:0.0:0.8719	.	816	Q9BVI0	PHF20_HUMAN	E	816	ENSP00000363124:V816E	ENSP00000363124:V816E	V	+	2	0	PHF20	33990179	0.988000	0.35896	0.952000	0.39060	0.102000	0.19082	1.649000	0.37281	2.254000	0.74563	0.533000	0.62120	GTG		0.572	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436		Missense_Mutation
MRPL39	54148	broad.mit.edu	37	21	26965162	26965162	+	Missense_Mutation	SNP	G	G	C	rs61735761		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr21:26965162G>C	ENST00000352957.4	-	8	924	c.883C>G	c.(883-885)Cga>Gga	p.R295G	MRPL39_ENST00000307301.7_Missense_Mutation_p.R295G	NM_017446.3	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39	295						mitochondrial ribosome (GO:0005761)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R295G(1)		endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	10						TGGAATCTTCGTATGAGACTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	21											87.0	81.0	83.0					21																	26965162		2203	4300	6503	25887033	SO:0001583	missense	54148			AB051346	CCDS13573.1, CCDS33522.1	21q11.2-q21	2012-09-13			ENSG00000154719	ENSG00000154719		"""Mitochondrial ribosomal proteins / large subunits"""	14027	protein-coding gene	gene with protein product		611845				11543634	Standard	NM_080794		Approved	RPML5, MRP-L5, MGC104174, PRED66, PRED22, C21orf92, L39mt, MSTP003, MGC3400, FLJ20451	uc002yln.3	Q9NYK5	OTTHUMG00000078371	ENST00000352957.4:c.883C>G	21.37:g.26965162G>C	ENSP00000284967:p.Arg295Gly	Unknown		x	x	x	25887033	C9JYA5|Q32Q74|Q5QTR3|Q96Q65|Q9BSQ7|Q9BZV6|Q9NX44	Missense_Mutation	SNP	ENST00000352957.4	37	CCDS13573.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139735	0.37728	.	.	ENSG00000154719	ENST00000352957;ENST00000307301;ENST00000419219	T;T;T	0.45668	0.89;0.89;0.92	5.39	2.38	0.29361	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	L	0.59436	1.845	0.52099	D	0.999945	P;P	0.51653	0.947;0.947	P;P	0.55391	0.68;0.775	T	0.60010	-0.7346	10	0.72032	D	0.01	-9.1079	14.6113	0.68517	0.0:0.0:0.5272:0.4728	.	295;295	Q9NYK5;Q9NYK5-2	RM39_HUMAN;.	G	295;295;285	ENSP00000284967:R295G;ENSP00000305682:R295G;ENSP00000404426:R285G	ENSP00000305682:R295G	R	-	1	2	MRPL39	25887033	0.587000	0.26791	0.671000	0.29857	0.668000	0.39293	0.688000	0.25422	0.782000	0.33613	0.655000	0.94253	CGA		0.408	MRPL39-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000171194.1	NM_017446		Missense_Mutation
SH3BP5	9467	broad.mit.edu	37	3	15298555	15298555	+	Nonsense_Mutation	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr3:15298555G>A	ENST00000383791.3	-	8	1175	c.955C>T	c.(955-957)Cag>Tag	p.Q319*	SH3BP5_ENST00000253688.5_Nonsense_Mutation_p.Q162*|SH3BP5_ENST00000408919.3_Nonsense_Mutation_p.Q162*|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5_ENST00000426925.1_Nonsense_Mutation_p.Q162*|SH3BP5-AS1_ENST00000413977.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	319	Ser-rich.				intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)	p.Q319*(1)		NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GACACGGACTGGGTTTCCGAG	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	3											100.0	87.0	91.0					3																	15298555		2203	4300	6503	15273559	SO:0001587	stop_gained	9467			AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.955C>T	3.37:g.15298555G>A	ENSP00000373301:p.Gln319*	Unknown		x	x	x	15273559	B3KQW6|Q5JWV9	Nonsense_Mutation	SNP	ENST00000383791.3	37	CCDS2625.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	42	9.198016	0.99098	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919	.	.	.	5.65	5.65	0.86999	.	0.119337	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-22.5748	19.376	0.94508	0.0:0.0:1.0:0.0	.	.	.	.	X	319;162;162;162	.	ENSP00000253688:Q162X	Q	-	1	0	SH3BP5	15273559	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.530000	0.81962	2.683000	0.91414	0.456000	0.33151	CAG		0.552	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844		Nonsense_Mutation
ANKRD28	23243	broad.mit.edu	37	3	15749562	15749562	+	Silent	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr3:15749562C>T	ENST00000399451.2	-	14	1693	c.1326G>A	c.(1324-1326)ctG>ctA	p.L442L	ANKRD28_ENST00000383777.1_Silent_p.L475L|ANKRD28_ENST00000497037.1_5'UTR	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	442						nucleus (GO:0005634)		p.L475L(1)		breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						CAGCGTAGTGCAGTGGAGATC	0.453																																																1	Substitution - coding silent(1)	ovary(1)	3											74.0	74.0	74.0					3																	15749562		2031	4196	6227	15724566	SO:0001819	synonymous_variant	23243			AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.1326G>A	3.37:g.15749562C>T		Unknown		x	x	x	15724566	B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Silent	SNP	ENST00000399451.2	37	CCDS46769.1	SNP	25	Broad																																																																																				0.453	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339758.1	NM_015199		Silent
SCN5A	6331	broad.mit.edu	37	3	38592052	38592052	+	Silent	SNP	G	G	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr3:38592052G>A	ENST00000333535.4	-	28	5960	c.5811C>T	c.(5809-5811)tcC>tcT	p.S1937S	SCN5A_ENST00000423572.2_Silent_p.S1936S|SCN5A_ENST00000414099.2_Silent_p.S1919S|SCN5A_ENST00000455624.2_Silent_p.S1904S|SCN5A_ENST00000443581.1_Silent_p.S1936S|SCN5A_ENST00000425664.1_Silent_p.S1919S|SCN5A_ENST00000450102.2_Silent_p.S1883S|SCN5A_ENST00000449557.2_Silent_p.S1883S|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Silent_p.S1883S|SCN5A_ENST00000413689.1_Silent_p.S1937S			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1937					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.S1937S(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CATCCTCTTCGGAGAGGCCGC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	3											41.0	49.0	46.0					3																	38592052		2053	4188	6241	38567056	SO:0001819	synonymous_variant	6331			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5811C>T	3.37:g.38592052G>A		Unknown		x	x	x	38567056	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	37	CCDS46796.1	SNP	39	Broad																																																																																				0.627	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		Silent
TM4SF4	7104	broad.mit.edu	37	3	149216648	149216648	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr3:149216648G>T	ENST00000305354.4	+	4	1445	c.541G>T	c.(541-543)Ggc>Tgc	p.G181C		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	181					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)		p.G181C(1)		large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GGTGGTCAATGGCCTCCTGGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											102.0	107.0	105.0					3																	149216648		1951	4149	6100	150699338	SO:0001583	missense	7104				CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.541G>T	3.37:g.149216648G>T	ENSP00000305852:p.Gly181Cys	Unknown		x	x	x	150699338	B2RDA4	Missense_Mutation	SNP	ENST00000305354.4	37	CCDS46932.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830808	0.71258	.	.	ENSG00000169903	ENST00000305354	T	0.35789	1.29	5.9	4.85	0.62838	.	0.045012	0.85682	D	0.000000	T	0.67896	0.2942	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75351	-0.3348	10	0.87932	D	0	-0.0421	15.9431	0.79773	0.0745:0.0:0.9255:0.0	.	181	P48230	T4S4_HUMAN	C	181	ENSP00000305852:G181C	ENSP00000305852:G181C	G	+	1	0	TM4SF4	150699338	1.000000	0.71417	0.982000	0.44146	0.992000	0.81027	6.396000	0.73234	2.788000	0.95919	0.650000	0.86243	GGC		0.567	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1			Missense_Mutation
CLDN11	5010	broad.mit.edu	37	3	170150371	170150371	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr3:170150371A>G	ENST00000064724.3	+	3	653	c.451A>G	c.(451-453)Atc>Gtc	p.I151V	CLDN11_ENST00000489485.1_3'UTR|CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_005602.5	NP_005593.2	O75508	CLD11_HUMAN	claudin 11	151					axon ensheathment (GO:0008366)|calcium-independent cell-cell adhesion (GO:0016338)|spermatogenesis (GO:0007283)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.I151V(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|liver(2)|lung(3)|ovary(2)	12	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TGAGACCACCATCGTGAGCTT	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											176.0	161.0	166.0					3																	170150371		2203	4300	6503	171633065	SO:0001583	missense	5010			AF068863	CCDS3213.1	3q26.2-q26.3	2008-08-01	2008-08-01		ENSG00000013297	ENSG00000013297		"""Claudins"""	8514	protein-coding gene	gene with protein product		601326	"""oligodendrocyte transmembrane protein"""	OTM		8661061, 8797478	Standard	NM_005602		Approved	OSP	uc003fgx.3	O75508	OTTHUMG00000158940	ENST00000064724.3:c.451A>G	3.37:g.170150371A>G	ENSP00000064724:p.Ile151Val	Unknown		x	x	x	171633065	B2R7C1|D3DNQ5|Q5U0P3	Missense_Mutation	SNP	ENST00000064724.3	37	CCDS3213.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	14.94	2.685281	0.47991	.	.	ENSG00000013297	ENST00000064724	D	0.88431	-2.38	5.83	4.67	0.58626	.	0.109044	0.64402	D	0.000008	T	0.80974	0.4727	N	0.17248	0.465	0.80722	D	1	B	0.26445	0.149	B	0.29524	0.103	T	0.76258	-0.3025	10	0.45353	T	0.12	.	11.6789	0.51446	0.9311:0.0:0.0689:0.0	.	151	O75508	CLD11_HUMAN	V	151	ENSP00000064724:I151V	ENSP00000064724:I151V	I	+	1	0	CLDN11	171633065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.045000	0.57368	1.037000	0.40024	0.533000	0.62120	ATC		0.617	CLDN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352403.1	NM_005602		Missense_Mutation
TRA2B	6434	broad.mit.edu	37	3	185639898	185639898	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr3:185639898T>C	ENST00000453386.2	-	5	814	c.539A>G	c.(538-540)aAt>aGt	p.N180S	TRA2B_ENST00000382191.4_Missense_Mutation_p.N80S	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	180	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.N180S(1)		breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						CTCCATTCCATTGGCACGTTC	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											134.0	125.0	128.0					3																	185639898		2203	4300	6503	187122592	SO:0001583	missense	6434			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.539A>G	3.37:g.185639898T>C	ENSP00000416959:p.Asn180Ser	Unknown		x	x	x	187122592	B4DVK2|D3DNU3|O15449|Q15815|Q64283	Missense_Mutation	SNP	ENST00000453386.2	37	CCDS33905.1	SNP	52	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.56|12.56	1.973228|1.973228	0.34848|0.34848	.|.	.|.	ENSG00000136527|ENSG00000136527	ENST00000259043|ENST00000453386;ENST00000382191	.|T;T	.|0.79653	.|0.88;-1.29	6.17|6.17	5.02|5.02	0.67125|0.67125	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82508|0.82508	0.5052|0.5052	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|B;B	.|0.29188	.|0.236;0.236	.|B;B	.|0.40982	.|0.345;0.345	T|T	0.79329|0.79329	-0.1848|-0.1848	5|10	.|0.39692	.|T	.|0.17	-10.6602|-10.6602	11.3322|11.3322	0.49484|0.49484	0.0:0.0713:0.0:0.9287|0.0:0.0713:0.0:0.9287	.|.	.|180;180	.|B2RDQ3;P62995	.|.;TRA2B_HUMAN	V|S	39|180;80	.|ENSP00000416959:N180S;ENSP00000371626:N80S	.|ENSP00000371626:N80S	M|N	-|-	1|2	0|0	TRA2B|TRA2B	187122592|187122592	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.997000|7.997000	0.88414|0.88414	1.160000|1.160000	0.42584|0.42584	0.533000|0.533000	0.62120|0.62120	ATG|AAT		0.418	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344984.1	NM_004593		Missense_Mutation
GRK6	2870	broad.mit.edu	37	5	176857884	176857884	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr5:176857884A>T	ENST00000355472.5	+	2	232	c.64A>T	c.(64-66)Aat>Tat	p.N22Y	GRK6_ENST00000393576.3_Missense_Mutation_p.N22Y|GRK6_ENST00000355958.5_Missense_Mutation_p.N22Y|GRK6_ENST00000528793.1_Missense_Mutation_p.N22Y|GRK6_ENST00000507633.1_Missense_Mutation_p.N22Y	NM_001004106.2|NM_002082.3	NP_001004106.1|NP_002073.2	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6	22	N-terminal.				regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)	p.N22Y(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(5)|stomach(1)	25	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCGGTGGAAATCGCAAAGG	0.617																																																1	Substitution - Missense(1)	ovary(1)	5											72.0	63.0	66.0					5																	176857884		2203	4300	6503	176790490	SO:0001583	missense	2870				CCDS34303.1, CCDS43406.1, CCDS47348.1	5q35	2011-01-14	2004-02-04	2004-02-06	ENSG00000198055	ENSG00000198055			4545	protein-coding gene	gene with protein product		600869		GPRK6		8415712	Standard	NM_002082		Approved		uc021yiu.1	P43250	OTTHUMG00000163401	ENST00000355472.5:c.64A>T	5.37:g.176857884A>T	ENSP00000347655:p.Asn22Tyr	Unknown		x	x	x	176790490	O60541|Q13652	Missense_Mutation	SNP	ENST00000355472.5	37	CCDS34303.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518139	0.44763	.	.	ENSG00000198055	ENST00000355472;ENST00000507633;ENST00000393576;ENST00000355958;ENST00000528793	T;T;T;T;T	0.72615	-0.34;-0.35;-0.67;-0.34;-0.36	4.83	4.83	0.62350	.	0.050785	0.85682	D	0.000000	T	0.70351	0.3214	N	0.12182	0.205	0.80722	D	1	B;B;D	0.67145	0.022;0.005;0.996	B;B;D	0.70227	0.007;0.013;0.968	T	0.74231	-0.3732	10	0.45353	T	0.12	-15.4788	14.3978	0.67022	1.0:0.0:0.0:0.0	.	22;22;22	P43250;P43250-2;D6RHX8	GRK6_HUMAN;.;.	Y	22	ENSP00000347655:N22Y;ENSP00000427581:N22Y;ENSP00000377204:N22Y;ENSP00000348230:N22Y;ENSP00000433511:N22Y	ENSP00000347655:N22Y	N	+	1	0	GRK6	176790490	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	4.891000	0.63185	1.794000	0.52575	0.379000	0.24179	AAT		0.617	GRK6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373204.1	NM_002082		Missense_Mutation
LRRC16A	55604	broad.mit.edu	37	6	25517617	25517617	+	Silent	SNP	T	T	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr6:25517617T>C	ENST00000329474.6	+	22	2216	c.1848T>C	c.(1846-1848)ttT>ttC	p.F616F		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	616					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)	p.F616F(1)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CACAAGGCTTTCAGGATATAG	0.323																																																1	Substitution - coding silent(1)	ovary(1)	6											115.0	109.0	111.0					6																	25517617		1843	4091	5934	25625596	SO:0001819	synonymous_variant	55604			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1848T>C	6.37:g.25517617T>C		Unknown		x	x	x	25625596	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Silent	SNP	ENST00000329474.6	37	CCDS54973.1	SNP	62	Broad																																																																																				0.323	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640		Silent
MAD1L1	8379	broad.mit.edu	37	7	2255794	2255794	+	Silent	SNP	C	C	A	rs200142472		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr7:2255794C>A	ENST00000406869.1	-	8	1364	c.807G>T	c.(805-807)ctG>ctT	p.L269L	MAD1L1_ENST00000399654.2_Silent_p.L269L|MAD1L1_ENST00000265854.7_Silent_p.L269L|MAD1L1_ENST00000486340.1_5'Flank|MAD1L1_ENST00000402746.1_Silent_p.L177L			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	269					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)		p.L269L(1)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CCCCTCACCGCAGGTGCGCGC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	7											47.0	54.0	51.0					7																	2255794		2008	4164	6172	2222320	SO:0001819	synonymous_variant	8379			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.807G>T	7.37:g.2255794C>A		Unknown		x	x	x	2222320	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	ENST00000406869.1	37	CCDS43539.1	SNP	25	Broad																																																																																				0.647	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550		Silent
ABCB5	340273	broad.mit.edu	37	7	20685402	20685402	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr7:20685402G>T	ENST00000404938.2	+	8	1354	c.702G>T	c.(700-702)aaG>aaT	p.K234N	ABCB5_ENST00000406935.1_5'Flank|ABCB5_ENST00000258738.6_5'Flank|ABCB5_ENST00000443026.2_5'Flank	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	234	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TGACCAGTAAGGAATTAAGTG	0.403																																																0			7											132.0	122.0	125.0					7																	20685402		1568	3582	5150	20651927	SO:0001583	missense	340273			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.702G>T	7.37:g.20685402G>T	ENSP00000384881:p.Lys234Asn	Unknown		x	x	x	20651927	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018687	0.54576	.	.	ENSG00000004846	ENST00000404938	D	0.91011	-2.77	4.79	1.67	0.24075	.	.	.	.	.	D	0.92264	0.7546	M	0.62266	1.93	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.88980	0.3407	9	0.54805	T	0.06	.	4.9639	0.14080	0.2152:0.0:0.6233:0.1615	.	234	A7BKA4	.	N	234	ENSP00000384881:K234N	ENSP00000384881:K234N	K	+	3	2	ABCB5	20651927	0.999000	0.42202	0.999000	0.59377	0.895000	0.52256	0.503000	0.22610	0.349000	0.23975	-0.122000	0.15005	AAG		0.403	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		Missense_Mutation
NPC1L1	29881	broad.mit.edu	37	7	44579342	44579342	+	Silent	SNP	G	G	T	rs141358485	byFrequency	TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr7:44579342G>T	ENST00000289547.4	-	2	709	c.654C>A	c.(652-654)atC>atA	p.I218I	NPC1L1_ENST00000381160.3_Silent_p.I218I|NPC1L1_ENST00000546276.1_Silent_p.I218I|NPC1L1_ENST00000423141.1_Silent_p.I218I	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	218					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.I218I(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GGTGGAAGGTGATGTCCAGTG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	7											91.0	79.0	83.0					7																	44579342		2203	4300	6503	44545867	SO:0001819	synonymous_variant	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.654C>A	7.37:g.44579342G>T		Unknown		x	x	x	44545867	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1	SNP	45	Broad																																																																																				0.607	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		Silent
MUC17	140453	broad.mit.edu	37	7	100685760	100685760	+	Missense_Mutation	SNP	C	C	A	rs140881970	byFrequency	TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr7:100685760C>A	ENST00000306151.4	+	3	11127	c.11063C>A	c.(11062-11064)aCg>aAg	p.T3688K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3688	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T3688K(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAATCTGGACGCCTAGTGAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	7											208.0	197.0	201.0					7																	100685760		2203	4300	6503	100472480	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11063C>A	7.37:g.100685760C>A	ENSP00000302716:p.Thr3688Lys	Unknown		x	x	x	100472480	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	c	7.431	0.638671	0.14386	.	.	ENSG00000169876	ENST00000306151	T	0.02863	4.13	1.71	-1.41	0.08941	.	.	.	.	.	T	0.05593	0.0147	N	0.24115	0.695	0.09310	N	1	D	0.63046	0.992	D	0.72075	0.976	T	0.43861	-0.9365	9	0.39692	T	0.17	.	8.2246	0.31562	0.0:0.5411:0.4589:0.0	.	3688	Q685J3	MUC17_HUMAN	K	3688	ENSP00000302716:T3688K	ENSP00000302716:T3688K	T	+	2	0	MUC17	100472480	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.620000	0.24403	0.002000	0.14630	0.186000	0.17326	ACG		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Missense_Mutation
ZBTB10	65986	broad.mit.edu	37	8	81430806	81430806	+	Nonsense_Mutation	SNP	G	G	A	rs190969114	byFrequency	TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr8:81430806G>A	ENST00000430430.1	+	5	2908	c.2129G>A	c.(2128-2130)tGg>tAg	p.W710*	ZBTB10_ENST00000426744.2_Nonsense_Mutation_p.W686*|ZBTB10_ENST00000379091.4_Nonsense_Mutation_p.W418*|ZBTB10_ENST00000455036.3_Nonsense_Mutation_p.W710*	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	710					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W686*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			CAAGAAACCTGGGAAAATGGC	0.308																																																1	Substitution - Nonsense(1)	ovary(1)	8											39.0	32.0	35.0					8																	81430806		1771	4006	5777	81593361	SO:0001587	stop_gained	65986			AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.2129G>A	8.37:g.81430806G>A	ENSP00000387462:p.Trp710*	Unknown		x	x	x	81593361	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Nonsense_Mutation	SNP	ENST00000430430.1	37	CCDS47880.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.653489	0.96724	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	.	.	.	5.76	5.76	0.90799	.	0.203730	0.43579	D	0.000551	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	20.3431	0.98773	0.0:0.0:1.0:0.0	.	.	.	.	X	418;710;686;710;536	.	ENSP00000368384:W418X	W	+	2	0	ZBTB10	81593361	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.039000	0.64185	2.880000	0.98712	0.650000	0.86243	TGG		0.308	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929		Nonsense_Mutation
PKHD1L1	93035	broad.mit.edu	37	8	110397798	110397798	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr8:110397798A>T	ENST00000378402.5	+	6	612	c.508A>T	c.(508-510)Act>Tct	p.T170S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	170	IPT/TIG 2.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T170S(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CAGAATCTTCACTGATGTCTA	0.308										HNSCC(38;0.096)																																						1	Substitution - Missense(1)	ovary(1)	8											64.0	62.0	63.0					8																	110397798		1805	4064	5869	110466974	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.508A>T	8.37:g.110397798A>T	ENSP00000367655:p.Thr170Ser	Unknown		x	x	x	110466974	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	21.1	4.096468	0.76870	.	.	ENSG00000205038	ENST00000378402	T	0.58652	0.32	5.58	5.58	0.84498	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.061178	0.64402	D	0.000005	T	0.71281	0.3321	M	0.79926	2.475	0.37588	D	0.920081	D	0.63046	0.992	P	0.57283	0.817	T	0.74970	-0.3482	10	0.29301	T	0.29	.	13.699	0.62597	1.0:0.0:0.0:0.0	.	170	Q86WI1	PKHL1_HUMAN	S	170	ENSP00000367655:T170S	ENSP00000367655:T170S	T	+	1	0	PKHD1L1	110466974	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.639000	0.74314	2.129000	0.65627	0.454000	0.30748	ACT		0.308	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		Missense_Mutation
PTPRD	5789	broad.mit.edu	37	9	8497241	8497241	+	Splice_Site	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr9:8497241C>A	ENST00000381196.4	-	23	2893		c.e23+1		PTPRD_ENST00000540109.1_Splice_Site|PTPRD_ENST00000356435.5_Splice_Site|PTPRD_ENST00000471274.1_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Splice_Site|PTPRD_ENST00000358503.5_Intron|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000397617.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.?(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AAATTACTCACATGTTCAGTA	0.333										TSP Lung(15;0.13)																																						2	Unknown(2)	ovary(1)|lung(1)	9											81.0	73.0	76.0					9																	8497241		2203	4300	6503	8487241	SO:0001630	splice_region_variant	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2349+1G>T	9.37:g.8497241C>A		Unknown		x	x	x	8487241	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Splice_Site_SNP	SNP	ENST00000381196.4	37	CCDS43786.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434766	0.83885	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000540109	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0128	0.97467	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPRD	8487241	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.380000	0.79704	2.827000	0.97445	0.650000	0.86243	.		0.333	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		Intron	Splice_Site_SNP
ZNF79	7633	broad.mit.edu	37	9	130198267	130198267	+	Nonsense_Mutation	SNP	C	C	T			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr9:130198267C>T	ENST00000342483.5	+	4	719	c.313C>T	c.(313-315)Cga>Tga	p.R105*	ZNF79_ENST00000543471.1_Nonsense_Mutation_p.R81*	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	105	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R105*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						CGAAGACCTGCGAAGTCCCTC	0.498																																																1	Substitution - Nonsense(1)	ovary(1)	9											103.0	93.0	97.0					9																	130198267		2203	4300	6503	129238088	SO:0001587	stop_gained	7633			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.313C>T	9.37:g.130198267C>T	ENSP00000362446:p.Arg105*	Unknown		x	x	x	129238088	Q5VVW1|Q96NV1	Nonsense_Mutation	SNP	ENST00000342483.5	37	CCDS6871.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633586	0.87660	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	.	.	.	3.79	-2.71	0.05986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.1557	0.20335	0.2376:0.468:0.2943:0.0	.	.	.	.	X	105;81	.	ENSP00000362446:R105X	R	+	1	2	ZNF79	129238088	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.092000	0.11129	-0.399000	0.07668	-1.014000	0.02459	CGA		0.498	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1	NM_007135		Nonsense_Mutation
WNK3	65267	broad.mit.edu	37	X	54321213	54321213	+	Missense_Mutation	SNP	G	G	A	rs373983548		TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chrX:54321213G>A	ENST00000375159.2	-	7	1465	c.1466C>T	c.(1465-1467)aCg>aTg	p.T489M	WNK3_ENST00000375169.3_Missense_Mutation_p.T489M|WNK3_ENST00000354646.2_Missense_Mutation_p.T489M			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	489					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.T489M(2)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CTTTATTGGCGTCACCCGGTC	0.448																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	X						G	MET/THR,MET/THR	0,3835		0,0,0,1632,571	72.0	65.0	68.0		1466,1466	4.9	1.0	X		68	2,6726		0,1,1,2427,1871	no	missense,missense	WNK3	NM_001002838.3,NM_020922.4	81,81	0,1,1,4059,2442	AA,AG,A,GG,G		0.0297,0.0,0.0189	probably-damaging,probably-damaging	489/1744,489/1801	54321213	2,10561	2203	4300	6503	54337938	SO:0001583	missense	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1466C>T	X.37:g.54321213G>A	ENSP00000364301:p.Thr489Met	Unknown		x	x	x	54337938	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825096	0.50739	0.0	2.97E-4	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.70749	-0.49;-0.51;-0.51	4.89	4.89	0.63831	.	0.260386	0.27402	N	0.019521	T	0.67221	0.2870	N	0.19112	0.55	0.09310	N	1	D;D	0.64830	0.994;0.989	P;P	0.55667	0.781;0.608	T	0.61758	-0.6997	10	0.56958	D	0.05	-3.5841	11.8628	0.52476	0.0:0.1727:0.8273:0.0	.	489;489	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	M	489	ENSP00000364312:T489M;ENSP00000346667:T489M;ENSP00000364301:T489M	ENSP00000346667:T489M	T	-	2	0	WNK3	54337938	0.063000	0.20901	0.952000	0.39060	0.705000	0.40729	2.407000	0.44565	2.001000	0.58596	0.594000	0.82650	ACG		0.448	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		Missense_Mutation
XKRX	402415	broad.mit.edu	37	X	100169657	100169657	+	Silent	SNP	G	G	T	rs61740851	byFrequency	TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chrX:100169657G>T	ENST00000372956.2	-	3	1624	c.1020C>A	c.(1018-1020)gtC>gtA	p.V340V	XKRX_ENST00000328526.5_Silent_p.V353V|XKRX_ENST00000468904.1_3'UTR			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	340				V -> A (in Ref. 3; BAG59304). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V353V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						GCCCTTTGTCGACGAGATCTC	0.483																																																1	Substitution - coding silent(1)	ovary(1)	X											172.0	158.0	163.0					X																	100169657		2203	4300	6503	100056313	SO:0001819	synonymous_variant	402415			AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.1020C>A	X.37:g.100169657G>T		Unknown		x	x	x	100056313	B2RNN6|B4DKU2|Q5H9J6	Silent	SNP	ENST00000372956.2	37	CCDS14476.2	SNP	37	Broad																																																																																				0.483	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057501.3	NM_212559		Silent
DCAF12L2	340578	broad.mit.edu	37	X	125299722	125299722	+	Silent	SNP	C	C	A			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chrX:125299722C>A	ENST00000360028.2	-	1	212	c.186G>T	c.(184-186)gcG>gcT	p.A62A	DCAF12L2_ENST00000538699.1_Silent_p.A62A			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	62								p.A62A(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CTGGGCCCCGCGCTCCTACCT	0.731																																																1	Substitution - coding silent(1)	ovary(1)	X											14.0	18.0	17.0					X																	125299722		2159	4171	6330	125127403	SO:0001819	synonymous_variant	340578			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.186G>T	X.37:g.125299722C>A		Unknown		x	x	x	125127403	B2RN42	Silent	SNP	ENST00000360028.2	37	CCDS43991.1	SNP	27	Broad																																																																																				0.731	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		Silent
DDX60L	91351	broad.mit.edu	37	4	169374281	169374307	+	In_Frame_Del	DEL	TAAGAAAGAATCACTGTTCCTAATCCA	TAAGAAAGAATCACTGTTCCTAATCCA	-			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr4:169374281_169374307delTAAGAAAGAATCACTGTTCCTAATCCA	ENST00000511577.1	-	8	1211_1237	c.964_990delTGGATTAGGAACAGTGATTCTTTCTTA	c.(964-990)tggattaggaacagtgattctttcttadel	p.WIRNSDSFL322del	DDX60L_ENST00000505890.1_In_Frame_Del_p.WIRNSDSFL322del|DDX60L_ENST00000260184.7_In_Frame_Del_p.WIRNSDSFL322del			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	322							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)	p.W322_L330delWIRNSDSFL(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTACCATTTTTAAGAAAGAATCACTGTTCCTAATCCAAGAGCATGTG	0.383																																																1	Deletion - In frame(1)	ovary(1)	4																																								169610882	SO:0001651	inframe_deletion	91351			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.964_990delTGGATTAGGAACAGTGATTCTTTCTTA	4.37:g.169374281_169374307delTAAGAAAGAATCACTGTTCCTAATCCA	ENSP00000422423:p.Trp322_Leu330del	Unknown		Capture	Illumina GAIIx	Phase_I	169610856	Q96ND6	In_Frame_Del	DEL	ENST00000511577.1	37		DEL	61	Broad																																																																																				0.383	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967		In_Frame_Del
LATS1	9113	broad.mit.edu	37	6	150023030	150023030	+	Frame_Shift_Del	DEL	A	A	-			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr6:150023030delA	ENST00000543571.1	-	2	780	c.233delT	c.(232-234)ttgfs	p.L78fs	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Frame_Shift_Del_p.L78fs|LATS1_ENST00000392273.3_Frame_Shift_Del_p.L78fs	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.L78fs*54(1)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AATTTCCTGCAAGGCTTTATG	0.413																																																1	Deletion - Frameshift(1)	ovary(1)	6											173.0	168.0	169.0					6																	150023030		2203	4300	6503	150064723	SO:0001589	frameshift_variant	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.233delT	6.37:g.150023030delA	ENSP00000437550:p.Leu78fs	Unknown		Capture	Illumina GAIIx	Phase_I	150064723		Frame_Shift_Del	DEL	ENST00000543571.1	37	CCDS34551.1	DEL	5	Broad																																																																																				0.413	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690		Frame_Shift_Del
SAMD9L	219285	broad.mit.edu	37	7	92763627	92763628	+	Frame_Shift_Ins	INS	-	-	C			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chr7:92763627_92763628insC	ENST00000318238.4	-	5	2873_2874	c.1657_1658insG	c.(1657-1659)gtgfs	p.V553fs	SAMD9L_ENST00000437805.1_Frame_Shift_Ins_p.V553fs|SAMD9L_ENST00000411955.1_Frame_Shift_Ins_p.V553fs	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	553					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.V553fs*10(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TGGGCTTTCCACTGAAGAGAGT	0.347																																																1	Insertion - Frameshift(1)	ovary(1)	7																																								92601564	SO:0001589	frameshift_variant	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1658dupG	7.37:g.92763628_92763628dupC	ENSP00000326247:p.Val553fs	Unknown		Capture	Illumina GAIIx	Phase_I	92601563	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Frame_Shift_Ins	INS	ENST00000318238.4	37	CCDS34681.1	INS	6	Broad																																																																																				0.347	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		Frame_Shift_Ins
BCORL1	63035	broad.mit.edu	37	X	129149426	129149441	+	Frame_Shift_Del	DEL	GCTCCTTCGTTCCAGA	GCTCCTTCGTTCCAGA	-			TCGA-30-1891-01	TCGA-30-1891-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-30-1891-01	TCGA-30-1891-10	g.chrX:129149426_129149441delGCTCCTTCGTTCCAGA	ENST00000218147.7	+	4	2875_2890	c.2678_2693delGCTCCTTCGTTCCAGA	c.(2677-2694)ggctccttcgttccagagfs	p.GSFVPE893fs	BCORL1_ENST00000540052.1_Frame_Shift_Del_p.GSFVPE893fs|BCORL1_ENST00000359304.2_Frame_Shift_Del_p.GSFVPE893fs|BCORL1_ENST00000303743.5_Frame_Shift_Del_p.GSFVPE893fs			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	893					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S894fs*26(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CGGCCTGGGGGCTCCTTCGTTCCAGAGCAGGACCCT	0.565																																																1	Deletion - Frameshift(1)	ovary(1)	X																																								128977122	SO:0001589	frameshift_variant	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2678_2693delGCTCCTTCGTTCCAGA	X.37:g.129149426_129149441delGCTCCTTCGTTCCAGA	ENSP00000218147:p.Gly893fs	Unknown		Capture	Illumina GAIIx	Phase_I	128977107	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Frame_Shift_Del	DEL	ENST00000218147.7	37	CCDS14616.1	DEL	42	Broad																																																																																				0.565	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		Frame_Shift_Del
