#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CTBS	1486	broad.mit.edu	37	1	85036344	85036344	+	Silent	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr1:85036344T>C	ENST00000370630.5	-	2	285	c.237A>G	c.(235-237)acA>acG	p.T79T	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	79					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)	p.T79T(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		TTGCCACAGTTGTAATCTGTG	0.373																																																1	Substitution - coding silent(1)	ovary(1)	1											113.0	111.0	112.0					1																	85036344		2203	4300	6503	84808932	SO:0001819	synonymous_variant	1486			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.237A>G	1.37:g.85036344T>C		Unknown		x	x	x	84808932	Q5VX50	Silent	SNP	ENST00000370630.5	37	CCDS698.1	SNP	63	Broad																																																																																				0.373	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388		Silent
SPTBN2	6712	broad.mit.edu	37	11	66466974	66466974	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr11:66466974G>A	ENST00000533211.1	-	18	4010	c.3679C>T	c.(3679-3681)Cgg>Tgg	p.R1227W	SPTBN2_ENST00000309996.2_Missense_Mutation_p.R1227W|SPTBN2_ENST00000529997.1_Missense_Mutation_p.R1227W			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1227					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.R1227W(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CCGTGGATCCGTTCCCCATTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	11											109.0	101.0	104.0					11																	66466974		2200	4295	6495	66223550	SO:0001583	missense	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3679C>T	11.37:g.66466974G>A	ENSP00000432568:p.Arg1227Trp	Unknown		x	x	x	66223550	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351438	0.61183	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.55588	0.51;0.51;0.51	5.16	5.16	0.70880	.	0.153310	0.44285	D	0.000465	T	0.61438	0.2347	L	0.40543	1.245	0.46981	D	0.999271	D	0.89917	1.0	D	0.70016	0.967	T	0.63189	-0.6693	10	0.87932	D	0	.	11.0476	0.47867	0.0:0.0:0.7114:0.2886	.	1227	O15020	SPTN2_HUMAN	W	1227	ENSP00000432568:R1227W;ENSP00000311489:R1227W;ENSP00000433593:R1227W	ENSP00000311489:R1227W	R	-	1	2	SPTBN2	66223550	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	4.628000	0.61282	2.670000	0.90874	0.591000	0.81541	CGG		0.567	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946		Missense_Mutation
CLPB	81570	broad.mit.edu	37	11	72145490	72145490	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr11:72145490T>C	ENST00000294053.3	-	1	202	c.29A>G	c.(28-30)aAa>aGa	p.K10R	CLPB_ENST00000542555.1_5'Flank|CLPB_ENST00000445069.2_Missense_Mutation_p.K10R|CLPB_ENST00000538039.1_Missense_Mutation_p.K10R|CLPB_ENST00000543042.1_5'UTR|CLPB_ENST00000437826.2_5'Flank|CLPB_ENST00000340729.5_Missense_Mutation_p.K10R	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	10					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.K10R(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						CGCCAGTGCTTTTCTCCTCAA	0.657											OREG0021194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											53.0	55.0	54.0					11																	72145490		2200	4293	6493	71823138	SO:0001583	missense	81570			BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.29A>G	11.37:g.72145490T>C	ENSP00000294053:p.Lys10Arg	Unknown	1135	x	x	x	71823138	B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	ENST00000294053.3	37	CCDS8215.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	13.72	2.320685	0.41096	.	.	ENSG00000162129	ENST00000294053;ENST00000538039;ENST00000340729	T;T;T	0.63913	2.04;1.25;-0.07	4.52	2.54	0.30619	.	0.169160	0.36893	N	0.002351	T	0.35941	0.0949	N	0.08118	0	0.80722	D	1	B;B;B	0.13145	0.007;0.007;0.004	B;B;B	0.15870	0.014;0.014;0.006	T	0.16571	-1.0398	10	0.56958	D	0.05	-4.9613	4.621	0.12449	0.1203:0.0:0.62:0.2596	.	10;10;10	F8W7P6;Q9H078-2;Q9H078	.;.;CLPB_HUMAN	R	10	ENSP00000294053:K10R;ENSP00000441518:K10R;ENSP00000340385:K10R	ENSP00000294053:K10R	K	-	2	0	CLPB	71823138	1.000000	0.71417	0.994000	0.49952	0.377000	0.30045	0.852000	0.27764	0.962000	0.38057	0.533000	0.62120	AAA		0.657	CLPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396889.1	NM_030813		Missense_Mutation
PUS1	80324	broad.mit.edu	37	12	132414548	132414548	+	Silent	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr12:132414548C>T	ENST00000376649.3	+	2	671	c.171C>T	c.(169-171)cgC>cgT	p.R57R	PUS1_ENST00000542167.2_Intron|RP11-417L19.4_ENST00000539078.1_lincRNA|PUS1_ENST00000443358.2_Silent_p.R29R|PUS1_ENST00000440818.2_Silent_p.R29R|PUS1_ENST00000535067.1_Silent_p.R29R	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	57					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)	p.R57R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		GGGGCGACCGCGTCTGGGAGG	0.741																																					Esophageal Squamous(102;671 2009 17384 45666)											1	Substitution - coding silent(1)	ovary(1)	12											12.0	19.0	17.0					12																	132414548		2175	4273	6448	130980501	SO:0001819	synonymous_variant	80324			AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.171C>T	12.37:g.132414548C>T		Unknown		x	x	x	130980501	A8K877|B3KQC1|Q8WYT2|Q9BU44	Silent	SNP	ENST00000376649.3	37	CCDS9275.2	SNP	27	Broad																																																																																				0.741	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250313.2	NM_025215		Silent
MYO16	23026	broad.mit.edu	37	13	109472689	109472690	+	Missense_Mutation	DNP	AT	AT	TA			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr13:109472689_109472690AT>TA	ENST00000357550.2	+	7	847_848	c.806_807AT>TA	c.(805-807)aAT>aTA	p.N269I	MYO16_ENST00000251041.5_Missense_Mutation_p.N269I|MYO16_ENST00000356711.2_Missense_Mutation_p.N269I	NM_001198950.1	NP_001185879.1			myosin XVI									p.N269I(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TTTCAGACAAATCTGGTGAAAC	0.455																																																1	Substitution - Missense(1)	ovary(1)	13																																								108270691	SO:0001583	missense	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	Exception_encountered	13.37:g.109472689_109472690delinsTA	ENSP00000350160:p.Asn269Ile	Unknown		x	x	x	108270690		Missense_Mutation	DNP	ENST00000357550.2	37	CCDS32008.1	DNP	4	Broad																																																																																				0.455	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		Missense_Mutation
CGRRF1	10668	broad.mit.edu	37	14	55004880	55004880	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr14:55004880T>C	ENST00000216420.7	+	6	910	c.778T>C	c.(778-780)Tct>Cct	p.S260P	CGRRF1_ENST00000557512.1_3'UTR	NM_006568.2	NP_006559.1	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	260					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S260P(1)		endometrium(3)|kidney(2)|lung(5)|ovary(2)|stomach(1)	13						GGTGGGACTCTCTGAAAGTGA	0.428																																																1	Substitution - Missense(1)	ovary(1)	14											108.0	100.0	103.0					14																	55004880		2203	4300	6503	54074630	SO:0001583	missense	10668			BC015063	CCDS9719.1	14q22.2	2013-09-20			ENSG00000100532	ENSG00000100532		"""RING-type (C3HC4) zinc fingers"""	15528	protein-coding gene	gene with protein product		606138				8968090	Standard	NM_006568		Approved	CGR19, RNF197	uc001xay.3	Q99675	OTTHUMG00000140308	ENST00000216420.7:c.778T>C	14.37:g.55004880T>C	ENSP00000216420:p.Ser260Pro	Unknown		x	x	x	54074630	Q96BX2	Missense_Mutation	SNP	ENST00000216420.7	37	CCDS9719.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	6.790	0.514737	0.12944	.	.	ENSG00000100532	ENST00000216420	T	0.27256	1.68	5.31	-1.53	0.08611	.	0.662690	0.15439	N	0.262295	T	0.20088	0.0483	L	0.46157	1.445	0.09310	N	1	B	0.22909	0.077	B	0.25759	0.063	T	0.27502	-1.0072	10	0.62326	D	0.03	-1.1262	7.9791	0.30172	0.1803:0.0:0.4602:0.3595	.	260	Q99675	CGRF1_HUMAN	P	260	ENSP00000216420:S260P	ENSP00000216420:S260P	S	+	1	0	CGRRF1	54074630	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	0.042000	0.13949	0.092000	0.17331	0.482000	0.46254	TCT		0.428	CGRRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276905.2	NM_006568		Missense_Mutation
NDN	4692	broad.mit.edu	37	15	23932244	23932244	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr15:23932244G>A	ENST00000331837.4	-	1	206	c.121C>T	c.(121-123)Ccg>Tcg	p.P41S		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	41					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P41S(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGGCTCTGCGGCTCTGCCAGG	0.726									Prader-Willi syndrome																																							1	Substitution - Missense(1)	ovary(1)	15											8.0	9.0	9.0					15																	23932244		1689	3312	5001	21483337	SO:0001583	missense	4692	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.121C>T	15.37:g.23932244G>A	ENSP00000332643:p.Pro41Ser	Unknown		x	x	x	21483337	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	37	CCDS10014.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370427	0.24771	.	.	ENSG00000182636	ENST00000331837	T	0.02177	4.41	3.09	0.0374	0.14196	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.49113	-0.8973	9	0.21540	T	0.41	.	2.6315	0.04946	0.261:0.0:0.5115:0.2275	.	41	Q99608	NECD_HUMAN	S	41	ENSP00000332643:P41S	ENSP00000332643:P41S	P	-	1	0	NDN	21483337	0.037000	0.19845	0.008000	0.14137	0.023000	0.10783	0.980000	0.29513	0.012000	0.14892	0.561000	0.74099	CCG		0.726	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487		Missense_Mutation
VPS13C	54832	broad.mit.edu	37	15	62201253	62201253	+	Silent	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr15:62201253C>T	ENST00000261517.5	-	65	8989	c.8916G>A	c.(8914-8916)gaG>gaA	p.E2972E	VPS13C_ENST00000395898.3_Silent_p.E2929E|VPS13C_ENST00000395896.4_Silent_p.E2972E|VPS13C_ENST00000249837.3_Silent_p.E2929E	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.E2972E(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GTGCAGATCCCTCATGGTAAT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	15											157.0	144.0	149.0					15																	62201253		2203	4300	6503	59988545	SO:0001819	synonymous_variant	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8916G>A	15.37:g.62201253C>T		Unknown		x	x	x	59988545		Silent	SNP	ENST00000261517.5	37	CCDS32257.1	SNP	24	Broad																																																																																				0.373	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		Silent
PRC1	9055	broad.mit.edu	37	15	91524227	91524227	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr15:91524227C>G	ENST00000361188.5	-	6	1920	c.709G>C	c.(709-711)Gag>Cag	p.E237Q	PRC1-AS1_ENST00000554388.1_RNA|PRC1_ENST00000361919.3_Missense_Mutation_p.E237Q|PRC1_ENST00000442656.2_Missense_Mutation_p.E196Q|PRC1_ENST00000394249.3_Missense_Mutation_p.E237Q					protein regulator of cytokinesis 1									p.E237Q(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					CGCAGCCCCTCACACACTGCT	0.507																																																1	Substitution - Missense(1)	ovary(1)	15											110.0	107.0	108.0					15																	91524227		2198	4298	6496	89325231	SO:0001583	missense	9055			AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.709G>C	15.37:g.91524227C>G	ENSP00000354679:p.Glu237Gln	Unknown		x	x	x	89325231		Missense_Mutation	SNP	ENST00000361188.5	37	CCDS45352.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068059	0.36470	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000442656;ENST00000556982	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.19	5.19	0.71726	.	0.240235	0.41605	D	0.000850	T	0.40979	0.1139	L	0.39514	1.22	0.38511	D	0.948472	D;D;D;D	0.63046	0.991;0.991;0.991;0.992	P;P;P;D	0.63703	0.865;0.907;0.865;0.917	T	0.09378	-1.0677	10	0.02654	T	1	.	18.5027	0.90888	0.0:1.0:0.0:0.0	.	196;237;237;237	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	Q	237;237;237;196;11	ENSP00000377793:E237Q;ENSP00000354618:E237Q;ENSP00000354679:E237Q;ENSP00000409549:E196Q	ENSP00000354679:E237Q	E	-	1	0	PRC1	89325231	0.608000	0.26966	0.998000	0.56505	0.023000	0.10783	1.659000	0.37387	2.711000	0.92665	0.655000	0.94253	GAG		0.507	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981		Missense_Mutation
SYNM	23336	broad.mit.edu	37	15	99672905	99672905	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr15:99672905C>G	ENST00000336292.6	+	5	4457	c.4337C>G	c.(4336-4338)aCg>aGg	p.T1446R	SYNM_ENST00000560674.1_Intron|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000328642.7_Intron|SYNM_ENST00000561323.1_3'UTR	NM_145728.2	NP_663780.2	O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1447	Interaction with DMD and UTRN.|Interaction with TLN1 and VCL.|Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						AGCAGCAGAACGCTAAGGCAC	0.542																																					Pancreas(125;1071 1762 21750 40003 40381)											0			15											185.0	190.0	188.0					15																	99672905		2106	4218	6324	97490428	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000336292.6:c.4337C>G	15.37:g.99672905C>G	ENSP00000336775:p.Thr1446Arg	Unknown		x	x	x	97490428	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000336292.6	37		SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613985	0.46631	.	.	ENSG00000182253	ENST00000336292	T	0.17691	2.26	5.11	1.09	0.20402	.	.	.	.	.	T	0.15176	0.0366	.	.	.	0.09310	N	1	B	0.27951	0.195	B	0.33042	0.157	T	0.30208	-0.9986	8	0.87932	D	0	.	6.7538	0.23501	0.0:0.6571:0.127:0.2159	.	1447	O15061	SYNEM_HUMAN	R	1446	ENSP00000336775:T1446R	ENSP00000336775:T1446R	T	+	2	0	SYNM	97490428	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.990000	0.29642	-0.048000	0.13401	-0.743000	0.03520	ACG		0.542	SYNM-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145728		Missense_Mutation
GSPT1	2935	broad.mit.edu	37	16	11980775	11980775	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr16:11980775C>T	ENST00000563468.1	-	6	583	c.557G>A	c.(556-558)aGg>aAg	p.R186K	GSPT1_ENST00000564790.1_5'Flank|RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000434724.2_Missense_Mutation_p.R324K|GSPT1_ENST00000420576.2_Missense_Mutation_p.R186K|GSPT1_ENST00000439887.2_Missense_Mutation_p.R323K			P15170	ERF3A_HUMAN	G1 to S phase transition 1	186	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)	p.R186K(1)		breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						CTCTCCTTTCCTGGCTGAGAT	0.398																																																1	Substitution - Missense(1)	ovary(1)	16											164.0	161.0	162.0					16																	11980775		2124	4261	6385	11888276	SO:0001583	missense	2935			BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.557G>A	16.37:g.11980775C>T	ENSP00000454351:p.Arg186Lys	Unknown		x	x	x	11888276	J3KQG6|Q96GF2	Missense_Mutation	SNP	ENST00000563468.1	37	CCDS45414.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.156607	0.94686	.	.	ENSG00000103342	ENST00000434724;ENST00000439887;ENST00000420576	T;T;T	0.70164	-0.46;-0.46;-0.46	5.51	5.51	0.81932	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	U	0.000000	D	0.82604	0.5073	M	0.86953	2.85	0.80722	D	1	D;D;D	0.55385	0.971;0.971;0.971	P;P;P	0.60068	0.868;0.868;0.868	D	0.84124	0.0408	10	0.48119	T	0.1	-13.7821	17.981	0.89141	0.0:1.0:0.0:0.0	.	323;320;186	E7EQZ3;Q96GF2;P15170	.;.;ERF3A_HUMAN	K	324;323;186	ENSP00000398131:R324K;ENSP00000408399:R323K;ENSP00000399539:R186K	ENSP00000399539:R186K	R	-	2	0	GSPT1	11888276	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.584000	0.87258	0.561000	0.74099	AGG		0.398	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421513.1	NM_002094		Missense_Mutation
ZNF821	55565	broad.mit.edu	37	16	71894401	71894401	+	Silent	SNP	G	G	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr16:71894401G>T	ENST00000565601.1	-	7	1166	c.759C>A	c.(757-759)ccC>ccA	p.P253P	ZNF821_ENST00000564134.1_3'UTR|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000313565.6_Silent_p.P211P|ZNF821_ENST00000446827.2_Silent_p.P211P|ZNF821_ENST00000425432.1_Silent_p.P253P	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P211P(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						TGCGTACACTGGGAGTCTGGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	16											108.0	97.0	101.0					16																	71894401		2198	4300	6498	70451902	SO:0001819	synonymous_variant	55565			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.759C>A	16.37:g.71894401G>T		Unknown		x	x	x	70451902	A6NK48|B4DKK4|D3DWS3	Silent	SNP	ENST00000565601.1	37	CCDS56006.1	SNP	47	Broad																																																																																				0.567	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1	NM_017530		Silent
TRPV3	162514	broad.mit.edu	37	17	3458091	3458091	+	Silent	SNP	G	G	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr17:3458091G>C	ENST00000576742.1	-	2	375	c.54C>G	c.(52-54)gcC>gcG	p.A18A	TRPV3_ENST00000572519.1_Silent_p.A18A|TRPV3_ENST00000301365.4_Silent_p.A18A	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	18					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.A18A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	TCCCACTGGGGGCAGCAACTC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											42.0	43.0	43.0					17																	3458091		2203	4300	6503	3404841	SO:0001819	synonymous_variant	162514			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.54C>G	17.37:g.3458091G>C		Unknown		x	x	x	3404841	Q8NDW7|Q8NET9|Q8NFH2	Silent	SNP	ENST00000576742.1	37	CCDS11029.1	SNP	43	Broad																																																																																				0.627	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		Silent
MED11	400569	broad.mit.edu	37	17	4635181	4635181	+	Missense_Mutation	SNP	C	C	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr17:4635181C>A	ENST00000293777.5	+	2	252	c.196C>A	c.(196-198)Cag>Aag	p.Q66K	CXCL16_ENST00000576153.1_5'Flank|RP11-314A20.5_ENST00000570493.2_RNA|MED11_ENST00000575284.1_Missense_Mutation_p.Q66K|MED11_ENST00000573708.1_Missense_Mutation_p.Q66K	NM_001001683.2	NP_001001683.1	Q9P086	MED11_HUMAN	mediator complex subunit 11	66						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q66K(1)		lung(2)|ovary(2)	4						GCTGTCAGCTCAGATCCGCTA	0.612											OREG0024104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17											38.0	40.0	39.0					17																	4635181		2203	4300	6503	4581930	SO:0001583	missense	400569			AF161414	CCDS32533.1	17p13.2	2007-07-30	2007-07-30			ENSG00000161920			32687	protein-coding gene	gene with protein product		612383	"""mediator of RNA polymerase II transcription, subunit 11 homolog (S. cerevisiae)"""			15175163, 12584197	Standard	NM_001001683		Approved	HSPC296, MGC88387	uc002fyp.3	Q9P086		ENST00000293777.5:c.196C>A	17.37:g.4635181C>A	ENSP00000293777:p.Gln66Lys	Unknown	620	x	x	x	4581930	Q6NS89	Missense_Mutation	SNP	ENST00000293777.5	37	CCDS32533.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920055	0.92249	.	.	ENSG00000161920	ENST00000293777	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.68317	2.08	0.80722	D	1	P	0.47034	0.889	P	0.45406	0.479	T	0.68127	-0.5491	9	0.72032	D	0.01	-20.0936	17.5022	0.87735	0.0:1.0:0.0:0.0	.	66	Q9P086	MED11_HUMAN	K	66	.	ENSP00000293777:Q66K	Q	+	1	0	MED11	4581930	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.088000	0.71371	2.727000	0.93392	0.655000	0.94253	CAG		0.612	MED11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439574.1	NM_001001683		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr17:7577568C>A	ENST00000269305.4	-	7	902	c.713G>T	c.(712-714)tGt>tTt	p.C238F	TP53_ENST00000420246.2_Missense_Mutation_p.C238F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C238F|TP53_ENST00000445888.2_Missense_Mutation_p.C238F|TP53_ENST00000455263.2_Missense_Mutation_p.C238F|TP53_ENST00000413465.2_Missense_Mutation_p.C238F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	17	GRCh37	CM034930	TP53	M							132.0	103.0	113.0					17																	7577568		2203	4300	6503	7518293	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>T	17.37:g.7577568C>A	ENSP00000269305:p.Cys238Phe	Unknown		x	x	x	7518293	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262614	0.80358	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238F;ENSP00000352610:C238F;ENSP00000269305:C238F;ENSP00000398846:C238F;ENSP00000391127:C238F;ENSP00000391478:C238F;ENSP00000425104:C106F;ENSP00000423862:C145F	ENSP00000269305:C238F	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ETV4	2118	broad.mit.edu	37	17	41606539	41606539	+	Silent	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr17:41606539C>G	ENST00000319349.5	-	12	1492	c.1194G>C	c.(1192-1194)tcG>tcC	p.S398S	ETV4_ENST00000545089.1_Silent_p.S344S|ETV4_ENST00000538265.1_Silent_p.S359S|ETV4_ENST00000393664.2_Silent_p.S398S|ETV4_ENST00000586826.1_Silent_p.S121S|ETV4_ENST00000545954.1_Silent_p.S359S|ETV4_ENST00000591713.1_Silent_p.S398S	NM_001079675.2	NP_001073143.1	P43268	ETV4_HUMAN	ets variant 4	398					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|motor neuron axon guidance (GO:0008045)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S398S(1)	EWSR1/ETV4(6)|CANT1/ETV4(3)|TMPRSS2/ETV4(13)|DDX5_ENST00000540698/ETV4(2)|KLK2/ETV4(2)	ovary(2)|upper_aerodigestive_tract(1)	3		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		AGTATCGGAGCGAGCGGCTCA	0.567			T	"""EWSR1, TMPRSS2, DDX5, KLK2, CANT1"""	"""Ewing sarcoma, Prostate carcinoma"""																																Esophageal Squamous(116;1540 1611 12927 31103 34118)		Dom	yes		17	17q21	2118	"""ets variant gene 4 (E1A enhancer binding protein, E1AF)"""		"""M, E"""	1	Substitution - coding silent(1)	ovary(1)	17											154.0	149.0	151.0					17																	41606539		2203	4300	6503	38962065	SO:0001819	synonymous_variant	2118			U18018	CCDS11465.1, CCDS58553.1, CCDS59292.1	17q21	2014-04-30	2008-09-12			ENSG00000175832			3493	protein-coding gene	gene with protein product	"""E1A enhancer binding protein"""	600711	"""ets variant gene 4 (E1A enhancer-binding protein, E1AF)"""			8530053, 1547944	Standard	NM_001986		Approved	E1A-F, E1AF, PEA3	uc002idw.3	P43268		ENST00000319349.5:c.1194G>C	17.37:g.41606539C>G		Unknown		x	x	x	38962065	A8K314|B7Z5J3|B7Z9J6|Q96AW9	Silent	SNP	ENST00000319349.5	37	CCDS11465.1	SNP	27	Broad																																																																																				0.567	ETV4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453489.1	NM_001986		Silent
CA4	762	broad.mit.edu	37	17	58236639	58236639	+	Missense_Mutation	SNP	A	A	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr17:58236639A>G	ENST00000300900.4	+	8	892	c.793A>G	c.(793-795)Agc>Ggc	p.S265G		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	265					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.S265G(1)		kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	ACAGACAGTGAGCATGAAGGA	0.647																																																1	Substitution - Missense(1)	ovary(1)	17											34.0	22.0	26.0					17																	58236639		2203	4300	6503	55591421	SO:0001583	missense	762			L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.793A>G	17.37:g.58236639A>G	ENSP00000300900:p.Ser265Gly	Unknown		x	x	x	55591421	B4DQA4|Q6FHI7	Missense_Mutation	SNP	ENST00000300900.4	37	CCDS11624.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	6.494	0.459322	0.12342	.	.	ENSG00000167434	ENST00000300900	T	0.68025	-0.3	3.3	2.22	0.28083	Carbonic anhydrase, alpha-class, catalytic domain (4);	1.247480	0.05277	N	0.518714	T	0.47948	0.1473	N	0.17723	0.515	0.09310	N	1	B	0.27117	0.168	B	0.18561	0.022	T	0.32025	-0.9922	10	0.23302	T	0.38	.	5.2565	0.15550	0.8677:0.0:0.1323:0.0	.	265	P22748	CAH4_HUMAN	G	265	ENSP00000300900:S265G	ENSP00000300900:S265G	S	+	1	0	CA4	55591421	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.272000	0.08560	0.669000	0.31146	0.454000	0.30748	AGC		0.647	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717		Missense_Mutation
TMC8	147138	broad.mit.edu	37	17	76134472	76134472	+	Missense_Mutation	SNP	C	C	T	rs199993214		TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr17:76134472C>T	ENST00000318430.5	+	13	1950	c.1576C>T	c.(1576-1578)Cgt>Tgt	p.R526C	TMC8_ENST00000589691.1_Missense_Mutation_p.R303C|TMC8_ENST00000591144.1_3'UTR	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	526					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)	p.R526C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GCGGCCCTTCCGTGCCTCCAG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		18763	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17											74.0	76.0	76.0					17																	76134472		2203	4300	6503	73646067	SO:0001583	missense	147138			AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1576C>T	17.37:g.76134472C>T	ENSP00000325561:p.Arg526Cys	Unknown		x	x	x	73646067	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Missense_Mutation	SNP	ENST00000318430.5	37	CCDS32749.1	SNP	23	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.90	3.249925	0.59212	.	.	ENSG00000167895	ENST00000318430	T	0.71579	-0.58	4.84	4.84	0.62591	.	0.124359	0.56097	D	0.000039	D	0.83727	0.5317	M	0.84156	2.68	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.85954	0.1466	10	0.87932	D	0	-16.3831	12.206	0.54353	0.1711:0.8289:0.0:0.0	.	526	Q8IU68	TMC8_HUMAN	C	526	ENSP00000325561:R526C	ENSP00000325561:R526C	R	+	1	0	TMC8	73646067	1.000000	0.71417	0.988000	0.46212	0.219000	0.24729	2.331000	0.43894	2.379000	0.81126	0.563000	0.77884	CGT		0.617	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3			Missense_Mutation
TMEM241	85019	broad.mit.edu	37	18	20878004	20878004	+	Silent	SNP	G	G	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr18:20878004G>T	ENST00000383233.3	-	15	910	c.858C>A	c.(856-858)gcC>gcA	p.A286A	TMEM241_ENST00000450466.2_Intron|TMEM241_ENST00000542162.1_3'UTR|TMEM241_ENST00000475185.1_5'UTR	NM_032933.4	NP_116322.3	Q24JQ0	TM241_HUMAN	transmembrane protein 241	286						integral component of membrane (GO:0016021)		p.A286A(1)									AAACCAGCAAGGCCTCTCCAA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	18											77.0	81.0	80.0					18																	20878004		1993	4164	6157	19132002	SO:0001819	synonymous_variant	85019			BC082984	CCDS11876.2	18q11.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134490	ENSG00000134490			31723	protein-coding gene	gene with protein product		615430	"""chromosome 18 open reading frame 45"""	C18orf45		12477932	Standard	NM_032933		Approved	MGC11386, FLJ44259	uc002kuf.3	Q24JQ0	OTTHUMG00000131771	ENST00000383233.3:c.858C>A	18.37:g.20878004G>T		Unknown		x	x	x	19132002	I0J130|Q6ZTS7|Q6ZW41	Silent	SNP	ENST00000383233.3	37	CCDS11876.2	SNP	35	Broad																																																																																				0.597	TMEM241-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254702.3	NM_032933		Silent
CCDC178	374864	broad.mit.edu	37	18	30928909	30928909	+	Missense_Mutation	SNP	T	T	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr18:30928909T>G	ENST00000383096.3	-	8	584	c.402A>C	c.(400-402)aaA>aaC	p.K134N	CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000300227.8_Missense_Mutation_p.K134N|CCDC178_ENST00000579947.1_Missense_Mutation_p.K134N|CCDC178_ENST00000403303.1_Missense_Mutation_p.K134N|CCDC178_ENST00000583930.1_Missense_Mutation_p.K134N|CCDC178_ENST00000406524.2_Missense_Mutation_p.K134N|CCDC178_ENST00000402325.1_Missense_Mutation_p.K134N			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	134								p.K134N(1)									TCCAATCTTCTTTCAGGTCTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	18											135.0	117.0	123.0					18																	30928909		2203	4300	6503	29182907	SO:0001583	missense	374864			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.402A>C	18.37:g.30928909T>G	ENSP00000372576:p.Lys134Asn	Unknown		x	x	x	29182907	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	11.55	1.671820	0.29693	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.48836	2.39;2.39;2.39;2.39;2.39;0.8	3.82	0.948	0.19561	.	.	.	.	.	T	0.49133	0.1539	L	0.50333	1.59	0.09310	N	1	D;P;B;B	0.54964	0.969;0.867;0.337;0.337	P;P;B;B	0.55824	0.785;0.45;0.116;0.116	T	0.32481	-0.9905	9	0.31617	T	0.26	-1.8319	5.1944	0.15227	0.0:0.3508:0.0:0.6492	.	134;134;134;134	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	N	134	ENSP00000385591:K134N;ENSP00000372576:K134N;ENSP00000300227:K134N;ENSP00000385867:K134N;ENSP00000385234:K134N;ENSP00000382130:K134N	ENSP00000300227:K134N	K	-	3	2	C18orf34	29182907	0.012000	0.17670	0.060000	0.19600	0.711000	0.40976	0.058000	0.14301	0.180000	0.19960	0.482000	0.46254	AAA		0.343	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		Missense_Mutation
ZNF91	7644	broad.mit.edu	37	19	23545146	23545146	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr19:23545146C>T	ENST00000300619.7	-	4	840	c.635G>A	c.(634-636)tGt>tAt	p.C212Y	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.C180Y	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	212					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C212S(1)|p.C212Y(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ACATTCTTTACATTTACAGGA	0.323																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	19											72.0	76.0	75.0					19																	23545146		2124	4266	6390	23336986	SO:0001583	missense	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.635G>A	19.37:g.23545146C>T	ENSP00000300619:p.Cys212Tyr	Unknown		x	x	x	23336986	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	6.385	0.439080	0.12104	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.38560	1.13;1.13	1.64	0.469	0.16741	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47340	0.1440	H	0.96633	3.855	0.19300	N	0.999975	P;P	0.45348	0.856;0.775	B;B	0.31101	0.124;0.058	T	0.53315	-0.8456	9	0.87932	D	0	.	5.6078	0.17389	0.0:0.7926:0.0:0.2074	.	180;212	Q05481-2;Q05481	.;ZNF91_HUMAN	Y	212;180	ENSP00000300619:C212Y;ENSP00000380272:C180Y	ENSP00000300619:C212Y	C	-	2	0	ZNF91	23336986	0.992000	0.36948	0.005000	0.12908	0.009000	0.06853	4.975000	0.63777	0.008000	0.14787	0.174000	0.16983	TGT		0.323	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		Missense_Mutation
SHKBP1	92799	broad.mit.edu	37	19	41094995	41094995	+	Silent	SNP	C	C	T	rs373280102		TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr19:41094995C>T	ENST00000291842.5	+	15	1549	c.1500C>T	c.(1498-1500)taC>taT	p.Y500Y	SHKBP1_ENST00000600733.1_Silent_p.Y475Y|SHKBP1_ENST00000597649.1_3'UTR	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	500					protein homooligomerization (GO:0051260)			p.Y500Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGGCCCCTACGGTGAGCGGG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19						C		1,4405	2.1+/-5.4	0,1,2202	53.0	45.0	48.0		1500	-3.6	0.6	19		48	0,8600		0,0,4300	no	coding-synonymous	SHKBP1	NM_138392.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		500/708	41094995	1,13005	2203	4300	6503	45786835	SO:0001819	synonymous_variant	92799			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1500C>T	19.37:g.41094995C>T		Unknown		x	x	x	45786835	Q8N2I6|Q8WY93|Q96IB8	Silent	SNP	ENST00000291842.5	37	CCDS12560.1	SNP	19	Broad																																																																																				0.637	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392		Silent
RSPH6A	81492	broad.mit.edu	37	19	46317996	46317997	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr19:46317996_46317997CC>AA	ENST00000221538.3	-	1	580_581	c.438_439GG>TT	c.(436-441)ttGGgc>ttTTgc	p.146_147LG>FC	RSPH6A_ENST00000597055.1_Missense_Mutation_p.146_147LG>FC|SYMPK_ENST00000598155.1_5'Flank	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	146						intracellular (GO:0005622)		p.L146_G147>FC(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						TTGAACTGGCCCAAGGGGTTGA	0.599																																																1	Complex - compound substitution(1)	ovary(1)	19																																								51009837	SO:0001583	missense	81492			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.438_439delinsAA	19.37:g.46317996_46317997delinsAA	ENSP00000221538:p.L146_G147delinsFC	Unknown		x	x	x	51009836	Q53FE2|Q6PEZ9	Missense_Mutation	DNP	ENST00000221538.3	37	CCDS12675.1	DNP	22	Broad																																																																																				0.599	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1			Missense_Mutation
NLRP12	91662	broad.mit.edu	37	19	54312964	54312964	+	Missense_Mutation	SNP	G	G	C	rs373806981		TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr19:54312964G>C	ENST00000324134.6	-	3	2117	c.1949C>G	c.(1948-1950)tCc>tGc	p.S650C	NLRP12_ENST00000391773.1_Missense_Mutation_p.S650C|NLRP12_ENST00000535162.1_Missense_Mutation_p.S650C|NLRP12_ENST00000391775.3_Missense_Mutation_p.S650C|NLRP12_ENST00000351894.4_Missense_Mutation_p.S650C|NLRP12_ENST00000345770.5_Missense_Mutation_p.S650C|NLRP12_ENST00000354278.3_Missense_Mutation_p.S650C|NLRP12_ENST00000391772.1_Missense_Mutation_p.S650C	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	650					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.S650C(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		ACAGAACGAGGAGACCATGTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											69.0	63.0	65.0					19																	54312964		2203	4300	6503	59004776	SO:0001583	missense	91662			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1949C>G	19.37:g.54312964G>C	ENSP00000319377:p.Ser650Cys	Unknown		x	x	x	59004776	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	6.971	0.549075	0.13312	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65;-2.65;-2.65	4.05	1.83	0.25207	.	0.445392	0.16561	N	0.209031	D	0.84588	0.5505	L	0.37507	1.11	0.19945	N	0.999944	B;B;B;B	0.18461	0.028;0.028;0.001;0.017	B;B;B;B	0.18263	0.018;0.018;0.001;0.021	T	0.72597	-0.4245	10	0.39692	T	0.17	.	10.8956	0.47021	0.0:0.4676:0.5324:0.0	.	650;650;650;650	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	C	650	ENSP00000319377:S650C;ENSP00000438030:S650C;ENSP00000340473:S650C;ENSP00000346231:S650C;ENSP00000375655:S650C;ENSP00000375653:S650C;ENSP00000375652:S650C	ENSP00000319377:S650C	S	-	2	0	NLRP12	59004776	0.006000	0.16342	0.005000	0.12908	0.021000	0.10359	1.809000	0.38922	0.297000	0.22615	-0.410000	0.06199	TCC		0.607	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		Missense_Mutation
LILRA5	353514	broad.mit.edu	37	19	54822927	54822927	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr19:54822927T>C	ENST00000301219.3	-	5	588	c.469A>G	c.(469-471)Aac>Gac	p.N157D	LILRA5_ENST00000346508.3_Missense_Mutation_p.N145D|LILRA5_ENST00000432233.3_Missense_Mutation_p.N157D|AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000446712.3_Missense_Mutation_p.N145D	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	157	Ig-like C2-type 2.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.N157D(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGTCACGTTCTCTCCTGAG	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											82.0	81.0	82.0					19																	54822927		2203	4300	6503	59514739	SO:0001583	missense	353514			AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.469A>G	19.37:g.54822927T>C	ENSP00000301219:p.Asn157Asp	Unknown		x	x	x	59514739	A6NHI3	Missense_Mutation	SNP	ENST00000301219.3	37	CCDS12888.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	14.86	2.661078	0.47572	.	.	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.00824	5.65;5.65;5.65;5.65	2.61	2.61	0.31194	Immunoglobulin-like fold (1);	1.492870	0.04804	U	0.434106	T	0.03783	0.0107	M	0.89163	3.01	0.09310	N	1	P;P;P;P	0.40834	0.625;0.678;0.654;0.73	B;B;B;P	0.45856	0.259;0.233;0.303;0.495	T	0.39313	-0.9620	10	0.87932	D	0	.	6.9932	0.24767	0.0:0.0:0.0:1.0	.	145;157;145;157	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	D	157;145;145;157	ENSP00000301219:N157D;ENSP00000302948:N145D;ENSP00000389499:N145D;ENSP00000404236:N157D	ENSP00000301219:N157D	N	-	1	0	LILRA5	59514739	0.000000	0.05858	0.012000	0.15200	0.006000	0.05464	0.166000	0.16583	1.214000	0.43395	0.172000	0.16884	AAC		0.567	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985		Missense_Mutation
MAP4K3	8491	broad.mit.edu	37	2	39664035	39664035	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr2:39664035T>C	ENST00000263881.3	-	1	418	c.94A>G	c.(94-96)Aag>Gag	p.K32E	AC007246.3_ENST00000422128.1_RNA|AC007246.3_ENST00000445520.1_RNA|MAP4K3_ENST00000484274.1_Missense_Mutation_p.K32E|MAP4K3_ENST00000341681.5_Missense_Mutation_p.K32E|AC007246.3_ENST00000449569.1_RNA|AC007246.3_ENST00000443038.1_RNA|AC007246.3_ENST00000426083.1_RNA	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	32	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.K32E(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GCCTTTACCTTGTAGACGTCG	0.701																																																1	Substitution - Missense(1)	ovary(1)	2											12.0	14.0	13.0					2																	39664035		2179	4277	6456	39517539	SO:0001583	missense	8491			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.94A>G	2.37:g.39664035T>C	ENSP00000263881:p.Lys32Glu	Unknown		x	x	x	39517539	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	CCDS1803.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	32	5.134056	0.94517	.	.	ENSG00000011566	ENST00000263881;ENST00000341681	T;T	0.27557	1.66;1.66	3.78	2.53	0.30540	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	L	0.47078	1.49	0.80722	D	1	P;D	0.69078	0.937;0.997	P;D	0.65323	0.516;0.934	T	0.12993	-1.0526	9	.	.	.	.	8.4879	0.33082	0.0:0.0:0.1947:0.8053	.	32;32	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	E	32	ENSP00000263881:K32E;ENSP00000345434:K32E	.	K	-	1	0	MAP4K3	39517539	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.150000	0.64869	1.580000	0.49851	0.379000	0.24179	AAG		0.701	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618		Missense_Mutation
TTL	150465	broad.mit.edu	37	2	113251755	113251755	+	Missense_Mutation	SNP	G	G	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr2:113251755G>T	ENST00000233336.6	+	3	463	c.272G>T	c.(271-273)tGc>tTc	p.C91F		NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	91	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)	p.C91F(1)		breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		GCTGAGTCCTGCACATGGTTC	0.478			T	ETV6	ALL																																		Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	1	Substitution - Missense(1)	ovary(1)	2											81.0	68.0	72.0					2																	113251755		2203	4300	6503	112968226	SO:0001583	missense	150465				CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.272G>T	2.37:g.113251755G>T	ENSP00000233336:p.Cys91Phe	Unknown		x	x	x	112968226	Q585T3|Q7Z302|Q8N426	Missense_Mutation	SNP	ENST00000233336.6	37	CCDS2096.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702250	0.48307	.	.	ENSG00000114999	ENST00000233336	T	0.05199	3.48	5.67	4.79	0.61399	.	0.090690	0.85682	D	0.000000	T	0.04048	0.0113	N	0.05230	-0.09	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.45789	-0.9237	10	0.42905	T	0.14	.	13.7627	0.62977	0.0755:0.0:0.9245:0.0	.	91	Q8NG68	TTL_HUMAN	F	91	ENSP00000233336:C91F	ENSP00000233336:C91F	C	+	2	0	TTL	112968226	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	5.077000	0.64419	1.527000	0.49086	0.561000	0.74099	TGC		0.478	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712		Missense_Mutation
SCN3A	6328	broad.mit.edu	37	2	166003344	166003344	+	Missense_Mutation	SNP	A	A	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr2:166003344A>G	ENST00000360093.3	-	12	2067	c.1576T>C	c.(1576-1578)Tcc>Ccc	p.S526P	RN7SL455P_ENST00000580629.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.S526P|SCN3A_ENST00000283254.7_Missense_Mutation_p.S526P	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	526					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S526P(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAGATTCGGATTTGGGAAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											224.0	222.0	223.0					2																	166003344		2203	4300	6503	165711590	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1576T>C	2.37:g.166003344A>G	ENSP00000353206:p.Ser526Pro	Unknown		x	x	x	165711590	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	15.49	2.848997	0.51164	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	5.67	4.52	0.55395	Domain of unknown function DUF3451 (1);	0.191789	0.37761	N	0.001958	D	0.96451	0.8842	M	0.91406	3.205	0.80722	D	1	D;D;B;B;D	0.89917	1.0;0.993;0.004;0.004;1.0	D;D;B;B;D	0.81914	0.995;0.985;0.006;0.006;0.994	D	0.96535	0.9396	10	0.87932	D	0	.	11.8309	0.52295	0.9315:0.0:0.0685:0.0	.	526;526;526;526;526	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	P	526	ENSP00000353206:S526P;ENSP00000283254:S526P;ENSP00000386726:S526P;ENSP00000403348:S526P	ENSP00000283254:S526P	S	-	1	0	SCN3A	165711590	1.000000	0.71417	0.982000	0.44146	0.134000	0.20937	8.910000	0.92685	1.087000	0.41251	-0.256000	0.11100	TCC		0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		Missense_Mutation
C2orf66	401027	broad.mit.edu	37	2	197672278	197672278	+	Silent	SNP	G	G	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr2:197672278G>A	ENST00000342506.2	-	2	1131	c.243C>T	c.(241-243)ttC>ttT	p.F81F		NM_213608.2	NP_998773.1	Q6UXQ4	CB066_HUMAN	chromosome 2 open reading frame 66	81						extracellular region (GO:0005576)		p.F81F(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9						CATTCGTGGGGAAAGGATTTG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	2											135.0	142.0	140.0					2																	197672278		2203	4300	6503	197380523	SO:0001819	synonymous_variant	401027				CCDS2317.1	2q33.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000187944	ENSG00000187944			33809	protein-coding gene	gene with protein product							Standard	NM_213608		Approved	UNQ6411	uc002utv.3	Q6UXQ4	OTTHUMG00000132742	ENST00000342506.2:c.243C>T	2.37:g.197672278G>A		Unknown		x	x	x	197380523	B2RNW3	Silent	SNP	ENST00000342506.2	37	CCDS2317.1	SNP	41	Broad																																																																																				0.398	C2orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256102.1	NM_213608		Silent
SNED1	25992	broad.mit.edu	37	2	242021731	242021731	+	Missense_Mutation	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr2:242021731C>T	ENST00000310397.8	+	29	4073	c.4073C>T	c.(4072-4074)tCc>tTc	p.S1358F	MTERFD2_ENST00000464344.2_Intron|SNED1_ENST00000342631.6_Missense_Mutation_p.S1325F|SNED1_ENST00000405547.3_Missense_Mutation_p.S1325F	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1358					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S1338F(1)		NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		AGGCTGTTCTCCGAGACAAAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	2											191.0	206.0	201.0					2																	242021731		2032	4185	6217	241670404	SO:0001583	missense	25992			AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.4073C>T	2.37:g.242021731C>T	ENSP00000308893:p.Ser1358Phe	Unknown		x	x	x	241670404	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	17.65	3.443319	0.63067	.	.	ENSG00000162804	ENST00000405547;ENST00000310397;ENST00000342631	D;D;D	0.84516	-1.78;-1.71;-1.86	4.48	4.48	0.54585	.	0.000000	0.38605	N	0.001624	D	0.89298	0.6675	L	0.47190	1.495	0.41761	D	0.989719	D;D	0.89917	0.998;1.0	D;D	0.91635	0.99;0.999	D	0.90603	0.4546	10	0.87932	D	0	.	13.8813	0.63684	0.0:1.0:0.0:0.0	.	1325;1358	B5MEF5;Q8TER0	.;SNED1_HUMAN	F	1325;1358;1325	ENSP00000386007:S1325F;ENSP00000308893:S1358F;ENSP00000342992:S1325F	ENSP00000308893:S1358F	S	+	2	0	SNED1	241670404	0.999000	0.42202	0.956000	0.39512	0.699000	0.40488	5.367000	0.66127	2.049000	0.60858	0.462000	0.41574	TCC		0.577	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482		Missense_Mutation
SLC4A11	83959	broad.mit.edu	37	20	3210863	3210863	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr20:3210863C>G	ENST00000380056.3	-	12	1554	c.1507G>C	c.(1507-1509)Gtg>Ctg	p.V503L	SLC4A11_ENST00000539553.2_Missense_Mutation_p.V487L|SLC4A11_ENST00000380059.3_Missense_Mutation_p.V530L|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	503	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.V503L(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GCATCCAGCACAAACGTGATG	0.622																																					NSCLC(190;922 2139 10266 10292 38692)											1	Substitution - Missense(1)	ovary(1)	20											94.0	85.0	88.0					20																	3210863		2203	4300	6503	3158863	SO:0001583	missense	83959			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1507G>C	20.37:g.3210863C>G	ENSP00000369396:p.Val503Leu	Unknown		x	x	x	3158863	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631907	0.29068	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	T;T;T	0.78924	-1.22;-1.22;-1.22	5.21	2.09	0.27110	Bicarbonate transporter, C-terminal (1);	0.522767	0.18903	N	0.127985	T	0.68897	0.3051	L	0.51853	1.615	0.58432	D	0.999996	B;B;B	0.28324	0.101;0.207;0.123	B;B;B	0.29353	0.042;0.101;0.07	T	0.61456	-0.7059	10	0.51188	T	0.08	.	6.9267	0.24419	0.1393:0.7033:0.0:0.1574	.	487;530;503	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	L	530;503;487	ENSP00000369399:V530L;ENSP00000369396:V503L;ENSP00000441370:V487L	ENSP00000369396:V503L	V	-	1	0	SLC4A11	3158863	1.000000	0.71417	0.115000	0.21578	0.329000	0.28539	2.522000	0.45572	0.165000	0.19558	0.563000	0.77884	GTG		0.622	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			Missense_Mutation
PROKR2	128674	broad.mit.edu	37	20	5282783	5282783	+	Missense_Mutation	SNP	C	C	T	rs576243101		TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr20:5282783C>T	ENST00000217270.3	-	2	1057	c.1058G>A	c.(1057-1059)cGt>cAt	p.R353H	PROKR2_ENST00000546004.1_Missense_Mutation_p.R353H	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	353					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.R353H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						CTGGGAGGGACGCCAGTGCAG	0.557										HNSCC(71;0.22)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		24072	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20											206.0	166.0	179.0					20																	5282783		2203	4300	6503	5230783	SO:0001583	missense	128674			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.1058G>A	20.37:g.5282783C>T	ENSP00000217270:p.Arg353His	Unknown		x	x	x	5230783	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	ENST00000217270.3	37	CCDS13089.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999680	0.54147	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.38401	1.14;1.14	5.05	4.1	0.47936	.	0.060269	0.64402	D	0.000009	T	0.34048	0.0884	M	0.62723	1.935	0.49213	D	0.999764	P	0.49447	0.924	B	0.40038	0.317	T	0.23084	-1.0198	10	0.44086	T	0.13	.	11.623	0.51130	0.0:0.9101:0.0:0.0899	.	353	Q8NFJ6	PKR2_HUMAN	H	353	ENSP00000440790:R353H;ENSP00000217270:R353H	ENSP00000217270:R353H	R	-	2	0	PROKR2	5230783	0.141000	0.22595	0.989000	0.46669	0.516000	0.34256	0.683000	0.25349	2.370000	0.80446	0.655000	0.94253	CGT		0.557	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773		Missense_Mutation
MYH7B	57644	broad.mit.edu	37	20	33586666	33586666	+	Missense_Mutation	SNP	A	A	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr20:33586666A>C	ENST00000262873.7	+	33	4356	c.4264A>C	c.(4264-4266)Agc>Cgc	p.S1422R		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1380						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.S1422R(1)		NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CCAGTGGAGGAGCAAGTACGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	20											26.0	30.0	28.0					20																	33586666		2202	4298	6500	33050327	SO:0001583	missense	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.4264A>C	20.37:g.33586666A>C	ENSP00000262873:p.Ser1422Arg	Unknown		x	x	x	33050327	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	16.45	3.127883	0.56721	.	.	ENSG00000078814	ENST00000262873	T	0.79352	-1.26	4.65	4.65	0.58169	Myosin tail (1);	0.000000	0.45361	D	0.000376	T	0.65933	0.2739	L	0.35723	1.085	0.38448	D	0.946894	P	0.38677	0.642	B	0.28011	0.085	T	0.74247	-0.3727	10	0.87932	D	0	.	13.9199	0.63926	1.0:0.0:0.0:0.0	.	1380	A7E2Y1	MYH7B_HUMAN	R	1422	ENSP00000262873:S1422R	ENSP00000262873:S1422R	S	+	1	0	MYH7B	33050327	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.108000	0.71522	1.953000	0.56701	0.459000	0.35465	AGC		0.632	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884		Missense_Mutation
TRPM2	7226	broad.mit.edu	37	21	45811185	45811185	+	Missense_Mutation	SNP	G	G	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr21:45811185G>T	ENST00000397928.1	+	11	1916	c.1471G>T	c.(1471-1473)Gca>Tca	p.A491S	TRPM2_ENST00000300482.5_Missense_Mutation_p.A491S|TRPM2_ENST00000300481.9_Missense_Mutation_p.A491S|TRPM2_ENST00000397932.2_Missense_Mutation_p.A491S|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	491					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.A491S(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GATGACAGCTGCACTCATCTC	0.527																																																1	Substitution - Missense(1)	ovary(1)	21											128.0	91.0	103.0					21																	45811185		2203	4300	6503	44635613	SO:0001583	missense	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1471G>T	21.37:g.45811185G>T	ENSP00000381023:p.Ala491Ser	Unknown		x	x	x	44635613	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760599	0.69763	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	M	0.91612	3.225	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70487	0.951;0.969;0.969	D	0.83703	0.0183	10	0.87932	D	0	-25.1522	16.963	0.86278	0.0:0.0:1.0:0.0	.	491;277;491	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	S	491	ENSP00000300482:A491S;ENSP00000381023:A491S;ENSP00000300481:A491S;ENSP00000381026:A491S	ENSP00000300481:A491S	A	+	1	0	TRPM2	44635613	1.000000	0.71417	0.931000	0.37212	0.319000	0.28217	6.905000	0.75714	2.456000	0.83038	0.655000	0.94253	GCA		0.527	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		Missense_Mutation
ALDH1L1	10840	broad.mit.edu	37	3	125872370	125872370	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr3:125872370C>G	ENST00000393434.2	-	7	1124	c.775G>C	c.(775-777)Gac>Cac	p.D259H	ALDH1L1_ENST00000413612.1_5'UTR|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.D259H|ALDH1L1_ENST00000455064.2_Missense_Mutation_p.D84H|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.D158H|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.D259H|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.D269H	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	259					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.D259H(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GGCAAAGCGTCTCCCTCGGGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											104.0	102.0	102.0					3																	125872370		2203	4300	6503	127355060	SO:0001583	missense	10840			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.775G>C	3.37:g.125872370C>G	ENSP00000377083:p.Asp259His	Unknown		x	x	x	127355060	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.14	1.268180	0.23136	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000455064	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	4.25	4.25	0.50352	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.500690	0.21188	N	0.078699	T	0.40645	0.1125	N	0.22421	0.69	0.35253	D	0.778901	P;P;B;D;B	0.57571	0.908;0.923;0.008;0.98;0.001	P;P;B;P;B	0.54759	0.607;0.726;0.013;0.76;0.008	T	0.54289	-0.8316	10	0.72032	D	0.01	.	10.1008	0.42504	0.0:0.7955:0.2045:0.0	.	84;158;311;164;259	B4DGC8;E9PBX3;Q59G10;Q9UFA9;O75891	.;.;.;.;AL1L1_HUMAN	H	269;259;158;259;259;84	ENSP00000273450:D269H;ENSP00000420293:D259H;ENSP00000395881:D158H;ENSP00000377083:D259H;ENSP00000377081:D259H;ENSP00000414126:D84H	ENSP00000273450:D269H	D	-	1	0	ALDH1L1	127355060	1.000000	0.71417	0.976000	0.42696	0.226000	0.24999	3.494000	0.53273	2.190000	0.69967	0.467000	0.42956	GAC		0.537	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190		Missense_Mutation
NPHP3	27031	broad.mit.edu	37	3	132420346	132420346	+	Missense_Mutation	SNP	G	G	C	rs202044508		TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr3:132420346G>C	ENST00000337331.5	-	10	1642	c.1556C>G	c.(1555-1557)gCa>gGa	p.A519G	NPHP3_ENST00000326682.8_Missense_Mutation_p.A519G	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	519					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)		p.A519G(1)		NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CGGGGCTGGTGCTGCCACTAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	3																																								133903036	SO:0001583	missense	27031			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.1556C>G	3.37:g.132420346G>C	ENSP00000338766:p.Ala519Gly	Unknown		x	x	x	133903036	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	37	CCDS3078.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431879	0.62844	.	.	ENSG00000113971	ENST00000326682;ENST00000337331	T;D	0.91740	-1.46;-2.9	5.79	4.91	0.64330	.	0.050100	0.85682	D	0.000000	D	0.91362	0.7275	L	0.58101	1.795	0.80722	D	1	P	0.51791	0.948	P	0.48304	0.573	D	0.89417	0.3707	10	0.29301	T	0.29	-21.1088	13.9462	0.64086	0.073:0.0:0.927:0.0	.	519	Q7Z494	NPHP3_HUMAN	G	519	ENSP00000319909:A519G;ENSP00000338766:A519G	ENSP00000319909:A519G	A	-	2	0	NPHP3	133903036	1.000000	0.71417	0.974000	0.42286	0.099000	0.18886	6.469000	0.73555	2.731000	0.93534	0.650000	0.86243	GCA		0.413	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240		Missense_Mutation
ABCC5	10057	broad.mit.edu	37	3	183639179	183639179	+	Missense_Mutation	SNP	A	A	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr3:183639179A>T	ENST00000334444.6	-	30	4463	c.4223T>A	c.(4222-4224)tTt>tAt	p.F1408Y	ABCC5_ENST00000265586.6_Missense_Mutation_p.F1365Y	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1408	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.F1408Y(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	TGGGGTGTCAAACTCCACCAC	0.562																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	90.0	87.0					3																	183639179		2089	4228	6317	185121873	SO:0001583	missense	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4223T>A	3.37:g.183639179A>T	ENSP00000333926:p.Phe1408Tyr	Unknown		x	x	x	185121873	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	15.78	2.933867	0.52866	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	T;T	0.79454	-1.27;-1.27	4.92	4.92	0.64577	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	N	0.17901	0.54	0.51233	D	0.999915	B;B	0.28667	0.219;0.126	B;B	0.33042	0.157;0.1	T	0.63629	-0.6594	10	0.40728	T	0.16	-4.1637	9.896	0.41318	0.8478:0.0:0.0:0.1522	.	1365;1408	Q86UX3;O15440	.;MRP5_HUMAN	Y	1408;1365	ENSP00000333926:F1408Y;ENSP00000265586:F1365Y	ENSP00000265586:F1365Y	F	-	2	0	ABCC5	185121873	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.884000	0.75600	1.840000	0.53500	0.482000	0.46254	TTT		0.562	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		Missense_Mutation
FGFR3	2261	broad.mit.edu	37	4	1807576	1807576	+	Missense_Mutation	SNP	G	G	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr4:1807576G>T	ENST00000260795.2	+	12	1847	c.1745G>T	c.(1744-1746)tGc>tTc	p.C582F	FGFR3_ENST00000352904.1_Missense_Mutation_p.C470F|FGFR3_ENST00000412135.2_Missense_Mutation_p.C470F|FGFR3_ENST00000340107.4_Missense_Mutation_p.C584F|FGFR3_ENST00000481110.2_Missense_Mutation_p.C583F|FGFR3_ENST00000440486.2_Missense_Mutation_p.C582F			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	582	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.C582F(1)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	TTCGACACCTGCAAGCCGCCC	0.682		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																														Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	1	Substitution - Missense(1)	ovary(1)	4											42.0	53.0	49.0					4																	1807576		2203	4298	6501	1777374	SO:0001583	missense	2261	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1745G>T	4.37:g.1807576G>T	ENSP00000260795:p.Cys582Phe	Unknown		x	x	x	1777374	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	g	12.56	1.974242	0.34848	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	D;D;D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76;-2.76;-2.76	4.32	4.32	0.51571	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87257	0.6132	N	0.21373	0.66	0.80722	D	1	B;P;B;B	0.48294	0.01;0.908;0.007;0.396	B;P;B;B	0.46543	0.033;0.52;0.021;0.064	D	0.89048	0.3453	10	0.54805	T	0.06	.	17.1556	0.86791	0.0:0.0:1.0:0.0	.	584;470;582;583	P22607-2;P22607-3;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	F	583;584;582;470;582;470	ENSP00000420533:C583F;ENSP00000339824:C584F;ENSP00000414914:C582F;ENSP00000412903:C470F;ENSP00000260795:C582F;ENSP00000231803:C470F	ENSP00000260795:C582F	C	+	2	0	FGFR3	1777374	1.000000	0.71417	0.998000	0.56505	0.216000	0.24613	4.537000	0.60643	2.119000	0.64992	0.297000	0.19635	TGC		0.682	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142		Missense_Mutation
CCDC158	339965	broad.mit.edu	37	4	77278575	77278575	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr4:77278575C>G	ENST00000388914.3	-	13	2277	c.2125G>C	c.(2125-2127)Gaa>Caa	p.E709Q	RNU6-1000P_ENST00000391066.1_RNA	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	709								p.E709Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						CTTGTCTGTTCTAGTTCAGAC	0.299																																																1	Substitution - Missense(1)	ovary(1)	4											130.0	123.0	125.0					4																	77278575		1845	4081	5926	77497599	SO:0001583	missense	339965			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.2125G>C	4.37:g.77278575C>G	ENSP00000373566:p.Glu709Gln	Unknown		x	x	x	77497599	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	CCDS43242.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547392	0.45383	.	.	ENSG00000163749	ENST00000388914	T	0.77489	-1.1	4.98	4.98	0.66077	.	0.086055	0.43747	D	0.000529	T	0.78679	0.4321	N	0.14661	0.345	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.81315	-0.0988	10	0.54805	T	0.06	.	15.2713	0.73705	0.0:1.0:0.0:0.0	.	709	Q5M9N0	CD158_HUMAN	Q	709	ENSP00000373566:E709Q	ENSP00000373566:E709Q	E	-	1	0	CCDC158	77497599	0.990000	0.36364	0.976000	0.42696	0.926000	0.56050	2.433000	0.44793	2.588000	0.87417	0.460000	0.39030	GAA		0.299	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		Missense_Mutation
ZGRF1	55345	broad.mit.edu	37	4	113539115	113539115	+	Missense_Mutation	SNP	G	G	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr4:113539115G>C	ENST00000505019.1	-	6	2208	c.2083C>G	c.(2083-2085)Caa>Gaa	p.Q695E	C4orf21_ENST00000445203.2_Missense_Mutation_p.Q664E|C4orf21_ENST00000309071.5_Missense_Mutation_p.Q695E	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		695						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.Q695E(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		ATCTGGTTTTGAATATGAGGA	0.308																																																1	Substitution - Missense(1)	ovary(1)	4											44.0	47.0	46.0					4																	113539115		2201	4297	6498	113758564	SO:0001583	missense	55345																														ENST00000505019.1:c.2083C>G	4.37:g.113539115G>C	ENSP00000424737:p.Gln695Glu	Unknown		x	x	x	113758564	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	37		SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	3.185	-0.167050	0.06461	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.81659	-1.52;1.98;1.56	4.96	-2.76	0.05896	.	1.904430	0.03088	N	0.159400	T	0.60856	0.2301	N	0.08118	0	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.13407	0.004;0.009	T	0.49551	-0.8928	10	0.16896	T	0.51	1.194	7.5872	0.27999	0.3123:0.1485:0.5393:0.0	.	695;695	Q86YA3;G5EA02	CD021_HUMAN;.	E	695;695;664	ENSP00000424737:Q695E;ENSP00000309095:Q695E;ENSP00000390505:Q664E	ENSP00000309095:Q695E	Q	-	1	0	C4orf21	113758564	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.480000	0.22244	-0.371000	0.08004	-0.262000	0.10625	CAA		0.308	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1			Missense_Mutation
ADCY2	108	broad.mit.edu	37	5	7826918	7826918	+	Silent	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr5:7826918C>T	ENST00000338316.4	+	25	3299	c.3210C>T	c.(3208-3210)gaC>gaT	p.D1070D	ADCY2_ENST00000537121.1_Silent_p.D890D	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1070					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.D1070D(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GAAAGGGGGACCTGAAGACGT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	5											119.0	100.0	107.0					5																	7826918		2203	4300	6503	7879918	SO:0001819	synonymous_variant	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3210C>T	5.37:g.7826918C>T		Unknown		x	x	x	7879918	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2	SNP	18	Broad																																																																																				0.502	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		Silent
CTNND2	1501	broad.mit.edu	37	5	11236923	11236923	+	Missense_Mutation	SNP	C	C	G			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr5:11236923C>G	ENST00000304623.8	-	10	1830	c.1641G>C	c.(1639-1641)tgG>tgC	p.W547C	CTNND2_ENST00000458100.2_Missense_Mutation_p.W114C|CTNND2_ENST00000359640.2_Missense_Mutation_p.W547C|CTNND2_ENST00000511377.1_Missense_Mutation_p.W456C|CTNND2_ENST00000503622.1_Missense_Mutation_p.W210C|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	547					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.W547C(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						CCGGGTCTCTCCATCCAAATT	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											81.0	81.0	81.0					5																	11236923		2203	4300	6503	11289923	SO:0001583	missense	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1641G>C	5.37:g.11236923C>G	ENSP00000307134:p.Trp547Cys	Unknown		x	x	x	11289923	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533805	0.85812	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.80994	-1.35;-1.38;-1.34;-1.44;-1.41	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90452	0.7010	M	0.78916	2.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.996;0.987	D	0.90725	0.4638	10	0.87932	D	0	-10.7502	20.0734	0.97734	0.0:1.0:0.0:0.0	.	210;114;547	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	C	547;547;456;114;210	ENSP00000307134:W547C;ENSP00000352661:W547C;ENSP00000426510:W456C;ENSP00000391155:W114C;ENSP00000426887:W210C	ENSP00000307134:W547C	W	-	3	0	CTNND2	11289923	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.751000	0.94390	0.555000	0.69702	TGG		0.483	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		Missense_Mutation
FBN2	2201	broad.mit.edu	37	5	127710427	127710427	+	Silent	SNP	C	C	T			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr5:127710427C>T	ENST00000508053.1	-	21	2963	c.1989G>A	c.(1987-1989)caG>caA	p.Q663Q	FBN2_ENST00000262464.4_Silent_p.Q663Q|FBN2_ENST00000511489.1_5'UTR|FBN2_ENST00000508989.1_Silent_p.Q630Q			P35556	FBN2_HUMAN	fibrillin 2	663	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Q663Q(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTCCTGGGGTCTGGCATTCAT	0.517																																																2	Substitution - coding silent(2)	ovary(2)	5											103.0	81.0	88.0					5																	127710427		2203	4300	6503	127738326	SO:0001819	synonymous_variant	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1989G>A	5.37:g.127710427C>T		Unknown		x	x	x	127738326	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1	SNP	32	Broad																																																																																				0.517	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		Silent
CTNNA1	1495	broad.mit.edu	37	5	138117614	138117614	+	Start_Codon_SNP	SNP	A	A	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr5:138117614A>C	ENST00000302763.7	+	2	91	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	CTNNA1_ENST00000518825.1_Start_Codon_SNP_p.M1L|CTNNA1_ENST00000355078.5_5'UTR	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	1					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.M1L(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTATTTAGAAATGACTGCTGT	0.398																																																1	Substitution - Missense(1)	ovary(1)	5											71.0	63.0	66.0					5																	138117614		2203	4300	6503	138145513	SO:0001582	initiator_codon_variant	1495			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1A>C	5.37:g.138117614A>C	ENSP00000304669:p.Met1Leu	Unknown		x	x	x	138145513	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	CCDS34243.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	18.01	3.528334	0.64860	.	.	ENSG00000044115	ENST00000517980;ENST00000522227;ENST00000524127;ENST00000523912;ENST00000520339;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000519113;ENST00000520158;ENST00000518825	T;T;T;T;T;T;T;T;T;T	0.70986	0.0;-0.0;1.0;-0.53;0.01;1.81;0.57;0.05;0.44;1.79	5.83	5.83	0.93111	.	0.039544	0.85682	D	0.000000	T	0.80539	0.4642	.	.	.	0.80722	D	1	B;B	0.29805	0.257;0.167	P;B	0.47786	0.557;0.267	T	0.80977	-0.1141	9	0.87932	D	0	-21.2993	15.864	0.79047	1.0:0.0:0.0:0.0	.	1;1	G3XAM7;P35221	.;CTNA1_HUMAN	L	1	ENSP00000428439:M1L;ENSP00000429636:M1L;ENSP00000428049:M1L;ENSP00000430304:M1L;ENSP00000428202:M1L;ENSP00000304669:M1L;ENSP00000428457:M1L;ENSP00000430078:M1L;ENSP00000429457:M1L;ENSP00000427821:M1L	ENSP00000304669:M1L	M	+	1	0	CTNNA1	138145513	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	8.828000	0.92047	2.231000	0.72958	0.459000	0.35465	ATG		0.398	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	Missense_Mutation	Missense_Mutation
HIST1H2BJ	8970	broad.mit.edu	37	6	27100452	27100452	+	Silent	SNP	G	G	A	rs138662108		TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr6:27100452G>A	ENST00000607124.1	-	1	77	c.78C>T	c.(76-78)gaC>gaT	p.D26D	HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000339812.2_Silent_p.D26D|HIST1H2BJ_ENST00000541790.1_Silent_p.D26D			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	26					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D26D(1)		breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						GCTTCTTGCCGTCTTTCTTCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	6											140.0	136.0	138.0					6																	27100452		2203	4300	6503	27208431	SO:0001819	synonymous_variant	8970			X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.78C>T	6.37:g.27100452G>A		Unknown		x	x	x	27208431	B2R4J4|O60816	Silent	SNP	ENST00000607124.1	37	CCDS4618.1	SNP	40	Broad																																																																																				0.562	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058		Silent
ABCC10	89845	broad.mit.edu	37	6	43406410	43406410	+	Silent	SNP	G	G	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr6:43406410G>A	ENST00000372530.4	+	8	2219	c.2004G>A	c.(2002-2004)ctG>ctA	p.L668L	ABCC10_ENST00000244533.3_Silent_p.L640L	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	668	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.L640L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GCTTTGGCCTGGCCACCCAGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	6											101.0	95.0	97.0					6																	43406410		2203	4300	6503	43514388	SO:0001819	synonymous_variant	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2004G>A	6.37:g.43406410G>A		Unknown		x	x	x	43514388	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	37	CCDS56430.1	SNP	47	Broad																																																																																				0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450		Silent
EPDR1	54749	broad.mit.edu	37	7	37960418	37960418	+	5'UTR	SNP	A	A	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr7:37960418A>C	ENST00000199448.4	+	0	256				EPDR1_ENST00000559325.1_Silent_p.A79A|EPDR1_ENST00000476620.1_Intron|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000423717.1_5'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A79A(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GACAGGAAGCACTTTGGTCCA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	7											27.0	37.0	34.0					7																	37960418		2203	4299	6502	37926943	SO:0001623	5_prime_UTR_variant	54749			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-124A>C	7.37:g.37960418A>C		Unknown		x	x	x	37926943	A8K4C0|C9JYS3|Q06BL0|Q99M77	Silent	SNP	ENST00000199448.4	37	CCDS5454.2	SNP	6	Broad																																																																																				0.682	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549		Silent
NPC1L1	29881	broad.mit.edu	37	7	44553115	44553115	+	Missense_Mutation	SNP	G	G	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr7:44553115G>C	ENST00000289547.4	-	20	4066	c.4011C>G	c.(4009-4011)agC>agG	p.S1337R	NPC1L1_ENST00000546276.1_Missense_Mutation_p.S1264R|NPC1L1_ENST00000381160.3_Missense_Mutation_p.S1310R	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1337					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.S1337R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	AACCTTCAAAGCTGTGGTTGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											125.0	123.0	124.0					7																	44553115		2203	4300	6503	44519640	SO:0001583	missense	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.4011C>G	7.37:g.44553115G>C	ENSP00000289547:p.Ser1337Arg	Unknown		x	x	x	44519640	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002101	0.35320	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.93426	-3.1;-3.12;-3.22	3.59	3.59	0.41128	.	1.122620	0.06931	N	0.811083	D	0.83440	0.5255	N	0.08118	0	0.24129	N	0.995778	B;B;P	0.37015	0.41;0.41;0.578	B;B;B	0.30029	0.11;0.11;0.11	T	0.72750	-0.4199	10	0.15952	T	0.53	-14.629	11.0178	0.47701	0.0:0.0:1.0:0.0	.	1264;1310;1337	B7ZLE6;Q17RV5;D3DVK9	.;.;.	R	1337;1310;1264	ENSP00000289547:S1337R;ENSP00000370552:S1310R;ENSP00000438033:S1264R	ENSP00000289547:S1337R	S	-	3	2	NPC1L1	44519640	0.957000	0.32711	0.703000	0.30354	0.074000	0.17049	0.923000	0.28757	2.304000	0.77564	0.462000	0.41574	AGC		0.557	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		Missense_Mutation
ELN	2006	broad.mit.edu	37	7	73455561	73455561	+	Missense_Mutation	SNP	C	C	A	rs41350445	byFrequency	TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr7:73455561C>A	ENST00000252034.7	+	5	611	c.212C>A	c.(211-213)gCg>gAg	p.A71E	ELN_ENST00000380553.4_Missense_Mutation_p.A71E|ELN_ENST00000380575.4_Missense_Mutation_p.A61E|ELN_ENST00000380576.5_Missense_Mutation_p.A71E|ELN_ENST00000320399.6_Missense_Mutation_p.A71E|ELN_ENST00000380584.4_Missense_Mutation_p.A71E|ELN_ENST00000429192.1_Missense_Mutation_p.A71E|ELN_ENST00000414324.1_Missense_Mutation_p.A61E|ELN_ENST00000445912.1_Missense_Mutation_p.A71E|ELN_ENST00000380562.4_Missense_Mutation_p.A71E|ELN_ENST00000358929.4_Missense_Mutation_p.A71E|ELN_ENST00000458204.1_Missense_Mutation_p.A61E|ELN_ENST00000320492.7_Intron|ELN_ENST00000357036.5_Missense_Mutation_p.A71E	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	71					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)	p.A71E(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGAGGGCTTGCGGGTGCTGGC	0.592			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																Dom	yes		7	7q11.23	2006	elastin	yes	L	1	Substitution - Missense(1)	ovary(1)	7											238.0	232.0	234.0					7																	73455561		2203	4300	6503	73093497	SO:0001583	missense	2006				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.212C>A	7.37:g.73455561C>A	ENSP00000252034:p.Ala71Glu	Unknown		x	x	x	73093497	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	8.831	0.939940	0.18281	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000417091;ENST00000429192;ENST00000442462;ENST00000442310;ENST00000380553;ENST00000380576;ENST00000428787;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T	0.77877	1.44;1.45;1.41;1.44;1.45;1.44;1.45;1.44;1.44;1.45;-1.13;1.45;1.43	3.11	-3.34	0.04943	.	.	.	.	.	T	0.61400	0.2344	L	0.56769	1.78	0.09310	N	1	P;P;P;P;P;P;P;P;P;P;P;B;P	0.39131	0.661;0.491;0.661;0.661;0.661;0.661;0.661;0.661;0.661;0.661;0.661;0.434;0.661	B;B;B;B;B;B;B;B;B;B;B;B;B	0.34590	0.122;0.122;0.122;0.122;0.122;0.122;0.122;0.122;0.122;0.186;0.122;0.122;0.122	T	0.55134	-0.8188	9	0.06365	T	0.9	5.031	4.6386	0.12538	0.0:0.3025:0.2569:0.4406	.	71;71;61;61;71;61;71;71;71;71;61;71;71	E7ENM0;E9PBM4;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	E	71;71;71;61;71;61;71;61;71;71;71;71;71;71;71;71;71	ENSP00000389857:A71E;ENSP00000252034:A71E;ENSP00000351807:A71E;ENSP00000392575:A61E;ENSP00000369936:A71E;ENSP00000369949:A61E;ENSP00000369958:A71E;ENSP00000403162:A61E;ENSP00000349540:A71E;ENSP00000391129:A71E;ENSP00000369926:A71E;ENSP00000369950:A71E;ENSP00000313565:A71E	ENSP00000252034:A71E	A	+	2	0	ELN	73093497	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.132000	0.10467	-0.820000	0.04318	-2.735000	0.00129	GCG		0.592	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501		Missense_Mutation
DGKI	9162	broad.mit.edu	37	7	137271924	137271924	+	Silent	SNP	C	C	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr7:137271924C>A	ENST00000288490.5	-	13	1344	c.1344G>T	c.(1342-1344)ctG>ctT	p.L448L	DGKI_ENST00000424189.2_Silent_p.L448L|DGKI_ENST00000453654.2_Silent_p.L148L|DGKI_ENST00000446122.1_Silent_p.L448L	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	448	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.L448L(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GGCTCAGCTGCAGTTCATCCA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	7											59.0	57.0	58.0					7																	137271924		2203	4300	6503	136922464	SO:0001819	synonymous_variant	9162			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1344G>T	7.37:g.137271924C>A		Unknown		x	x	x	136922464	A4D1Q9|Q9NZ49	Silent	SNP	ENST00000288490.5	37	CCDS5845.1	SNP	25	Broad																																																																																				0.532	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717		Silent
TRPS1	7227	broad.mit.edu	37	8	116631880	116631880	+	Missense_Mutation	SNP	G	G	A			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr8:116631880G>A	ENST00000220888.5	-	2	565	c.406C>T	c.(406-408)Cct>Tct	p.P136S	TRPS1_ENST00000519674.1_Missense_Mutation_p.P136S|TRPS1_ENST00000520276.1_Missense_Mutation_p.P140S|TRPS1_ENST00000395715.3_Missense_Mutation_p.P149S|TRPS1_ENST00000519076.1_Missense_Mutation_p.P90S			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	136					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P136S(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATATCTTGAGGGTCATCTGCC	0.527									Langer-Giedion syndrome																																							1	Substitution - Missense(1)	ovary(1)	8											66.0	66.0	66.0					8																	116631880		1931	4141	6072	116701055	SO:0001583	missense	7227	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.406C>T	8.37:g.116631880G>A	ENSP00000220888:p.Pro136Ser	Unknown		x	x	x	116701055	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	13.48	2.251093	0.39797	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	D;D;D;D;T	0.98362	-4.89;-4.86;-4.83;-4.86;0.95	5.82	4.87	0.63330	.	0.079597	0.52532	D	0.000079	D	0.93772	0.8009	N	0.08118	0	0.32277	N	0.568075	B;B;B	0.18741	0.03;0.018;0.03	B;B;B	0.21917	0.037;0.016;0.022	D	0.92451	0.5970	10	0.62326	D	0.03	-9.2557	11.4999	0.50430	0.0:0.0:0.6124:0.3876	.	140;136;149	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	S	149;136;90;140;136	ENSP00000379065:P149S;ENSP00000220888:P136S;ENSP00000428910:P90S;ENSP00000428680:P140S;ENSP00000429174:P136S	ENSP00000220888:P136S	P	-	1	0	TRPS1	116701055	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.992000	0.40737	2.751000	0.94390	0.650000	0.86243	CCT		0.527	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		Missense_Mutation
BAI1	575	broad.mit.edu	37	8	143569728	143569728	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chr8:143569728T>C	ENST00000517894.1	+	14	3206	c.2312T>C	c.(2311-2313)cTc>cCc	p.L771P	BAI1_ENST00000323289.5_Missense_Mutation_p.L771P			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	771					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L771P(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CTCCCAGTTCTCAGCATCCAT	0.637																																																1	Substitution - Missense(1)	ovary(1)	8											71.0	82.0	78.0					8																	143569728		2034	4210	6244	143566730	SO:0001583	missense	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2312T>C	8.37:g.143569728T>C	ENSP00000430945:p.Leu771Pro	Unknown		x	x	x	143566730		Missense_Mutation	SNP	ENST00000517894.1	37		SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112751	0.56398	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.19669	2.13;2.13	4.29	4.29	0.51040	.	0.000000	0.64402	U	0.000016	T	0.41050	0.1142	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.32508	-0.9904	10	0.87932	D	0	.	12.5498	0.56220	0.0:0.0:0.0:1.0	.	771	E9PBK0	.	P	771	ENSP00000430945:L771P;ENSP00000313046:L771P	ENSP00000313046:L771P	L	+	2	0	BAI1	143566730	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	7.287000	0.78681	1.710000	0.51325	0.260000	0.18958	CTC		0.637	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		Missense_Mutation
USP51	158880	broad.mit.edu	37	X	55514319	55514319	+	Missense_Mutation	SNP	T	T	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chrX:55514319T>C	ENST00000500968.3	-	2	1136	c.1054A>G	c.(1054-1056)Aga>Gga	p.R352G	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	352					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R352G(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						TTTTTTCTTCTCTTTTTCTTG	0.398																																																1	Substitution - Missense(1)	ovary(1)	X											107.0	104.0	105.0					X																	55514319		2203	4300	6503	55531044	SO:0001583	missense	158880			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.1054A>G	X.37:g.55514319T>C	ENSP00000423333:p.Arg352Gly	Unknown		x	x	x	55531044	Q8IWJ8	Missense_Mutation	SNP	ENST00000500968.3	37	CCDS14370.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	.	12.61	1.991020	0.35131	.	.	ENSG00000247746	ENST00000500968	T	0.10860	2.83	2.87	2.87	0.33458	.	0.110699	0.64402	U	0.000012	T	0.16896	0.0406	L	0.32530	0.975	0.58432	D	0.999992	D	0.71674	0.998	D	0.67900	0.954	T	0.01480	-1.1344	10	0.59425	D	0.04	.	6.7158	0.23302	0.0:0.0:0.0:1.0	.	352	Q70EK9	UBP51_HUMAN	G	352	ENSP00000423333:R352G	ENSP00000423333:R352G	R	-	1	2	USP51	55531044	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.543000	0.45752	1.387000	0.46486	0.413000	0.27773	AGA		0.398	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2	NM_201286		Missense_Mutation
UTP14A	10813	broad.mit.edu	37	X	129063583	129063583	+	Nonstop_Mutation	SNP	G	G	C			TCGA-31-1959-01	TCGA-31-1959-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-31-1959-01	TCGA-31-1959-10	g.chrX:129063583G>C	ENST00000394422.3	+	15	2343	c.2315G>C	c.(2314-2316)tGa>tCa	p.*772S	UTP14A_ENST00000425117.2_Nonstop_Mutation_p.*720S|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Nonstop_Mutation_p.*718S|UTP14A_ENST00000371042.3_Nonstop_Mutation_p.*604S	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	0					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.*772S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TCTGTAGATTGAGTTGCTGGA	0.478																																																1	Nonstop extension(1)	ovary(1)	X											78.0	69.0	72.0					X																	129063583		2203	4300	6503	128891264	SO:0001578	stop_lost	10813			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.2315G>C	X.37:g.129063583G>C	ENSP00000377944:p.*772Serext*21	Unknown		x	x	x	128891264	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Nonstop_Mutation	SNP	ENST00000394422.3	37	CCDS14615.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	N	10.84	1.463281	0.26248	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000371042	.	.	.	4.18	3.31	0.37934	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6568	0.28379	0.1258:0.0:0.8742:0.0	.	.	.	.	S	720;772;718;604	.	.	X	+	2	2	UTP14A	128891264	0.116000	0.22171	0.167000	0.22817	0.185000	0.23345	0.813000	0.27225	0.885000	0.36088	0.585000	0.79938	TGA		0.478	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649		Nonstop_Mutation
