#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCC2	1244	hgsc.bcm.edu	37	10	101578641	101578641	+	Missense_Mutation	SNP	C	C	G	rs56220353	byFrequency	TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr10:101578641C>G	ENST00000370449.4	+	18	2479	c.2366C>G	c.(2365-2367)tCt>tGt	p.S789C		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	789	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		S -> F (in dbSNP:rs56220353). {ECO:0000269|PubMed:11266082}.		cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.S789C(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GACCCCCTGTCTGCAGTGGAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	10	GRCh37	CM045738	ABCC2	M	rs56220353						71.0	76.0	74.0					10																	101578641		2203	4300	6503	101568631	SO:0001583	missense	1244			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.2366C>G	10.37:g.101578641C>G	ENSP00000359478:p.Ser789Cys	Somatic		Capture	SOLID	Phase_III	101568631	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515701	0.64634	.	.	ENSG00000023839	ENST00000370449	D	0.93189	-3.18	6.08	6.08	0.98989	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.98115	0.9378	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98655	1.0681	10	0.87932	D	0	-9.0945	19.6529	0.95825	0.0:1.0:0.0:0.0	.	789	Q92887	MRP2_HUMAN	C	789	ENSP00000359478:S789C	ENSP00000359478:S789C	S	+	2	0	ABCC2	101568631	1.000000	0.71417	0.617000	0.29091	0.202000	0.24057	7.815000	0.86186	2.890000	0.99128	0.655000	0.94253	TCT		0.448	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392		Missense_Mutation
ABHD6	57406	hgsc.bcm.edu	37	3	58271149	58271149	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:58271149C>T	ENST00000478253.1	+	9	1307	c.806C>T	c.(805-807)cCg>cTg	p.P269L	ABHD6_ENST00000295962.4_Missense_Mutation_p.P269L			Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	269					long term synaptic depression (GO:0060292)|negative regulation of cell migration (GO:0030336)|regulation of endocannabinoid signaling pathway (GO:2000124)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acylglycerol lipase activity (GO:0047372)	p.P269L(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	16				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		ATCAAGGTTCCGACGCAGATC	0.483																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	85.0	88.0					3																	58271149		2203	4300	6503	58246189	SO:0001583	missense	57406			AF225418	CCDS2887.1	3p21.2	2006-03-10			ENSG00000163686	ENSG00000163686		"""Abhydrolase domain containing"""	21398	protein-coding gene	gene with protein product							Standard	NM_020676		Approved		uc003djs.4	Q9BV23	OTTHUMG00000159150	ENST00000478253.1:c.806C>T	3.37:g.58271149C>T	ENSP00000420315:p.Pro269Leu	Somatic		Capture	SOLID	Phase_III	58246189	B2R7Y9|Q6ZMF7	Missense_Mutation	SNP	ENST00000478253.1	37	CCDS2887.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	31	5.101839	0.94245	.	.	ENSG00000163686	ENST00000478253;ENST00000295962;ENST00000511761	D;D	0.90844	-2.74;-2.74	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.95626	0.8578	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.941	D	0.95871	0.8891	10	0.87932	D	0	-23.4988	19.1572	0.93516	0.0:1.0:0.0:0.0	.	269;269	Q9BV23;F5H7L1	ABHD6_HUMAN;.	L	269	ENSP00000420315:P269L;ENSP00000295962:P269L	ENSP00000295962:P269L	P	+	2	0	ABHD6	58246189	1.000000	0.71417	0.516000	0.27786	0.986000	0.74619	7.230000	0.78097	2.606000	0.88127	0.563000	0.77884	CCG		0.483	ABHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353511.1	NM_020676		Missense_Mutation
ACE	1636	hgsc.bcm.edu	37	17	61571747	61571747	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:61571747G>A	ENST00000290866.4	+	22	3320	c.3296G>A	c.(3295-3297)gGc>gAc	p.G1099D	ACE_ENST00000577647.1_Missense_Mutation_p.G525D|ACE_ENST00000421982.2_Missense_Mutation_p.G345D|ACE_ENST00000428043.1_Missense_Mutation_p.G1099D|ACE_ENST00000413513.3_Missense_Mutation_p.G525D|ACE_ENST00000490216.2_Missense_Mutation_p.G525D|ACE_ENST00000290863.6_Missense_Mutation_p.G525D	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1099	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.G1099D(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	AAGTACCAGGGCCTCTGCCCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											75.0	59.0	65.0					17																	61571747		2203	4300	6503	58925479	SO:0001583	missense	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3296G>A	17.37:g.61571747G>A	ENSP00000290866:p.Gly1099Asp	Somatic		Capture	SOLID	Phase_III	58925479	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818374	0.50633	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513;ENST00000421982	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.83198	0.5202	H	0.98027	4.13	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.90322	0.4345	10	0.87932	D	0	-38.6559	17.7487	0.88428	0.0:0.0:1.0:0.0	.	345;525;525;1099	F6X3S4;B4DXI3;P12821-3;P12821	.;.;.;ACE_HUMAN	D	1099;1099;525;525;345	ENSP00000290866:G1099D;ENSP00000397593:G1099D;ENSP00000290863:G525D;ENSP00000392247:G525D;ENSP00000387760:G345D	ENSP00000290863:G525D	G	+	2	0	ACE	58925479	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.561000	0.98142	2.197000	0.70478	0.313000	0.20887	GGC		0.562	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			Missense_Mutation
AMHR2	269	hgsc.bcm.edu	37	12	53819530	53819530	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr12:53819530G>C	ENST00000257863.4	+	6	759	c.679G>C	c.(679-681)Gtt>Ctt	p.V227L	AMHR2_ENST00000550311.1_Missense_Mutation_p.V227L|AMHR2_ENST00000379791.3_Missense_Mutation_p.V227L	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	227	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)	p.V227L(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	AGGAAAACTGGTTGCCATCAA	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											73.0	61.0	65.0					12																	53819530		2203	4300	6503	52105797	SO:0001583	missense	269			AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.679G>C	12.37:g.53819530G>C	ENSP00000257863:p.Val227Leu	Somatic		Capture	SOLID	Phase_III	52105797	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.115085	0.94339	.	.	ENSG00000135409	ENST00000257863;ENST00000550311;ENST00000379791	T;T;T	0.71461	-0.57;-0.57;-0.57	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35805	N	0.002975	D	0.84638	0.5516	M	0.79693	2.465	0.45930	D	0.99876	D;D	0.89917	0.996;1.0	D;D	0.85130	0.99;0.997	D	0.85990	0.1488	10	0.87932	D	0	.	15.6361	0.76953	0.0:0.0:1.0:0.0	.	227;227	F8W1D2;Q16671	.;AMHR2_HUMAN	L	227	ENSP00000257863:V227L;ENSP00000446661:V227L;ENSP00000369117:V227L	ENSP00000257863:V227L	V	+	1	0	AMHR2	52105797	1.000000	0.71417	0.963000	0.40424	0.908000	0.53690	6.030000	0.70903	2.840000	0.97914	0.655000	0.94253	GTT		0.562	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547		Missense_Mutation
ANO10	55129	hgsc.bcm.edu	37	3	43474200	43474200	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:43474200T>C	ENST00000292246.3	-	12	1987	c.1817A>G	c.(1816-1818)aAg>aGg	p.K606R	ANO10_ENST00000451430.2_Missense_Mutation_p.K495R|ANO10_ENST00000350459.4_Missense_Mutation_p.K416R|ANO10_ENST00000414522.2_Intron|ANO10_ENST00000396091.3_Missense_Mutation_p.K540R	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	606					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.K606R(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						AAGTATAAACTTTAAAGCCAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											89.0	84.0	86.0					3																	43474200		2203	4300	6503	43449204	SO:0001583	missense	55129			AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.1817A>G	3.37:g.43474200T>C	ENSP00000292246:p.Lys606Arg	Somatic		Capture	SOLID	Phase_III	43449204	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	37	CCDS2710.2	SNP	56	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.21|17.21	3.332820|3.332820	0.60853|0.60853	.|.	.|.	ENSG00000160746|ENSG00000160746	ENST00000292246;ENST00000350459;ENST00000396091;ENST00000451430|ENST00000448045	T;T;T;T|.	0.69040|.	-0.37;-0.37;-0.37;-0.37|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.175554|.	0.49916|.	D|.	0.000139|.	T|T	0.68146|0.68146	0.2969|0.2969	L|L	0.52206|0.52206	1.635|1.635	0.54753|0.54753	D|D	0.999985|0.999985	P;P;P;P|.	0.46656|.	0.545;0.569;0.882;0.763|.	B;P;P;P|.	0.51582|.	0.165;0.58;0.612;0.674|.	T|T	0.66135|0.66135	-0.5999|-0.5999	10|5	0.21014|.	T|.	0.42|.	.|.	15.5982|15.5982	0.76602|0.76602	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	495;416;540;606|.	Q9NW15-4;Q9NW15-2;Q9NW15-3;Q9NW15|.	.;.;.;ANO10_HUMAN|.	R|G	606;416;540;495|134	ENSP00000292246:K606R;ENSP00000327767:K416R;ENSP00000379398:K540R;ENSP00000394119:K495R|.	ENSP00000292246:K606R|.	K|S	-|-	2|1	0|0	ANO10|ANO10	43449204|43449204	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.987000|0.987000	0.75469|0.75469	7.310000|7.310000	0.78947|0.78947	2.088000|2.088000	0.63022|0.63022	0.477000|0.477000	0.44152|0.44152	AAG|AGT		0.403	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075		Missense_Mutation
APOB	338	hgsc.bcm.edu	37	2	21237962	21237962	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:21237962C>T	ENST00000233242.1	-	23	3806	c.3679G>A	c.(3679-3681)Ggt>Agt	p.G1227S		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1227					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.G1227S(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATTTGGAACCCACGTGCCGG	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											101.0	102.0	102.0					2																	21237962		2203	4300	6503	21091467	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3679G>A	2.37:g.21237962C>T	ENSP00000233242:p.Gly1227Ser	Somatic		Capture	SOLID	Phase_III	21091467	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.17	3.045997	0.55110	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00705	5.81	5.48	4.61	0.57282	.	0.104858	0.41712	D	0.000829	T	0.01254	0.0041	M	0.65975	2.015	0.80722	D	1	P	0.35507	0.506	B	0.26864	0.074	T	0.62982	-0.6738	10	0.59425	D	0.04	.	13.7642	0.62983	0.0:0.9262:0.0:0.0738	.	1227	P04114	APOB_HUMAN	S	1227	ENSP00000233242:G1227S	ENSP00000233242:G1227S	G	-	1	0	APOB	21091467	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.282000	0.43461	1.483000	0.48342	0.650000	0.86243	GGT		0.428	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
AQP3	360	hgsc.bcm.edu	37	9	33442355	33442356	+	Frame_Shift_Ins	INS	-	-	A	rs539666664		TCGA-36-1577-01	TCGA-36-1577-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr9:33442355_33442356insA	ENST00000297991.4	-	5	733_734	c.653_654insT	c.(652-654)cggfs	p.R218fs	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	218					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)	p.D219fs*>75(1)		endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		GGCCAAAGTCCCGGGCAGGGTT	0.668																																																1	Insertion - Frameshift(1)	ovary(1)	9																																								33432356	SO:0001589	frameshift_variant	360				CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.653_654insT	9.37:g.33442355_33442356insA	ENSP00000297991:p.Arg218fs	Somatic		Capture	SOLID	Phase_III	33432355	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Frame_Shift_Ins	INS	ENST00000297991.4	37	CCDS6542.1	INS	22	Baylor																																																																																				0.668	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925		Frame_Shift_Ins
ARID1B	57492	hgsc.bcm.edu	37	6	157527615	157527615	+	Silent	SNP	A	A	G			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr6:157527615A>G	ENST00000350026.5	+	19	5302	c.5301A>G	c.(5299-5301)caA>caG	p.Q1767Q	ARID1B_ENST00000346085.5_Silent_p.Q1780Q|ARID1B_ENST00000275248.4_Silent_p.Q1762Q|ARID1B_ENST00000367148.1_Silent_p.Q1820Q	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1767					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AGCCCAAGCAAGCCAGTAAGT	0.502																																																0			6											67.0	68.0	68.0					6																	157527615		2203	4296	6499	157569307	SO:0001819	synonymous_variant	57492			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.5301A>G	6.37:g.157527615A>G		Somatic		Capture	SOLID	Phase_III	157569307	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	37	CCDS5251.2	SNP	3	Baylor																																																																																				0.502	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732		Silent
ATP10A	57194	hgsc.bcm.edu	37	15	25924920	25924921	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-36-1577-01	TCGA-36-1577-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr15:25924920_25924921insAA	ENST00000356865.6	-	21	4178_4179	c.4067_4068insTT	c.(4066-4068)cacfs	p.H1356fs		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1356					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T1357fs*20(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCTGCTGTGTGTGCCAAGAAGG	0.649																																																1	Insertion - Frameshift(1)	ovary(1)	15																																								23476014	SO:0001589	frameshift_variant	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4067_4068insTT	15.37:g.25924920_25924921insAA	ENSP00000349325:p.His1356fs	Somatic		Capture	SOLID	Phase_III	23476013	Q4G0S9|Q969I4	Frame_Shift_Ins	INS	ENST00000356865.6	37	CCDS32178.1	INS	48	Baylor																																																																																				0.649	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490		Frame_Shift_Ins
C10orf12	26148	hgsc.bcm.edu	37	10	98743852	98743855	+	Frame_Shift_Del	DEL	CTGT	CTGT	-			TCGA-36-1577-01	TCGA-36-1577-10	CTGT	CTGT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr10:98743852_98743855delCTGT	ENST00000286067.2	+	1	2812_2815	c.2705_2708delCTGT	c.(2704-2709)cctgtcfs	p.PV902fs		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	902								p.V903I(1)|p.V903fs*22(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GACGTTCCCCCTGTCAAGCATCCT	0.446																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(2)	10																																								98733845	SO:0001589	frameshift_variant	26148			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2705_2708delCTGT	10.37:g.98743852_98743855delCTGT	ENSP00000286067:p.Pro902fs	Somatic		Capture	SOLID	Phase_III	98733842	Q9H945|Q9Y457	Frame_Shift_Del	DEL	ENST00000286067.2	37	CCDS7452.1	DEL	24	Baylor																																																																																				0.446	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		Frame_Shift_Del
VWA7	80737	hgsc.bcm.edu	37	6	31733543	31733543	+	Missense_Mutation	SNP	C	C	T	rs375942272	byFrequency	TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr6:31733543C>T	ENST00000375688.4	-	17	2704	c.2504G>A	c.(2503-2505)cGg>cAg	p.R835Q	VWA7_ENST00000467576.1_5'Flank|SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000375686.3_Silent_p.P844P			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	835						extracellular region (GO:0005576)		p.R835Q(1)									GGTGGTGTGCCGGTCCTGTGG	0.597													T|||	2	0.000399361	0.0	0.0	5008	,	,		16929	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	6						T	GLN/ARG	0,3022		0,0,1511	93.0	49.0	65.0		2504	2.4	0.0	6		65	1,5417		0,1,2708	no	missense	C6orf27	NM_025258.2	43	0,1,4219	TT,TC,CC		0.0185,0.0,0.0118	benign	835/892	31733543	1,8439	1511	2709	4220	31841522	SO:0001583	missense	80737				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2504G>A	6.37:g.31733543C>T	ENSP00000364840:p.Arg835Gln	Somatic		Capture	SOLID	Phase_III	31841522	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.826	-0.747080	0.03065	0.0	1.85E-4	ENSG00000204396	ENST00000375688	T	0.10192	2.9	4.87	2.42	0.29668	.	1.482110	0.04450	N	0.372373	T	0.00967	0.0032	N	0.02247	-0.625	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.42699	-0.9436	10	0.10111	T	0.7	0.1777	4.2278	0.10589	0.0:0.1831:0.1732:0.6438	.	835	Q9Y334	G7C_HUMAN	Q	835	ENSP00000364840:R835Q	ENSP00000364840:R835Q	R	-	2	0	C6orf27	31841522	0.968000	0.33430	0.001000	0.08648	0.000000	0.00434	0.292000	0.19011	0.097000	0.17492	-0.269000	0.10298	CGG		0.597	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258		Missense_Mutation
C7orf31	136895	hgsc.bcm.edu	37	7	25182384	25182384	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr7:25182384G>C	ENST00000409280.1	-	8	1042	c.734C>G	c.(733-735)cCt>cGt	p.P245R	C7orf31_ENST00000283905.3_Missense_Mutation_p.P245R			Q8N865	CG031_HUMAN	chromosome 7 open reading frame 31	245										autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	14						GAAGGTTTTAGGAGGTTTTGG	0.383																																																0			7											92.0	98.0	96.0					7																	25182384		2203	4300	6503	25148909	SO:0001583	missense	136895			AK097248	CCDS5394.1	7p15.2	2011-11-24			ENSG00000153790	ENSG00000153790			21722	protein-coding gene	gene with protein product							Standard	NM_138811		Approved		uc003sxn.1	Q8N865	OTTHUMG00000128497	ENST00000409280.1:c.734C>G	7.37:g.25182384G>C	ENSP00000386604:p.Pro245Arg	Somatic		Capture	SOLID	Phase_III	25148909	A4D165|Q6MZV8|Q6P989|Q7LE28|Q86XK1|Q8N1H5|Q96BN4	Missense_Mutation	SNP	ENST00000409280.1	37	CCDS5394.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769054	0.69992	.	.	ENSG00000153790	ENST00000409280;ENST00000283905	T;T	0.11604	2.76;2.76	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.31949	0.0813	M	0.74258	2.255	0.44079	D	0.996834	D	0.89917	1.0	D	0.81914	0.995	T	0.01767	-1.1278	10	0.87932	D	0	-7.5623	12.3141	0.54946	0.0822:0.0:0.9178:0.0	.	245	Q8N865	CG031_HUMAN	R	245	ENSP00000386604:P245R;ENSP00000283905:P245R	ENSP00000283905:P245R	P	-	2	0	C7orf31	25148909	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.681000	0.74523	2.594000	0.87642	0.484000	0.47621	CCT		0.383	C7orf31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326929.1	NM_138811		Missense_Mutation
CDC27	996	hgsc.bcm.edu	37	17	45247389	45247389	+	Frame_Shift_Del	DEL	T	T	-			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:45247389delT	ENST00000066544.3	-	4	364	c.271delA	c.(271-273)atcfs	p.I91fs	CDC27_ENST00000531206.1_Frame_Shift_Del_p.I91fs|CDC27_ENST00000527547.1_Frame_Shift_Del_p.I91fs|CDC27_ENST00000446365.2_Frame_Shift_Del_p.I30fs|CDC27_ENST00000528748.1_5'UTR|RP5-867C24.5_ENST00000572193.1_RNA	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	91					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.I91fs*54(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CCAGATAAGATTTGTTCCCCT	0.323																																																1	Deletion - Frameshift(1)	ovary(1)	17											84.0	94.0	91.0					17																	45247389		2203	4299	6502	42602388	SO:0001589	frameshift_variant	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.271delA	17.37:g.45247389delT	ENSP00000066544:p.Ile91fs	Somatic		Capture	SOLID	Phase_III	42602388	G3V1C4|Q16349|Q96F35	Frame_Shift_Del	DEL	ENST00000066544.3	37	CCDS11509.1	DEL	52	Baylor																																																																																				0.323	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			Frame_Shift_Del
CENPJ	55835	hgsc.bcm.edu	37	13	25484157	25484157	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr13:25484157C>G	ENST00000381884.4	-	4	821	c.636G>C	c.(634-636)gaG>gaC	p.E212D	CENPJ_ENST00000545981.1_Missense_Mutation_p.E212D	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	212					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.E212D(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		ATGTGGCTCTCTCTCCAGTGG	0.463																																																1	Substitution - Missense(1)	ovary(1)	13											124.0	126.0	126.0					13																	25484157		2203	4300	6503	24382157	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.636G>C	13.37:g.25484157C>G	ENSP00000371308:p.Glu212Asp	Somatic		Capture	SOLID	Phase_III	24382157	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.485	0.089907	0.08632	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.18960	2.18;2.18	5.15	2.31	0.28768	.	0.717637	0.13369	N	0.393087	T	0.16811	0.0404	L	0.57536	1.79	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.27331	-1.0077	10	0.24483	T	0.36	.	2.5937	0.04848	0.2011:0.5222:0.1719:0.1048	.	212	Q9HC77	CENPJ_HUMAN	D	212	ENSP00000371308:E212D;ENSP00000441090:E212D	ENSP00000371308:E212D	E	-	3	2	CENPJ	24382157	0.219000	0.23619	0.038000	0.18304	0.007000	0.05969	0.080000	0.14802	0.731000	0.32448	0.555000	0.69702	GAG		0.463	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		Missense_Mutation
CHD4	1108	hgsc.bcm.edu	37	12	6704527	6704527	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr12:6704527C>A	ENST00000357008.2	-	14	2257	c.2094G>T	c.(2092-2094)gaG>gaT	p.E698D	CHD4_ENST00000544040.1_Missense_Mutation_p.E691D|CHD4_ENST00000544484.1_Missense_Mutation_p.E695D|CHD4_ENST00000309577.6_Missense_Mutation_p.E698D	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	698					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.E698D(1)		central_nervous_system(2)	2						CTGGAGGCCTCTCCAACTTCC	0.502																																					Colon(32;586 792 4568 16848 45314)											1	Substitution - Missense(1)	ovary(1)	12											179.0	143.0	155.0					12																	6704527		2203	4300	6503	6574788	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2094G>T	12.37:g.6704527C>A	ENSP00000349508:p.Glu698Asp	Somatic		Capture	SOLID	Phase_III	6574788	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.313	1.056093	0.19907	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.90844	-2.73;-2.73;-2.73;-2.74	5.83	4.0	0.46444	.	0.123212	0.53938	D	0.000043	T	0.80071	0.4556	N	0.17723	0.515	0.39095	D	0.961171	B;B;P	0.35612	0.011;0.0;0.512	B;B;B	0.32762	0.01;0.002;0.152	T	0.74166	-0.3753	10	0.15952	T	0.53	-2.4798	9.1628	0.37032	0.0:0.7741:0.0:0.2259	.	698;698;691	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	D	695;691;698;698;672	ENSP00000440392:E695D;ENSP00000440542:E691D;ENSP00000312419:E698D;ENSP00000349508:E698D	ENSP00000312419:E698D	E	-	3	2	CHD4	6574788	0.997000	0.39634	0.996000	0.52242	0.592000	0.36648	1.183000	0.32041	0.802000	0.34089	0.655000	0.94253	GAG		0.502	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
CHML	1122	hgsc.bcm.edu	37	1	241797528	241797528	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr1:241797528G>C	ENST00000366553.1	-	1	1704	c.1541C>G	c.(1540-1542)tCt>tGt	p.S514C	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron|OPN3_ENST00000366554.2_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	514					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.S514C(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TGTTTTAGAAGATGAACATGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	78.0	80.0					1																	241797528		2203	4299	6502	239864151	SO:0001583	missense	1122			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1541C>G	1.37:g.241797528G>C	ENSP00000355511:p.Ser514Cys	Somatic		Capture	SOLID	Phase_III	239864151	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539723	0.65085	.	.	ENSG00000203668	ENST00000366553	D	0.83673	-1.75	5.08	5.08	0.68730	.	0.000000	0.85682	U	0.000000	D	0.89615	0.6766	.	.	.	0.54753	D	0.999986	D	0.69078	0.997	P	0.62382	0.901	D	0.89970	0.4093	9	0.59425	D	0.04	-13.9275	16.3808	0.83460	0.0:0.0:1.0:0.0	.	514	P26374	RAE2_HUMAN	C	514	ENSP00000355511:S514C	ENSP00000355511:S514C	S	-	2	0	CHML	239864151	1.000000	0.71417	0.986000	0.45419	0.976000	0.68499	2.468000	0.45102	2.826000	0.97356	0.655000	0.94253	TCT		0.408	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821		Missense_Mutation
CHMP4A	29082	hgsc.bcm.edu	37	14	24682648	24682648	+	5'UTR	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr14:24682648C>A	ENST00000609024.1	-	0	46				CHMP4A_ENST00000530996.1_5'UTR|MDP1_ENST00000532557.1_5'Flank|CHMP4A_ENST00000542700.2_5'Flank|CHMP4A_ENST00000347519.6_Missense_Mutation_p.A43S|TM9SF1_ENST00000530611.1_5'UTR|NEDD8-MDP1_ENST00000604306.1_5'Flank|AL136419.6_ENST00000565988.1_RNA|TM9SF1_ENST00000556387.1_5'UTR			Q9BY43	CHM4A_HUMAN	charged multivesicular body protein 4A						endosomal transport (GO:0016197)|membrane budding (GO:0006900)|membrane organization (GO:0061024)|membrane tubulation (GO:0097320)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			NS(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9				GBM - Glioblastoma multiforme(265;0.0181)		CCACTCATCGCGAGCTCGCCT	0.677																																																0			14											42.0	41.0	42.0					14																	24682648		2203	4300	6503	23752488	SO:0001623	5_prime_UTR_variant	29082			AF212243	CCDS9619.1	14q12	2012-10-04	2011-09-21	2005-04-04	ENSG00000254505	ENSG00000254505		"""Charged multivesicular body proteins"""	20274	protein-coding gene	gene with protein product		610051	"""chromosome 14 open reading frame 123"", ""chromatin modifying protein 4A"""	C14orf123			Standard	NM_014169		Approved	HSPC134, VPS32A		Q9BY43	OTTHUMG00000167036	ENST00000609024.1:c.-3G>T	14.37:g.24682648C>A		Somatic		Capture	SOLID	Phase_III	23752488	Q14D22|Q32Q79|Q86SZ8|Q96QJ9|Q9P026	Missense_Mutation	SNP	ENST00000609024.1	37		SNP	27	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.85|14.85	2.659864|2.659864	0.47572|0.47572	.|.	.|.	ENSG00000254505|ENSG00000254505	ENST00000347519|ENST00000548308	T|.	0.58506|.	0.33|.	4.8|4.8	0.535|0.535	0.17133|0.17133	.|.	.|.	.|.	.|.	.|.	T|T	0.14614|0.14614	0.0353|0.0353	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.24426|.	0.103|.	B|.	0.17979|.	0.02|.	T|T	0.24440|0.24440	-1.0160|-1.0160	9|5	0.09590|.	T|.	0.72|.	-4.0E-4|-4.0E-4	3.4479|3.4479	0.07487|0.07487	0.0:0.4599:0.1989:0.3411|0.0:0.4599:0.1989:0.3411	.|.	43|.	Q14D22|.	.|.	S|L	43|19	ENSP00000324205:A43S|.	ENSP00000324205:A43S|.	A|R	-|-	1|2	0|0	AL096870.1|AL096870.1	23752488|23752488	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.641000|0.641000	0.38312|0.38312	0.079000|0.079000	0.14782|0.14782	0.212000|0.212000	0.20703|0.20703	0.609000|0.609000	0.83330|0.83330	GCG|CGC		0.677	CHMP4A-012	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471846.1	NM_014169		Missense_Mutation
CSMD3	114788	hgsc.bcm.edu	37	8	113347628	113347628	+	Silent	SNP	A	A	C			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr8:113347628A>C	ENST00000297405.5	-	45	7339	c.7095T>G	c.(7093-7095)acT>acG	p.T2365T	CSMD3_ENST00000455883.2_Silent_p.T2261T|CSMD3_ENST00000343508.3_Silent_p.T2325T|CSMD3_ENST00000352409.3_Silent_p.T2295T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2365	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T2365T(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCTGATTTGAAGTACTGTAGA	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - coding silent(1)	ovary(1)	8											129.0	118.0	122.0					8																	113347628		2203	4300	6503	113416804	SO:0001819	synonymous_variant	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7095T>G	8.37:g.113347628A>C		Somatic		Capture	SOLID	Phase_III	113416804	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	3	Baylor																																																																																				0.408	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Silent
CSRNP1	64651	hgsc.bcm.edu	37	3	39186582	39186582	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:39186582G>T	ENST00000273153.5	-	3	548	c.371C>A	c.(370-372)tCt>tAt	p.S124Y	CSRNP1_ENST00000514182.1_Missense_Mutation_p.S124Y	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	124					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S124Y(1)		central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CTCAGCCAAAGAGAAGCGACG	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											70.0	62.0	65.0					3																	39186582		2203	4300	6503	39161586	SO:0001583	missense	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.371C>A	3.37:g.39186582G>T	ENSP00000273153:p.Ser124Tyr	Somatic		Capture	SOLID	Phase_III	39161586	Q69YY5	Missense_Mutation	SNP	ENST00000273153.5	37	CCDS2682.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933237	0.73442	.	.	ENSG00000144655	ENST00000273153;ENST00000514182	T;T	0.13538	2.58;2.58	5.14	5.14	0.70334	.	0.053994	0.64402	D	0.000001	T	0.36663	0.0975	M	0.62723	1.935	0.58432	D	0.999991	D	0.76494	0.999	D	0.70935	0.971	T	0.08638	-1.0712	10	0.87932	D	0	-35.4696	18.9945	0.92807	0.0:0.0:1.0:0.0	.	124	Q96S65	CSRN1_HUMAN	Y	124	ENSP00000273153:S124Y;ENSP00000422532:S124Y	ENSP00000273153:S124Y	S	-	2	0	CSRNP1	39161586	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	7.873000	0.87193	2.563000	0.86464	0.561000	0.74099	TCT		0.607	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027		Missense_Mutation
CTHRC1	115908	hgsc.bcm.edu	37	8	104390423	104390423	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr8:104390423G>C	ENST00000330295.5	+	3	683	c.541G>C	c.(541-543)Gga>Cga	p.G181R	CTHRC1_ENST00000520880.1_Missense_Mutation_p.G51R|CTHRC1_ENST00000520337.1_Missense_Mutation_p.G167R	NM_138455.3	NP_612464.1	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	181					cell migration (GO:0016477)|cochlea morphogenesis (GO:0090103)|establishment of planar polarity involved in neural tube closure (GO:0090177)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|ossification involved in bone remodeling (GO:0043932)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein binding (GO:0032092)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)		p.G181R(1)		endometrium(1)|large_intestine(5)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			TTTGGACCAAGGAAGCCCTGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	8											95.0	94.0	95.0					8																	104390423		2203	4300	6503	104459599	SO:0001583	missense	115908			BC014245	CCDS6299.1, CCDS59110.1	8q22.3	2008-08-07			ENSG00000164932	ENSG00000164932			18831	protein-coding gene	gene with protein product		610635				15618538	Standard	NM_138455		Approved		uc003ylk.4	Q96CG8	OTTHUMG00000164887	ENST00000330295.5:c.541G>C	8.37:g.104390423G>C	ENSP00000330523:p.Gly181Arg	Somatic		Capture	SOLID	Phase_III	104459599	G3V141|Q6UW91|Q8IX63	Missense_Mutation	SNP	ENST00000330295.5	37	CCDS6299.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562247	0.86335	.	.	ENSG00000164932	ENST00000330295;ENST00000520337;ENST00000297577;ENST00000520880	T;T	0.68479	-0.33;0.73	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.82084	0.4960	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83473	0.0060	10	0.72032	D	0.01	-3.781	19.3347	0.94312	0.0:0.0:1.0:0.0	.	181	Q96CG8	CTHR1_HUMAN	R	181;167;167;51	ENSP00000330523:G181R;ENSP00000430550:G167R	ENSP00000297577:G167R	G	+	1	0	CTHRC1	104459599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.472000	0.97709	2.571000	0.86741	0.650000	0.86243	GGA		0.373	CTHRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380792.1	NM_138455		Missense_Mutation
DAAM1	23002	hgsc.bcm.edu	37	14	59797938	59797940	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-36-1577-01	TCGA-36-1577-10	TGC	TGC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr14:59797938_59797940delTGC	ENST00000395125.1	+	13	1595_1597	c.1572_1574delTGC	c.(1570-1575)tgtgct>tgt	p.A525del	DAAM1_ENST00000360909.3_In_Frame_Del_p.A525del|DAAM1_ENST00000351081.1_In_Frame_Del_p.A525del	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	525					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.A525delA(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GGGCCGTCTGTGCTTCAATCCCA	0.483																																																1	Deletion - In frame(1)	ovary(1)	14																																								58867693	SO:0001651	inframe_deletion	23002			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1572_1574delTGC	14.37:g.59797938_59797940delTGC	ENSP00000378557:p.Ala525del	Somatic		Capture	SOLID	Phase_III	58867691	Q86U34|Q8N1Z8|Q8TB39	In_Frame_Del	DEL	ENST00000395125.1	37	CCDS9737.1	DEL	59	Baylor																																																																																				0.483	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992		In_Frame_Del
DAD1	1603	hgsc.bcm.edu	37	14	23044008	23044010	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-36-1577-01	TCGA-36-1577-10	CAA	CAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr14:23044008_23044010delCAA	ENST00000250498.4	-	2	446_448	c.335_337delTTG	c.(334-339)gttggc>ggc	p.V112del	DAD1_ENST00000489532.2_5'Flank|DAD1_ENST00000543337.1_In_Frame_Del_p.V84del|DAD1_ENST00000538631.1_Intron	NM_001344.2	NP_001335.1	P61803	DAD1_HUMAN	defender against cell death 1	112					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.V112delV(1)		large_intestine(2)|ovary(2)|prostate(1)	5	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0156)		ATGAGTCAGCCAACAAAGTTCAT	0.419																																																1	Deletion - In frame(1)	ovary(1)	14																																								22113850	SO:0001651	inframe_deletion	1603			AK223129	CCDS9571.1	14q11.2	2013-03-06			ENSG00000129562	ENSG00000129562			2664	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 2 homolog (S. cerevisiae)"", ""oligosaccharyltransferase subunit 2 (non-catalytic)"""	600243					Standard	NM_001344		Approved	OST2	uc001wgl.2	P61803	OTTHUMG00000028685	ENST00000250498.4:c.335_337delTTG	14.37:g.23044011_23044013delCAA	ENSP00000250498:p.Val112del	Somatic		Capture	SOLID	Phase_III	22113848	D3DS25|O08552|O70364|P46966|P46968|Q6FGA3|Q96GB7	In_Frame_Del	DEL	ENST00000250498.4	37	CCDS9571.1	DEL	21	Baylor																																																																																				0.419	DAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071617.2	NM_001344		In_Frame_Del
DBI	1622	hgsc.bcm.edu	37	2	120125782	120125782	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:120125782G>T	ENST00000355857.3	+	2	159	c.28G>T	c.(28-30)Gca>Tca	p.A10S	DBI_ENST00000542275.1_Missense_Mutation_p.A71S|DBI_ENST00000535617.1_Missense_Mutation_p.A52S|DBI_ENST00000393103.2_Missense_Mutation_p.A11S|DBI_ENST00000311521.4_Missense_Mutation_p.A27S|C2orf76_ENST00000409466.2_5'Flank|C2orf76_ENST00000334816.7_5'Flank|DBI_ENST00000535757.1_Missense_Mutation_p.A27S|DBI_ENST00000460901.1_3'UTR|C2orf76_ENST00000409877.1_5'Flank|DBI_ENST00000409094.1_Missense_Mutation_p.A27S|C2orf76_ENST00000409523.1_5'Flank|C2orf76_ENST00000498049.1_5'Flank	NM_001079862.1|NM_001178043.1	NP_001073331.1|NP_001171514.1	P07108	ACBP_HUMAN	diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)	10	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				hair follicle development (GO:0001942)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|transport (GO:0006810)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear endoplasmic reticulum (GO:0097038)	benzodiazepine receptor binding (GO:0030156)|lipid binding (GO:0008289)|long-chain fatty acyl-CoA binding (GO:0036042)|protein dimerization activity (GO:0046983)	p.A27S(1)		kidney(1)|lung(4)|skin(1)	6						TGAGAAAGCTGCAGAGGAGGT	0.517																																																1	Substitution - Missense(1)	lung(1)	2											119.0	108.0	112.0					2																	120125782		2203	4300	6503	119842252	SO:0001583	missense	1622			L76366	CCDS2126.1, CCDS42740.1, CCDS42741.1, CCDS74568.1	2q12-q21	2010-10-20	2010-04-30		ENSG00000155368	ENSG00000155368			2690	protein-coding gene	gene with protein product	"""endozepine"""	125950	"""diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)"""			1440058	Standard	NM_001079863		Approved	ACBP, ACBD1	uc021vnj.1	P07108	OTTHUMG00000131403	ENST00000355857.3:c.28G>T	2.37:g.120125782G>T	ENSP00000348116:p.Ala10Ser	Somatic		Capture	SOLID	Phase_III	119842252	B8ZWD2|B8ZWD6|B8ZWD7|P08869|Q4VWZ6|Q53SQ7|Q6IB48|Q9UCI8	Missense_Mutation	SNP	ENST00000355857.3	37	CCDS42740.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424400	0.83667	.	.	ENSG00000155368	ENST00000355857;ENST00000535617;ENST00000535757;ENST00000409094;ENST00000311521;ENST00000542275;ENST00000393103	T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97	4.6	4.6	0.57074	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	0.000000	0.85682	D	0.000000	T	0.53753	0.1816	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.996;0.988	D;D;D;D;P	0.87578	0.998;0.998;0.996;0.941;0.901	T	0.63703	-0.6577	10	0.72032	D	0.01	-26.2336	15.3057	0.73990	0.0:0.0:1.0:0.0	.	20;52;11;27;10	B8ZWD1;B8ZWD7;P07108-3;B8ZWD2;P07108	.;.;.;.;ACBP_HUMAN	S	10;52;27;27;27;71;11	ENSP00000348116:A10S;ENSP00000442917:A52S;ENSP00000439012:A27S;ENSP00000386486:A27S;ENSP00000311117:A27S;ENSP00000440698:A71S;ENSP00000376815:A11S	ENSP00000311117:A27S	A	+	1	0	DBI	119842252	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	8.388000	0.90170	2.547000	0.85894	0.655000	0.94253	GCA		0.517	DBI-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330590.1	NM_020548		Missense_Mutation
DLX1	1745	hgsc.bcm.edu	37	2	172951554	172951554	+	Silent	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:172951554G>A	ENST00000361725.4	+	2	938	c.486G>A	c.(484-486)gcG>gcA	p.A162A	DLX1_ENST00000341900.6_Intron	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	162					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CGGAGCTCGCGGCCTCTTTGG	0.607																																																0			2											83.0	94.0	90.0					2																	172951554		2203	4300	6503	172659800	SO:0001819	synonymous_variant	1745			BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.486G>A	2.37:g.172951554G>A		Somatic		Capture	SOLID	Phase_III	172659800	D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Silent	SNP	ENST00000361725.4	37	CCDS2247.2	SNP	39	Baylor																																																																																				0.607	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405916.1	XM_087198		Silent
DMXL1	1657	hgsc.bcm.edu	37	5	118502388	118502388	+	Missense_Mutation	SNP	A	A	T			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr5:118502388A>T	ENST00000311085.8	+	22	5128	c.5048A>T	c.(5047-5049)aAg>aTg	p.K1683M	DMXL1_ENST00000539542.1_Missense_Mutation_p.K1683M	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1683										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GCAGCTTTAAAGAATGCTTTT	0.368																																																0			5											97.0	99.0	99.0					5																	118502388		2202	4300	6502	118530287	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.5048A>T	5.37:g.118502388A>T	ENSP00000309690:p.Lys1683Met	Somatic		Capture	SOLID	Phase_III	118530287		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730195	0.89390	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.68903	-0.36;-0.36	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.86581	0.5967	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.986;0.995	D	0.89903	0.4046	10	0.87932	D	0	-15.4115	16.6438	0.85155	1.0:0.0:0.0:0.0	.	1683;1683	F5H269;Q9Y485	.;DMXL1_HUMAN	M	1683	ENSP00000309690:K1683M;ENSP00000439479:K1683M	ENSP00000309690:K1683M	K	+	2	0	DMXL1	118530287	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.333000	0.79357	0.533000	0.62120	AAG		0.368	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509		Missense_Mutation
EPM2A	7957	hgsc.bcm.edu	37	6	145956542	145956542	+	Missense_Mutation	SNP	A	A	C			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr6:145956542A>C	ENST00000367519.3	-	3	1082	c.557T>G	c.(556-558)aTt>aGt	p.I186S	EPM2A_ENST00000496228.1_5'UTR	NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	186					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		TACAGCTGTAATCCCCAATTC	0.433																																																0			6											124.0	108.0	113.0					6																	145956542		2203	4300	6503	145998235	SO:0001583	missense	7957			AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.557T>G	6.37:g.145956542A>C	ENSP00000356489:p.Ile186Ser	Somatic		Capture	SOLID	Phase_III	145998235	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Missense_Mutation	SNP	ENST00000367519.3	37	CCDS5206.1	SNP	4	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.9|27.9	4.872137|4.872137	0.91587|0.91587	.|.	.|.	ENSG00000112425|ENSG00000112425	ENST00000535403;ENST00000367519;ENST00000392304;ENST00000324857|ENST00000450221;ENST00000435470	D|.	0.90133|.	-2.62|.	5.91|5.91	5.91|5.91	0.95273|0.95273	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (1);|.	0.461817|.	0.26863|.	N|.	0.022108|.	T|T	0.69178|0.69178	0.3082|0.3082	M|M	0.75085|0.75085	2.285|2.285	0.38694|0.38694	D|D	0.952823|0.952823	P;P;B|.	0.44877|.	0.845;0.554;0.078|.	P;B;B|.	0.53185|.	0.72;0.3;0.11|.	T|T	0.71227|0.71227	-0.4655|-0.4655	10|5	0.87932|.	D|.	0|.	-8.014|-8.014	16.3512|16.3512	0.83208|0.83208	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	186;186;48|.	O95278;O95278-2;E1P599|.	EPM2A_HUMAN;.;.|.	S|V	186|86;106	ENSP00000356489:I186S|.	ENSP00000320279:I186S|.	I|L	-|-	2|1	0|2	EPM2A|EPM2A	145998235|145998235	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.996000|0.996000	0.88848|0.88848	8.962000|8.962000	0.93254|0.93254	2.266000|2.266000	0.75297|0.75297	0.533000|0.533000	0.62120|0.62120	ATT|TTA		0.433	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042564.1			Missense_Mutation
EXTL3	2137	hgsc.bcm.edu	37	8	28574118	28574119	+	In_Frame_Ins	INS	-	-	CCATGT			TCGA-36-1577-01	TCGA-36-1577-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr8:28574118_28574119insCCATGT	ENST00000220562.4	+	3	1444_1445	c.542_543insCCATGT	c.(541-546)aactgc>aaCCATGTctgc	p.181_182NC>NHVC	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	181					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.N181_C182insHV(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CGGCTACACAACTGCTTTGATT	0.594																																																1	Insertion - In frame(1)	ovary(1)	8																																								28630038	SO:0001652	inframe_insertion	2137			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	Exception_encountered	8.37:g.28574118_28574119insCCATGT	ENSP00000220562:p.Asn181_Cys182insHisVal	Somatic		Capture	SOLID	Phase_III	28630037	D3DST8|O00225|Q53XT3	In_Frame_Ins	INS	ENST00000220562.4	37	CCDS6070.1	INS	2	Baylor																																																																																				0.594	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		In_Frame_Ins
FRMD4A	55691	hgsc.bcm.edu	37	10	13712491	13712491	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr10:13712491T>C	ENST00000357447.2	-	17	1657	c.1289A>G	c.(1288-1290)gAt>gGt	p.D430G	FRMD4A_ENST00000378503.1_Missense_Mutation_p.D430G|FRMD4A_ENST00000358621.4_Missense_Mutation_p.D415G	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	430					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						CTCCCCTGGATCCAGGGGATA	0.517																																																0			10											149.0	142.0	145.0					10																	13712491		2203	4300	6503	13752497	SO:0001583	missense	55691			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1289A>G	10.37:g.13712491T>C	ENSP00000350032:p.Asp430Gly	Somatic		Capture	SOLID	Phase_III	13752497	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.84	2.058828	0.36277	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.65	5.35	4.23	0.50019	.	0.043327	0.85682	D	0.000000	T	0.68696	0.3029	N	0.14661	0.345	0.80722	D	1	B;B	0.13145	0.003;0.007	B;B	0.17433	0.007;0.018	T	0.60870	-0.7177	10	0.26408	T	0.33	-19.6618	11.1021	0.48182	0.0:0.0719:0.0:0.9281	.	463;430	Q5T376;Q9P2Q2	.;FRM4A_HUMAN	G	415;430;430;463	ENSP00000351438:D415G;ENSP00000350032:D430G;ENSP00000367764:D430G;ENSP00000264546:D463G	ENSP00000264546:D463G	D	-	2	0	FRMD4A	13752497	1.000000	0.71417	0.983000	0.44433	0.858000	0.48976	4.863000	0.62983	1.062000	0.40625	0.533000	0.62120	GAT		0.517	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027		Missense_Mutation
FURIN	5045	hgsc.bcm.edu	37	15	91424681	91424681	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr15:91424681G>A	ENST00000268171.3	+	16	2237	c.1958G>A	c.(1957-1959)gGg>gAg	p.G653E	FES_ENST00000414248.2_5'Flank|FES_ENST00000328850.3_5'Flank	NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	653					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G653E(1)		breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ACATGCCAGGGGCCGGCCCTG	0.667																																																1	Substitution - Missense(1)	ovary(1)	15											38.0	40.0	39.0					15																	91424681		2196	4294	6490	89225685	SO:0001583	missense	5045			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1958G>A	15.37:g.91424681G>A	ENSP00000268171:p.Gly653Glu	Somatic		Capture	SOLID	Phase_III	89225685	Q14336|Q6LBS3|Q9UCZ5	Missense_Mutation	SNP	ENST00000268171.3	37	CCDS10364.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853889	0.91355	.	.	ENSG00000140564	ENST00000268171	T	0.35973	1.28	5.02	5.02	0.67125	Growth factor, receptor (1);	0.100948	0.64402	D	0.000002	T	0.67581	0.2908	M	0.89658	3.05	0.58432	D	0.999997	D	0.76494	0.999	D	0.69142	0.962	T	0.76350	-0.2991	10	0.87932	D	0	-33.8562	18.3814	0.90452	0.0:0.0:1.0:0.0	.	653	P09958	FURIN_HUMAN	E	653	ENSP00000268171:G653E	ENSP00000268171:G653E	G	+	2	0	FURIN	89225685	1.000000	0.71417	0.978000	0.43139	0.939000	0.58152	3.712000	0.54875	2.337000	0.79520	0.555000	0.69702	GGG		0.667	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569		Missense_Mutation
GADD45GIP1	90480	hgsc.bcm.edu	37	19	13065323	13065323	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:13065323T>C	ENST00000316939.1	-	2	391	c.368A>G	c.(367-369)gAg>gGg	p.E123G		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	123					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				ovary(2)|prostate(1)|skin(1)	4						GGCCATGCACTCTGCGATGTG	0.617																																																0			19											57.0	50.0	52.0					19																	13065323		2203	4299	6502	12926323	SO:0001583	missense	90480			AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.368A>G	19.37:g.13065323T>C	ENSP00000323065:p.Glu123Gly	Somatic		Capture	SOLID	Phase_III	12926323	Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Missense_Mutation	SNP	ENST00000316939.1	37	CCDS12290.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.129	1.010853	0.19277	.	.	ENSG00000179271	ENST00000316939	.	.	.	4.67	2.46	0.29980	.	0.240961	0.31123	N	0.008217	T	0.29389	0.0732	L	0.43152	1.355	0.09310	N	1	B	0.15719	0.014	B	0.15052	0.012	T	0.14200	-1.0481	9	0.27785	T	0.31	-41.8921	5.8065	0.18442	0.0:0.1113:0.4014:0.4873	.	123	Q8TAE8	G45IP_HUMAN	G	123	.	ENSP00000323065:E123G	E	-	2	0	GADD45GIP1	12926323	0.998000	0.40836	0.093000	0.20910	0.686000	0.39977	3.638000	0.54332	0.676000	0.31285	-0.379000	0.06801	GAG		0.617	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452759.2	NM_052850		Missense_Mutation
GADD45GIP1	90480	hgsc.bcm.edu	37	19	13065326	13065326	+	Missense_Mutation	SNP	G	G	T	rs148072118		TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:13065326G>T	ENST00000316939.1	-	2	388	c.365C>A	c.(364-366)gCa>gAa	p.A122E		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	122					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.A122E(1)		ovary(2)|prostate(1)|skin(1)	4						CATGCACTCTGCGATGTGCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											54.0	47.0	50.0					19																	13065326		2203	4299	6502	12926326	SO:0001583	missense	90480			AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.365C>A	19.37:g.13065326G>T	ENSP00000323065:p.Ala122Glu	Somatic		Capture	SOLID	Phase_III	12926326	Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Missense_Mutation	SNP	ENST00000316939.1	37	CCDS12290.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.600	1.128558	0.21041	.	.	ENSG00000179271	ENST00000316939	.	.	.	4.83	2.55	0.30701	.	0.132676	0.48767	N	0.000166	T	0.29684	0.0741	N	0.26042	0.785	0.19575	N	0.999968	B	0.21753	0.06	B	0.20955	0.032	T	0.21143	-1.0254	9	0.36615	T	0.2	-20.2894	13.2808	0.60212	0.0:0.0:0.6568:0.3432	.	122	Q8TAE8	G45IP_HUMAN	E	122	.	ENSP00000323065:A122E	A	-	2	0	GADD45GIP1	12926326	0.985000	0.35326	0.046000	0.18839	0.703000	0.40648	3.418000	0.52721	1.002000	0.39104	0.558000	0.71614	GCA		0.622	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452759.2	NM_052850		Missense_Mutation
GLIS2	84662	hgsc.bcm.edu	37	16	4383356	4383357	+	Frame_Shift_Ins	INS	-	-	T			TCGA-36-1577-01	TCGA-36-1577-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr16:4383356_4383357insT	ENST00000262366.3	+	4	1002_1003	c.181_182insT	c.(181-183)ctgfs	p.L61fs	PAM16_ENST00000577031.1_Intron|GLIS2_ENST00000433375.1_Frame_Shift_Ins_p.L61fs|RP11-295D4.1_ENST00000574705.1_RNA			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	61	Interaction with CTNND1. {ECO:0000250}.				cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.N62fs*115(1)		breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						AGGCTTCCTGCTGAACTCCAAG	0.619																																																1	Insertion - Frameshift(1)	ovary(1)	16																																								4323358	SO:0001589	frameshift_variant	84662			AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.182dupT	16.37:g.4383357_4383357dupT	ENSP00000262366:p.Leu61fs	Somatic		Capture	SOLID	Phase_III	4323357	B3KX84	Frame_Shift_Ins	INS	ENST00000262366.3	37	CCDS10511.1	INS	28	Baylor																																																																																				0.619	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251630.1	NM_032575		Frame_Shift_Ins
GOLIM4	27333	hgsc.bcm.edu	37	3	167750318	167750318	+	Missense_Mutation	SNP	G	G	T	rs142340864		TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:167750318G>T	ENST00000470487.1	-	9	1855	c.1166C>A	c.(1165-1167)gCg>gAg	p.A389E	GOLIM4_ENST00000309027.4_Missense_Mutation_p.A361E	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	389	Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A389E(1)		breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CTCAGCACGCGCGTGCCCTTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	3											237.0	197.0	211.0					3																	167750318		2203	4300	6503	169233012	SO:0001583	missense	27333			U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1166C>A	3.37:g.167750318G>T	ENSP00000417354:p.Ala389Glu	Somatic		Capture	SOLID	Phase_III	169233012		Missense_Mutation	SNP	ENST00000470487.1	37	CCDS3204.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	4.368	0.067761	0.08436	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	5.54	2.76	0.32466	.	1.404780	0.03726	N	0.252712	T	0.33352	0.0860	L	0.54323	1.7	0.09310	N	1	P;P	0.41546	0.754;0.754	B;B	0.43478	0.421;0.421	T	0.27020	-1.0086	9	0.02654	T	1	0.0909	4.038	0.09738	0.2919:0.0:0.4628:0.2453	.	361;389	F8W785;O00461	.;GOLI4_HUMAN	E	389;361	.	ENSP00000309893:A361E	A	-	2	0	GOLIM4	169233012	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.065000	0.14466	0.721000	0.32231	0.555000	0.69702	GCG		0.488	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2			Missense_Mutation
GRM5	2915	hgsc.bcm.edu	37	11	88300288	88300288	+	Missense_Mutation	SNP	C	C	T	rs376576529	byFrequency	TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr11:88300288C>T	ENST00000305447.4	-	7	2712	c.2563G>A	c.(2563-2565)Gca>Aca	p.A855T	GRM5_ENST00000418177.2_Missense_Mutation_p.A855T|GRM5_ENST00000455756.2_Missense_Mutation_p.A855T|GRM5_ENST00000393297.1_Missense_Mutation_p.A855T|GRM5_ENST00000305432.5_Missense_Mutation_p.A855T	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	855					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.A855T(1)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	CTGCTGGCTGCGGAGGATGAC	0.567													C|||	2	0.000399361	0.0	0.0	5008	,	,		21002	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11						C	THR/ALA,THR/ALA	0,4402		0,0,2201	87.0	76.0	80.0		2563,2563	5.7	0.2	11		80	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	GRM5	NM_000842.3,NM_001143831.2	58,58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	855/1181,855/1213	88300288	1,12999	2201	4299	6500	87939936	SO:0001583	missense	2915			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.2563G>A	11.37:g.88300288C>T	ENSP00000306138:p.Ala855Thr	Somatic		Capture	SOLID	Phase_III	87939936	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787247	0.70337	0.0	1.16E-4	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.88277	-2.34;-2.35;-2.35;-2.34;-2.36	5.71	5.71	0.89125	.	0.095077	0.64402	D	0.000001	D	0.89949	0.6863	L	0.42245	1.32	0.58432	D	0.999996	D;P	0.59767	0.986;0.9	P;B	0.52627	0.704;0.167	D	0.88299	0.2948	9	.	.	.	.	19.8631	0.96790	0.0:1.0:0.0:0.0	.	855;855	P41594-2;P41594	.;GRM5_HUMAN	T	855	ENSP00000402912:A855T;ENSP00000405690:A855T;ENSP00000305905:A855T;ENSP00000306138:A855T;ENSP00000376975:A855T	.	A	-	1	0	GRM5	87939936	1.000000	0.71417	0.233000	0.24025	0.995000	0.86356	4.934000	0.63491	2.709000	0.92574	0.655000	0.94253	GCA		0.567	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		Missense_Mutation
HDAC7	51564	hgsc.bcm.edu	37	12	48180401	48180401	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr12:48180401C>T	ENST00000427332.2	-	22	2578	c.2422G>A	c.(2422-2424)Gcc>Acc	p.A808T	HDAC7_ENST00000488927.1_5'Flank|HDAC7_ENST00000380610.4_Missense_Mutation_p.A864T|HDAC7_ENST00000354334.3_Missense_Mutation_p.A810T|HDAC7_ENST00000552960.1_Missense_Mutation_p.A830T|HDAC7_ENST00000080059.7_Missense_Mutation_p.A847T			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	808	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.A808T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		CCCAGTGGGGCCGGGTGACCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	12											68.0	62.0	64.0					12																	48180401		2203	4300	6503	46466668	SO:0001583	missense	51564			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2422G>A	12.37:g.48180401C>T	ENSP00000404394:p.Ala808Thr	Somatic		Capture	SOLID	Phase_III	46466668	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	37		SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.270	0.606993	0.14002	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	T;T;T;T;T	0.56941	0.44;0.43;0.44;0.43;0.44	5.11	2.23	0.28157	Histone deacetylase domain (2);	0.339036	0.29924	N	0.010848	T	0.37705	0.1013	L	0.45581	1.43	0.38468	D	0.947408	B;B;B;B	0.18610	0.001;0.029;0.001;0.002	B;B;B;B	0.14023	0.007;0.01;0.003;0.002	T	0.30446	-0.9978	10	0.02654	T	1	.	10.2239	0.43214	0.0:0.4422:0.4665:0.0912	.	808;847;830;810	Q8WUI4;Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	HDAC7_HUMAN;.;.;.	T	847;810;830;864;808	ENSP00000080059:A847T;ENSP00000351326:A810T;ENSP00000448532:A830T;ENSP00000369984:A864T;ENSP00000404394:A808T	ENSP00000080059:A847T	A	-	1	0	HDAC7	46466668	0.489000	0.26004	0.306000	0.25113	0.812000	0.45895	0.859000	0.27858	0.272000	0.22027	0.558000	0.71614	GCC		0.602	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2			Missense_Mutation
HUWE1	10075	hgsc.bcm.edu	37	X	53577921	53577921	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chrX:53577921T>C	ENST00000342160.3	-	64	9783	c.9326A>G	c.(9325-9327)cAt>cGt	p.H3109R	HUWE1_ENST00000262854.6_Missense_Mutation_p.H3109R|HUWE1_ENST00000474288.1_5'Flank			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3109					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.H2999R(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGACGCTCATGCATGAGCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	X											64.0	46.0	52.0					X																	53577921		2203	4300	6503	53594646	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9326A>G	X.37:g.53577921T>C	ENSP00000340648:p.His3109Arg	Somatic		Capture	SOLID	Phase_III	53594646	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.03	3.531990	0.64972	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.35236	1.32;1.32	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.47911	0.1471	L	0.36672	1.1	0.58432	D	0.999998	P;D	0.53462	0.932;0.96	P;D	0.66979	0.888;0.948	T	0.33624	-0.9861	10	0.27785	T	0.31	.	14.1505	0.65381	0.0:0.0:0.0:1.0	.	3109;3093	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	R	3109	ENSP00000340648:H3109R;ENSP00000262854:H3109R	ENSP00000262854:H3109R	H	-	2	0	HUWE1	53594646	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	7.306000	0.78905	1.987000	0.57996	0.486000	0.48141	CAT		0.572	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		Missense_Mutation
IGSF11	152404	hgsc.bcm.edu	37	3	118621759	118621759	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:118621759C>T	ENST00000393775.2	-	7	1209	c.904G>A	c.(904-906)Gag>Aag	p.E302K	IGSF11_ENST00000425327.2_Missense_Mutation_p.E301K|IGSF11_ENST00000489689.1_Missense_Mutation_p.E278K|IGSF11_ENST00000354673.2_Missense_Mutation_p.E301K|IGSF11_ENST00000441144.2_Missense_Mutation_p.E277K|IGSF11_ENST00000491903.1_Missense_Mutation_p.E274K	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	302					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GAGGAAATCTCAGTGTGAAAT	0.408																																																0			3											110.0	115.0	114.0					3																	118621759		2199	4300	6499	120104449	SO:0001583	missense	152404			AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.904G>A	3.37:g.118621759C>T	ENSP00000377370:p.Glu302Lys	Somatic		Capture	SOLID	Phase_III	120104449	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	ENST00000393775.2	37	CCDS46891.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240673	0.79912	.	.	ENSG00000144847	ENST00000425327;ENST00000393775;ENST00000489689;ENST00000354673;ENST00000441144;ENST00000491903	T;T;D;T;D;D	0.83335	-0.9;-1.12;-1.71;-0.9;-1.65;-1.54	5.37	5.37	0.77165	.	0.046342	0.85682	D	0.000000	T	0.67674	0.2918	N	0.08118	0	0.53688	D	0.999972	P;P;P;P;P	0.41848	0.651;0.763;0.763;0.651;0.651	B;B;B;B;B	0.36608	0.115;0.229;0.229;0.115;0.115	T	0.68569	-0.5374	10	0.20046	T	0.44	.	18.2816	0.90099	0.0:1.0:0.0:0.0	.	274;277;301;278;302	C9JBA5;Q5DX21-3;Q5DX21-2;C9JMW0;Q5DX21	.;.;.;.;IGS11_HUMAN	K	301;302;278;301;277;274	ENSP00000406092:E301K;ENSP00000377370:E302K;ENSP00000420486:E278K;ENSP00000346700:E301K;ENSP00000401240:E277K;ENSP00000417413:E274K	ENSP00000346700:E301K	E	-	1	0	IGSF11	120104449	1.000000	0.71417	0.983000	0.44433	0.988000	0.76386	7.233000	0.78125	2.804000	0.96469	0.655000	0.94253	GAG		0.408	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2			Missense_Mutation
IRS4	8471	hgsc.bcm.edu	37	X	107976436	107976436	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chrX:107976436C>G	ENST00000372129.2	-	1	3215	c.3139G>C	c.(3139-3141)Gtg>Ctg	p.V1047L	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1047					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.V1047L(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGGTCGACCACATAGATTCGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											84.0	80.0	82.0					X																	107976436		2203	4300	6503	107863092	SO:0001583	missense	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3139G>C	X.37:g.107976436C>G	ENSP00000361202:p.Val1047Leu	Somatic		Capture	SOLID	Phase_III	107863092		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.95	3.731639	0.69189	.	.	ENSG00000133124	ENST00000372129	T	0.47177	0.85	5.38	3.41	0.39046	.	0.477537	0.19860	N	0.104444	T	0.24661	0.0598	L	0.27053	0.805	0.30640	N	0.756524	P	0.34864	0.473	B	0.29267	0.1	T	0.09907	-1.0653	10	0.19590	T	0.45	-14.3121	2.3912	0.04378	0.0:0.4184:0.2954:0.2862	.	1047	O14654	IRS4_HUMAN	L	1047	ENSP00000361202:V1047L	ENSP00000361202:V1047L	V	-	1	0	IRS4	107863092	0.979000	0.34478	0.996000	0.52242	0.993000	0.82548	1.356000	0.34079	1.194000	0.43101	0.600000	0.82982	GTG		0.488	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		Missense_Mutation
ITIH1	3697	hgsc.bcm.edu	37	3	52813473	52813473	+	Missense_Mutation	SNP	T	T	G			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:52813473T>G	ENST00000273283.2	+	5	460	c.436T>G	c.(436-438)Ttc>Gtc	p.F146V	ITIH1_ENST00000542827.1_Missense_Mutation_p.F146V|ITIH1_ENST00000540715.1_Missense_Mutation_p.F4V|ITIH1_ENST00000537050.1_5'Flank	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	146	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TATGGAGCAATTCACCATCCA	0.493																																																0			3											137.0	125.0	129.0					3																	52813473		2203	4300	6503	52788513	SO:0001583	missense	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.436T>G	3.37:g.52813473T>G	ENSP00000273283:p.Phe146Val	Somatic		Capture	SOLID	Phase_III	52788513	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846783	0.91277	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715	T;T;T	0.58797	0.31;0.31;3.07	5.27	5.27	0.74061	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.80232	0.4585	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84835	0.0804	10	0.87932	D	0	-24.4818	14.85	0.70289	0.0:0.0:0.0:1.0	.	146	P19827	ITIH1_HUMAN	V	146;146;4	ENSP00000442584:F146V;ENSP00000273283:F146V;ENSP00000443973:F4V	ENSP00000273283:F146V	F	+	1	0	ITIH1	52788513	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.173000	0.77612	2.004000	0.58718	0.459000	0.35465	TTC		0.493	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215		Missense_Mutation
JOSD1	9929	hgsc.bcm.edu	37	22	39095977	39095977	+	Frame_Shift_Del	DEL	A	A	-	rs202131287		TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr22:39095977delA	ENST00000216039.5	-	1	695	c.16delT	c.(16-18)tggfs	p.W6fs	JOSD1_ENST00000462610.1_5'Flank	NM_014876.5	NP_055691.1	Q15040	JOS1_HUMAN	Josephin domain containing 1	6						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	omega peptidase activity (GO:0008242)	p.W6fs*64(1)		large_intestine(1)|lung(1)|ovary(2)|pancreas(1)	5	Melanoma(58;0.04)					TCTCCTTTCCATGGCACACAA	0.488																																																1	Deletion - Frameshift(1)	ovary(1)	22											140.0	142.0	141.0					22																	39095977		2203	4300	6503	37425923	SO:0001589	frameshift_variant	9929				CCDS13976.1	22q13.1	2005-11-10			ENSG00000100221	ENSG00000100221			28953	protein-coding gene	gene with protein product		615323				7584044	Standard	NM_014876		Approved	KIAA0063	uc003awf.3	Q15040	OTTHUMG00000151030	ENST00000216039.5:c.16delT	22.37:g.39095977delA	ENSP00000216039:p.Trp6fs	Somatic		Capture	SOLID	Phase_III	37425923	A8K712	Frame_Shift_Del	DEL	ENST00000216039.5	37	CCDS13976.1	DEL	8	Baylor																																																																																				0.488	JOSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321047.1	NM_014876		Frame_Shift_Del
KIFC3	3801	hgsc.bcm.edu	37	16	57790315	57790315	+	IGR	SNP	T	T	A			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr16:57790315T>A	ENST00000379655.4	-	0	3427				KATNB1_ENST00000379661.3_Missense_Mutation_p.F589Y	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3						ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CTGCAGCGGTTTCTGCCCCTC	0.607																																																0			16											119.0	121.0	120.0					16																	57790315		2198	4300	6498	56347816	SO:0001628	intergenic_variant	10300			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455		16.37:g.57790315T>A		Somatic		Capture	SOLID	Phase_III	56347816	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	37	CCDS10789.2	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	31	5.085770	0.94100	.	.	ENSG00000140854	ENST00000379661	T	0.71341	-0.56	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.85071	0.5613	M	0.84846	2.72	0.58432	D	0.999997	D	0.69078	0.997	D	0.79108	0.992	D	0.87712	0.2567	10	0.87932	D	0	-0.7909	14.373	0.66854	0.0:0.0:0.0:1.0	.	589	Q9BVA0	KTNB1_HUMAN	Y	589	ENSP00000368982:F589Y	ENSP00000368982:F589Y	F	+	2	0	KATNB1	56347816	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.379000	0.79691	2.002000	0.58637	0.443000	0.29094	TTT		0.607	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550		Missense_Mutation
CTIF	9811	hgsc.bcm.edu	37	18	46287796	46287796	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr18:46287796G>C	ENST00000256413.3	+	9	1402	c.1107G>C	c.(1105-1107)caG>caC	p.Q369H	CTIF_ENST00000382998.4_Missense_Mutation_p.Q371H	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	369					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)	p.Q369H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						CTCCCCAGCAGAACAAGATGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	18											125.0	87.0	100.0					18																	46287796		2203	4300	6503	44541794	SO:0001583	missense	9811			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.1107G>C	18.37:g.46287796G>C	ENSP00000256413:p.Gln369His	Somatic		Capture	SOLID	Phase_III	44541794	B3KTR8|Q8IVD5	Missense_Mutation	SNP	ENST00000256413.3	37	CCDS11935.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177014	0.38413	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.21932	1.98;1.98	5.8	0.738	0.18319	Armadillo-type fold (1);	0.704602	0.14295	N	0.328699	T	0.12646	0.0307	N	0.14661	0.345	0.31614	N	0.65118	B;B	0.30870	0.298;0.162	B;B	0.35899	0.213;0.078	T	0.19451	-1.0305	10	0.62326	D	0.03	-4.8823	6.6616	0.23016	0.2035:0.2377:0.5587:0.0	.	371;369	O43310-2;O43310	.;CTIF_HUMAN	H	369;371;321	ENSP00000256413:Q369H;ENSP00000372459:Q371H	ENSP00000256413:Q369H	Q	+	3	2	CTIF	44541794	1.000000	0.71417	0.927000	0.36925	0.582000	0.36321	2.490000	0.45294	-0.148000	0.11234	-0.175000	0.13238	CAG		0.577	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1	NM_014772		Missense_Mutation
KLK10	5655	hgsc.bcm.edu	37	19	51519365	51519365	+	Missense_Mutation	SNP	C	C	A	rs577311064		TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:51519365C>A	ENST00000309958.3	-	4	535	c.317G>T	c.(316-318)gGa>gTa	p.G106V	KLK10_ENST00000391805.1_Missense_Mutation_p.G106V|KLK10_ENST00000358789.3_Missense_Mutation_p.G106V|CTC-518B2.12_ENST00000596286.1_RNA	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	106	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G106V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GAGCTGCTCTCCCTGAAGAAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											42.0	35.0	37.0					19																	51519365		2200	4295	6495	56211177	SO:0001583	missense	5655			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.317G>T	19.37:g.51519365C>A	ENSP00000311746:p.Gly106Val	Somatic		Capture	SOLID	Phase_III	56211177	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	37	CCDS12817.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	c	18.24	3.579954	0.65992	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.90504	-2.68;-2.68;-2.68	4.67	3.6	0.41247	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.685753	0.11990	N	0.509955	D	0.89529	0.6741	L	0.50993	1.605	0.37346	D	0.91058	P	0.38078	0.617	B	0.44133	0.442	D	0.88603	0.3151	10	0.87932	D	0	.	9.529	0.39182	0.0:0.8977:0.0:0.1023	.	106	O43240	KLK10_HUMAN	V	106	ENSP00000375681:G106V;ENSP00000311746:G106V;ENSP00000351640:G106V	ENSP00000311746:G106V	G	-	2	0	KLK10	56211177	0.006000	0.16342	0.752000	0.31206	0.988000	0.76386	0.528000	0.23002	1.046000	0.40249	0.655000	0.94253	GGA		0.602	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776		Missense_Mutation
LARP1	23367	hgsc.bcm.edu	37	5	154181875	154181876	+	In_Frame_Ins	INS	-	-	GAT			TCGA-36-1577-01	TCGA-36-1577-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr5:154181875_154181876insGAT	ENST00000336314.4	+	11	1818_1819	c.1794_1795insGAT	c.(1795-1797)gcc>GATgcc	p.598_599insD		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	675					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.L675_A676insD(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCGCCGAACTGGCCAAGGTCAT	0.55																																																1	Insertion - In frame(1)	ovary(1)	5																																								154162069	SO:0001652	inframe_insertion	23367			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	Exception_encountered	5.37:g.154181875_154181876insGAT	ENSP00000336721:p.Leu598_Ala599insAsp	Somatic		Capture	SOLID	Phase_III	154162068	O94836|Q8N4M2|Q8NB73|Q9UFD7	In_Frame_Ins	INS	ENST00000336314.4	37	CCDS4328.1	INS	47	Baylor																																																																																				0.550	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551		In_Frame_Ins
LCAT	3931	hgsc.bcm.edu	37	16	67974172	67974172	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr16:67974172G>C	ENST00000264005.5	-	6	987	c.958C>G	c.(958-960)Cag>Gag	p.Q320E		NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	320					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		TCACGTGACTGCAGCCACATG	0.572																																																0			16											94.0	84.0	88.0					16																	67974172		2198	4300	6498	66531673	SO:0001583	missense	3931				CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.958C>G	16.37:g.67974172G>C	ENSP00000264005:p.Gln320Glu	Somatic		Capture	SOLID	Phase_III	66531673	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	37	CCDS10854.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266901	0.40095	.	.	ENSG00000213398	ENST00000264005	D	0.95035	-3.59	5.43	3.3	0.37823	.	0.225553	0.34986	U	0.003526	D	0.91533	0.7326	M	0.62016	1.91	0.36376	D	0.861602	B	0.26002	0.139	B	0.31290	0.127	D	0.89108	0.3494	10	0.37606	T	0.19	-25.2368	6.3756	0.21505	0.0938:0.0:0.725:0.1812	.	320	P04180	LCAT_HUMAN	E	320	ENSP00000264005:Q320E	ENSP00000264005:Q320E	Q	-	1	0	LCAT	66531673	1.000000	0.71417	0.990000	0.47175	0.929000	0.56500	3.735000	0.55044	2.537000	0.85549	0.555000	0.69702	CAG		0.572	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3			Missense_Mutation
LRBA	987	hgsc.bcm.edu	37	4	151203756	151203756	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr4:151203756C>T	ENST00000357115.3	-	56	8438	c.8195G>A	c.(8194-8196)aGg>aAg	p.R2732K	LRBA_ENST00000510413.1_Missense_Mutation_p.R2720K|LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.R2721K	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2732						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R2732K(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CTCCAAGGTCCTCAACAAGTC	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											107.0	101.0	103.0					4																	151203756		2203	4300	6503	151423206	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.8195G>A	4.37:g.151203756C>T	ENSP00000349629:p.Arg2732Lys	Somatic		Capture	SOLID	Phase_III	151423206	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	SNP	24	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.775091|5.775091	0.96922|0.96922	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835;ENST00000508606|ENST00000535741;ENST00000510413;ENST00000357115	.|T;T;T	.|0.28666	.|1.6;1.6;1.6	5.91|5.91	5.91|5.91	0.95273|0.95273	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62258|0.62258	0.2413|0.2413	M|M	0.84156|0.84156	2.68|2.68	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.67145	.|0.994;0.987;0.952;0.996	.|D;D;P;D	.|0.77004	.|0.97;0.937;0.754;0.989	T|T	0.64076|0.64076	-0.6492|-0.6492	5|10	.|0.62326	.|D	.|0.03	.|.	20.2985|20.2985	0.98592|0.98592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2732;2721;2720;627	.|P50851;F5H1X8;P50851-2;Q68D03	.|LRBA_HUMAN;.;.;.	R|K	1374;78|2721;2720;2732	.|ENSP00000446299:R2721K;ENSP00000421552:R2720K;ENSP00000349629:R2732K	.|ENSP00000349629:R2732K	G|R	-|-	1|2	0|0	LRBA|LRBA	151423206|151423206	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.702000|7.702000	0.84576|0.84576	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GGA|AGG		0.403	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			Missense_Mutation
LRP10	26020	hgsc.bcm.edu	37	14	23344376	23344376	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr14:23344376G>A	ENST00000359591.4	+	4	1019	c.328G>A	c.(328-330)Ggc>Agc	p.G110S	LRP10_ENST00000546834.1_Missense_Mutation_p.G110S	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	110	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G110S(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		GCTGCCCGGGGGCAACGTCAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	14											48.0	46.0	47.0					14																	23344376		2203	4300	6503	22414216	SO:0001583	missense	26020			AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.328G>A	14.37:g.23344376G>A	ENSP00000352601:p.Gly110Ser	Somatic		Capture	SOLID	Phase_III	22414216	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	37	CCDS9578.1	SNP	43	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.96|13.96	2.391812|2.391812	0.42410|0.42410	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000551466|ENST00000359591;ENST00000546834	D|T;T	0.94417|0.26518	-3.42|1.73;1.73	5.4|5.4	4.51|4.51	0.55191|0.55191	.|CUB (3);	0.056027|0.056027	0.64402|0.64402	D|N	0.000001|0.000001	T|T	0.20210|0.20210	0.0486|0.0486	L|L	0.32530|0.32530	0.975|0.975	0.46499|0.46499	D|D	0.999079|0.999079	.|B	.|0.11235	.|0.004	.|B	.|0.10450	.|0.005	T|T	0.03240|0.03240	-1.1057|-1.1057	8|10	0.15499|0.28530	T|T	0.54|0.3	-19.2094|-19.2094	12.924|12.924	0.58249|0.58249	0.08:0.0:0.92:0.0|0.08:0.0:0.92:0.0	.|.	.|110	.|Q7Z4F1	.|LRP10_HUMAN	E|S	11|110	ENSP00000447977:G11E|ENSP00000352601:G110S;ENSP00000447559:G110S	ENSP00000447977:G11E|ENSP00000352601:G110S	G|G	+|+	2|1	0|0	LRP10|LRP10	22414216|22414216	1.000000|1.000000	0.71417|0.71417	0.867000|0.867000	0.34043|0.34043	0.089000|0.089000	0.18198|0.18198	3.196000|3.196000	0.51020|0.51020	1.280000|1.280000	0.44463|0.44463	0.563000|0.563000	0.77884|0.77884	GGG|GGC		0.632	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3			Missense_Mutation
LRRTM1	347730	hgsc.bcm.edu	37	2	80530076	80530076	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:80530076T>C	ENST00000295057.3	-	2	1525	c.869A>G	c.(868-870)aAc>aGc	p.N290S	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.N290S|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	290					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GGTGAGGCGGTTGGAGTCCAG	0.597										HNSCC(69;0.2)																																						0			2											59.0	59.0	59.0					2																	80530076		2203	4300	6503	80383587	SO:0001583	missense	347730			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.869A>G	2.37:g.80530076T>C	ENSP00000295057:p.Asn290Ser	Somatic		Capture	SOLID	Phase_III	80383587	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.58	3.163817	0.57476	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.68025	-0.3;-0.3	5.26	4.08	0.47627	.	0.000000	0.85682	U	0.000000	D	0.83876	0.5349	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85616	0.1261	9	.	.	.	.	11.3977	0.49851	0.1358:0.0:0.0:0.8642	.	290	Q86UE6	LRRT1_HUMAN	S	290	ENSP00000295057:N290S;ENSP00000386646:N290S	.	N	-	2	0	LRRTM1	80383587	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.036000	0.88901	0.787000	0.33731	0.533000	0.62120	AAC		0.597	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		Missense_Mutation
LRP2	4036	hgsc.bcm.edu	37	2	170062136	170062136	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:170062136C>G	ENST00000263816.3	-	41	7853	c.7568G>C	c.(7567-7569)tGg>tCg	p.W2523S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2523					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.W2523S(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCAGTCAGCCCAGTACAGGTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											91.0	86.0	88.0					2																	170062136		2203	4300	6503	169770382	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7568G>C	2.37:g.170062136C>G	ENSP00000263816:p.Trp2523Ser	Somatic		Capture	SOLID	Phase_III	169770382	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387306	0.61956	.	.	ENSG00000081479	ENST00000263816	D	0.99789	-6.75	5.9	5.9	0.94986	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.99887	0.9946	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96651	0.9481	10	0.87932	D	0	.	20.2664	0.98460	0.0:1.0:0.0:0.0	.	2523	P98164	LRP2_HUMAN	S	2523	ENSP00000263816:W2523S	ENSP00000263816:W2523S	W	-	2	0	LRP2	169770382	1.000000	0.71417	0.999000	0.59377	0.129000	0.20672	7.818000	0.86416	2.786000	0.95864	0.561000	0.74099	TGG		0.428	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
MAGEA8	4107	hgsc.bcm.edu	37	X	149013837	149013837	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chrX:149013837C>A	ENST00000542674.1	+	3	1312	c.791C>A	c.(790-792)gCg>gAg	p.A264E	MAGEA8_ENST00000535454.1_Missense_Mutation_p.A264E|MAGEA8_ENST00000286482.1_Missense_Mutation_p.A264E	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	264	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					TACCGCCAGGCGCCCGGCAGT	0.577																																																0			X											108.0	103.0	104.0					X																	149013837		2203	4298	6501	148774495	SO:0001583	missense	4107				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.791C>A	X.37:g.149013837C>A	ENSP00000443776:p.Ala264Glu	Somatic		Capture	SOLID	Phase_III	148774495	Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	CCDS14692.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	.	10.18	1.280160	0.23392	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.05025	3.51;3.51;3.51	1.0	-2.01	0.07410	.	0.398443	0.27526	N	0.018972	T	0.03915	0.0110	N	0.14661	0.345	0.09310	N	1	P	0.38455	0.632	B	0.42386	0.386	T	0.33650	-0.9860	10	0.72032	D	0.01	.	4.681	0.12734	0.0:0.2457:0.0:0.7543	.	264	P43361	MAGA8_HUMAN	E	264	ENSP00000438293:A264E;ENSP00000443776:A264E;ENSP00000286482:A264E	ENSP00000286482:A264E	A	+	2	0	MAGEA8	148774495	0.001000	0.12720	0.097000	0.21041	0.261000	0.26267	-0.038000	0.12144	-1.079000	0.03113	-2.572000	0.00171	GCG		0.577	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		Missense_Mutation
MAN2C1	4123	hgsc.bcm.edu	37	15	75656375	75656375	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr15:75656375G>C	ENST00000267978.5	-	6	801	c.755C>G	c.(754-756)aCc>aGc	p.T252S	MAN2C1_ENST00000565683.1_Missense_Mutation_p.T252S|MAN2C1_ENST00000563539.1_Intron|MAN2C1_ENST00000569482.1_Missense_Mutation_p.T252S|MAN2C1_ENST00000563622.1_Intron	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	252					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						GGCATGAATGGTGTGTTGGCT	0.607																																																0			15											133.0	87.0	103.0					15																	75656375		2197	4294	6491	73443428	SO:0001583	missense	4123			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.755C>G	15.37:g.75656375G>C	ENSP00000267978:p.Thr252Ser	Somatic		Capture	SOLID	Phase_III	73443428	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	ENST00000267978.5	37	CCDS32298.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	g	11.23	1.578526	0.28180	.	.	ENSG00000140400	ENST00000267978	T	0.80480	-1.38	5.47	4.54	0.55810	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.164818	0.52532	D	0.000062	T	0.72550	0.3474	L	0.46885	1.475	0.37411	D	0.913232	B;B;B	0.22983	0.036;0.044;0.078	B;B;B	0.32090	0.065;0.14;0.068	T	0.64976	-0.6280	10	0.08837	T	0.75	-29.815	10.0205	0.42039	0.1556:0.0:0.8444:0.0	.	34;252;252	B4DVP6;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	S	252	ENSP00000267978:T252S	ENSP00000267978:T252S	T	-	2	0	MAN2C1	73443428	1.000000	0.71417	0.871000	0.34182	0.830000	0.47004	4.143000	0.58051	2.576000	0.86940	0.486000	0.48141	ACC		0.607	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1			Missense_Mutation
MYH8	4626	hgsc.bcm.edu	37	17	10317286	10317286	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:10317286C>A	ENST00000403437.2	-	12	1174	c.1080G>T	c.(1078-1080)atG>atT	p.M360I	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	360	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCCCATAATGCATCACAGCCC	0.443									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							0			17											154.0	145.0	148.0					17																	10317286		2203	4300	6503	10258011	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1080G>T	17.37:g.10317286C>A	ENSP00000384330:p.Met360Ile	Somatic		Capture	SOLID	Phase_III	10258011	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694869	0.68386	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.87103	-2.21	4.85	4.85	0.62838	Myosin head, motor domain (2);	0.000000	0.50627	U	0.000110	D	0.93687	0.7983	M	0.83692	2.655	0.50171	D	0.999857	P	0.50617	0.937	D	0.65443	0.935	D	0.94492	0.7702	10	0.87932	D	0	.	18.164	0.89719	0.0:1.0:0.0:0.0	.	360	P13535	MYH8_HUMAN	I	360	ENSP00000384330:M360I	ENSP00000252173:M360I	M	-	3	0	MYH8	10258011	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.695000	0.61767	2.534000	0.85438	0.650000	0.86243	ATG		0.443	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		Missense_Mutation
MYH4	4622	hgsc.bcm.edu	37	17	10350417	10350417	+	Silent	SNP	T	T	A			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:10350417T>A	ENST00000255381.2	-	35	5192	c.5082A>T	c.(5080-5082)gcA>gcT	p.A1694A	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1694					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.A1694A(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GTTCCAGGGATGCCCTGAGCT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	17											174.0	138.0	150.0					17																	10350417		2203	4300	6503	10291142	SO:0001819	synonymous_variant	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5082A>T	17.37:g.10350417T>A		Somatic		Capture	SOLID	Phase_III	10291142		Silent	SNP	ENST00000255381.2	37	CCDS11154.1	SNP	51	Baylor																																																																																				0.522	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		Silent
MAP3K3	4215	hgsc.bcm.edu	37	17	61768495	61768495	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:61768495C>A	ENST00000361733.3	+	13	1566	c.1246C>A	c.(1246-1248)Cta>Ata	p.L416I	MAP3K3_ENST00000584573.1_Missense_Mutation_p.L443I|MAP3K3_ENST00000577395.1_Missense_Mutation_p.L412I|MAP3K3_ENST00000579585.1_Missense_Mutation_p.L447I|MAP3K3_ENST00000361357.3_Missense_Mutation_p.L447I	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	416	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)	p.L416I(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						GATCCAGTTGCTAAAGAACTT	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											112.0	92.0	99.0					17																	61768495		2203	4300	6503	59122227	SO:0001583	missense	4215			U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1246C>A	17.37:g.61768495C>A	ENSP00000354485:p.Leu416Ile	Somatic		Capture	SOLID	Phase_III	59122227	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	CCDS32702.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.5	4.427635	0.83667	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.34275	1.37;1.37	5.19	2.08	0.27032	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.59142	0.2172	M	0.82433	2.59	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.997;0.995	T	0.63283	-0.6672	10	0.87932	D	0	.	10.6012	0.45369	0.0:0.7798:0.0:0.2202	.	412;384;416;447	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	I	447;416	ENSP00000354927:L447I;ENSP00000354485:L416I	ENSP00000354927:L447I	L	+	1	2	MAP3K3	59122227	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.588000	0.36633	0.695000	0.31675	0.462000	0.41574	CTA		0.592	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401		Missense_Mutation
NEFH	4744	hgsc.bcm.edu	37	22	29885437	29885438	+	Frame_Shift_Ins	INS	-	-	G			TCGA-36-1577-01	TCGA-36-1577-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr22:29885437_29885438insG	ENST00000310624.6	+	4	1841_1842	c.1808_1809insG	c.(1807-1812)aaggccfs	p.A604fs		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	604	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A604fs*14(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCTCCAGAGAAGGCCAAGtccc	0.559																																																1	Insertion - Frameshift(1)	ovary(1)	22																																								28215438	SO:0001589	frameshift_variant	4744				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1810dupG	22.37:g.29885439_29885439dupG	ENSP00000311997:p.Ala604fs	Somatic		Capture	SOLID	Phase_III	28215437	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Frame_Shift_Ins	INS	ENST00000310624.6	37	CCDS13858.1	INS	3	Baylor																																																																																				0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076		Frame_Shift_Ins
NOVA1	4857	hgsc.bcm.edu	37	14	26918027	26918027	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr14:26918027A>G	ENST00000539517.2	-	5	979	c.662T>C	c.(661-663)gTc>gCc	p.V221A	NOVA1_ENST00000267422.7_Missense_Mutation_p.V99A|NOVA1_ENST00000465357.2_Missense_Mutation_p.V197A	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	224	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V221A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		ACTCACAGTGACAACCCTCTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	14											204.0	187.0	193.0					14																	26918027		2203	4300	6503	25987867	SO:0001583	missense	4857			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.662T>C	14.37:g.26918027A>G	ENSP00000438875:p.Val221Ala	Somatic		Capture	SOLID	Phase_III	25987867	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	ENST00000539517.2	37	CCDS32061.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964891	0.74131	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422;ENST00000449198;ENST00000347476	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.73	5.73	0.89815	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.64402	D	0.000003	T	0.63780	0.2540	M	0.71871	2.18	0.80722	D	1	D;P;P	0.71674	0.998;0.58;0.525	D;B;B	0.69654	0.965;0.285;0.188	T	0.67620	-0.5624	10	0.87932	D	0	-3.1557	16.0142	0.80425	1.0:0.0:0.0:0.0	.	224;197;221	P51513;D3DS81;P51513-4	NOVA1_HUMAN;.;.	A	197;221;99;180;75	ENSP00000447391:V197A;ENSP00000438875:V221A;ENSP00000267422:V99A;ENSP00000408914:V180A;ENSP00000299472:V75A	ENSP00000267422:V99A	V	-	2	0	NOVA1	25987867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.297000	0.96120	2.187000	0.69744	0.460000	0.39030	GTC		0.488	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491		Missense_Mutation
NR1H3	10062	hgsc.bcm.edu	37	11	47282193	47282193	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr11:47282193C>A	ENST00000467728.1	+	3	1704	c.466C>A	c.(466-468)Cgc>Agc	p.R156S	NR1H3_ENST00000405853.3_Missense_Mutation_p.R156S|NR1H3_ENST00000395397.3_Missense_Mutation_p.R111S|NR1H3_ENST00000481889.2_Missense_Mutation_p.R111S|NR1H3_ENST00000407404.1_Missense_Mutation_p.R156S|NR1H3_ENST00000527949.1_Missense_Mutation_p.R65S|NR1H3_ENST00000405576.1_Missense_Mutation_p.R111S|NR1H3_ENST00000441012.2_Missense_Mutation_p.R156S|NR1H3_ENST00000529540.1_3'UTR			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	156					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R156S(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						GTGTCGGCTTCGCAAATGCCG	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											31.0	29.0	30.0					11																	47282193		2201	4298	6499	47238769	SO:0001583	missense	10062			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.466C>A	11.37:g.47282193C>A	ENSP00000420656:p.Arg156Ser	Somatic		Capture	SOLID	Phase_III	47238769	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	CCDS7929.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846747	0.91277	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000436778;ENST00000407404;ENST00000444396;ENST00000412937;ENST00000449369;ENST00000441012;ENST00000436029;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41	5.08	5.08	0.68730	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.98223	0.9412	M	0.71206	2.165	0.42919	D	0.994286	D;D;D;D;D	0.89917	0.997;0.984;0.994;1.0;0.974	D;D;D;D;P	0.79784	0.958;0.937;0.963;0.993;0.851	D	0.99768	1.1023	10	0.87932	D	0	.	18.8433	0.92194	0.0:1.0:0.0:0.0	.	162;111;156;111;156	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	S	111;111;111;156;156;156;111;156;156;156;156;156;65	ENSP00000378793:R111S;ENSP00000385073:R111S;ENSP00000433271:R111S;ENSP00000403798:R156S;ENSP00000385801:R156S;ENSP00000391005:R156S;ENSP00000412636:R111S;ENSP00000415591:R156S;ENSP00000387946:R156S;ENSP00000403696:R156S;ENSP00000420656:R156S;ENSP00000384745:R156S;ENSP00000432073:R65S	ENSP00000378793:R111S	R	+	1	0	NR1H3	47238769	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	5.927000	0.70080	2.503000	0.84419	0.462000	0.41574	CGC		0.632	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3			Missense_Mutation
OR10H2	26538	hgsc.bcm.edu	37	19	15839642	15839642	+	Silent	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:15839642C>A	ENST00000305899.3	+	1	809	c.789C>A	c.(787-789)ccC>ccA	p.P263P		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P263P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					ACCTCAAGCCCAAAGGTCCCC	0.557																																																1	Substitution - coding silent(1)	ovary(1)	19											165.0	130.0	142.0					19																	15839642		2203	4300	6503	15700642	SO:0001819	synonymous_variant	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.789C>A	19.37:g.15839642C>A		Somatic		Capture	SOLID	Phase_III	15700642	Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	CCDS12333.1	SNP	21	Baylor																																																																																				0.557	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1			Silent
OXSR1	9943	hgsc.bcm.edu	37	3	38265303	38265303	+	Splice_Site	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:38265303G>T	ENST00000446845.1	+	7	973	c.601G>T	c.(601-603)Gtc>Ttc	p.V201F	OXSR1_ENST00000311806.3_Splice_Site_p.V201F					oxidative stress responsive 1									p.V201F(1)		skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGTTTTGCAGGTCCGTGGTTA	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	95.0	95.0					3																	38265303		2203	4300	6503	38240307	SO:0001630	splice_region_variant	9943			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.601-1G>T	3.37:g.38265303G>T		Somatic		Capture	SOLID	Phase_III	38240307		Missense_Mutation	SNP	ENST00000446845.1	37		SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771210	0.90108	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.65916	-0.18;-0.18	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67543	0.2904	N	0.20610	0.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65759	-0.6090	9	.	.	.	-12.1705	18.307	0.90185	0.0:0.0:1.0:0.0	.	201;201	C9JIG9;O95747	.;OXSR1_HUMAN	F	201	ENSP00000415851:V201F;ENSP00000311713:V201F	.	V	+	1	0	OXSR1	38240307	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.389000	0.97243	2.658000	0.90341	0.655000	0.94253	GTC		0.408	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000342708.1	NM_005109	Missense_Mutation	Missense_Mutation
PCDH20	64881	hgsc.bcm.edu	37	13	61986664	61986664	+	Missense_Mutation	SNP	A	A	C			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr13:61986664A>C	ENST00000409186.1	-	5	3673	c.1568T>G	c.(1567-1569)gTg>gGg	p.V523G	PCDH20_ENST00000409204.4_Missense_Mutation_p.V523G			Q8N6Y1	PCD20_HUMAN	protocadherin 20	523	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		V -> M (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.V496G(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TAAAAGTTGCACTTTAATGAC	0.403																																																1	Substitution - Missense(1)	ovary(1)	13											140.0	142.0	141.0					13																	61986664		2203	4300	6503	60884665	SO:0001583	missense	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1568T>G	13.37:g.61986664A>C	ENSP00000386653:p.Val523Gly	Somatic		Capture	SOLID	Phase_III	60884665	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	CCDS9442.2	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.90	3.250281	0.59212	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.71222	-0.55;-0.55	6.06	6.06	0.98353	.	0.408933	0.21981	N	0.066314	D	0.84511	0.5488	M	0.87900	2.915	0.80722	D	1	D	0.56746	0.977	P	0.58454	0.839	D	0.87100	0.2178	10	0.87932	D	0	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	523	A8K1K9	.	G	523;523;269	ENSP00000387250:V523G;ENSP00000386653:V523G	ENSP00000351500:V269G	V	-	2	0	PCDH20	60884665	1.000000	0.71417	0.995000	0.50966	0.825000	0.46686	9.249000	0.95470	2.323000	0.78572	0.528000	0.53228	GTG		0.403	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843		Missense_Mutation
PDK3	5165	hgsc.bcm.edu	37	X	24523397	24523397	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chrX:24523397G>A	ENST00000379162.4	+	5	812	c.577G>A	c.(577-579)Gtg>Atg	p.V193M	PDK3_ENST00000441463.2_Missense_Mutation_p.V193M	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	193	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.V193M(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CACCTGTAACGTGGCGGATGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	X											185.0	137.0	154.0					X																	24523397		2203	4300	6503	24433318	SO:0001583	missense	5165			L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.577G>A	X.37:g.24523397G>A	ENSP00000368460:p.Val193Met	Somatic		Capture	SOLID	Phase_III	24433318	B4DXG6	Missense_Mutation	SNP	ENST00000379162.4	37	CCDS14212.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537541	0.65085	.	.	ENSG00000067992	ENST00000379162;ENST00000441463	T;T	0.78003	-1.14;-1.14	5.6	4.75	0.60458	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.90249	0.6951	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70016	0.967;0.958	D	0.92105	0.5691	10	0.62326	D	0.03	.	13.8548	0.63519	0.0754:0.0:0.9246:0.0	.	193;193	B4DXG6;Q15120	.;PDK3_HUMAN	M	193	ENSP00000368460:V193M;ENSP00000387536:V193M	ENSP00000368460:V193M	V	+	1	0	PDK3	24433318	1.000000	0.71417	0.302000	0.25058	0.577000	0.36160	9.761000	0.98940	1.253000	0.44018	0.600000	0.82982	GTG		0.458	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1	NM_005391		Missense_Mutation
PKHD1	5314	hgsc.bcm.edu	37	6	51897949	51897949	+	Silent	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr6:51897949G>T	ENST00000371117.3	-	29	3518	c.3243C>A	c.(3241-3243)cgC>cgA	p.R1081R	PKHD1_ENST00000340994.4_Silent_p.R1081R	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1081	IPT/TIG 5.		R -> C (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CATTCACAATGCGTCCATCTT	0.363																																																0			6											88.0	85.0	86.0					6																	51897949		2203	4300	6503	52005908	SO:0001819	synonymous_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3243C>A	6.37:g.51897949G>T		Somatic		Capture	SOLID	Phase_III	52005908	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	46	Baylor																																																																																				0.363	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Silent
PKN3	29941	hgsc.bcm.edu	37	9	131482068	131482068	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr9:131482068G>T	ENST00000291906.4	+	19	2622	c.2229G>T	c.(2227-2229)tgG>tgT	p.W743C	ZDHHC12_ENST00000467312.1_5'Flank|PKN3_ENST00000485301.1_3'UTR	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	743	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TGGACTGGTGGGGGCTGGGTG	0.667																																																0			9											116.0	130.0	125.0					9																	131482068		2203	4300	6503	130521889	SO:0001583	missense	29941			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.2229G>T	9.37:g.131482068G>T	ENSP00000291906:p.Trp743Cys	Somatic		Capture	SOLID	Phase_III	130521889	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	37	CCDS6908.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520635	0.85495	.	.	ENSG00000160447	ENST00000291906	T	0.46819	0.86	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.80380	0.4612	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87258	0.2277	9	0.87932	D	0	.	16.8453	0.85979	0.0:0.0:1.0:0.0	.	743	Q6P5Z2	PKN3_HUMAN	C	743	ENSP00000291906:W743C	ENSP00000291906:W743C	W	+	3	0	PKN3	130521889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.513000	0.98010	2.588000	0.87417	0.563000	0.77884	TGG		0.667	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355		Missense_Mutation
PLVAP	83483	hgsc.bcm.edu	37	19	17487777	17487777	+	Silent	SNP	G	G	A	rs181770634	byFrequency	TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:17487777G>A	ENST00000252590.4	-	1	382	c.321C>T	c.(319-321)cgC>cgT	p.R107R		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	107					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R107R(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGTCCAGGTCGCGGCGAGCAT	0.637													G|||	3	0.000599042	0.0	0.0	5008	,	,		18373	0.002		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	19											99.0	86.0	90.0					19																	17487777		2203	4300	6503	17348777	SO:0001819	synonymous_variant	83483			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.321C>T	19.37:g.17487777G>A		Somatic		Capture	SOLID	Phase_III	17348777	Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Silent	SNP	ENST00000252590.4	37	CCDS32952.1	SNP	38	Baylor																																																																																				0.637	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310		Silent
PLXNA1	5361	hgsc.bcm.edu	37	3	126746833	126746833	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr3:126746833G>C	ENST00000393409.2	+	23	4413	c.4413G>C	c.(4411-4413)caG>caC	p.Q1471H	PLXNA1_ENST00000251772.4_Missense_Mutation_p.Q1448H	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1471					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TCAAGCAGCAGATGGAGAAGG	0.637																																																0			3											119.0	96.0	103.0					3																	126746833		2203	4300	6503	128229523	SO:0001583	missense	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4413G>C	3.37:g.126746833G>C	ENSP00000377061:p.Gln1471His	Somatic		Capture	SOLID	Phase_III	128229523		Missense_Mutation	SNP	ENST00000393409.2	37	CCDS33847.2	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	g	17.62	3.434071	0.62955	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.16073	2.37;2.37	3.52	3.52	0.40303	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000019	T	0.50939	0.1645	M	0.92923	3.36	0.53005	D	0.999968	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.67264	-0.5714	10	0.87932	D	0	.	15.5936	0.76558	0.0:0.0:1.0:0.0	.	85;1471	Q6ZTY7;Q9UIW2	.;PLXA1_HUMAN	H	1471;1448	ENSP00000377061:Q1471H;ENSP00000251772:Q1448H	ENSP00000251772:Q1448H	Q	+	3	2	PLXNA1	128229523	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	6.244000	0.72391	1.966000	0.57179	0.306000	0.20318	CAG		0.637	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242		Missense_Mutation
PRC1	9055	hgsc.bcm.edu	37	15	91512798	91512798	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr15:91512798C>A	ENST00000361188.5	-	13	2839	c.1628G>T	c.(1627-1629)gGa>gTa	p.G543V	PRC1-AS1_ENST00000554388.1_RNA|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000361919.3_Missense_Mutation_p.G543V|PRC1_ENST00000442656.2_Missense_Mutation_p.G502V|PRC1_ENST00000394249.3_Missense_Mutation_p.G543V					protein regulator of cytokinesis 1									p.G543V(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTTGTTGGCTCCATGCCTGCC	0.547																																																1	Substitution - Missense(1)	ovary(1)	15											137.0	103.0	114.0					15																	91512798		2198	4298	6496	89313802	SO:0001583	missense	9055			AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1628G>T	15.37:g.91512798C>A	ENSP00000354679:p.Gly543Val	Somatic		Capture	SOLID	Phase_III	89313802		Missense_Mutation	SNP	ENST00000361188.5	37	CCDS45352.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900285	0.52227	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000555455;ENST00000442656	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	6.06	5.13	0.70059	.	0.463864	0.24652	N	0.036711	T	0.40272	0.1110	L	0.36672	1.1	0.49213	D	0.999761	B;B;B;B	0.27765	0.156;0.156;0.156;0.188	B;B;B;P	0.45794	0.211;0.168;0.299;0.493	T	0.32745	-0.9895	10	0.30078	T	0.28	.	10.0855	0.42415	0.0:0.7773:0.1506:0.0721	.	502;543;513;543	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	V	543;543;543;146;502	ENSP00000377793:G543V;ENSP00000354618:G543V;ENSP00000354679:G543V;ENSP00000409549:G502V	ENSP00000354679:G543V	G	-	2	0	PRC1	89313802	1.000000	0.71417	0.893000	0.35052	0.933000	0.57130	3.342000	0.52159	1.541000	0.49316	0.650000	0.86243	GGA		0.547	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981		Missense_Mutation
PRKD1	5587	hgsc.bcm.edu	37	14	30107998	30107998	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr14:30107998G>A	ENST00000331968.5	-	5	1038	c.809C>T	c.(808-810)cCg>cTg	p.P270L	PRKD1_ENST00000551644.1_5'UTR|PRKD1_ENST00000415220.2_Missense_Mutation_p.P278L	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	270					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.P270L(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AAATGTGTGCGGCACTTTAAC	0.468																																																2	Substitution - Missense(2)	ovary(2)	14											97.0	92.0	94.0					14																	30107998		2203	4300	6503	29177749	SO:0001583	missense	5587				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.809C>T	14.37:g.30107998G>A	ENSP00000333568:p.Pro270Leu	Somatic		Capture	SOLID	Phase_III	29177749	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279086	0.80692	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.85171	-1.95;-1.95	5.4	5.4	0.78164	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.92404	0.7589	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92805	0.6259	10	0.87932	D	0	-18.5697	19.5253	0.95203	0.0:0.0:1.0:0.0	.	270	Q15139	KPCD1_HUMAN	L	270;278	ENSP00000333568:P270L;ENSP00000390535:P278L	ENSP00000333568:P270L	P	-	2	0	PRKD1	29177749	1.000000	0.71417	0.987000	0.45799	0.377000	0.30045	9.695000	0.98691	2.696000	0.92011	0.650000	0.86243	CCG		0.468	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742		Missense_Mutation
PRKD2	25865	hgsc.bcm.edu	37	19	47197154	47197154	+	Silent	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:47197154G>A	ENST00000291281.4	-	10	1779	c.1554C>T	c.(1552-1554)agC>agT	p.S518S	PRKD2_ENST00000600194.1_Silent_p.S361S|PRKD2_ENST00000433867.1_Silent_p.S518S|PRKD2_ENST00000601806.1_Silent_p.S361S|PRKD2_ENST00000595515.1_Silent_p.S518S			Q9BZL6	KPCD2_HUMAN	protein kinase D2	518					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GGCCTGGGGCGCTGGGTGCGT	0.677																																																0			19											54.0	58.0	57.0					19																	47197154		2203	4300	6503	51888994	SO:0001819	synonymous_variant	25865			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1554C>T	19.37:g.47197154G>A		Somatic		Capture	SOLID	Phase_III	51888994	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	37	CCDS12689.1	SNP	38	Baylor																																																																																				0.677	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457		Silent
PROM2	150696	hgsc.bcm.edu	37	2	95944750	95944753	+	Frame_Shift_Del	DEL	GCCC	GCCC	-	rs537330308		TCGA-36-1577-01	TCGA-36-1577-10	GCCC	GCCC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:95944750_95944753delGCCC	ENST00000317620.9	+	10	1265_1268	c.1132_1135delGCCC	c.(1132-1137)gcccagfs	p.AQ378fs	PROM2_ENST00000317668.4_Frame_Shift_Del_p.AQ378fs|PROM2_ENST00000542147.1_Frame_Shift_Del_p.AQ378fs|PROM2_ENST00000403131.2_Frame_Shift_Del_p.AQ378fs	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	378					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.A378fs*6(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GAAGGCAGTGGCCCAGCAGCCGGA	0.647																																																1	Deletion - Frameshift(1)	ovary(1)	2																																								95308480	SO:0001589	frameshift_variant	150696			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1132_1135delGCCC	2.37:g.95944750_95944753delGCCC	ENSP00000318270:p.Ala378fs	Somatic		Capture	SOLID	Phase_III	95308477	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Frame_Shift_Del	DEL	ENST00000317620.9	37	CCDS2012.1	DEL	42	Baylor																																																																																				0.647	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707		Frame_Shift_Del
RIF1	55183	hgsc.bcm.edu	37	2	152325066	152325066	+	Splice_Site	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:152325066G>C	ENST00000243326.5	+	31	7308		c.e31+1		RIF1_ENST00000453091.2_Intron|RIF1_ENST00000444746.2_Splice_Site|RIF1_ENST00000428287.2_Intron|RIF1_ENST00000430328.2_Intron			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1						fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.?(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		GAAGTGTTTAGTAAGAAGTGC	0.358																																																1	Unknown(1)	ovary(1)	2											155.0	161.0	159.0					2																	152325066		2203	4300	6503	152033312	SO:0001630	splice_region_variant	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6825+1G>C	2.37:g.152325066G>C		Somatic		Capture	SOLID	Phase_III	152033312	A0AVS0|Q9NS16	Splice_Site_SNP	SNP	ENST00000243326.5	37	CCDS2194.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582869	0.86748	.	.	ENSG00000080345	ENST00000444746;ENST00000243326	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6454	0.95775	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIF1	152033312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.950000	0.93019	2.736000	0.93811	0.591000	0.81541	.		0.358	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		Intron	Splice_Site_SNP
RIMBP2	23504	hgsc.bcm.edu	37	12	130897166	130897166	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr12:130897166A>G	ENST00000261655.4	-	15	2982	c.2819T>C	c.(2818-2820)aTa>aCa	p.I940T		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	940					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I940T(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCGCTTACCTATTTTCTCCAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	103.0	105.0					12																	130897166		2203	4300	6503	129463119	SO:0001583	missense	23504			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2819T>C	12.37:g.130897166A>G	ENSP00000261655:p.Ile940Thr	Somatic		Capture	SOLID	Phase_III	129463119	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.65	2.895435	0.52121	.	.	ENSG00000060709	ENST00000261655;ENST00000536632	T;T	0.45668	1.95;0.89	5.06	-1.85	0.07784	Src homology-3 domain (1);	0.560962	0.18188	N	0.148926	T	0.28267	0.0698	L	0.32530	0.975	0.80722	D	1	D	0.54601	0.967	B	0.43809	0.432	T	0.09751	-1.0660	10	0.25106	T	0.35	-12.7988	9.8792	0.41222	0.5862:0.0:0.4138:0.0	.	940	O15034	RIMB2_HUMAN	T	940;77	ENSP00000261655:I940T;ENSP00000439030:I77T	ENSP00000261655:I940T	I	-	2	0	RIMBP2	129463119	1.000000	0.71417	0.092000	0.20876	0.962000	0.63368	1.646000	0.37249	-0.640000	0.05495	0.533000	0.62120	ATA		0.493	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		Missense_Mutation
SCN1A	6323	hgsc.bcm.edu	37	2	166903282	166903282	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr2:166903282G>A	ENST00000303395.4	-	9	1374	c.1375C>T	c.(1375-1377)Cag>Tag	p.Q459*	SCN1A_ENST00000409050.1_Nonsense_Mutation_p.Q459*|SCN1A_ENST00000375405.3_Nonsense_Mutation_p.Q459*|SCN1A_ENST00000423058.2_Nonsense_Mutation_p.Q459*|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000599041.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	459					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.Q459*(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCTTTACCTGAGCTGCCTCC	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	2											91.0	79.0	83.0					2																	166903282		2203	4300	6503	166611528	SO:0001587	stop_gained	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1375C>T	2.37:g.166903282G>A	ENSP00000303540:p.Gln459*	Somatic		Capture	SOLID	Phase_III	166611528	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Nonsense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	37	6.556459	0.97663	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	.	.	.	5.31	5.31	0.75309	.	0.206675	0.35179	N	0.003386	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	19.3428	0.94350	0.0:0.0:1.0:0.0	.	.	.	.	X	459	.	ENSP00000303540:Q459X	Q	-	1	0	SCN1A	166611528	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.827000	0.86722	2.637000	0.89404	0.655000	0.94253	CAG		0.448	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		Nonsense_Mutation
SDHA	6389	hgsc.bcm.edu	37	5	256484	256485	+	Frame_Shift_Del	DEL	TT	TT	-	rs112307877		TCGA-36-1577-01	TCGA-36-1577-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr5:256484_256485delTT	ENST00000264932.6	+	15	2059_2060	c.1944_1945delTT	c.(1942-1947)actttgfs	p.L649fs	SDHA_ENST00000510361.1_Frame_Shift_Del_p.L601fs|SDHA_ENST00000504309.1_Frame_Shift_Del_p.L568fs|SDHA_ENST00000507522.1_3'UTR	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	649					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)	p.L649fs*4(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TCGACAAAACTTTGAACGAGGC	0.431									Familial Paragangliomas																																							1	Deletion - Frameshift(1)	ovary(1)	5																																								309485	SO:0001589	frameshift_variant	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1944_1945delTT	5.37:g.256484_256485delTT	ENSP00000264932:p.Leu649fs	Somatic		Capture	SOLID	Phase_III	309484	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Frame_Shift_Del	DEL	ENST00000264932.6	37	CCDS3853.1	DEL	56	Baylor																																																																																				0.431	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168		Frame_Shift_Del
SGSM2	9905	hgsc.bcm.edu	37	17	2266876	2266877	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-36-1577-01	TCGA-36-1577-10	CA	CA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:2266876_2266877delCA	ENST00000426855.2	+	7	965_966	c.790_791delCA	c.(790-792)cacfs	p.H264fs	SGSM2_ENST00000574563.1_Frame_Shift_Del_p.H264fs|SGSM2_ENST00000268989.3_Frame_Shift_Del_p.H264fs	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	264					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.H264fs*169(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		TGGCAAGAACCACGTGCTGGTG	0.629																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								2213627	SO:0001589	frameshift_variant	9905			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.790_791delCA	17.37:g.2266876_2266877delCA	ENSP00000415107:p.His264fs	Somatic		Capture	SOLID	Phase_III	2213626	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Frame_Shift_Del	DEL	ENST00000426855.2	37	CCDS45570.1	DEL	21	Baylor																																																																																				0.629	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853		Frame_Shift_Del
SLC17A7	57030	hgsc.bcm.edu	37	19	49939976	49939976	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:49939976G>T	ENST00000221485.3	-	2	316	c.145C>A	c.(145-147)Ccg>Acg	p.P49T	SLC17A7_ENST00000600601.1_5'UTR|SLC17A7_ENST00000543531.1_Missense_Mutation_p.P37T	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	49					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		ACCACCGGCGGGTCCCGGGTC	0.657																																																0			19											63.0	60.0	61.0					19																	49939976		2203	4299	6502	54631788	SO:0001583	missense	57030			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.145C>A	19.37:g.49939976G>T	ENSP00000221485:p.Pro49Thr	Somatic		Capture	SOLID	Phase_III	54631788	B4DFR9|B4DG46|Q6PCD0	Missense_Mutation	SNP	ENST00000221485.3	37	CCDS12764.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819787	0.50633	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	T;T	0.63096	-0.02;-0.02	4.05	4.05	0.47172	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.43919	D	0.000514	T	0.44871	0.1314	N	0.20986	0.625	0.32092	N	0.591738	B	0.12630	0.006	B	0.09377	0.004	T	0.41088	-0.9528	10	0.11182	T	0.66	.	14.5234	0.67870	0.0:0.0:1.0:0.0	.	49	Q9P2U7	VGLU1_HUMAN	T	49;37	ENSP00000221485:P49T;ENSP00000441767:P37T	ENSP00000221485:P49T	P	-	1	0	SLC17A7	54631788	0.045000	0.20229	1.000000	0.80357	0.990000	0.78478	0.976000	0.29462	2.572000	0.86782	0.561000	0.74099	CCG		0.657	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2			Missense_Mutation
SMARCA1	6594	hgsc.bcm.edu	37	X	128630779	128630779	+	Missense_Mutation	SNP	C	C	T	rs146487129		TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chrX:128630779C>T	ENST00000371122.4	-	12	1703	c.1574G>A	c.(1573-1575)cGt>cAt	p.R525H	SMARCA1_ENST00000371123.1_Missense_Mutation_p.R525H|SMARCA1_ENST00000371121.3_Missense_Mutation_p.R525H	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	525	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R525H(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CTCATAACCACGCCACATGCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	X						C	HIS/ARG,HIS/ARG	1,3834		0,1,1631,571	155.0	143.0	147.0		1574,1574	5.4	1.0	X	dbSNP_134	147	0,6728		0,0,2428,1872	no	missense,missense	SMARCA1	NM_003069.3,NM_139035.2	29,29	0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095	probably-damaging,probably-damaging	525/1055,525/1043	128630779	1,10562	2203	4300	6503	128458460	SO:0001583	missense	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.1574G>A	X.37:g.128630779C>T	ENSP00000360163:p.Arg525His	Somatic		Capture	SOLID	Phase_III	128458460	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733330	0.89482	2.61E-4	0.0	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.36	5.36	0.76844	Helicase, C-terminal (3);	0.000000	0.64402	D	0.000016	D	0.84884	0.5571	L	0.43646	1.37	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.992;0.996;0.987;0.996	D	0.86547	0.1832	10	0.87932	D	0	-7.751	18.2071	0.89858	0.0:1.0:0.0:0.0	.	504;525;525;525	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	H	525;525;525;504	ENSP00000360162:R525H;ENSP00000360164:R525H;ENSP00000360163:R525H;ENSP00000404275:R504H	ENSP00000360162:R525H	R	-	2	0	SMARCA1	128458460	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.896000	0.63222	2.238000	0.73509	0.422000	0.28245	CGT		0.388	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		Missense_Mutation
SORBS3	10174	hgsc.bcm.edu	37	8	22414287	22414287	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr8:22414287A>G	ENST00000240123.7	+	4	663	c.280A>G	c.(280-282)Atc>Gtc	p.I94V	SORBS3_ENST00000523402.1_Missense_Mutation_p.I94V	NM_005775.4	NP_005766.3	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3	94					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of stress fiber assembly (GO:0051496)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)	18		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		AAGCACAAAGATCCCTGCCTC	0.622																																																0			8											91.0	74.0	80.0					8																	22414287		2203	4300	6503	22470232	SO:0001583	missense	10174				CCDS6031.1	8p21.3	2008-02-05			ENSG00000120896	ENSG00000120896			30907	protein-coding gene	gene with protein product		610795				9885244, 12510380	Standard	NM_001018003		Approved	SCAM-1, SH3D4, vinexin	uc003xbv.3	O60504	OTTHUMG00000131728	ENST00000240123.7:c.280A>G	8.37:g.22414287A>G	ENSP00000240123:p.Ile94Val	Somatic		Capture	SOLID	Phase_III	22470232	Q5BJE4|Q6NX54|Q96FY4|Q9UQE4	Missense_Mutation	SNP	ENST00000240123.7	37	CCDS6031.1	SNP	12	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.075|0.075	-1.195307|-1.195307	0.01594|0.01594	.|.	.|.	ENSG00000120896|ENSG00000120896	ENST00000520563;ENST00000524057|ENST00000240123;ENST00000523402	.|T	.|0.05717	.|3.4	4.92|4.92	1.25|1.25	0.21368|0.21368	.|.	.|0.803275	.|0.10355	.|N	.|0.684654	T|T	0.03178|0.03178	0.0093|0.0093	N|N	0.08118|0.08118	0|0	0.25825|0.25825	N|N	0.984233|0.984233	.|B	.|0.09022	.|0.002	.|B	.|0.08055	.|0.003	T|T	0.45789|0.45789	-0.9237|-0.9237	5|10	.|0.30078	.|T	.|0.28	-4.3804|-4.3804	5.6609|5.6609	0.17668|0.17668	0.4091:0.4805:0.1104:0.0|0.4091:0.4805:0.1104:0.0	.|.	.|94	.|O60504	.|VINEX_HUMAN	G|V	48;30|94	.|ENSP00000240123:I94V	.|ENSP00000240123:I94V	D|I	+|+	2|1	0|0	SORBS3|SORBS3	22470232|22470232	0.351000|0.351000	0.24887|0.24887	0.865000|0.865000	0.33974|0.33974	0.353000|0.353000	0.29299|0.29299	0.598000|0.598000	0.24074|0.24074	0.218000|0.218000	0.20820|0.20820	0.533000|0.533000	0.62120|0.62120	GAT|ATC		0.622	SORBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254647.3	NM_005775		Missense_Mutation
ST7L	54879	hgsc.bcm.edu	37	1	113084662	113084662	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr1:113084662G>C	ENST00000358039.4	-	14	1844	c.1540C>G	c.(1540-1542)Cat>Gat	p.H514D	ST7L_ENST00000369669.1_Missense_Mutation_p.H331D|ST7L_ENST00000369668.2_Missense_Mutation_p.H514D|ST7L_ENST00000544629.1_Missense_Mutation_p.H449D|ST7L_ENST00000369666.1_Missense_Mutation_p.H497D|ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000538187.1_Missense_Mutation_p.H458D|ST7L_ENST00000360743.4_Missense_Mutation_p.H483D|ST7L_ENST00000343210.7_Missense_Mutation_p.H514D|ST7L_ENST00000490067.1_Missense_Mutation_p.H497D	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	514					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTGTGAAATGGATGAACAAA	0.358																																																0			1											93.0	90.0	91.0					1																	113084662		2203	4300	6503	112886185	SO:0001583	missense	54879			AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.1540C>G	1.37:g.113084662G>C	ENSP00000350734:p.His514Asp	Somatic		Capture	SOLID	Phase_III	112886185	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	ENST00000358039.4	37	CCDS848.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748272	0.69533	.	.	ENSG00000007341	ENST00000358039;ENST00000360743;ENST00000369673;ENST00000544629;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187	T;T;T;T;T;T;T;T;T	0.17213	2.29;2.53;2.29;2.29;2.29;2.29;2.29;2.29;2.29	6.11	5.2	0.72013	.	0.112546	0.64402	D	0.000007	T	0.16769	0.0403	L	0.36672	1.1	0.80722	D	1	B;D;P;P;P;P;P;P	0.59767	0.355;0.986;0.799;0.81;0.714;0.817;0.817;0.727	B;P;P;B;B;B;B;P	0.55545	0.378;0.778;0.491;0.306;0.306;0.395;0.395;0.53	T	0.01360	-1.1375	10	0.87932	D	0	-8.3708	15.1266	0.72486	0.068:0.0:0.9319:0.0	.	458;449;449;514;497;497;483;514	B7Z7D4;B7Z3J2;F5H2P3;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4	.;.;.;.;.;.;.;ST7L_HUMAN	D	514;483;264;449;331;497;514;514;497;458	ENSP00000350734:H514D;ENSP00000353972:H483D;ENSP00000445499:H449D;ENSP00000358683:H331D;ENSP00000417140:H497D;ENSP00000358682:H514D;ENSP00000345312:H514D;ENSP00000358680:H497D;ENSP00000444021:H458D	ENSP00000345312:H514D	H	-	1	0	ST7L	112886185	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.788000	0.75105	1.597000	0.50072	0.655000	0.94253	CAT		0.358	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3			Missense_Mutation
STAT3	6774	hgsc.bcm.edu	37	17	40489512	40489512	+	Silent	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:40489512C>A	ENST00000264657.5	-	8	1050	c.738G>T	c.(736-738)cgG>cgT	p.R246R	STAT3_ENST00000389272.3_Silent_p.R148R|STAT3_ENST00000588969.1_Silent_p.R246R|STAT3_ENST00000585517.1_Silent_p.R246R|STAT3_ENST00000404395.3_Silent_p.R246R	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	246					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CAATCTGTTGCCGCCTCTTCC	0.532									Hyperimmunoglobulin E Recurrent Infection Syndrome																																							0			17											69.0	64.0	66.0					17																	40489512		2203	4300	6503	37743038	SO:0001819	synonymous_variant	6774	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.738G>T	17.37:g.40489512C>A		Somatic		Capture	SOLID	Phase_III	37743038	A8K7B8|K7ENL3|O14916|Q9BW54	Silent	SNP	ENST00000264657.5	37	CCDS32656.1	SNP	26	Baylor																																																																																				0.532	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150		Silent
SULF2	55959	hgsc.bcm.edu	37	20	46294020	46294020	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr20:46294020G>C	ENST00000359930.4	-	14	2771	c.1920C>G	c.(1918-1920)aaC>aaG	p.N640K	SULF2_ENST00000361612.4_Missense_Mutation_p.N640K|SULF2_ENST00000467815.1_Missense_Mutation_p.N640K|SULF2_ENST00000484875.1_Missense_Mutation_p.N640K	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	640					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.N640K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TCTTAATTTTGTTCTGCAGGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	20											150.0	152.0	151.0					20																	46294020		2203	4300	6503	45727427	SO:0001583	missense	55959			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1920C>G	20.37:g.46294020G>C	ENSP00000353007:p.Asn640Lys	Somatic		Capture	SOLID	Phase_III	45727427	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827540	0.32329	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000371978;ENST00000467815	D;D;D;D	0.98901	-5.22;-5.22;-5.22;-5.22	5.15	4.2	0.49525	Extracellular sulfatase, C-terminal (1);Alkaline-phosphatase-like, core domain (1);	0.090836	0.85682	D	0.000000	D	0.95962	0.8685	L	0.47716	1.5	0.43564	D	0.995882	P;B	0.44195	0.828;0.336	B;B	0.40066	0.318;0.183	D	0.93659	0.6980	10	0.14252	T	0.57	-30.3527	8.4913	0.33102	0.2264:0.0:0.7736:0.0	.	640;640	Q8IWU5-2;Q8IWU5	.;SULF2_HUMAN	K	640;640;640;59;640	ENSP00000353007:N640K;ENSP00000418290:N640K;ENSP00000354662:N640K;ENSP00000418442:N640K	ENSP00000353007:N640K	N	-	3	2	SULF2	45727427	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.789000	0.38724	1.168000	0.42723	0.462000	0.41574	AAC		0.522	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837		Missense_Mutation
TCP11	6954	hgsc.bcm.edu	37	6	35088209	35088209	+	Silent	SNP	A	A	T			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr6:35088209A>T	ENST00000512012.1	-	6	1086	c.930T>A	c.(928-930)ccT>ccA	p.P310P	TCP11_ENST00000418521.2_Silent_p.P247P|TCP11_ENST00000444780.2_Silent_p.P318P|TCP11_ENST00000373974.4_Silent_p.P277P|TCP11_ENST00000244645.3_Silent_p.P248P|TCP11_ENST00000373979.2_Silent_p.P248P|TCP11_ENST00000412155.2_Silent_p.P272P|TCP11_ENST00000311875.5_Silent_p.P323P			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	310					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						TTCCTACCTCAGGGAACTCTT	0.557																																																0			6											106.0	117.0	113.0					6																	35088209		2203	4300	6503	35196187	SO:0001819	synonymous_variant	6954				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.930T>A	6.37:g.35088209A>T		Somatic		Capture	SOLID	Phase_III	35196187	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Silent	SNP	ENST00000512012.1	37		SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.28	1.593472	0.28357	.	.	ENSG00000124678	ENST00000502480	.	.	.	5.03	-2.43	0.06522	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3821	0.21540	0.5186:0.1306:0.3508:0.0	.	.	.	.	R	118	.	.	X	-	1	0	TCP11	35196187	0.042000	0.20092	0.997000	0.53966	0.994000	0.84299	-0.697000	0.05098	-0.227000	0.09884	0.455000	0.32223	TGA		0.557	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728		Silent
TEX10	54881	hgsc.bcm.edu	37	9	103082642	103082642	+	Missense_Mutation	SNP	G	G	C	rs367648075		TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr9:103082642G>C	ENST00000374902.4	-	11	2283	c.2107C>G	c.(2107-2109)Cga>Gga	p.R703G	TEX10_ENST00000535814.1_Missense_Mutation_p.R706G	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	703						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)		p.R703G(1)		NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		GGAACTCCTCGAAGGCTCTGA	0.388																																																1	Substitution - Missense(1)	ovary(1)	9						G	GLY/ARG,GLY/ARG	0,4406		0,0,2203	62.0	55.0	58.0		2116,2107	4.6	1.0	9		58	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TEX10	NM_001161584.1,NM_017746.3	125,125	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign,benign	706/914,703/930	103082642	1,13005	2203	4300	6503	102122463	SO:0001583	missense	54881			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.2107C>G	9.37:g.103082642G>C	ENSP00000364037:p.Arg703Gly	Somatic		Capture	SOLID	Phase_III	102122463	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	37	CCDS6748.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150015	0.37923	0.0	1.16E-4	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730	.	.	.	5.55	4.62	0.57501	.	0.391462	0.26859	N	0.022124	T	0.61739	0.2371	L	0.29908	0.895	0.80722	D	1	B;D;B	0.65815	0.079;0.995;0.079	B;P;B	0.60682	0.016;0.878;0.016	T	0.65018	-0.6270	9	0.72032	D	0.01	-6.0115	14.0117	0.64500	0.0:0.0:0.6756:0.3244	.	706;571;703	B4DYV2;E7ERG2;Q9NXF1	.;.;TEX10_HUMAN	G	706;703;571	.	ENSP00000364037:R703G	R	-	1	2	TEX10	102122463	0.991000	0.36638	0.997000	0.53966	0.993000	0.82548	1.180000	0.32005	2.605000	0.88082	0.563000	0.77884	CGA		0.388	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746		Missense_Mutation
TMOD2	29767	hgsc.bcm.edu	37	15	52058735	52058735	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr15:52058735G>C	ENST00000249700.4	+	2	318	c.97G>C	c.(97-99)Gaa>Caa	p.E33Q	TMOD2_ENST00000435126.2_Missense_Mutation_p.E33Q|TMOD2_ENST00000539962.2_5'UTR	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	33					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)	p.E33Q(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		GAAACAGTTGGAAAATGTTCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	15											148.0	136.0	140.0					15																	52058735		2195	4293	6488	49846027	SO:0001583	missense	29767			AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.97G>C	15.37:g.52058735G>C	ENSP00000249700:p.Glu33Gln	Somatic		Capture	SOLID	Phase_III	49846027	B4DEW6	Missense_Mutation	SNP	ENST00000249700.4	37	CCDS10144.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.4	4.407255	0.83230	.	.	ENSG00000128872	ENST00000435126;ENST00000249700	T;T	0.33654	1.4;1.4	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	L	0.54323	1.7	0.53688	D	0.999974	D;D	0.89917	1.0;1.0	D;D	0.97110	0.988;1.0	T	0.48790	-0.9004	10	0.32370	T	0.25	-19.6125	19.4249	0.94737	0.0:0.0:1.0:0.0	.	33;33	Q9NZR1-2;Q9NZR1	.;TMOD2_HUMAN	Q	33	ENSP00000404590:E33Q;ENSP00000249700:E33Q	ENSP00000249700:E33Q	E	+	1	0	TMOD2	49846027	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.062000	0.89475	2.604000	0.88044	0.591000	0.81541	GAA		0.418	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2			Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578176	7578176	+	Splice_Site	SNP	C	C	A			TCGA-36-1577-01	TCGA-36-1577-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:7578176C>A	ENST00000269305.4	-	6	862		c.e6+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(56)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAACCAGACCTCAGGCGGC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Unknown(56)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	ovary(12)|upper_aerodigestive_tract(10)|lung(8)|biliary_tract(5)|endometrium(5)|large_intestine(4)|oesophagus(4)|bone(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|cervix(1)|soft_tissue(1)|skin(1)|pancreas(1)	17	GRCh37	CS071266	TP53	S							80.0	75.0	77.0					17																	7578176		2203	4300	6503	7518901	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>T	17.37:g.7578176C>A		Somatic		Capture	SOLID	Phase_III	7518901	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964220	0.74131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.205	0.59790	0.1605:0.8394:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518901	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.775000	0.85489	1.321000	0.45227	0.563000	0.77884	.		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
TRIM41	90933	hgsc.bcm.edu	37	5	180661662	180661662	+	Missense_Mutation	SNP	A	A	C			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr5:180661662A>C	ENST00000315073.5	+	6	2490	c.1780A>C	c.(1780-1782)Aac>Cac	p.N594H	TRIM41_ENST00000351937.5_Intron|TRIM41_ENST00000510072.1_3'UTR	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	594	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCTTCTACAACGCAGAGAC	0.602																																																0			5											108.0	117.0	114.0					5																	180661662		2203	4300	6503	180594268	SO:0001583	missense	90933			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1780A>C	5.37:g.180661662A>C	ENSP00000320869:p.Asn594His	Somatic		Capture	SOLID	Phase_III	180594268	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	ENST00000315073.5	37	CCDS4466.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.46	1.355654	0.24598	.	.	ENSG00000146063	ENST00000315073;ENST00000438174	T	0.65178	-0.14	5.17	2.75	0.32379	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000011	T	0.59088	0.2168	M	0.83312	2.635	0.31260	N	0.69302	B	0.02656	0.0	B	0.08055	0.003	T	0.61033	-0.7144	10	0.66056	D	0.02	.	4.1592	0.10275	0.646:0.1767:0.1773:0.0	.	594	Q8WV44	TRI41_HUMAN	H	594;279	ENSP00000320869:N594H	ENSP00000320869:N594H	N	+	1	0	TRIM41	180594268	1.000000	0.71417	0.831000	0.32960	0.011000	0.07611	3.893000	0.56243	0.425000	0.26087	-0.475000	0.04921	AAC		0.602	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627		Missense_Mutation
TSPYL1	7259	hgsc.bcm.edu	37	6	116600085	116600085	+	Nonsense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr6:116600085G>C	ENST00000368608.3	-	1	981	c.909C>G	c.(907-909)taC>taG	p.Y303*	RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000452085.3_5'Flank|DSE_ENST00000540275.1_Intron	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	303					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.Y303*(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		AATTGGTTATGTACCTTAACA	0.453																																																1	Substitution - Nonsense(1)	ovary(1)	6											124.0	129.0	127.0					6																	116600085		2203	4300	6503	116706778	SO:0001587	stop_gained	7259			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.909C>G	6.37:g.116600085G>C	ENSP00000357597:p.Tyr303*	Somatic		Capture	SOLID	Phase_III	116706778	O75885|Q5TFE6	Nonsense_Mutation	SNP	ENST00000368608.3	37	CCDS34518.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.119744	0.94385	.	.	ENSG00000189241	ENST00000368608	.	.	.	4.27	2.5	0.30297	.	0.000000	0.32204	N	0.006430	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.0138	6.6031	0.22710	0.2134:0.0:0.7866:0.0	.	.	.	.	X	303	.	ENSP00000357597:Y303X	Y	-	3	2	TSPYL1	116706778	0.939000	0.31865	0.895000	0.35142	0.995000	0.86356	0.808000	0.27154	0.751000	0.32900	0.462000	0.41574	TAC		0.453	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1			Nonsense_Mutation
TXNDC12	51060	hgsc.bcm.edu	37	1	52486660	52486660	+	Missense_Mutation	SNP	T	T	A			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr1:52486660T>A	ENST00000371626.4	-	7	1538	c.464A>T	c.(463-465)cAg>cTg	p.Q155L	TXNDC12_ENST00000471493.1_5'Flank	NM_015913.3	NP_056997.1	O95881	TXD12_HUMAN	thioredoxin domain containing 12 (endoplasmic reticulum)	155					cell redox homeostasis (GO:0045454)	endoplasmic reticulum (GO:0005783)	protein-disulfide reductase (glutathione) activity (GO:0019153)	p.Q155L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7					Glutathione(DB00143)	CAGCCTTTCCTGAGCTTCCTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											129.0	113.0	118.0					1																	52486660		2203	4300	6503	52259248	SO:0001583	missense	51060			AF131758	CCDS561.1	1p32.3	2011-10-19			ENSG00000117862	ENSG00000117862		"""Protein disulfide isomerases"""	24626	protein-coding gene	gene with protein product	"""endoplasmic reticulum thioredoxin superfamily member, 18 kDa"", ""anterior gradient homolog 1 (Xenopus laevis)"", ""protein disulfide isomerase family A, member 16"""	609448				8619474, 9110174	Standard	NM_015913		Approved	TLP19, ERP18, ERP19, hAG-1, AGR1, PDIA16	uc001cti.4	O95881	OTTHUMG00000008629	ENST00000371626.4:c.464A>T	1.37:g.52486660T>A	ENSP00000360688:p.Gln155Leu	Somatic		Capture	SOLID	Phase_III	52259248	B3KQS0|Q5T1T4|Q96H50	Missense_Mutation	SNP	ENST00000371626.4	37	CCDS561.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.104	0.777283	0.16120	.	.	ENSG00000117862	ENST00000371626	T	0.40225	1.04	5.62	5.62	0.85841	Thioredoxin-like fold (3);	0.128326	0.53938	D	0.000045	T	0.39332	0.1074	M	0.65975	2.015	0.80722	D	1	B	0.15473	0.013	B	0.09377	0.004	T	0.31166	-0.9953	10	0.08179	T	0.78	.	14.0523	0.64745	0.0:0.0:0.0:1.0	.	155	O95881	TXD12_HUMAN	L	155	ENSP00000360688:Q155L	ENSP00000360688:Q155L	Q	-	2	0	TXNDC12	52259248	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.137000	0.71710	2.138000	0.66242	0.533000	0.62120	CAG		0.383	TXNDC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023818.1	NM_015913		Missense_Mutation
TXNL1	9352	hgsc.bcm.edu	37	18	54305583	54305583	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr18:54305583G>C	ENST00000217515.6	-	1	293	c.89C>G	c.(88-90)aCc>aGc	p.T30S	TXNL1_ENST00000540155.1_5'UTR|TXNL1_ENST00000590954.1_Missense_Mutation_p.T30S	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1	30	Thioredoxin.				cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		CCCTCTCATGGTGAACTTGAC	0.622																																																0			18											38.0	32.0	34.0					18																	54305583		2203	4300	6503	52456581	SO:0001583	missense	9352			AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.89C>G	18.37:g.54305583G>C	ENSP00000217515:p.Thr30Ser	Somatic		Capture	SOLID	Phase_III	52456581		Missense_Mutation	SNP	ENST00000217515.6	37	CCDS11961.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340117	0.60963	.	.	ENSG00000091164	ENST00000217515	T	0.21932	1.98	5.3	5.3	0.74995	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (2);	0.095123	0.64402	D	0.000001	T	0.19327	0.0464	L	0.43701	1.375	0.80722	D	1	B;B	0.27068	0.167;0.047	B;B	0.31812	0.136;0.062	T	0.03068	-1.1076	10	0.08599	T	0.76	.	14.4516	0.67389	0.0:0.0:1.0:0.0	.	30;30	B2R960;O43396	.;TXNL1_HUMAN	S	30	ENSP00000217515:T30S	ENSP00000217515:T30S	T	-	2	0	TXNL1	52456581	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.023000	0.76437	2.481000	0.83766	0.462000	0.41574	ACC		0.622	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256064.2			Missense_Mutation
UBE4A	9354	hgsc.bcm.edu	37	11	118261438	118261441	+	Frame_Shift_Del	DEL	ACAG	ACAG	-	rs142299294	byFrequency	TCGA-36-1577-01	TCGA-36-1577-10	ACAG	ACAG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr11:118261438_118261441delACAG	ENST00000431736.2	+	18	2928_2931	c.2856_2859delACAG	c.(2854-2859)gcacagfs	p.AQ952fs	UBE4A_ENST00000545354.1_Frame_Shift_Del_p.AQ417fs|UBE4A_ENST00000252108.3_Frame_Shift_Del_p.AQ945fs					ubiquitination factor E4A									p.T954fs*4(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CTCTCTTTGCACAGACAGTTCGAG	0.436																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								117766651	SO:0001589	frameshift_variant	9354			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2856_2859delACAG	11.37:g.118261442_118261445delACAG	ENSP00000387362:p.Ala952fs	Somatic		Capture	SOLID	Phase_III	117766648		Frame_Shift_Del	DEL	ENST00000431736.2	37	CCDS8396.1	DEL	6	Baylor																																																																																				0.436	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788		Frame_Shift_Del
VAT1	10493	hgsc.bcm.edu	37	17	41170667	41170667	+	Silent	SNP	G	G	T			TCGA-36-1577-01	TCGA-36-1577-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr17:41170667G>T	ENST00000420567.3	-	2	280	c.135C>A	c.(133-135)gtC>gtA	p.V45V	VAT1_ENST00000587173.1_Silent_p.V111V|VAT1_ENST00000355653.3_Silent_p.V179V			P54219	VMAT1_HUMAN	vesicle amine transport 1	0					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	AGTCAAAGAGGACCATGTAGG	0.552																																																0			17											115.0	109.0	111.0					17																	41170667		2203	4300	6503	38424193	SO:0001819	synonymous_variant	10493			U18009	CCDS11451.1	17q21	2013-08-23	2013-08-23			ENSG00000108828			16919	protein-coding gene	gene with protein product		604631	"""vesicle amine transport protein 1 homolog (T. californica)"""			7774926, 8938427	Standard	NM_006373		Approved	VATI, FLJ20230	uc002icm.1	Q99536		ENST00000420567.3:c.135C>A	17.37:g.41170667G>T		Somatic		Capture	SOLID	Phase_III	38424193	E9PDJ5|Q9BRE4	Silent	SNP	ENST00000420567.3	37		SNP	41	Baylor																																																																																				0.552	VAT1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000453104.1	NM_006373		Silent
VLDLR	7436	hgsc.bcm.edu	37	9	2641485	2641485	+	Missense_Mutation	SNP	A	A	C			TCGA-36-1577-01	TCGA-36-1577-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr9:2641485A>C	ENST00000382100.3	+	4	790	c.434A>C	c.(433-435)gAt>gCt	p.D145A	VLDLR_ENST00000382099.2_Missense_Mutation_p.D145A|RP11-125B21.2_ENST00000599229.1_RNA	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	145	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.D145A(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		AGTGGAGAAGATGAAGAAAAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	9											269.0	242.0	252.0					9																	2641485		2203	4300	6503	2631485	SO:0001583	missense	7436				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.434A>C	9.37:g.2641485A>C	ENSP00000371532:p.Asp145Ala	Somatic		Capture	SOLID	Phase_III	2631485	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	ENST00000382100.3	37	CCDS6446.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.7	4.853506	0.91355	.	.	ENSG00000147852	ENST00000382100;ENST00000382099	D;D	0.99220	-5.58;-5.58	6.07	6.07	0.98685	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.56097	D	0.000038	D	0.99764	0.9904	H	0.99689	4.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96772	0.9569	10	0.87932	D	0	.	16.6288	0.85011	1.0:0.0:0.0:0.0	.	145;145	Q5VVF5;P98155	.;VLDLR_HUMAN	A	145	ENSP00000371532:D145A;ENSP00000371531:D145A	ENSP00000371531:D145A	D	+	2	0	VLDLR	2631485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.326000	0.78906	0.533000	0.62120	GAT		0.463	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383		Missense_Mutation
ZNF556	80032	hgsc.bcm.edu	37	19	2878120	2878120	+	Missense_Mutation	SNP	T	T	G			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:2878120T>G	ENST00000307635.2	+	4	1251	c.1164T>G	c.(1162-1164)caT>caG	p.H388Q	ZNF556_ENST00000586426.1_Missense_Mutation_p.H387Q	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACACAAACATGAGAGAAAGC	0.453																																																0			19											86.0	86.0	86.0					19																	2878120		2203	4300	6503	2829120	SO:0001583	missense	80032			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.1164T>G	19.37:g.2878120T>G	ENSP00000302603:p.His388Gln	Somatic		Capture	SOLID	Phase_III	2829120	Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	37	CCDS12097.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962458	0.53400	.	.	ENSG00000172000	ENST00000307635	D	0.99974	-10.2	2.3	1.25	0.21368	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.99966	0.9987	M	0.90082	3.085	0.09310	N	0.999999	D	0.56287	0.975	P	0.57371	0.819	D	0.99949	1.1518	9	0.87932	D	0	.	5.1302	0.14905	0.0:0.1643:0.0:0.8357	.	388	Q9HAH1	ZN556_HUMAN	Q	388	ENSP00000302603:H388Q	ENSP00000302603:H388Q	H	+	3	2	ZNF556	2829120	0.000000	0.05858	0.009000	0.14445	0.824000	0.46624	-0.799000	0.04560	0.055000	0.16094	0.334000	0.21626	CAT		0.453	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967		Missense_Mutation
ZNF235	9310	hgsc.bcm.edu	37	19	44791479	44791479	+	Missense_Mutation	SNP	T	T	G			TCGA-36-1577-01	TCGA-36-1577-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1577-01	TCGA-36-1577-10	g.chr19:44791479T>G	ENST00000291182.4	-	5	2211	c.2109A>C	c.(2107-2109)agA>agC	p.R703S	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	703					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				CAGTGTGGACTCTCTGGTGTG	0.517																																																0			19											144.0	127.0	133.0					19																	44791479		2203	4300	6503	49483319	SO:0001583	missense	9310			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.2109A>C	19.37:g.44791479T>G	ENSP00000291182:p.Arg703Ser	Somatic		Capture	SOLID	Phase_III	49483319	B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	CCDS33048.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928365	0.52759	.	.	ENSG00000159917	ENST00000391957;ENST00000291182	T	0.24151	1.87	4.97	-1.39	0.08997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000404	T	0.40094	0.1103	M	0.78049	2.395	0.32685	N	0.514953	D;D	0.71674	0.997;0.998	P;D	0.66847	0.881;0.947	T	0.48019	-0.9071	10	0.62326	D	0.03	-39.1471	4.2944	0.10894	0.0:0.2635:0.3259:0.4106	.	699;703	Q14590-2;Q14590	.;ZN235_HUMAN	S	703	ENSP00000291182:R703S	ENSP00000291182:R703S	R	-	3	2	ZNF235	49483319	0.000000	0.05858	1.000000	0.80357	0.984000	0.73092	-0.539000	0.06113	0.199000	0.20427	0.260000	0.18958	AGA		0.517	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1			Missense_Mutation
