#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
HSPG2	3339	broad.mit.edu	37	1	22168767	22168767	+	Missense_Mutation	SNP	G	G	A	rs376414322		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr1:22168767G>A	ENST00000374695.3	-	68	9096	c.9017C>T	c.(9016-9018)aCa>aTa	p.T3006I		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3006	Ig-like C2-type 15.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.T3006I(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GACGGTGACTGTGAAGGAGGC	0.662													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18338	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						G	ILE/THR	1,4405	2.1+/-5.4	0,1,2202	58.0	54.0	55.0		9017	2.0	0.2	1		55	0,8600		0,0,4300	no	missense	HSPG2	NM_005529.5	89	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	3006/4392	22168767	1,13005	2203	4300	6503	22041354	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9017C>T	1.37:g.22168767G>A	ENSP00000363827:p.Thr3006Ile	Unknown		x	x	x	22041354	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	1.594	-0.528254	0.04112	2.27E-4	0.0	ENSG00000142798	ENST00000374695	T	0.13307	2.6	4.95	1.97	0.26223	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.435561	0.16945	N	0.193123	T	0.12987	0.0315	L	0.52759	1.655	0.09310	N	1	B;B	0.27765	0.066;0.188	B;B	0.34038	0.155;0.174	T	0.26360	-1.0105	10	0.38643	T	0.18	.	5.1169	0.14838	0.2479:0.0:0.6016:0.1504	.	946;3006	Q59EG0;P98160	.;PGBM_HUMAN	I	3006	ENSP00000363827:T3006I	ENSP00000363827:T3006I	T	-	2	0	HSPG2	22041354	0.000000	0.05858	0.190000	0.23270	0.088000	0.18126	-0.157000	0.10085	0.111000	0.17947	-0.448000	0.05591	ACA		0.662	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		Missense_Mutation
C1orf87	127795	broad.mit.edu	37	1	60505704	60505704	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr1:60505704C>T	ENST00000371201.3	-	5	739	c.632G>A	c.(631-633)gGa>gAa	p.G211E	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	211							calcium ion binding (GO:0005509)	p.G211E(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GAGAAGAAATCCTGAAGAGAT	0.433																																					NSCLC(75;811 1386 4923 13371 51772)											1	Substitution - Missense(1)	ovary(1)	1											105.0	118.0	113.0					1																	60505704		2203	4300	6503	60278292	SO:0001583	missense	127795			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.632G>A	1.37:g.60505704C>T	ENSP00000360244:p.Gly211Glu	Unknown		x	x	x	60278292	Q6ZU07|Q8IVS0	Missense_Mutation	SNP	ENST00000371201.3	37	CCDS614.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878538	0.72294	.	.	ENSG00000162598	ENST00000371201	T	0.63255	-0.03	5.18	5.18	0.71444	EF-hand-like domain (1);	0.000000	0.52532	D	0.000067	T	0.72930	0.3522	M	0.63843	1.955	0.80722	D	1	P	0.42785	0.79	P	0.54401	0.751	T	0.75178	-0.3409	10	0.87932	D	0	-22.3915	15.7235	0.77732	0.0:1.0:0.0:0.0	.	211	Q8N0U7	CA087_HUMAN	E	211	ENSP00000360244:G211E	ENSP00000360244:G211E	G	-	2	0	C1orf87	60278292	0.987000	0.35691	1.000000	0.80357	0.775000	0.43874	2.683000	0.46943	2.710000	0.92621	0.650000	0.86243	GGA		0.433	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377		Missense_Mutation
RPRD2	23248	broad.mit.edu	37	1	150443802	150443802	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr1:150443802G>A	ENST00000369068.4	+	11	2382	c.2378G>A	c.(2377-2379)gGt>gAt	p.G793D	RPRD2_ENST00000539519.1_Missense_Mutation_p.G767D|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.G767D	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	793	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)		p.G793D(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CGACCCTTTGGTCTGGGCAGT	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	73.0	75.0					1																	150443802		1880	4112	5992	148710426	SO:0001583	missense	23248			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2378G>A	1.37:g.150443802G>A	ENSP00000358064:p.Gly793Asp	Unknown		x	x	x	148710426	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319831	0.60634	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.59772	0.3;0.24;0.3	5.0	5.0	0.66597	.	0.134498	0.49916	D	0.000140	T	0.49881	0.1583	L	0.27053	0.805	0.36667	D	0.878279	D;D;D	0.57257	0.964;0.964;0.979	P;P;P	0.53518	0.452;0.539;0.728	T	0.55347	-0.8155	10	0.54805	T	0.06	-10.1098	18.5409	0.91027	0.0:0.0:1.0:0.0	.	767;793;767	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	D	767;767;793	ENSP00000383785:G767D;ENSP00000445482:G767D;ENSP00000358064:G793D	ENSP00000358064:G793D	G	+	2	0	RPRD2	148710426	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.757000	0.55212	2.608000	0.88229	0.650000	0.86243	GGT		0.498	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203		Missense_Mutation
CHIT1	1118	broad.mit.edu	37	1	203194187	203194187	+	Silent	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr1:203194187G>A	ENST00000367229.1	-	4	337	c.303C>T	c.(301-303)ttC>ttT	p.F101F	CHIT1_ENST00000255427.3_Intron|CHIT1_ENST00000535569.1_Intron|CHIT1_ENST00000484834.1_5'UTR	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	101					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)	p.F101F(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						TCTGAGTGCCGAAATTCCAGC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	1											75.0	67.0	70.0					1																	203194187		2203	4300	6503	201460810	SO:0001819	synonymous_variant	1118			U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.303C>T	1.37:g.203194187G>A		Unknown		x	x	x	201460810	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Silent	SNP	ENST00000367229.1	37	CCDS1436.1	SNP	37	Broad																																																																																				0.567	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465		Silent
C1orf95	375057	broad.mit.edu	37	1	226784593	226784593	+	Missense_Mutation	SNP	C	C	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr1:226784593C>A	ENST00000366788.3	+	2	398	c.293C>A	c.(292-294)gCa>gAa	p.A98E	C1orf95_ENST00000366789.4_Missense_Mutation_p.A98E	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	98						integral component of membrane (GO:0016021)		p.A98E(1)		large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		CTGAACATTGCAGCAGCCCTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											164.0	142.0	149.0					1																	226784593		2203	4300	6503	224851216	SO:0001583	missense	375057			AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.293C>A	1.37:g.226784593C>A	ENSP00000355752:p.Ala98Glu	Unknown		x	x	x	224851216	A6NGL2	Missense_Mutation	SNP	ENST00000366788.3	37	CCDS31044.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039429	0.93630	.	.	ENSG00000203685	ENST00000366788;ENST00000366789	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.75722	0.3888	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.76380	-0.2980	9	0.66056	D	0.02	-0.1126	19.3828	0.94543	0.0:1.0:0.0:0.0	.	98	Q69YW2	CA095_HUMAN	E	98	.	ENSP00000355752:A98E	A	+	2	0	C1orf95	224851216	1.000000	0.71417	0.752000	0.31206	0.852000	0.48524	7.730000	0.84881	2.669000	0.90835	0.561000	0.74099	GCA		0.592	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091634.1	NM_001003665		Missense_Mutation
FRMPD2	143162	broad.mit.edu	37	10	49392827	49392827	+	Silent	SNP	C	C	T	rs148717200		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr10:49392827C>T	ENST00000374201.3	-	19	2759	c.2457G>A	c.(2455-2457)acG>acA	p.T819T	FRMPD2_ENST00000305531.3_Silent_p.T794T|FRMPD2_ENST00000407470.4_Silent_p.T787T	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	819	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.T819T(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTGGTTTGATCGTTTTTGCTT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	10						C		1,4405	2.1+/-5.4	0,1,2202	90.0	86.0	87.0		2457	3.2	0.3	10	dbSNP_134	87	0,8600		0,0,4300	no	coding-synonymous	FRMPD2	NM_001018071.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		819/1310	49392827	1,13005	2203	4300	6503	49062833	SO:0001819	synonymous_variant	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2457G>A	10.37:g.49392827C>T		Unknown		x	x	x	49062833	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	CCDS31195.1	SNP	31	Broad																																																																																				0.348	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		Silent
CCDC6	8030	broad.mit.edu	37	10	61552776	61552776	+	Missense_Mutation	SNP	G	G	A	rs199549238		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr10:61552776G>A	ENST00000263102.6	-	9	1555	c.1324C>T	c.(1324-1326)Ccg>Tcg	p.P442S		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	442	Poly-Pro.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)	p.P442S(1)	CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GGTGGAGGCGGAGGTGGCTGG	0.637			T	RET	NSCLC																																		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	1	Substitution - Missense(1)	ovary(1)	10											164.0	153.0	157.0					10																	61552776		2203	4300	6503	61222782	SO:0001583	missense	8030			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.1324C>T	10.37:g.61552776G>A	ENSP00000263102:p.Pro442Ser	Unknown		x	x	x	61222782	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	37	CCDS7257.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197594	0.58126	.	.	ENSG00000108091	ENST00000263102	T	0.44482	0.92	5.6	5.6	0.85130	.	0.103596	0.64402	D	0.000002	T	0.33118	0.0852	L	0.36672	1.1	0.80722	D	1	B	0.30793	0.295	B	0.29267	0.1	T	0.17198	-1.0377	10	0.02654	T	1	-9.6528	19.9854	0.97342	0.0:0.0:1.0:0.0	.	442	Q16204	CCDC6_HUMAN	S	442	ENSP00000263102:P442S	ENSP00000263102:P442S	P	-	1	0	CCDC6	61222782	1.000000	0.71417	0.972000	0.41901	0.982000	0.71751	9.420000	0.97426	2.786000	0.95864	0.563000	0.77884	CCG		0.637	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436		Missense_Mutation
OPN4	94233	broad.mit.edu	37	10	88419652	88419652	+	Splice_Site	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr10:88419652G>A	ENST00000241891.5	+	6	968	c.801G>A	c.(799-801)cgG>cgA	p.R267R	OPN4_ENST00000372071.2_Splice_Site_p.R278R	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	267					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)	p.R278R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						TCCTTCCTAGGGCTCTCCAGA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	10											94.0	71.0	78.0					10																	88419652		2203	4300	6503	88409632	SO:0001630	splice_region_variant	94233			AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.801-1G>A	10.37:g.88419652G>A		Unknown		x	x	x	88409632	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Silent	SNP	ENST00000241891.5	37	CCDS7376.1	SNP	43	Broad																																																																																				0.637	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	Silent	Silent
MYOF	26509	broad.mit.edu	37	10	95089472	95089472	+	Missense_Mutation	SNP	C	C	T	rs372110838		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr10:95089472C>T	ENST00000359263.4	-	44	4930	c.4931G>A	c.(4930-4932)cGa>cAa	p.R1644Q	MYOF_ENST00000358334.5_Missense_Mutation_p.R1631Q|MYOF_ENST00000371502.4_Missense_Mutation_p.R1663Q|MYOF_ENST00000485212.1_5'UTR|MYOF_ENST00000371501.4_Missense_Mutation_p.R1644Q	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1644					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.R1644Q(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGAAAGGAATCGGTTTTCCAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	10						C	GLN/ARG,GLN/ARG	0,3754		0,0,1877	118.0	116.0	117.0		4931,4892	5.3	1.0	10		117	1,8227		0,1,4113	no	missense,missense	MYOF	NM_013451.3,NM_133337.2	43,43	0,1,5990	TT,TC,CC		0.0122,0.0,0.0083	probably-damaging,probably-damaging	1644/2062,1631/2049	95089472	1,11981	1877	4114	5991	95079462	SO:0001583	missense	26509			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4931G>A	10.37:g.95089472C>T	ENSP00000352208:p.Arg1644Gln	Unknown		x	x	x	95079462	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.498707	0.96355	0.0	1.22E-4	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.3	5.3	0.74995	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.74824	0.3767	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.81545	-0.0884	10	0.87932	D	0	-10.7975	19.1392	0.93441	0.0:1.0:0.0:0.0	.	1631;1644	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	Q	1631;1644;1644;1663	ENSP00000351094:R1631Q;ENSP00000352208:R1644Q;ENSP00000360556:R1644Q;ENSP00000360557:R1663Q	ENSP00000351094:R1631Q	R	-	2	0	MYOF	95079462	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.289000	0.78701	2.765000	0.95021	0.555000	0.69702	CGA		0.433	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		Missense_Mutation
KCNJ1	3758	broad.mit.edu	37	11	128709604	128709604	+	Missense_Mutation	SNP	C	C	T	rs104894253		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr11:128709604C>T	ENST00000392664.2	-	2	708	c.592G>A	c.(592-594)Gca>Aca	p.A198T	KCNJ1_ENST00000392665.2_Missense_Mutation_p.A179T|KCNJ1_ENST00000324036.3_Missense_Mutation_p.A179T|KCNJ1_ENST00000440599.2_Missense_Mutation_p.A179T|KCNJ1_ENST00000392666.1_Missense_Mutation_p.A179T	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	198			A -> T (in BS2). {ECO:0000269|PubMed:9002665}.		cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A198T(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	CTGATCACTGCGTTCTTGCTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	11	GRCh37	CM970812	KCNJ1	M	rs104894253						82.0	76.0	78.0					11																	128709604		2199	4291	6490	128214814	SO:0001583	missense	3758			BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.592G>A	11.37:g.128709604C>T	ENSP00000376432:p.Ala198Thr	Unknown		x	x	x	128214814	B2RMR4|Q6LD67	Missense_Mutation	SNP	ENST00000392664.2	37	CCDS8476.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502723	0.85176	.	.	ENSG00000151704	ENST00000392665;ENST00000392666;ENST00000440599;ENST00000324036;ENST00000392664	D;D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63;-3.63	5.71	5.71	0.89125	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98362	0.9456	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99104	1.0844	10	0.87932	D	0	.	19.8655	0.96803	0.0:1.0:0.0:0.0	.	198	P48048	IRK1_HUMAN	T	179;179;179;179;198	ENSP00000376433:A179T;ENSP00000376434:A179T;ENSP00000406320:A179T;ENSP00000316233:A179T;ENSP00000376432:A198T	ENSP00000316233:A179T	A	-	1	0	KCNJ1	128214814	1.000000	0.71417	0.344000	0.25628	0.599000	0.36880	7.805000	0.86005	2.690000	0.91761	0.514000	0.50259	GCA		0.458	KCNJ1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386233.1	NM_000220		Missense_Mutation
KCNA5	3741	broad.mit.edu	37	12	5153628	5153628	+	Silent	SNP	C	C	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr12:5153628C>A	ENST00000252321.3	+	1	544	c.315C>A	c.(313-315)ggC>ggA	p.G105G		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	105					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)	p.G105G(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CCGGCCTGGGCACGGTGGAGG	0.711																																																1	Substitution - coding silent(1)	ovary(1)	12											21.0	22.0	22.0					12																	5153628		2201	4294	6495	5023889	SO:0001819	synonymous_variant	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.315C>A	12.37:g.5153628C>A		Unknown		x	x	x	5023889	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	ENST00000252321.3	37	CCDS8536.1	SNP	25	Broad																																																																																				0.711	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234		Silent
ATXN2	6311	broad.mit.edu	37	12	111908043	111908043	+	Splice_Site	SNP	T	T	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr12:111908043T>C	ENST00000377617.3	-	20	3346	c.3185A>G	c.(3184-3186)cAt>cGt	p.H1062R	ATXN2_ENST00000550104.1_3'UTR|ATXN2_ENST00000535949.1_Splice_Site_p.H773R|ATXN2_ENST00000608853.1_Splice_Site_p.H902R|ATXN2_ENST00000389153.4_Splice_Site_p.H799R|ATXN2_ENST00000542287.2_Splice_Site_p.H797R	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1062	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.H1062R(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						GACATGAGGATGCTGTGTTCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											132.0	112.0	119.0					12																	111908043		2203	4300	6503	110392426	SO:0001630	splice_region_variant	6311			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3184-1A>G	12.37:g.111908043T>C		Unknown		x	x	x	110392426	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	37	CCDS31902.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	12.76	2.036070	0.35893	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000482777;ENST00000542287;ENST00000535949	T	0.64260	-0.09	5.46	4.29	0.51040	.	0.219434	0.47852	D	0.000212	T	0.47192	0.1432	N	0.22421	0.69	0.80722	D	1	B;B;P;B;P	0.47302	0.118;0.167;0.791;0.209;0.893	B;B;B;B;B	0.42653	0.179;0.062;0.263;0.124;0.394	T	0.30707	-0.9969	10	0.15952	T	0.53	-6.8995	12.967	0.58490	0.0:0.0:0.1349:0.8651	.	81;1062;773;797;799	Q99700-3;Q99700;Q24JQ7;F8VQP2;F8WB06	.;ATX2_HUMAN;.;.;.	R	117;799;1062;81;797;773	ENSP00000366843:H1062R	ENSP00000366843:H1062R	H	-	2	0	ATXN2	110392426	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.903000	0.39858	0.974000	0.38366	0.477000	0.44152	CAT		0.398	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	Missense_Mutation	Missense_Mutation
PITPNM2	57605	broad.mit.edu	37	12	123497236	123497236	+	Silent	SNP	G	G	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr12:123497236G>C	ENST00000542749.1	-	3	402	c.339C>G	c.(337-339)acC>acG	p.T113T	PITPNM2_ENST00000280562.5_Silent_p.T113T|PITPNM2_ENST00000392428.1_Intron|MIR4304_ENST00000580964.1_RNA|PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000320201.4_Silent_p.T113T|PITPNM2_ENST00000546049.1_Silent_p.T113T			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	113					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.T113T(1)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TTTTATAAAAGGTTTCAATGT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	12											154.0	166.0	162.0					12																	123497236		2203	4300	6503	122063189	SO:0001819	synonymous_variant	57605			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.339C>G	12.37:g.123497236G>C		Unknown		x	x	x	122063189	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1	SNP	35	Broad																																																																																				0.507	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845		Silent
NUSAP1	51203	broad.mit.edu	37	15	41641381	41641381	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr15:41641381G>A	ENST00000559596.1	+	3	335	c.248G>A	c.(247-249)gGc>gAc	p.G83D	NUSAP1_ENST00000558123.1_3'UTR|NUSAP1_ENST00000560177.1_Missense_Mutation_p.G83D|NUSAP1_ENST00000414849.2_Missense_Mutation_p.G83D|NUSAP1_ENST00000560747.1_Missense_Mutation_p.G83D|NUSAP1_ENST00000260359.6_Missense_Mutation_p.G83D|NUSAP1_ENST00000450592.2_Missense_Mutation_p.G60D|NUSAP1_ENST00000450318.1_Missense_Mutation_p.G83D			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	83					establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.G83D(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CAGCCACTTGGCCATGTCACC	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											90.0	93.0	92.0					15																	41641381		2039	4203	6242	39428673	SO:0001583	missense	51203			AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.248G>A	15.37:g.41641381G>A	ENSP00000453403:p.Gly83Asp	Unknown		x	x	x	39428673	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Missense_Mutation	SNP	ENST00000559596.1	37	CCDS45234.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892163	0.33442	.	.	ENSG00000137804	ENST00000260359;ENST00000414849;ENST00000450318;ENST00000450592	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	4.3	-2.23	0.06930	.	0.823673	0.11646	N	0.543282	T	0.19005	0.0456	L	0.43701	1.375	0.09310	N	1	B;B;B;B;B;B;B	0.21821	0.023;0.029;0.061;0.06;0.061;0.061;0.061	B;B;B;B;B;B;B	0.23716	0.016;0.024;0.033;0.032;0.048;0.033;0.033	T	0.27502	-1.0072	10	0.33940	T	0.23	.	0.9869	0.01448	0.3647:0.1505:0.3306:0.1542	.	60;83;83;83;83;83;83	E7ERR5;E9PB35;Q9BXS6-3;Q9BXS6-5;A8K4B4;Q9BXS6;Q9BXS6-2	.;.;.;.;.;NUSAP_HUMAN;.	D	83;83;83;60	ENSP00000260359:G83D;ENSP00000400746:G83D;ENSP00000401351:G83D;ENSP00000401014:G60D	ENSP00000260359:G83D	G	+	2	0	NUSAP1	39428673	0.000000	0.05858	0.000000	0.03702	0.448000	0.32197	-1.010000	0.03656	-0.391000	0.07763	-0.315000	0.08773	GGC		0.453	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419427.1	NM_016359		Missense_Mutation
CREBBP	1387	broad.mit.edu	37	16	3788596	3788596	+	Missense_Mutation	SNP	A	A	G			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr16:3788596A>G	ENST00000262367.5	-	26	5167	c.4358T>C	c.(4357-4359)aTc>aCc	p.I1453T	CREBBP_ENST00000382070.3_Missense_Mutation_p.I1415T	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1453	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.I1453T(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCCAATAAGGATCTCATGGTA	0.383			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Substitution - Missense(1)	ovary(1)	16											75.0	70.0	72.0					16																	3788596		2197	4300	6497	3728597	SO:0001583	missense	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4358T>C	16.37:g.3788596A>G	ENSP00000262367:p.Ile1453Thr	Unknown		x	x	x	3728597	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	a	19.34	3.809700	0.70797	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.93426	-3.22;-3.22	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.97343	0.9131	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.996	D	0.98290	1.0513	10	0.87932	D	0	-22.8561	15.8518	0.78937	1.0:0.0:0.0:0.0	.	1483;1453	Q4LE28;Q92793	.;CBP_HUMAN	T	1453;1483;1415;42	ENSP00000262367:I1453T;ENSP00000371502:I1415T	ENSP00000262367:I1453T	I	-	2	0	CREBBP	3728597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.215000	0.71742	0.459000	0.35465	ATC		0.383	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		Missense_Mutation
CHD9	80205	broad.mit.edu	37	16	53301839	53301839	+	Splice_Site	SNP	G	G	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr16:53301839G>T	ENST00000398510.3	+	21	4605	c.4518G>T	c.(4516-4518)ggG>ggT	p.G1506G	CHD9_ENST00000447540.1_Splice_Site_p.G1506G|CHD9_ENST00000566029.1_Splice_Site_p.G1506G|CHD9_ENST00000564845.1_Splice_Site_p.G1506G			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1506					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.G1506G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TTTTAACCAGGTGGGGCCGAT	0.353																																																1	Substitution - coding silent(1)	ovary(1)	16											76.0	70.0	72.0					16																	53301839		1812	4068	5880	51859340	SO:0001630	splice_region_variant	80205			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4518-1G>T	16.37:g.53301839G>T		Unknown		x	x	x	51859340	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	37		SNP	44	Broad																																																																																				0.353	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	Silent	Silent
ADAT1	23536	broad.mit.edu	37	16	75651145	75651145	+	Missense_Mutation	SNP	C	C	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr16:75651145C>A	ENST00000307921.3	-	6	464	c.319G>T	c.(319-321)Gca>Tca	p.A107S		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	107	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)	p.A107S(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						AGGGTGGCTGCCAACTGGAGT	0.463																																																1	Substitution - Missense(1)	ovary(1)	16											165.0	165.0	165.0					16																	75651145		2198	4300	6498	74208646	SO:0001583	missense	23536			AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.319G>T	16.37:g.75651145C>A	ENSP00000310015:p.Ala107Ser	Unknown		x	x	x	74208646	Q9NVB7|Q9UNG3	Missense_Mutation	SNP	ENST00000307921.3	37	CCDS10922.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	9.196	1.027376	0.19512	.	.	ENSG00000065457	ENST00000307921;ENST00000542252	D	0.93953	-3.32	5.59	5.59	0.84812	Adenosine deaminase/editase (3);	0.052499	0.85682	D	0.000000	D	0.92024	0.7473	L	0.51914	1.62	0.58432	D	0.999994	P	0.36110	0.537	B	0.40602	0.334	D	0.89862	0.4017	10	0.22109	T	0.4	-4.5656	18.1617	0.89710	0.0:1.0:0.0:0.0	.	107	Q9BUB4	ADAT1_HUMAN	S	107;78	ENSP00000310015:A107S	ENSP00000310015:A107S	A	-	1	0	ADAT1	74208646	1.000000	0.71417	0.923000	0.36655	0.402000	0.30811	4.977000	0.63792	2.646000	0.89796	0.411000	0.27672	GCA		0.463	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1	NM_012091		Missense_Mutation
P2RX5	5026	broad.mit.edu	37	17	3585199	3585200	+	Missense_Mutation	DNP	TC	TC	AA	rs1131057		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr17:3585199_3585200TC>AA	ENST00000225328.5	-	10	1452_1453	c.1054_1055GA>TT	c.(1054-1056)GAg>TTg	p.E352L	P2RX5_ENST00000552050.1_Missense_Mutation_p.E292L|P2RX5_ENST00000551178.1_Missense_Mutation_p.E327L|P2RX5-TAX1BP3_ENST00000550383.1_Missense_Mutation_p.E352L|P2RX5_ENST00000345901.3_Missense_Mutation_p.E328L|P2RX5_ENST00000552276.1_Missense_Mutation_p.E351L|P2RX5_ENST00000435558.1_Missense_Mutation_p.E352L|P2RX5_ENST00000547178.1_Missense_Mutation_p.E351L	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	352				E -> Q (in Ref. 1; AAB08576/AAB08577). {ECO:0000305}.	cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)	p.E352L(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						CCTCACTTCCTCGTACTTCTTG	0.55																																																1	Substitution - Missense(1)	ovary(1)	17																																								3531949	SO:0001583	missense	5026			AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.1054_1055delinsAA	17.37:g.3585199_3585200delinsAA	ENSP00000225328:p.Glu352Leu	Unknown		x	x	x	3531948	G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Missense_Mutation	DNP	ENST00000225328.5	37	CCDS11034.1	DNP	54	Broad																																																																																				0.550	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)	17											100.0	89.0	93.0					17																	7578265		2203	4300	6503	7518990	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr	Unknown		x	x	x	7518990	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ARHGEF15	22899	broad.mit.edu	37	17	8216356	8216356	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr17:8216356C>T	ENST00000361926.3	+	3	828	c.718C>T	c.(718-720)Cgg>Tgg	p.R240W	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.R240W	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	240					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R240W(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GGTCCCCCGTCGGGCCTCCCC	0.701																																																1	Substitution - Missense(1)	ovary(1)	17											48.0	57.0	54.0					17																	8216356		2203	4297	6500	8157081	SO:0001583	missense	22899			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.718C>T	17.37:g.8216356C>T	ENSP00000355026:p.Arg240Trp	Unknown		x	x	x	8157081	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	37	CCDS11139.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095505	0.36952	.	.	ENSG00000198844	ENST00000361926;ENST00000421050	T;T	0.50277	0.75;0.75	4.05	3.05	0.35203	.	0.340285	0.23887	N	0.043585	T	0.49592	0.1566	L	0.27053	0.805	0.34438	D	0.699289	D	0.76494	0.999	D	0.64687	0.928	T	0.62374	-0.6868	10	0.87932	D	0	-27.0412	9.0206	0.36198	0.22:0.78:0.0:0.0	.	240	O94989	ARHGF_HUMAN	W	240	ENSP00000355026:R240W;ENSP00000412505:R240W	ENSP00000355026:R240W	R	+	1	2	ARHGEF15	8157081	0.609000	0.26975	0.999000	0.59377	0.073000	0.16967	-0.231000	0.09069	1.250000	0.43966	0.561000	0.74099	CGG		0.701	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728		Missense_Mutation
FLII	2314	broad.mit.edu	37	17	18150528	18150528	+	Silent	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr17:18150528G>A	ENST00000327031.4	-	21	2856	c.2631C>T	c.(2629-2631)ctC>ctT	p.L877L	FLII_ENST00000379450.4_Silent_p.L791L|FLII_ENST00000579294.1_Silent_p.L866L|FLII_ENST00000578558.1_Intron|FLII_ENST00000545457.2_Silent_p.L822L	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	877					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.L877L(1)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AAAGCGCAGTGAGGTCAGCCT	0.711																																																1	Substitution - coding silent(1)	ovary(1)	17											34.0	40.0	38.0					17																	18150528		2203	4300	6503	18091253	SO:0001819	synonymous_variant	2314			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.2631C>T	17.37:g.18150528G>A		Unknown		x	x	x	18091253	B4DIL0|F5H407|J3QLG3	Silent	SNP	ENST00000327031.4	37	CCDS11192.1	SNP	45	Broad																																																																																				0.711	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018		Silent
KIAA0195	9772	broad.mit.edu	37	17	73488583	73488583	+	Missense_Mutation	SNP	A	A	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr17:73488583A>C	ENST00000314256.7	+	15	2019	c.1625A>C	c.(1624-1626)tAc>tCc	p.Y542S	KIAA0195_ENST00000375248.5_Missense_Mutation_p.Y552S|KIAA0195_ENST00000579208.1_Missense_Mutation_p.Y193S	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	542						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.Y542S(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCGACCCCTACGAAGCAGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											70.0	64.0	66.0					17																	73488583		2203	4300	6503	71000178	SO:0001583	missense	9772				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1625A>C	17.37:g.73488583A>C	ENSP00000313885:p.Tyr542Ser	Unknown		x	x	x	71000178	O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	CCDS32732.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	5.618	0.298707	0.10622	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.42131	0.99;0.98	5.77	-1.03	0.10102	.	0.715819	0.13719	N	0.367523	T	0.15262	0.0368	N	0.08118	0	0.21579	N	0.999636	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.0	T	0.13926	-1.0491	10	0.23302	T	0.38	-8.8013	0.1193	0.00063	0.2566:0.1739:0.2309:0.3387	.	552;552;542	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	S	542;552	ENSP00000313885:Y542S;ENSP00000364397:Y552S	ENSP00000313885:Y542S	Y	+	2	0	KIAA0195	71000178	0.564000	0.26602	0.039000	0.18376	0.351000	0.29236	1.428000	0.34892	0.083000	0.17047	0.459000	0.35465	TAC		0.607	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		Missense_Mutation
DLGAP1	9229	broad.mit.edu	37	18	3879897	3879897	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr18:3879897C>T	ENST00000315677.3	-	4	767	c.172G>A	c.(172-174)Gtg>Atg	p.V58M	DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000584874.1_Missense_Mutation_p.V58M|DLGAP1_ENST00000581527.1_Missense_Mutation_p.V58M|DLGAP1_ENST00000515196.2_Missense_Mutation_p.V58M	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	58					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.V58M(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				AAGGGGCCCACGCACTCAGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	18											52.0	53.0	53.0					18																	3879897		2203	4300	6503	3869897	SO:0001583	missense	9229			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.172G>A	18.37:g.3879897C>T	ENSP00000316377:p.Val58Met	Unknown		x	x	x	3869897	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	CCDS11836.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	9.017	0.983953	0.18889	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.11063	2.81;2.81	5.8	5.8	0.92144	.	0.354251	0.26995	N	0.021452	T	0.04770	0.0129	N	0.04959	-0.14	0.29526	N	0.853106	B;B;B	0.12013	0.001;0.004;0.005	B;B;B	0.12156	0.002;0.006;0.007	T	0.34551	-0.9824	10	0.14656	T	0.56	-9.3751	7.6051	0.28097	0.0:0.8067:0.0:0.1933	.	58;58;58	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	M	58	ENSP00000316377:V58M;ENSP00000445973:V58M	ENSP00000316377:V58M	V	-	1	0	DLGAP1	3869897	1.000000	0.71417	0.993000	0.49108	0.941000	0.58515	1.823000	0.39062	2.744000	0.94065	0.655000	0.94253	GTG		0.672	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			Missense_Mutation
CDC37	11140	broad.mit.edu	37	19	10506867	10506867	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr19:10506867G>A	ENST00000222005.2	-	2	168	c.115C>T	c.(115-117)Cgc>Tgc	p.R39C		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	39					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.R39C(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		TGCTCCATGCGTTCCACCCGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	19											44.0	47.0	46.0					19																	10506867		2203	4300	6503	10367867	SO:0001583	missense	11140			U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.115C>T	19.37:g.10506867G>A	ENSP00000222005:p.Arg39Cys	Unknown		x	x	x	10367867	Q53YA2	Missense_Mutation	SNP	ENST00000222005.2	37	CCDS12237.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	18.62	3.664170	0.67700	.	.	ENSG00000105401	ENST00000222005	T	0.63417	-0.04	4.19	4.19	0.49359	Cdc37, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74160	0.3680	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	P;P	0.61328	0.887;0.887	T	0.77534	-0.2552	10	0.87932	D	0	.	9.7854	0.40673	0.0:0.0:0.7942:0.2058	.	39;39	Q6FG59;Q16543	.;CDC37_HUMAN	C	39	ENSP00000222005:R39C	ENSP00000222005:R39C	R	-	1	0	CDC37	10367867	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.414000	0.52693	2.058000	0.61347	0.555000	0.69702	CGC		0.647	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065		Missense_Mutation
LILRA6	79168	broad.mit.edu	37	19	54744273	54744273	+	Missense_Mutation	SNP	C	C	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr19:54744273C>A	ENST00000396365.2	-	6	1174	c.1135G>T	c.(1135-1137)Gct>Tct	p.A379S	LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000245621.5_Missense_Mutation_p.A379S|LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000419410.2_Missense_Mutation_p.A379S|LILRB3_ENST00000407860.2_Intron	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	379	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.A379S(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGAATTCAGCCTGGTACTTA	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											78.0	110.0	99.0					19																	54744273		2202	4280	6482	59436085	SO:0001583	missense	79168			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.1135G>T	19.37:g.54744273C>A	ENSP00000379651:p.Ala379Ser	Unknown		x	x	x	59436085		Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445759	0.43429	.	.	ENSG00000244482	ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T	0.02631	4.22;4.22;4.22	2.39	2.39	0.29439	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.343884	0.20766	N	0.086074	T	0.16171	0.0389	M	0.91038	3.17	0.26274	N	0.978387	D;P;D	0.89917	1.0;0.689;1.0	D;B;D	0.91635	0.999;0.273;0.996	T	0.01545	-1.1328	10	0.56958	D	0.05	.	8.2715	0.31846	0.0:1.0:0.0:0.0	.	379;379;379	C9JFH3;Q6PI73;D3YTC4	.;LIRA6_HUMAN;.	S	379	ENSP00000411227:A379S;ENSP00000379651:A379S;ENSP00000245621:A379S	ENSP00000245621:A379S	A	-	1	0	LILRA6	59436085	0.000000	0.05858	0.060000	0.19600	0.113000	0.19764	-0.392000	0.07314	1.360000	0.45960	0.195000	0.17529	GCT		0.557	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318		Missense_Mutation
GALNT14	79623	broad.mit.edu	37	2	31189090	31189090	+	Silent	SNP	C	C	T	rs200313372		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr2:31189090C>T	ENST00000349752.5	-	3	1017	c.378G>A	c.(376-378)acG>acA	p.T126T	GALNT14_ENST00000406653.1_Silent_p.T106T|GALNT14_ENST00000356174.3_Intron|GALNT14_ENST00000324589.5_Silent_p.T131T|GALNT14_ENST00000420311.2_Silent_p.T91T	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	126	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.T126T(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TCCTGAGCAGCGTGGAGCGGG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	2								0,4406		0,0,2203	227.0	179.0	195.0		378	-0.3	1.0	2		195	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GALNT14	NM_024572.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		126/553	31189090	1,13005	2203	4300	6503	31042594	SO:0001819	synonymous_variant	79623			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.378G>A	2.37:g.31189090C>T		Unknown		x	x	x	31042594	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Silent	SNP	ENST00000349752.5	37	CCDS1773.2	SNP	27	Broad																																																																																				0.607	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		Silent
GALNT13	114805	broad.mit.edu	37	2	155306936	155306936	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr2:155306936G>A	ENST00000392825.3	+	13	2111	c.1544G>A	c.(1543-1545)cGa>cAa	p.R515Q	AC009227.2_ENST00000434635.1_RNA|GALNT13_ENST00000409237.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	515	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R515Q(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CTCACGTTGCGACATGTTAAC	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	101.0	106.0					2																	155306936		2203	4300	6503	155015182	SO:0001583	missense	114805			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1544G>A	2.37:g.155306936G>A	ENSP00000376570:p.Arg515Gln	Unknown		x	x	x	155015182	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848226	0.32699	.	.	ENSG00000144278	ENST00000392825	T	0.77489	-1.1	6.03	4.25	0.50352	Ricin B-related lectin (1);Ricin B lectin (3);	0.107611	0.64402	D	0.000006	T	0.64843	0.2635	L	0.39147	1.195	0.80722	D	1	B	0.15930	0.015	B	0.13407	0.009	T	0.55642	-0.8109	10	0.24483	T	0.36	.	5.8406	0.18630	0.158:0.0:0.6873:0.1547	.	515	Q8IUC8	GLT13_HUMAN	Q	515	ENSP00000376570:R515Q	ENSP00000376570:R515Q	R	+	2	0	GALNT13	155015182	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.342000	0.59341	0.901000	0.36495	0.650000	0.86243	CGA		0.403	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		Missense_Mutation
EVX2	344191	broad.mit.edu	37	2	176948376	176948376	+	Silent	SNP	C	C	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr2:176948376C>A	ENST00000308618.4	-	1	265	c.129G>T	c.(127-129)tcG>tcT	p.S43S		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	43					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S43S(1)		kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		CCGGGTGCTGCGAATTTTCCA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	2											43.0	49.0	47.0					2																	176948376		2203	4300	6503	176656622	SO:0001819	synonymous_variant	344191				CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.129G>T	2.37:g.176948376C>A		Unknown		x	x	x	176656622		Silent	SNP	ENST00000308618.4	37	CCDS33333.1	SNP	27	Broad																																																																																				0.602	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1			Silent
PAX3	5077	broad.mit.edu	37	2	223160323	223160323	+	Missense_Mutation	SNP	G	G	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr2:223160323G>C	ENST00000350526.4	-	3	511	c.375C>G	c.(373-375)aaC>aaG	p.N125K	PAX3_ENST00000258387.5_Missense_Mutation_p.N125K|PAX3_ENST00000409828.3_Missense_Mutation_p.N125K|CCDC140_ENST00000295226.1_5'Flank|PAX3_ENST00000344493.4_Missense_Mutation_p.N125K|PAX3_ENST00000336840.6_Missense_Mutation_p.N125K|PAX3_ENST00000392070.2_Missense_Mutation_p.N125K|PAX3_ENST00000409551.3_Missense_Mutation_p.N124K|PAX3_ENST00000392069.2_Missense_Mutation_p.N125K	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	125	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N125K(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACATGCCCGGGTTCTCTCTTT	0.542			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																																Dom	yes		2	2q35	5077	paired box gene 3	yes	M	1	Substitution - Missense(1)	ovary(1)	2											136.0	127.0	130.0					2																	223160323		2203	4300	6503	222868567	SO:0001583	missense	5077				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.375C>G	2.37:g.223160323G>C	ENSP00000343052:p.Asn125Lys	Unknown		x	x	x	222868567	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264550	0.59431	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551;ENST00000409828;ENST00000258387	D;D;D;D;D;D;D;D	0.99388	-5.81;-5.81;-5.81;-5.81;-5.81;-5.81;-5.81;-5.81	5.71	4.73	0.59995	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.124234	0.64402	D	0.000001	D	0.99315	0.9760	M	0.89163	3.01	0.58432	D	0.999995	P;D;D;P;P;D;P	0.60575	0.926;0.988;0.961;0.617;0.81;0.98;0.696	P;P;P;B;B;P;B	0.60609	0.825;0.877;0.491;0.25;0.16;0.768;0.115	D	0.98505	1.0616	10	0.87932	D	0	.	12.9266	0.58264	0.1087:0.0:0.8913:0.0	.	125;125;125;124;125;125;125	P23760;P23760-2;P23760-3;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.;.;.	K	125;125;125;125;125;124;125;125	ENSP00000375921:N125K;ENSP00000342092:N125K;ENSP00000343052:N125K;ENSP00000375922:N125K;ENSP00000338767:N125K;ENSP00000386750:N124K;ENSP00000386817:N125K;ENSP00000258387:N125K	ENSP00000258387:N125K	N	-	3	2	PAX3	222868567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.080000	0.41586	2.694000	0.91930	0.655000	0.94253	AAC		0.542	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			Missense_Mutation
ESF1	51575	broad.mit.edu	37	20	13756572	13756572	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr20:13756572C>G	ENST00000202816.1	-	3	1089	c.982G>C	c.(982-984)Ggt>Cgt	p.G328R		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G328R(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TGCTCAAAACCAGATTCTTCT	0.378																																																1	Substitution - Missense(1)	ovary(1)	20											161.0	158.0	159.0					20																	13756572		2203	4300	6503	13704572	SO:0001583	missense	51575				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.982G>C	20.37:g.13756572C>G	ENSP00000202816:p.Gly328Arg	Unknown		x	x	x	13704572	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696424	0.48202	.	.	ENSG00000089048	ENST00000202816	T	0.23754	1.89	5.15	3.18	0.36537	.	0.230411	0.43416	D	0.000577	T	0.19248	0.0462	N	0.24115	0.695	0.43347	D	0.995403	P	0.46706	0.883	P	0.45037	0.467	T	0.02596	-1.1136	10	0.24483	T	0.36	.	11.8841	0.52592	0.0:0.848:0.0:0.152	.	328	Q9H501	ESF1_HUMAN	R	328	ENSP00000202816:G328R	ENSP00000202816:G328R	G	-	1	0	ESF1	13704572	0.990000	0.36364	0.993000	0.49108	0.981000	0.71138	0.992000	0.29667	1.313000	0.45069	0.585000	0.79938	GGT		0.378	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649		Missense_Mutation
NINL	22981	broad.mit.edu	37	20	25498416	25498416	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr20:25498416C>T	ENST00000278886.6	-	3	323	c.250G>A	c.(250-252)Gat>Aat	p.D84N	NINL_ENST00000422516.1_Missense_Mutation_p.D84N	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	84					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)	p.D84N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CTGTCTTCATCTGAGGGGCGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	20											134.0	115.0	121.0					20																	25498416		2203	4300	6503	25446416	SO:0001583	missense	22981				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.250G>A	20.37:g.25498416C>T	ENSP00000278886:p.Asp84Asn	Unknown		x	x	x	25446416	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.47	2.841809	0.51057	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.26373	1.74;1.74	4.39	3.44	0.39384	.	0.137412	0.48286	D	0.000194	T	0.30479	0.0766	L	0.31664	0.95	0.31637	N	0.648273	D;D	0.56287	0.975;0.965	P;P	0.56343	0.796;0.521	T	0.30357	-0.9981	10	0.62326	D	0.03	-12.553	11.1231	0.48302	0.0:0.9074:0.0:0.0926	.	84;84	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	N	84	ENSP00000278886:D84N;ENSP00000410431:D84N	ENSP00000278886:D84N	D	-	1	0	NINL	25446416	0.982000	0.34865	0.037000	0.18230	0.193000	0.23685	2.688000	0.46984	1.051000	0.40369	0.561000	0.74099	GAT		0.378	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176		Missense_Mutation
BPIFB2	80341	broad.mit.edu	37	20	31609117	31609117	+	Missense_Mutation	SNP	G	G	A	rs543901024	byFrequency	TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr20:31609117G>A	ENST00000170150.3	+	14	1420	c.1225G>A	c.(1225-1227)Gtt>Att	p.V409I		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	409						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)	p.V409I(1)									GATGGGCACCGTTTTTGAGAA	0.647													G|||	4	0.000798722	0.0	0.0	5008	,	,		19613	0.0		0.0	False		,,,				2504	0.0041															1	Substitution - Missense(1)	ovary(1)	20											51.0	40.0	44.0					20																	31609117		2203	4300	6503	31072778	SO:0001583	missense	80341			AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.1225G>A	20.37:g.31609117G>A	ENSP00000170150:p.Val409Ile	Unknown		x	x	x	31072778	Q6UWN3|Q6ZME0|Q8NFQ7	Missense_Mutation	SNP	ENST00000170150.3	37	CCDS13210.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041790	0.35989	.	.	ENSG00000078898	ENST00000170150	T	0.08546	3.08	4.02	3.04	0.35103	.	0.293824	0.24449	N	0.038432	T	0.05686	0.0149	L	0.32530	0.975	0.19575	N	0.999968	P	0.38767	0.646	B	0.32465	0.146	T	0.36792	-0.9733	10	0.26408	T	0.33	-10.8057	9.6328	0.39789	0.0:0.2128:0.7872:0.0	.	409	Q8N4F0	BPIB2_HUMAN	I	409	ENSP00000170150:V409I	ENSP00000170150:V409I	V	+	1	0	BPIFB2	31072778	0.695000	0.27747	0.151000	0.22473	0.097000	0.18754	0.768000	0.26590	1.232000	0.43678	0.591000	0.81541	GTT		0.647	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227		Missense_Mutation
FAM65C	140876	broad.mit.edu	37	20	49236588	49236588	+	Silent	SNP	C	C	T	rs113703688		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr20:49236588C>T	ENST00000327979.2	-	3	603	c.192G>A	c.(190-192)tcG>tcA	p.S64S	FAM65C_ENST00000535356.1_Silent_p.S68S|FAM65C_ENST00000045083.2_Silent_p.S64S			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	64								p.S64S(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTGCACAGACCGACCCCTTCC	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19933	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	20						C		1,4405	2.1+/-5.4	0,1,2202	100.0	90.0	94.0		192	-6.1	0.0	20	dbSNP_132	94	0,8600		0,0,4300	no	coding-synonymous	FAM65C	NM_080829.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		64/947	49236588	1,13005	2203	4300	6503	48669995	SO:0001819	synonymous_variant	140876			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.192G>A	20.37:g.49236588C>T		Unknown		x	x	x	48669995	Q5QPB6|Q9NQQ2	Silent	SNP	ENST00000327979.2	37	CCDS13431.2	SNP	23	Broad																																																																																				0.542	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1			Silent
IL10RB	3588	broad.mit.edu	37	21	34652143	34652143	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr21:34652143T>C	ENST00000290200.2	+	4	526	c.418T>C	c.(418-420)Tac>Cac	p.Y140H	AP000295.9_ENST00000433395.2_Silent_p.N267N	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	140	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.Y140H(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						TGAGAATGAATACGAAACTTG	0.378																																					Melanoma(67;315 1275 21667 21943 44564)											1	Substitution - Missense(1)	ovary(1)	21											200.0	193.0	195.0					21																	34652143		2203	4300	6503	33574013	SO:0001583	missense	3588			U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.418T>C	21.37:g.34652143T>C	ENSP00000290200:p.Tyr140His	Unknown		x	x	x	33574013	Q9BUU4	Missense_Mutation	SNP	ENST00000290200.2	37	CCDS13623.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	0.248	-1.008453	0.02112	.	.	ENSG00000243646	ENST00000290200;ENST00000539894	T	0.40476	1.03	5.75	3.9	0.45041	Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.971658	0.08538	N	0.930984	T	0.16428	0.0395	N	0.01352	-0.895	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.26087	-1.0113	10	0.21540	T	0.41	-0.6838	6.7596	0.23532	0.1747:0.734:0.0:0.0913	.	142;140;140;140	Q6ZVU9;Q08334;B4DSX5;F5H766	.;I10R2_HUMAN;.;.	H	140	ENSP00000290200:Y140H	ENSP00000290200:Y140H	Y	+	1	0	IL10RB	33574013	0.001000	0.12720	0.066000	0.19879	0.022000	0.10575	0.779000	0.26746	0.736000	0.32559	-0.255000	0.11280	TAC		0.378	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139831.3			Missense_Mutation
ITSN1	6453	broad.mit.edu	37	21	35091159	35091159	+	Missense_Mutation	SNP	G	G	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr21:35091159G>C	ENST00000381318.3	+	2	314	c.26G>C	c.(25-27)gGt>gCt	p.G9A	ITSN1_ENST00000399352.1_Missense_Mutation_p.G9A|ITSN1_ENST00000399349.1_Missense_Mutation_p.G9A|ITSN1_ENST00000399367.3_Missense_Mutation_p.G9A|ITSN1_ENST00000399355.2_Missense_Mutation_p.G9A|ITSN1_ENST00000381285.4_Missense_Mutation_p.G9A|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399338.4_Missense_Mutation_p.G9A|ITSN1_ENST00000399353.1_Missense_Mutation_p.G9A|ITSN1_ENST00000399326.3_Missense_Mutation_p.G9A|ITSN1_ENST00000381291.4_Missense_Mutation_p.G9A|ITSN1_ENST00000379960.5_Missense_Mutation_p.G9A|ITSN1_ENST00000437442.2_Missense_Mutation_p.G9A	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	9					apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G9A(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						ACACCTTTTGGTGGTAAGTTT	0.294																																																1	Substitution - Missense(1)	ovary(1)	21											128.0	120.0	123.0					21																	35091159		2203	4300	6503	34013029	SO:0001583	missense	6453			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.26G>C	21.37:g.35091159G>C	ENSP00000370719:p.Gly9Ala	Unknown		x	x	x	34013029	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809904	0.50421	.	.	ENSG00000205726	ENST00000399353;ENST00000444491;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000451686;ENST00000381283;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.32272	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.46;1.58;1.58;1.58;1.58;1.58	5.31	5.31	0.75309	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.26702	0.0653	L	0.43152	1.355	0.48830	D	0.999715	B;B;B;B;B;B;B;B;B	0.25521	0.003;0.001;0.001;0.001;0.128;0.001;0.001;0.002;0.001	B;B;B;B;B;B;B;B;B	0.14578	0.001;0.001;0.001;0.001;0.011;0.001;0.001;0.001;0.001	T	0.03000	-1.1084	10	0.36615	T	0.2	.	14.0923	0.65000	0.0:0.1518:0.8482:0.0	.	9;9;9;9;9;9;9;9;9	A8D7D0;A7XZY7;A8CTY7;A8CTY3;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;ITSN1_HUMAN;.;.	A	9	ENSP00000382290:G9A;ENSP00000400079:G9A;ENSP00000370719:G9A;ENSP00000370691:G9A;ENSP00000370685:G9A;ENSP00000382301:G9A;ENSP00000382289:G9A;ENSP00000382292:G9A;ENSP00000382286:G9A;ENSP00000407132:G9A;ENSP00000370683:G9A;ENSP00000382275:G9A;ENSP00000387377:G9A;ENSP00000382265:G9A;ENSP00000369294:G9A	ENSP00000369294:G9A	G	+	2	0	ITSN1	34013029	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.498000	0.66931	2.504000	0.84457	0.563000	0.77884	GGT		0.294	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		Missense_Mutation
PCNT	5116	broad.mit.edu	37	21	47769677	47769677	+	Silent	SNP	G	G	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr21:47769677G>C	ENST00000359568.5	+	8	1394	c.1287G>C	c.(1285-1287)cgG>cgC	p.R429R	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	429	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.R429R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGCACGGCCGGTGTTTAGAAG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	21											95.0	96.0	95.0					21																	47769677		2203	4300	6503	46594105	SO:0001819	synonymous_variant	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1287G>C	21.37:g.47769677G>C		Unknown		x	x	x	46594105	O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	CCDS33592.1	SNP	44	Broad																																																																																				0.473	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		Silent
CLTCL1	8218	broad.mit.edu	37	22	19183895	19183895	+	Nonsense_Mutation	SNP	C	C	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr22:19183895C>T	ENST00000263200.10	-	26	4145	c.4073G>A	c.(4072-4074)tGg>tAg	p.W1358*	CLTCL1_ENST00000442042.2_5'UTR|CLTCL1_ENST00000353891.5_Nonsense_Mutation_p.W1358*|CLTCL1_ENST00000427926.1_Nonsense_Mutation_p.W1358*	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1358	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.W1358*(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CAGCTCAGCCCACAGGTGTGC	0.597			T	?	ALCL																																		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	1	Substitution - Nonsense(1)	ovary(1)	22											95.0	97.0	96.0					22																	19183895		2179	4272	6451	17563895	SO:0001587	stop_gained	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4073G>A	22.37:g.19183895C>T	ENSP00000445677:p.Trp1358*	Unknown		x	x	x	17563895	B7Z7U5|Q14017|Q15808|Q15809	Nonsense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	43	10.269140	0.99372	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	.	.	.	3.57	3.57	0.40892	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4124	15.336	0.74255	0.0:1.0:0.0:0.0	.	.	.	.	X	1358	.	ENSP00000445677:W1358X	W	-	2	0	CLTCL1	17563895	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	6.944000	0.75940	1.829000	0.53265	0.491000	0.48974	TGG		0.597	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098		Nonsense_Mutation
PROS1	5627	broad.mit.edu	37	3	93611923	93611923	+	Missense_Mutation	SNP	C	C	T	rs200771229		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr3:93611923C>T	ENST00000394236.3	-	10	1325	c.1009G>A	c.(1009-1011)Gtg>Atg	p.V337M	PROS1_ENST00000407433.1_Missense_Mutation_p.V206M	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	337	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.V337M(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TACAGTATCACGCCTTCTGAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											73.0	68.0	70.0					3																	93611923		2203	4300	6503	95094613	SO:0001583	missense	5627				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1009G>A	3.37:g.93611923C>T	ENSP00000377783:p.Val337Met	Unknown		x	x	x	95094613	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	CCDS2923.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	10.28	1.306744	0.23736	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	D;D	0.81499	-1.5;-1.5	4.47	1.13	0.20643	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.277488	0.33591	N	0.004752	D	0.85248	0.5653	M	0.84846	2.72	0.28591	N	0.909655	D	0.61080	0.989	P	0.57502	0.822	T	0.78259	-0.2273	10	0.87932	D	0	.	5.846	0.18665	0.1325:0.5343:0.0:0.3332	.	337	P07225	PROS_HUMAN	M	337;206	ENSP00000377783:V337M;ENSP00000385794:V206M	ENSP00000377783:V337M	V	-	1	0	PROS1	95094613	0.217000	0.23597	0.987000	0.45799	0.252000	0.25951	0.750000	0.26334	0.377000	0.24735	0.585000	0.79938	GTG		0.398	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		Missense_Mutation
ZFP42	132625	broad.mit.edu	37	4	188924260	188924260	+	Missense_Mutation	SNP	A	A	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr4:188924260A>C	ENST00000326866.4	+	4	707	c.299A>C	c.(298-300)aAa>aCa	p.K100T	ZFP42_ENST00000509524.1_Missense_Mutation_p.K100T	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	100					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K100T(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TACCTAAAGAAAGGATCAGAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											81.0	85.0	83.0					4																	188924260		2203	4300	6503	189161254	SO:0001583	missense	132625			AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.299A>C	4.37:g.188924260A>C	ENSP00000317686:p.Lys100Thr	Unknown		x	x	x	189161254	D3DP65|Q8WXE2	Missense_Mutation	SNP	ENST00000326866.4	37	CCDS3849.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320911	0.23994	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.63580	-0.05;-0.05	4.11	2.93	0.34026	.	0.164149	0.38005	U	0.001850	T	0.43919	0.1269	L	0.36672	1.1	0.09310	N	1	B	0.33694	0.421	B	0.29785	0.107	T	0.21415	-1.0246	10	0.29301	T	0.29	.	5.6476	0.17598	0.788:0.0:0.212:0.0	.	100	Q96MM3	ZFP42_HUMAN	T	100	ENSP00000317686:K100T;ENSP00000424662:K100T	ENSP00000317686:K100T	K	+	2	0	ZFP42	189161254	0.003000	0.15002	0.002000	0.10522	0.004000	0.04260	1.805000	0.38883	0.919000	0.36945	0.533000	0.62120	AAA		0.403	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	NM_174900		Missense_Mutation
STK38	11329	broad.mit.edu	37	6	36466139	36466139	+	Splice_Site	SNP	C	C	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr6:36466139C>T	ENST00000229812.7	-	11	1362		c.e11+1			NM_007271.2	NP_009202.1			serine/threonine kinase 38									p.?(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TTCTCTAATACCTCAAAATTA	0.363																																					Colon(180;997 3561 16158)											1	Unknown(1)	ovary(1)	6											122.0	125.0	124.0					6																	36466139		2203	4300	6503	36574117	SO:0001630	splice_region_variant	11329				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.1076+1G>A	6.37:g.36466139C>T		Unknown		x	x	x	36574117		Splice_Site_SNP	SNP	ENST00000229812.7	37	CCDS4822.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455271	0.84209	.	.	ENSG00000112079	ENST00000229812	.	.	.	5.91	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0464	0.71830	0.0:0.9321:0.0:0.0679	.	.	.	.	.	-1	.	.	.	-	.	.	STK38	36574117	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.814000	0.86154	1.517000	0.48917	0.650000	0.86243	.		0.363	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040346.1	NM_007271	Intron	Splice_Site_SNP
GRM1	2911	broad.mit.edu	37	6	146755633	146755633	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr6:146755633G>A	ENST00000282753.1	+	8	3521	c.3286G>A	c.(3286-3288)Gac>Aac	p.D1096N	GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000361719.2_Missense_Mutation_p.D1096N|GRM1_ENST00000492807.2_3'UTR			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1096	Asp/Glu-rich (acidic).				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.D1096N(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCCCGCGGACGACGACGACGA	0.647																																																1	Substitution - Missense(1)	ovary(1)	6											72.0	78.0	76.0					6																	146755633		2203	4300	6503	146797326	SO:0001583	missense	2911			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3286G>A	6.37:g.146755633G>A	ENSP00000282753:p.Asp1096Asn	Unknown		x	x	x	146797326	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372172	0.61624	.	.	ENSG00000152822	ENST00000361719;ENST00000282753	D;D	0.87179	-2.22;-2.22	5.56	5.56	0.83823	.	0.275955	0.40144	N	0.001163	T	0.69566	0.3125	L	0.29908	0.895	0.80722	D	1	P	0.36438	0.553	B	0.24541	0.054	T	0.75419	-0.3324	10	0.46703	T	0.11	.	14.3723	0.66849	0.0:0.0:0.8521:0.1479	.	1096	Q13255	GRM1_HUMAN	N	1096	ENSP00000354896:D1096N;ENSP00000282753:D1096N	ENSP00000282753:D1096N	D	+	1	0	GRM1	146797326	1.000000	0.71417	0.862000	0.33874	0.754000	0.42855	7.480000	0.81109	2.619000	0.88677	0.462000	0.41574	GAC		0.647	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		Missense_Mutation
MAS1	4142	broad.mit.edu	37	6	160328045	160328045	+	Missense_Mutation	SNP	G	G	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr6:160328045G>T	ENST00000252660.4	+	1	72	c.58G>T	c.(58-60)Ggc>Tgc	p.G20C		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	20					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)	p.G20C(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		CATCTCAACTGGCAGGAACGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	6											124.0	116.0	119.0					6																	160328045		2203	4300	6503	160248035	SO:0001583	missense	4142			M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.58G>T	6.37:g.160328045G>T	ENSP00000252660:p.Gly20Cys	Unknown		x	x	x	160248035	E1P5B3|Q2TBC9|Q6FG47	Missense_Mutation	SNP	ENST00000252660.4	37	CCDS5272.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	10.39	1.335915	0.24253	.	.	ENSG00000130368	ENST00000252660	T	0.20332	2.08	5.23	-10.5	0.00291	.	1.634530	0.03684	N	0.246010	T	0.02304	0.0071	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30297	-0.9983	10	0.54805	T	0.06	.	6.2277	0.20718	0.1219:0.2818:0.5153:0.081	.	20	P04201	MAS_HUMAN	C	20	ENSP00000252660:G20C	ENSP00000252660:G20C	G	+	1	0	MAS1	160248035	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.567000	0.02146	-2.572000	0.00467	-1.799000	0.00621	GGC		0.493	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042930.2	NM_002377		Missense_Mutation
RBM48	84060	broad.mit.edu	37	7	92164260	92164260	+	Silent	SNP	T	T	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr7:92164260T>C	ENST00000265732.5	+	4	1034	c.993T>C	c.(991-993)aaT>aaC	p.N331N	RBM48_ENST00000481551.1_Silent_p.N331N	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	331						nucleus (GO:0005634)	RNA binding (GO:0003723)	p.N331N(1)									CAACGGCGAATTTAATTCGGC	0.338																																																1	Substitution - coding silent(1)	ovary(1)	7											43.0	42.0	42.0					7																	92164260		1824	4079	5903	92002196	SO:0001819	synonymous_variant	84060			AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.993T>C	7.37:g.92164260T>C		Unknown		x	x	x	92002196	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Silent	SNP	ENST00000265732.5	37	CCDS43615.1	SNP	52	Broad																																																																																				0.338	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120		Silent
SVOPL	136306	broad.mit.edu	37	7	138310718	138310718	+	Missense_Mutation	SNP	G	G	C			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr7:138310718G>C	ENST00000419765.3	-	12	1292	c.1259C>G	c.(1258-1260)gCt>gGt	p.A420G	SVOPL_ENST00000288513.5_Missense_Mutation_p.A268G|SVOPL_ENST00000421622.1_Missense_Mutation_p.A300G|SNORA40_ENST00000516379.1_RNA|SVOPL_ENST00000436657.1_Missense_Mutation_p.A268G|SVOPL_ENST00000463557.1_5'UTR	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	420						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.A268G(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						ACTCACCTCAGCTGTGTAAAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											89.0	79.0	82.0					7																	138310718		2203	4300	6503	137961258	SO:0001583	missense	136306			BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.1259C>G	7.37:g.138310718G>C	ENSP00000405482:p.Ala420Gly	Unknown		x	x	x	137961258		Missense_Mutation	SNP	ENST00000419765.3	37	CCDS47721.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465247	0.84425	.	.	ENSG00000157703	ENST00000288513;ENST00000421622;ENST00000436657;ENST00000419765	T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.048203	0.85682	D	0.000000	D	0.83408	0.5248	L	0.45470	1.425	0.50039	D	0.999843	D;D	0.89917	0.999;1.0	D;D	0.85130	0.983;0.997	D	0.84723	0.0741	10	0.72032	D	0.01	-17.1703	19.0878	0.93212	0.0:0.0:1.0:0.0	.	420;268	Q8N434;Q8N434-2	SVOPL_HUMAN;.	G	268;300;268;420	ENSP00000288513:A268G;ENSP00000412830:A300G;ENSP00000417018:A268G;ENSP00000405482:A420G	ENSP00000288513:A268G	A	-	2	0	SVOPL	137961258	1.000000	0.71417	0.868000	0.34077	0.923000	0.55619	7.224000	0.78042	2.493000	0.84123	0.655000	0.94253	GCT		0.488	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342092.4	NM_174959		Missense_Mutation
NOS3	4846	broad.mit.edu	37	7	150698402	150698402	+	Silent	SNP	G	G	A			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr7:150698402G>A	ENST00000484524.1	+	10	1317	c.1317G>A	c.(1315-1317)ggG>ggA	p.G439G	NOS3_ENST00000461406.1_Silent_p.G233G|NOS3_ENST00000297494.3_Silent_p.G439G|NOS3_ENST00000467517.1_Silent_p.G439G	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G439G(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGGCCAGGGGGGGCTGCCCTG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	7											59.0	60.0	60.0					7																	150698402		2203	4300	6503	150329335	SO:0001819	synonymous_variant	4846				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1317G>A	7.37:g.150698402G>A		Unknown		x	x	x	150329335	Q495E5	Silent	SNP	ENST00000484524.1	37	CCDS55182.1	SNP	43	Broad																																																																																				0.612	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603		Silent
PTBP3	9991	broad.mit.edu	37	9	114989902	114989902	+	Missense_Mutation	SNP	T	T	G			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr9:114989902T>G	ENST00000374255.2	-	13	1384	c.1237A>C	c.(1237-1239)Aac>Cac	p.N413H	PTBP3_ENST00000374257.1_Missense_Mutation_p.N385H|PTBP3_ENST00000343327.2_Missense_Mutation_p.N318H|PTBP3_ENST00000458258.1_Missense_Mutation_p.N419H|PTBP3_ENST00000334318.6_Missense_Mutation_p.N416H			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	413	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.N413H(1)									CTTAGATGGTTCATTGCTAGT	0.378																																																1	Substitution - Missense(1)	ovary(1)	9											78.0	77.0	77.0					9																	114989902		2203	4300	6503	114029723	SO:0001583	missense	9991			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1237A>C	9.37:g.114989902T>G	ENSP00000363373:p.Asn413His	Unknown		x	x	x	114029723	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	ENST00000374255.2	37	CCDS6784.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162549	0.57368	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.55930	3.33;3.33;0.49;3.33;1.49	5.43	5.43	0.79202	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.046850	0.85682	D	0.000000	T	0.48624	0.1510	L	0.28694	0.88	0.50039	D	0.999841	B;B;B;P;B;P	0.40794	0.007;0.024;0.007;0.729;0.001;0.574	B;B;B;P;B;P	0.46110	0.027;0.037;0.027;0.471;0.026;0.504	T	0.40156	-0.9578	10	0.26408	T	0.33	-5.9532	15.479	0.75508	0.0:0.0:0.0:1.0	.	385;385;318;416;413;419	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	H	385;416;419;413;318	ENSP00000363375:N385H;ENSP00000334499:N416H;ENSP00000414921:N419H;ENSP00000363373:N413H;ENSP00000340705:N318H	ENSP00000334499:N416H	N	-	1	0	ROD1	114029723	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.117000	0.64667	2.053000	0.61076	0.482000	0.46254	AAC		0.378	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053679.1			Missense_Mutation
CTAG2	30848	broad.mit.edu	37	X	153880825	153880825	+	Missense_Mutation	SNP	G	G	T			TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chrX:153880825G>T	ENST00000247306.4	-	2	413	c.350C>A	c.(349-351)cCc>cAc	p.P117H	CTAG2_ENST00000369585.3_Missense_Mutation_p.P117H	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	117						centrosome (GO:0005813)		p.P117L(3)|p.P117H(2)		central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCTGGTCGGGGGAGAGGTGC	0.632																																																5	Substitution - Missense(5)	lung(3)|ovary(2)	X											46.0	46.0	46.0					X																	153880825		2203	4298	6501	153534019	SO:0001583	missense	30848			AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.350C>A	X.37:g.153880825G>T	ENSP00000247306:p.Pro117His	Unknown		x	x	x	153534019	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	ENST00000247306.4	37	CCDS14759.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594414	0.28445	.	.	ENSG00000126890	ENST00000247306;ENST00000369585;ENST00000454505	T;T	0.33654	1.4;1.4	2.64	-5.27	0.02763	.	.	.	.	.	T	0.24314	0.0589	L	0.51422	1.61	0.09310	N	1	B;B	0.30068	0.267;0.041	B;B	0.27170	0.077;0.031	T	0.16100	-1.0414	9	0.87932	D	0	.	2.2664	0.04079	0.1143:0.1422:0.3033:0.4402	.	117;117	O75638;O75638-2	CTAG2_HUMAN;.	H	117;117;59	ENSP00000247306:P117H;ENSP00000358598:P117H	ENSP00000247306:P117H	P	-	2	0	CTAG2	153534019	0.039000	0.19947	0.000000	0.03702	0.002000	0.02628	1.439000	0.35013	-2.007000	0.00956	-0.806000	0.03193	CCC		0.632	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061176.1	NM_020994		Missense_Mutation
UBXN11	91544	broad.mit.edu	37	1	26608812	26608889	+	In_Frame_Del	DEL	CCAGGACAGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGA	CCAGGACAGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGA	-	rs66614970|rs201454352|rs61775089|rs61775088|rs140364749|rs61775085|rs61775084|rs61775087|rs61775086|rs6667693|rs6672357|rs376181141|rs568953708|rs200313935|rs554923047|rs202134609|rs537852372|rs1134582|rs188535926|rs201756933|rs199707978|rs373828796|rs12354016|rs202239787|rs151149897|rs193142354|rs1134583|rs1134580|rs1134581|rs1134584	byFrequency	TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr1:26608812_26608889delCCAGGACAGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGA	ENST00000374222.1	-	16	1928_2005	c.1464_1541delTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCTGTCCTGG	c.(1462-1542)ggtcccggtcccggccccagtcccggtcccggtcccggccccagtcccggtcccggtcccggccccagtccctgtcctgga>gga	p.488_514GPGPGPSPGPGPGPSPGPGPGPSPCPG>G	UBXN11_ENST00000357089.4_In_Frame_Del_p.455_481GPGPGPSPGPGPGPSPGPGPGPSPCPG>G|UBXN11_ENST00000314675.7_In_Frame_Del_p.368_394GPGPGPSPGPGPGPSPGPGPGPSPCPG>G|UBXN11_ENST00000374217.2_In_Frame_Del_p.455_481GPGPGPSPGPGPGPSPGPGPGPSPCPG>G|UBXN11_ENST00000374223.1_In_Frame_Del_p.245_271GPGPGPSPGPGPGPSPGPGPGPSPCPG>G|UBXN11_ENST00000374221.3_In_Frame_Del_p.488_514GPGPGPSPGPGPGPSPGPGPGPSPCPG>G			Q5T124	UBX11_HUMAN	UBX domain protein 11	488	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.|Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.|P -> S (in dbSNP:rs17838088).|P -> S (in dbSNP:rs17838088). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P503_G504insCP(1)|p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gggactgggtccaggacagggactggggccgggaccgggaccgggactggggccgggaccgggaccgggactggggccgggaccgggaccgggacagg	0.712																																																2	Insertion - In frame(1)|Deletion - In frame(1)	upper_aerodigestive_tract(1)|ovary(1)	1																																								26481476	SO:0001651	inframe_deletion	91544			AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1464_1541delTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCCTGTCCTGG	1.37:g.26608812_26608889delCCAGGACAGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGA	ENSP00000363339:p.Gly488_Pro513del	Unknown		Capture	Illumina GAIIx	Phase_I	26481399	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	In_Frame_Del	DEL	ENST00000374222.1	37	CCDS41288.1	DEL	30	Broad																																																																																				0.712	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345		In_Frame_Del
FAM86B2	653333	broad.mit.edu	37	8	12291593	12291595	+	In_Frame_Del	DEL	CTG	CTG	-	rs146321506		TCGA-31-1950-01	TCGA-31-1950-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1950-01	TCGA-31-1950-10	g.chr8:12291593_12291595delCTG	ENST00000262365.4	-	2	124_126	c.125_127delCAG	c.(124-129)tcagat>tat	p.42_43SD>Y	FAM86B2_ENST00000393715.3_Intron|FAM86B2_ENST00000309608.5_In_Frame_Del_p.42_43SD>Y|FAM86B2_ENST00000351291.4_In_Frame_Del_p.42_43SD>Y	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	42			D -> Y (in dbSNP:rs2684093).							endometrium(1)|kidney(2)	3						AGCTCAGAATCTGATGAGTCTCT	0.473																																																0			8																																								12335966	SO:0001651	inframe_deletion	653333				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.125_127delCAG	8.37:g.12291593_12291595delCTG	ENSP00000262365:p.Ser42_Asp43delinsTyr	Unknown		Capture	Illumina GAIIx	Phase_I	12335964		In_Frame_Del	DEL	ENST00000262365.4	37	CCDS59092.1	DEL	32	Broad																																																																																				0.473	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_928336		In_Frame_Del
