#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACO1	48	hgsc.bcm.edu	37	9	32407428	32407428	+	Splice_Site	SNP	G	G	A			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr9:32407428G>A	ENST00000309951.6	+	3	404		c.e3+1		ACO1_ENST00000379923.1_Splice_Site|ACO1_ENST00000541043.1_Splice_Site	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble						cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.?(3)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		AGGACTTTACGTGAGCCTAAT	0.388																																																3	Unknown(3)	lung(2)|ovary(1)	9											113.0	85.0	95.0					9																	32407428		2203	4300	6503	32397428	SO:0001630	splice_region_variant	48			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.266+1G>A	9.37:g.32407428G>A		Somatic		Capture	SOLID	Phase_III	32397428	D3DRK7|Q14652|Q5VZA7	Splice_Site_SNP	SNP	ENST00000309951.6	37	CCDS6525.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512926	0.85389	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1904	0.89805	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACO1	32397428	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.614000	0.98353	2.673000	0.90976	0.650000	0.86243	.		0.388	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	Intron	Splice_Site_SNP
ALAS1	211	hgsc.bcm.edu	37	3	52245331	52245331	+	Missense_Mutation	SNP	G	G	A	rs144316660		TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:52245331G>A	ENST00000394965.2	+	10	1723	c.1363G>A	c.(1363-1365)Gcc>Acc	p.A455T	ALAS1_ENST00000310271.2_Missense_Mutation_p.A455T|ALAS1_ENST00000469224.1_Missense_Mutation_p.A455T|ALAS1_ENST00000484952.1_Missense_Mutation_p.A455T	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	455					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)	p.A455T(1)		endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	AGGGTACATCGCCAGCACGAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	3						G	THR/ALA,THR/ALA	0,4406		0,0,2203	162.0	135.0	145.0		1363,1363	4.8	1.0	3	dbSNP_134	145	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ALAS1	NM_000688.4,NM_199166.1	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	455/641,455/641	52245331	1,13005	2203	4300	6503	52220371	SO:0001583	missense	211			X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.1363G>A	3.37:g.52245331G>A	ENSP00000378416:p.Ala455Thr	Somatic		Capture	SOLID	Phase_III	52220371		Missense_Mutation	SNP	ENST00000394965.2	37	CCDS2847.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347392	0.82022	0.0	1.16E-4	ENSG00000023330	ENST00000469224;ENST00000394965;ENST00000310271;ENST00000484952	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	5.68	4.81	0.61882	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.051822	0.85682	D	0.000000	D	0.94335	0.8179	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70227	0.968;0.968	D	0.93759	0.7065	10	0.48119	T	0.1	-12.4414	10.2021	0.43089	0.0724:0.0:0.7838:0.1439	.	472;455	B4DVA0;P13196	.;HEM1_HUMAN	T	455	ENSP00000417719:A455T;ENSP00000378416:A455T;ENSP00000309259:A455T;ENSP00000418779:A455T	ENSP00000309259:A455T	A	+	1	0	ALAS1	52220371	1.000000	0.71417	0.993000	0.49108	0.745000	0.42441	6.525000	0.73795	1.401000	0.46761	0.650000	0.86243	GCC		0.522	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350207.1			Missense_Mutation
AOC2	314	hgsc.bcm.edu	37	17	40997405	40997405	+	Silent	SNP	T	T	A			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr17:40997405T>A	ENST00000253799.3	+	1	789	c.762T>A	c.(760-762)acT>acA	p.T254T	AOC2_ENST00000452774.2_Silent_p.T254T	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	254					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCCACTGGACTGTCCAGCAGG	0.572																																																0			17											70.0	67.0	68.0					17																	40997405		2203	4300	6503	38250931	SO:0001819	synonymous_variant	314			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.762T>A	17.37:g.40997405T>A		Somatic		Capture	SOLID	Phase_III	38250931	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Silent	SNP	ENST00000253799.3	37	CCDS11443.1	SNP	55	Baylor																																																																																				0.572	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158		Silent
ARID2	196528	hgsc.bcm.edu	37	12	46244263	46244263	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr12:46244263G>C	ENST00000334344.6	+	15	2529	c.2357G>C	c.(2356-2358)gGc>gCc	p.G786A	ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000422737.1_Missense_Mutation_p.G637A|ARID2_ENST00000444670.1_Missense_Mutation_p.G396A|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	786					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G786A(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		ATCCCTTCAGGCACTCCTGTT	0.448			"""N, S, F"""		hepatocellular carcinoma																																		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	ovary(1)	12											88.0	77.0	81.0					12																	46244263		2203	4300	6503	44530530	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2357G>C	12.37:g.46244263G>C	ENSP00000335044:p.Gly786Ala	Somatic		Capture	SOLID	Phase_III	44530530	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049079	0.75846	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.38077	1.16	5.83	5.83	0.93111	.	0.101064	0.64402	D	0.000003	T	0.49321	0.1550	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.998;0.996	T	0.43750	-0.9372	10	0.42905	T	0.14	-5.0456	20.1152	0.97926	0.0:0.0:1.0:0.0	.	786;396;786	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	A	786;637;396	ENSP00000335044:G786A	ENSP00000335044:G786A	G	+	2	0	ARID2	44530530	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.795000	0.85887	2.750000	0.94351	0.655000	0.94253	GGC		0.448	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		Missense_Mutation
ATP1A2	477	hgsc.bcm.edu	37	1	160109760	160109760	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr1:160109760G>C	ENST00000361216.3	+	22	3109	c.3020G>C	c.(3019-3021)cGg>cCg	p.R1007P	ATP1A2_ENST00000459972.1_3'UTR|ATP1A2_ENST00000392233.3_Missense_Mutation_p.R996P	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	1007			R -> W (in FHM2; some patients exhibit a clinical overlap between migraine and epilepsy). {ECO:0000269|PubMed:23838748}.		adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.R1007P(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CTCATCCTGCGGCGGTATCCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											120.0	108.0	112.0					1																	160109760		2203	4300	6503	158376384	SO:0001583	missense	477			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.3020G>C	1.37:g.160109760G>C	ENSP00000354490:p.Arg1007Pro	Somatic		Capture	SOLID	Phase_III	158376384	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	SNP	39	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.469223|4.469223	0.84533|0.84533	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|D;D	.|0.91068	.|-2.78;-2.78	4.37|4.37	4.37|4.37	0.52481|0.52481	.|ATPase, P-type,  transmembrane domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96778|0.96778	0.8948|0.8948	H|H	0.97940|0.97940	4.11|4.11	0.80722|0.80722	D|D	1|1	.|D;D	.|0.63880	.|0.993;0.988	.|D;D	.|0.69142	.|0.962;0.916	D|D	0.97810|0.97810	1.0250|1.0250	5|10	.|0.87932	.|D	.|0	.|.	14.8061|14.8061	0.69956|0.69956	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|907;1007	.|F5GXJ7;P50993	.|.;AT1A2_HUMAN	R|P	701|1007;996;710	.|ENSP00000354490:R1007P;ENSP00000376066:R996P	.|ENSP00000354490:R1007P	G|R	+|+	1|2	0|0	ATP1A2|ATP1A2	158376384|158376384	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	9.601000|9.601000	0.98297|0.98297	2.420000|2.420000	0.82092|0.82092	0.655000|0.655000	0.94253|0.94253	GGC|CGG		0.587	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702		Missense_Mutation
ATP6AP1	537	hgsc.bcm.edu	37	X	153662732	153662732	+	Missense_Mutation	SNP	T	T	G			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chrX:153662732T>G	ENST00000369762.2	+	7	924	c.863T>G	c.(862-864)cTc>cGc	p.L288R	GDI1_ENST00000447750.2_5'Flank	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	288					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.L288R(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGACTCCCCTCACCTTTGGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											123.0	103.0	110.0					X																	153662732		2203	4300	6503	153315926	SO:0001583	missense	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.863T>G	X.37:g.153662732T>G	ENSP00000358777:p.Leu288Arg	Somatic		Capture	SOLID	Phase_III	153315926	A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	ENST00000369762.2	37	CCDS35451.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165671	0.38217	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000445849	.	.	.	5.49	-1.74	0.08056	.	1.228710	0.05262	N	0.515940	T	0.19685	0.0473	N	0.22421	0.69	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.11329	0.006;0.006	T	0.14755	-1.0461	9	0.15499	T	0.54	-1.9916	2.0956	0.03667	0.1311:0.1595:0.3985:0.3109	.	248;288	B3KR70;Q15904	.;VAS1_HUMAN	R	288;218;112	.	ENSP00000358777:L288R	L	+	2	0	ATP6AP1	153315926	0.000000	0.05858	0.005000	0.12908	0.847000	0.48162	-0.480000	0.06559	-0.726000	0.04895	0.430000	0.28490	CTC		0.582	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183		Missense_Mutation
BCR	613	hgsc.bcm.edu	37	22	23634794	23634794	+	Missense_Mutation	SNP	A	A	T			TCGA-36-1578-01	TCGA-36-1578-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr22:23634794A>T	ENST00000305877.8	+	15	3600	c.2849A>T	c.(2848-2850)tAc>tTc	p.Y950F	BCR_ENST00000359540.3_Missense_Mutation_p.Y950F	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	950	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y950F(1)	BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	ACGCGCGTCTACAGGGACACA	0.522			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	1	Substitution - Missense(1)	ovary(1)	22											130.0	122.0	125.0					22																	23634794		2203	4300	6503	21964794	SO:0001583	missense	613				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2849A>T	22.37:g.23634794A>T	ENSP00000303507:p.Tyr950Phe	Somatic		Capture	SOLID	Phase_III	21964794	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	37	CCDS13806.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.98	1.800820	0.31869	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.79845	1.11;-1.31	4.71	4.71	0.59529	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.67173	0.2865	N	0.16478	0.41	0.80722	D	1	B;B;B	0.23442	0.006;0.069;0.085	B;B;B	0.29440	0.021;0.062;0.102	T	0.61778	-0.6993	10	0.13470	T	0.59	.	13.6678	0.62407	1.0:0.0:0.0:0.0	.	539;950;950	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	F	950;950;615	ENSP00000303507:Y950F;ENSP00000352535:Y950F	ENSP00000303507:Y950F	Y	+	2	0	BCR	21964794	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	4.745000	0.62125	1.895000	0.54865	0.460000	0.39030	TAC		0.522	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327		Missense_Mutation
BTAF1	9044	hgsc.bcm.edu	37	10	93719831	93719831	+	Silent	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr10:93719831C>T	ENST00000265990.6	+	11	1491	c.1183C>T	c.(1183-1185)Cta>Tta	p.L395L	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	395					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L395L(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GGATGTGCTGCTAAAATTACT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	10											167.0	164.0	165.0					10																	93719831		2203	4300	6503	93709811	SO:0001819	synonymous_variant	9044			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1183C>T	10.37:g.93719831C>T		Somatic		Capture	SOLID	Phase_III	93709811	B4E0W6|O43578	Silent	SNP	ENST00000265990.6	37	CCDS7419.1	SNP	28	Baylor																																																																																				0.398	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		Silent
SLX4	84464	hgsc.bcm.edu	37	16	3656512	3656512	+	Silent	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr16:3656512G>C	ENST00000294008.3	-	3	1363	c.723C>G	c.(721-723)gtC>gtG	p.V241V		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	241	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.V241V(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GATCCTTTGGGACATTTTCTT	0.512								Direct reversal of damage																																								1	Substitution - coding silent(1)	ovary(1)	16											238.0	234.0	235.0					16																	3656512		2197	4300	6497	3596513	SO:0001819	synonymous_variant	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.723C>G	16.37:g.3656512G>C		Somatic		Capture	SOLID	Phase_III	3596513	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	37	CCDS10506.2	SNP	41	Baylor																																																																																				0.512	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444		Silent
COL11A2	1302	hgsc.bcm.edu	37	6	33154591	33154591	+	Missense_Mutation	SNP	T	T	A			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr6:33154591T>A	ENST00000374708.4	-	5	869	c.611A>T	c.(610-612)gAt>gTt	p.D204V	COL11A2_ENST00000395197.1_Missense_Mutation_p.D204V|COL11A2_ENST00000357486.1_Missense_Mutation_p.D204V|COL11A2_ENST00000374713.1_Missense_Mutation_p.D204V|COL11A2_ENST00000395194.1_Missense_Mutation_p.D204V|COL11A2_ENST00000374714.1_Missense_Mutation_p.D204V|COL11A2_ENST00000361917.1_Missense_Mutation_p.D204V|COL11A2_ENST00000374712.1_Missense_Mutation_p.D204V|COL11A2_ENST00000341947.2_Missense_Mutation_p.D204V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	204	Laminin G-like.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.D204V(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CTCCTGGACATCACCCTGCAA	0.542																																					Melanoma(1;90 116 3946 5341 17093)											1	Substitution - Missense(1)	ovary(1)	6											123.0	118.0	119.0					6																	33154591		2203	4300	6503	33262569	SO:0001583	missense	1302			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.611A>T	6.37:g.33154591T>A	ENSP00000363840:p.Asp204Val	Somatic		Capture	SOLID	Phase_III	33262569	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	37	CCDS43452.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020485	0.75275	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788;ENST00000395194	T;T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	4.21	4.21	0.49690	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.067864	0.56097	D	0.000035	D	0.82337	0.5015	M	0.69463	2.115	0.80722	D	1	D;D;D;D	0.89917	1.0;0.989;0.989;0.999	D;P;P;D	0.91635	0.999;0.848;0.848;0.998	D	0.84802	0.0785	10	0.87932	D	0	.	11.5471	0.50700	0.0:0.0:0.0:1.0	.	204;204;204;204	Q7Z6C3;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	V	204	ENSP00000363840:D204V;ENSP00000339915:D204V;ENSP00000350079:D204V;ENSP00000363846:D204V;ENSP00000363845:D204V;ENSP00000378623:D204V;ENSP00000363844:D204V;ENSP00000355123:D204V;ENSP00000405520:D204V;ENSP00000378620:D204V	ENSP00000339915:D204V	D	-	2	0	COL11A2	33262569	1.000000	0.71417	0.982000	0.44146	0.819000	0.46315	6.689000	0.74562	1.896000	0.54893	0.363000	0.22086	GAT		0.542	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2			Missense_Mutation
MMS22L	253714	hgsc.bcm.edu	37	6	97730274	97730274	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr6:97730274G>A	ENST00000275053.4	-	2	345	c.80C>T	c.(79-81)cCt>cTt	p.P27L	MMS22L_ENST00000369251.2_Missense_Mutation_p.P27L	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	27					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.P27L(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						AGAAAAGTAAGGAGGTTTGCA	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											108.0	101.0	104.0					6																	97730274		2203	4300	6503	97836995	SO:0001583	missense	253714				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.80C>T	6.37:g.97730274G>A	ENSP00000275053:p.Pro27Leu	Somatic		Capture	SOLID	Phase_III	97836995	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009562	0.75046	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.59772	0.24;0.24	5.97	5.97	0.96955	.	0.193484	0.45126	D	0.000397	T	0.52853	0.1760	M	0.63843	1.955	0.80722	D	1	P;P	0.45827	0.867;0.867	B;B	0.44085	0.44;0.44	T	0.59974	-0.7353	10	0.72032	D	0.01	-3.7714	17.5947	0.88007	0.0:0.0:1.0:0.0	.	27;27	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	L	27	ENSP00000275053:P27L;ENSP00000358254:P27L	ENSP00000275053:P27L	P	-	2	0	MMS22L	97836995	1.000000	0.71417	0.947000	0.38551	0.703000	0.40648	6.105000	0.71505	2.836000	0.97738	0.655000	0.94253	CCT		0.473	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468		Missense_Mutation
CPS1	1373	hgsc.bcm.edu	37	2	211521299	211521299	+	Silent	SNP	G	G	A	rs148237524		TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:211521299G>A	ENST00000233072.5	+	30	3805	c.3609G>A	c.(3607-3609)tcG>tcA	p.S1203S	CPS1_ENST00000451903.2_Silent_p.S752S|CPS1_ENST00000430249.2_Silent_p.S1209S	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1203	ATP-grasp 2.		S -> L (in CPS1D). {ECO:0000269|PubMed:21120950}.|S -> P (in CPS1D). {ECO:0000269|PubMed:16737834}.		anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.S1203S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GTGTCCACTCGGGAGATGCCA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	2						G	,,	1,4405	2.1+/-5.4	0,1,2202	72.0	73.0	73.0		3627,2256,3609	-11.7	0.1	2	dbSNP_134	73	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CPS1	NM_001122633.2,NM_001122634.2,NM_001875.4	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	1209/1507,752/1050,1203/1501	211521299	1,13005	2203	4300	6503	211229544	SO:0001819	synonymous_variant	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3609G>A	2.37:g.211521299G>A		Somatic		Capture	SOLID	Phase_III	211229544	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	CCDS2393.1	SNP	39	Baylor																																																																																				0.418	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			Silent
CTBP2	1488	hgsc.bcm.edu	37	10	126678123	126678123	+	Frame_Shift_Del	DEL	T	T	-	rs140913543		TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr10:126678123delT	ENST00000337195.5	-	11	1701	c.1302delA	c.(1300-1302)aaafs	p.K434fs	CTBP2_ENST00000309035.6_Frame_Shift_Del_p.K974fs|CTBP2_ENST00000494626.2_Frame_Shift_Del_p.K434fs|CTBP2_ENST00000334808.6_Frame_Shift_Del_p.K502fs|CTBP2_ENST00000531469.1_Frame_Shift_Del_p.K434fs|CTBP2_ENST00000411419.2_Frame_Shift_Del_p.K434fs	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	434					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)	p.K974fs*>12(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TGTCCCCGTGTTTTGTGGGCT	0.537																																																1	Deletion - Frameshift(1)	ovary(1)	10											78.0	80.0	79.0					10																	126678123		2203	4300	6503	126668113	SO:0001589	frameshift_variant	1488			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.1302delA	10.37:g.126678123delT	ENSP00000338615:p.Lys434fs	Somatic		Capture	SOLID	Phase_III	126668113	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Frame_Shift_Del	DEL	ENST00000337195.5	37	CCDS7643.1	DEL	60	Baylor																																																																																				0.537	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914		Frame_Shift_Del
CTNND2	1501	hgsc.bcm.edu	37	5	11082865	11082865	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr5:11082865C>T	ENST00000304623.8	-	16	2920	c.2731G>A	c.(2731-2733)Gcg>Acg	p.A911T	CTNND2_ENST00000511377.1_Missense_Mutation_p.A820T|CTNND2_ENST00000503622.1_Missense_Mutation_p.A574T|CTNND2_ENST00000458100.2_Missense_Mutation_p.A478T|CTNND2_ENST00000359640.2_Missense_Mutation_p.A853T|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	911					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GTGGCCACCGCGCACACCACA	0.527																																																0			5											127.0	111.0	116.0					5																	11082865		2203	4300	6503	11135865	SO:0001583	missense	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2731G>A	5.37:g.11082865C>T	ENSP00000307134:p.Ala911Thr	Somatic		Capture	SOLID	Phase_III	11135865	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	35	5.499921	0.96355	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87485	0.6189	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.996;0.996;0.995	D	0.90094	0.4179	10	0.87932	D	0	-14.4219	18.7557	0.91832	0.0:1.0:0.0:0.0	.	574;503;911	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	T	911;853;820;6;478;574	ENSP00000307134:A911T;ENSP00000352661:A853T;ENSP00000426510:A820T;ENSP00000391155:A478T;ENSP00000426887:A574T	ENSP00000307134:A911T	A	-	1	0	CTNND2	11135865	1.000000	0.71417	0.810000	0.32431	0.955000	0.61496	4.817000	0.62650	2.505000	0.84491	0.563000	0.77884	GCG		0.527	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		Missense_Mutation
CYP2C18	1562	hgsc.bcm.edu	37	10	96495161	96495161	+	Missense_Mutation	SNP	G	G	T	rs41286884	byFrequency	TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr10:96495161G>T	ENST00000285979.6	+	9	1632	c.1433G>T	c.(1432-1434)cGt>cTt	p.R478L	CYP2C19_ENST00000464755.1_Intron|CYP2C18_ENST00000339022.5_Missense_Mutation_p.R419L	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	478					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.R478L(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GCATTTGGTCGTGTGCCACCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	10											222.0	201.0	208.0					10																	96495161		2203	4300	6503	96485151	SO:0001583	missense	1562			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.1433G>T	10.37:g.96495161G>T	ENSP00000285979:p.Arg478Leu	Somatic		Capture	SOLID	Phase_III	96485151	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	ENST00000285979.6	37	CCDS7435.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	g	9.154	1.017076	0.19355	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	T;T	0.64438	-0.1;-0.1	3.99	-7.97	0.01139	.	0.633137	0.14342	U	0.325631	T	0.26810	0.0656	N	0.01529	-0.815	0.09310	N	1	B;B	0.15141	0.012;0.007	B;B	0.20384	0.029;0.026	T	0.27054	-1.0085	10	0.66056	D	0.02	.	8.776	0.34762	0.4565:0.3363:0.2072:0.0	.	419;478	Q4VAT5;P33260	.;CP2CI_HUMAN	L	419;478	ENSP00000341293:R419L;ENSP00000285979:R478L	ENSP00000285979:R478L	R	+	2	0	CYP2C18	96485151	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.400000	0.02504	-1.910000	0.01083	-1.279000	0.01387	CGT		0.478	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772		Missense_Mutation
DARS	1615	hgsc.bcm.edu	37	2	136700956	136700956	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:136700956C>T	ENST00000264161.4	-	5	630	c.415G>A	c.(415-417)Gtt>Att	p.V139I	DARS_ENST00000463008.1_5'UTR|DARS_ENST00000537273.1_Missense_Mutation_p.V39I	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	139					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.V139I(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	ACCTTCTGAACATGTAACTCA	0.318																																																1	Substitution - Missense(1)	ovary(1)	2											169.0	164.0	165.0					2																	136700956		2203	4299	6502	136417426	SO:0001583	missense	1615			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.415G>A	2.37:g.136700956C>T	ENSP00000264161:p.Val139Ile	Somatic		Capture	SOLID	Phase_III	136417426	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	37	CCDS2180.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	3.758	-0.050262	0.07407	.	.	ENSG00000115866	ENST00000264161;ENST00000537273;ENST00000441323;ENST00000456565;ENST00000449218	T;T;T;T;T	0.79454	1.78;-1.27;1.78;1.78;1.78	4.9	4.9	0.64082	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.160889	0.56097	D	0.000034	T	0.61022	0.2314	N	0.16708	0.43	0.50632	D	0.999881	B	0.10296	0.003	B	0.17722	0.019	T	0.55062	-0.8199	10	0.16420	T	0.52	-19.071	11.694	0.51532	0.0:0.9178:0.0:0.0822	.	139	P14868	SYDC_HUMAN	I	139;39;106;106;106	ENSP00000264161:V139I;ENSP00000444192:V39I;ENSP00000389867:V106I;ENSP00000397616:V106I;ENSP00000388801:V106I	ENSP00000264161:V139I	V	-	1	0	DARS	136417426	0.997000	0.39634	1.000000	0.80357	0.895000	0.52256	0.790000	0.26900	2.700000	0.92200	0.563000	0.77884	GTT		0.318	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349		Missense_Mutation
DDX54	79039	hgsc.bcm.edu	37	12	113599733	113599733	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr12:113599733G>T	ENST00000306014.5	-	18	2292	c.2265C>A	c.(2263-2265)agC>agA	p.S755R	DDX54_ENST00000314045.7_Missense_Mutation_p.S755R|DDX54_ENST00000549271.1_5'Flank	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	755					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)	p.S755R(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TGTAGCGGCCGCTCTCTGTCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											170.0	151.0	158.0					12																	113599733		2203	4300	6503	112084116	SO:0001583	missense	79039			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.2265C>A	12.37:g.113599733G>T	ENSP00000304072:p.Ser755Arg	Somatic		Capture	SOLID	Phase_III	112084116	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	37	CCDS31907.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344437	0.61073	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.15834	2.41;2.39	4.74	-4.11	0.03928	DBP10CT (2);	0.102503	0.64402	D	0.000004	T	0.43233	0.1238	M	0.90483	3.12	0.50467	D	0.999877	D;D	0.76494	0.999;0.999	D;D	0.85130	0.995;0.997	T	0.54788	-0.8241	10	0.72032	D	0.01	.	14.0485	0.64719	0.4385:0.0:0.5615:0.0	.	755;755	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	R	755	ENSP00000323858:S755R;ENSP00000304072:S755R	ENSP00000304072:S755R	S	-	3	2	DDX54	112084116	0.128000	0.22383	0.974000	0.42286	0.508000	0.34012	-0.377000	0.07456	-0.746000	0.04766	-1.564000	0.00881	AGC		0.592	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072		Missense_Mutation
DOPEY1	23033	hgsc.bcm.edu	37	6	83823129	83823129	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr6:83823129C>A	ENST00000349129.2	+	7	1029	c.769C>A	c.(769-771)Cac>Aac	p.H257N	DOPEY1_ENST00000369739.3_Missense_Mutation_p.H257N|DOPEY1_ENST00000536812.1_3'UTR|DOPEY1_ENST00000237163.5_Missense_Mutation_p.H257N	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	257					protein transport (GO:0015031)			p.H257N(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TTTTCCATTCCACATGAGTCA	0.373																																																1	Substitution - Missense(1)	ovary(1)	6											147.0	128.0	134.0					6																	83823129		2203	4300	6503	83879848	SO:0001583	missense	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.769C>A	6.37:g.83823129C>A	ENSP00000195654:p.His257Asn	Somatic		Capture	SOLID	Phase_III	83879848	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311550	0.81358	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T;T	0.26373	1.79;1.76;1.74	5.81	5.81	0.92471	Dopey, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.36193	0.0958	L	0.41124	1.26	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	T	0.01951	-1.1241	10	0.41790	T	0.15	.	20.0726	0.97729	0.0:1.0:0.0:0.0	.	257;257	B2RWN9;Q5JWR5	.;DOP1_HUMAN	N	257	ENSP00000195654:H257N;ENSP00000237163:H257N;ENSP00000358754:H257N	ENSP00000237163:H257N	H	+	1	0	DOPEY1	83879848	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	5.953000	0.70290	2.738000	0.93877	0.655000	0.94253	CAC		0.373	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018		Missense_Mutation
ERBB2	2064	hgsc.bcm.edu	37	17	37881615	37881615	+	Silent	SNP	C	C	G			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr17:37881615C>G	ENST00000269571.5	+	22	2844	c.2685C>G	c.(2683-2685)ctC>ctG	p.L895L	ERBB2_ENST00000541774.1_Silent_p.L880L|ERBB2_ENST00000445658.2_Silent_p.L619L|ERBB2_ENST00000584450.1_Silent_p.L895L|ERBB2_ENST00000584601.1_Silent_p.L865L|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000406381.2_Silent_p.L865L|ERBB2_ENST00000540147.1_Silent_p.L865L			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	895	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	AGTCCATTCTCCGCCGGCGGT	0.607		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0			17											66.0	66.0	66.0					17																	37881615		2203	4300	6503	35135141	SO:0001819	synonymous_variant	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2685C>G	17.37:g.37881615C>G		Somatic		Capture	SOLID	Phase_III	35135141	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	37	CCDS32642.1	SNP	30	Baylor																																																																																				0.607	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			Silent
F2R	2149	hgsc.bcm.edu	37	5	76028813	76028813	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr5:76028813C>T	ENST00000319211.4	+	2	1028	c.763C>T	c.(763-765)Cat>Tat	p.H255Y		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	255					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.H255Y(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	CACTACCTGTCATGATGTGCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											125.0	128.0	127.0					5																	76028813		2203	4300	6503	76064569	SO:0001583	missense	2149			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.763C>T	5.37:g.76028813C>T	ENSP00000321326:p.His255Tyr	Somatic		Capture	SOLID	Phase_III	76064569	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	ENST00000319211.4	37	CCDS4032.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.65	3.183557	0.57800	.	.	ENSG00000181104	ENST00000319211	T	0.36340	1.26	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	L	0.53617	1.68	0.80722	D	1	P	0.39181	0.663	B	0.38378	0.272	T	0.14172	-1.0482	10	0.45353	T	0.12	-30.0502	12.9278	0.58270	0.0:0.9219:0.0:0.0781	.	255	P25116	PAR1_HUMAN	Y	255	ENSP00000321326:H255Y	ENSP00000321326:H255Y	H	+	1	0	F2R	76064569	1.000000	0.71417	0.968000	0.41197	0.992000	0.81027	4.694000	0.61760	2.676000	0.91093	0.561000	0.74099	CAT		0.532	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2			Missense_Mutation
F2R	2149	hgsc.bcm.edu	37	5	76028929	76028929	+	Silent	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr5:76028929C>T	ENST00000319211.4	+	2	1144	c.879C>T	c.(877-879)atC>atT	p.I293I		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	293					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.I293I(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	ATGTGTCTATCATTCGATGTC	0.483																																																1	Substitution - coding silent(1)	ovary(1)	5											153.0	153.0	153.0					5																	76028929		2203	4300	6503	76064685	SO:0001819	synonymous_variant	2149			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.879C>T	5.37:g.76028929C>T		Somatic		Capture	SOLID	Phase_III	76064685	Q53XV0|Q96RF7|Q9BUN4	Silent	SNP	ENST00000319211.4	37	CCDS4032.1	SNP	29	Baylor																																																																																				0.483	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2			Silent
F2R	2149	hgsc.bcm.edu	37	5	76029177	76029177	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr5:76029177C>T	ENST00000319211.4	+	2	1392	c.1127C>T	c.(1126-1128)tCt>tTt	p.S376F		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	376					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.S376F(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TACGCTTCCTCTGAGTGCCAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											121.0	117.0	119.0					5																	76029177		2203	4300	6503	76064933	SO:0001583	missense	2149			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.1127C>T	5.37:g.76029177C>T	ENSP00000321326:p.Ser376Phe	Somatic		Capture	SOLID	Phase_III	76064933	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	ENST00000319211.4	37	CCDS4032.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.80	3.221956	0.58560	.	.	ENSG00000181104	ENST00000319211	T	0.39787	1.06	4.92	3.09	0.35607	.	0.054794	0.85682	D	0.000000	T	0.59115	0.2170	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59920	-0.7363	10	0.66056	D	0.02	-22.8745	10.4039	0.44246	0.0:0.7911:0.1354:0.0734	.	376	P25116	PAR1_HUMAN	F	376	ENSP00000321326:S376F	ENSP00000321326:S376F	S	+	2	0	F2R	76064933	1.000000	0.71417	0.600000	0.28864	0.638000	0.38207	5.776000	0.68924	0.743000	0.32719	0.561000	0.74099	TCT		0.483	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2			Missense_Mutation
FAM171B	165215	hgsc.bcm.edu	37	2	187626639	187626639	+	Missense_Mutation	SNP	C	C	A	rs145285890	byFrequency	TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:187626639C>A	ENST00000304698.5	+	8	1773	c.1570C>A	c.(1570-1572)Cgt>Agt	p.R524S		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	524						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.R524S(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GGCGTATGGGCGTTCCCATAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	85.0	88.0					2																	187626639		2203	4300	6503	187334884	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1570C>A	2.37:g.187626639C>A	ENSP00000304108:p.Arg524Ser	Somatic		Capture	SOLID	Phase_III	187334884	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.128	-1.116691	0.01799	.	.	ENSG00000144369	ENST00000304698	T	0.40476	1.03	5.79	4.91	0.64330	.	0.601209	0.19035	N	0.124449	T	0.20414	0.0491	N	0.08118	0	0.23132	N	0.998248	B;B	0.15930	0.015;0.015	B;B	0.19666	0.026;0.026	T	0.23440	-1.0188	10	0.08837	T	0.75	2.0E-4	8.8081	0.34950	0.1488:0.7762:0.0:0.075	.	524;525	Q6P995;A8K122	F171B_HUMAN;.	S	524	ENSP00000304108:R524S	ENSP00000304108:R524S	R	+	1	0	FAM171B	187334884	0.888000	0.30383	0.546000	0.28166	0.620000	0.37586	2.077000	0.41557	1.431000	0.47355	0.655000	0.94253	CGT		0.418	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		Missense_Mutation
FGFR2	2263	hgsc.bcm.edu	37	10	123276864	123276864	+	Silent	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr10:123276864G>C	ENST00000358487.5	-	8	1325	c.1053C>G	c.(1051-1053)tcC>tcG	p.S351S	FGFR2_ENST00000346997.2_Silent_p.S351S|FGFR2_ENST00000478859.1_Silent_p.S123S|FGFR2_ENST00000356226.4_Silent_p.S236S|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000369059.1_Intron|FGFR2_ENST00000369056.1_Intron|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000351936.6_Silent_p.S351S|FGFR2_ENST00000360144.3_Intron|FGFR2_ENST00000357555.5_Silent_p.S262S|FGFR2_ENST00000369060.4_Intron|FGFR2_ENST00000457416.2_Intron	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	351	Ig-like C2-type 3.		S -> C (in CS, PS and ABS2). {ECO:0000269|PubMed:10633130, ECO:0000269|PubMed:8946174, ECO:0000269|PubMed:9693549}.		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.S351S(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CAGAGTGAAAGGATATCCCAA	0.418		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																														Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	1	Substitution - coding silent(1)	ovary(1)	10											127.0	114.0	118.0					10																	123276864		2203	4300	6503	123266854	SO:0001819	synonymous_variant	2263	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1053C>G	10.37:g.123276864G>C		Somatic		Capture	SOLID	Phase_III	123266854	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	ENST00000358487.5	37	CCDS31298.1	SNP	35	Baylor																																																																																				0.418	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141		Silent
GALNT3	2591	hgsc.bcm.edu	37	2	166626717	166626717	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:166626717C>A	ENST00000392701.3	-	2	1269	c.494G>T	c.(493-495)gGa>gTa	p.G165V		NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	165					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.G165V(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						AGTGTCTGGTCCAAGATCTCG	0.423																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	105.0	109.0					2																	166626717		2203	4300	6503	166334963	SO:0001583	missense	2591				CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.494G>T	2.37:g.166626717C>A	ENSP00000376465:p.Gly165Val	Somatic		Capture	SOLID	Phase_III	166334963	Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	37	CCDS2226.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695651	0.88830	.	.	ENSG00000115339	ENST00000392701;ENST00000412248	T;T	0.60920	0.45;0.15	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.77638	0.4160	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76862	-0.2802	10	0.51188	T	0.08	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	165;165	Q14435;Q14435-2	GALT3_HUMAN;.	V	165	ENSP00000376465:G165V;ENSP00000412643:G165V	ENSP00000376465:G165V	G	-	2	0	GALNT3	166334963	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.666000	0.83877	2.736000	0.93811	0.655000	0.94253	GGA		0.423	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482		Missense_Mutation
GTPBP1	9567	hgsc.bcm.edu	37	22	39112841	39112841	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr22:39112841G>C	ENST00000216044.5	+	4	903	c.670G>C	c.(670-672)Gta>Cta	p.V224L		NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	224	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.V224L(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					TGAAGGCAATGTAGTGAACAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	22											128.0	107.0	114.0					22																	39112841		2203	4300	6503	37442787	SO:0001583	missense	9567			U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.670G>C	22.37:g.39112841G>C	ENSP00000216044:p.Val224Leu	Somatic		Capture	SOLID	Phase_III	37442787	Q6IC67	Missense_Mutation	SNP	ENST00000216044.5	37	CCDS13977.2	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504023	0.64410	.	.	ENSG00000100226	ENST00000216044;ENST00000484657	T;T	0.48836	1.35;0.8	4.92	4.92	0.64577	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.54902	0.1887	M	0.74389	2.26	0.80722	D	1	B	0.28350	0.208	B	0.34385	0.181	T	0.58070	-0.7701	10	0.48119	T	0.1	.	18.1025	0.89510	0.0:0.0:1.0:0.0	.	224	O00178	GTPB1_HUMAN	L	224;143	ENSP00000216044:V224L;ENSP00000442881:V143L	ENSP00000216044:V224L	V	+	1	0	GTPBP1	37442787	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.814000	0.99346	2.251000	0.74343	0.448000	0.29417	GTA		0.522	GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075532.1	NM_004286		Missense_Mutation
HSPG2	3339	hgsc.bcm.edu	37	1	22169322	22169322	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr1:22169322G>C	ENST00000374695.3	-	67	8930	c.8851C>G	c.(8851-8853)Cag>Gag	p.Q2951E		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2951	Ig-like C2-type 15.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.Q2951E(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCATGGGCCTGCCCGGGCACC	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	64.0	64.0					1																	22169322		2203	4300	6503	22041909	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8851C>G	1.37:g.22169322G>C	ENSP00000363827:p.Gln2951Glu	Somatic		Capture	SOLID	Phase_III	22041909	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390382	0.42410	.	.	ENSG00000142798	ENST00000374695	T	0.11930	2.73	4.92	4.92	0.64577	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.36002	N	0.002850	T	0.22126	0.0533	L	0.35249	1.045	0.28923	N	0.892033	D;D	0.65815	0.995;0.981	D;D	0.79108	0.992;0.91	T	0.05903	-1.0857	10	0.05351	T	0.99	.	15.6188	0.76790	0.0:0.0:1.0:0.0	.	891;2951	Q59EG0;P98160	.;PGBM_HUMAN	E	2951	ENSP00000363827:Q2951E	ENSP00000363827:Q2951E	Q	-	1	0	HSPG2	22041909	0.688000	0.27680	1.000000	0.80357	0.969000	0.65631	2.970000	0.49240	2.268000	0.75426	0.462000	0.41574	CAG		0.662	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		Missense_Mutation
IGFBP6	3489	hgsc.bcm.edu	37	12	53494924	53494924	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr12:53494924G>T	ENST00000301464.3	+	3	853	c.580G>T	c.(580-582)Ggc>Tgc	p.G194C	SOAT2_ENST00000301466.3_5'Flank|IGFBP6_ENST00000548547.1_Missense_Mutation_p.G192C|IGFBP6_ENST00000549628.1_3'UTR	NM_002178.2	NP_002169.1	P24592	IBP6_HUMAN	insulin-like growth factor binding protein 6	194	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)		p.G194C(1)		large_intestine(1)|lung(3)|ovary(1)|pancreas(1)	6						TGACCATCGAGGCTTCTACCG	0.582																																					Esophageal Squamous(83;1656 1718 30141 34380)											1	Substitution - Missense(1)	ovary(1)	12											114.0	106.0	109.0					12																	53494924		2203	4300	6503	51781191	SO:0001583	missense	3489				CCDS8846.1	12q13	2008-07-28				ENSG00000167779			5475	protein-coding gene	gene with protein product		146735				1850258, 10087296	Standard	NM_002178		Approved		uc001sbu.1	P24592	OTTHUMG00000169773	ENST00000301464.3:c.580G>T	12.37:g.53494924G>T	ENSP00000301464:p.Gly194Cys	Somatic		Capture	SOLID	Phase_III	51781191	Q14492	Missense_Mutation	SNP	ENST00000301464.3	37	CCDS8846.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076465	0.76415	.	.	ENSG00000167779	ENST00000548547;ENST00000301464	D;D	0.94758	-3.51;-3.51	4.43	4.43	0.53597	Thyroglobulin type-1 (6);	0.055927	0.64402	D	0.000001	D	0.97782	0.9272	H	0.94620	3.56	0.51767	D	0.99993	D	0.89917	1.0	D	0.83275	0.996	D	0.97922	1.0315	10	0.87932	D	0	-14.8638	12.8581	0.57897	0.0:0.0:1.0:0.0	.	194	P24592	IBP6_HUMAN	C	192;194	ENSP00000448953:G192C;ENSP00000301464:G194C	ENSP00000301464:G194C	G	+	1	0	IGFBP6	51781191	1.000000	0.71417	0.972000	0.41901	0.937000	0.57800	5.519000	0.67074	2.761000	0.94854	0.655000	0.94253	GGC		0.582	IGFBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405813.1			Missense_Mutation
ITIH4	3700	hgsc.bcm.edu	37	3	52852496	52852496	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:52852496T>C	ENST00000266041.4	-	18	2230	c.2134A>G	c.(2134-2136)Atg>Gtg	p.M712V	ITIH4_ENST00000467462.1_5'Flank|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000406595.1_Missense_Mutation_p.M682V|ITIH4_ENST00000346281.5_Missense_Mutation_p.M682V|ITIH4_ENST00000485816.1_Missense_Mutation_p.M717V	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	712					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.M712V(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TTCATATTCATGACACGAGAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											59.0	54.0	56.0					3																	52852496		2202	4298	6500	52827536	SO:0001583	missense	3700			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2134A>G	3.37:g.52852496T>C	ENSP00000266041:p.Met712Val	Somatic		Capture	SOLID	Phase_III	52827536	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	37	CCDS2865.1	SNP	51	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.072|0.072	-1.200623|-1.200623	0.01581|0.01581	.|.	.|.	ENSG00000055955|ENSG00000055955	ENST00000441637|ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421	.|T;T;T;T	.|0.01406	.|4.98;4.95;4.98;4.93	3.3|3.3	-6.61|-6.61	0.01818|0.01818	.|.	.|.	.|.	.|.	.|.	T|T	0.00815|0.00815	0.0027|0.0027	N|N	0.15975|0.15975	0.35|0.35	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.01281	.|0.0;0.0;0.0;0.0	T|T	0.46871|0.46871	-0.9160|-0.9160	5|9	.|0.06099	.|T	.|0.92	3.4932|3.4932	10.3223|10.3223	0.43773|0.43773	0.0:0.5558:0.3116:0.1326|0.0:0.5558:0.3116:0.1326	.|.	.|682;717;712;682	.|E9PGN5;B7ZKJ8;Q14624;Q14624-2	.|.;.;ITIH4_HUMAN;.	R|V	539|712;682;717;682;670	.|ENSP00000266041:M712V;ENSP00000340520:M682V;ENSP00000417824:M717V;ENSP00000384425:M682V	.|ENSP00000266041:M712V	H|M	-|-	2|1	0|0	ITIH4|ITIH4	52827536|52827536	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-3.797000|-3.797000	0.00364|0.00364	-2.980000|-2.980000	0.00283|0.00283	-0.408000|-0.408000	0.06270|0.06270	CAT|ATG		0.552	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218		Missense_Mutation
IMPG2	50939	hgsc.bcm.edu	37	3	101038444	101038444	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:101038444C>G	ENST00000193391.7	-	2	505	c.318G>C	c.(316-318)aaG>aaC	p.K106N		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	106					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.K106N(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CTTTAAAATACTTCACATGAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											141.0	137.0	139.0					3																	101038444		2203	4300	6503	102521134	SO:0001583	missense	50939			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.318G>C	3.37:g.101038444C>G	ENSP00000193391:p.Lys106Asn	Somatic		Capture	SOLID	Phase_III	102521134	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296463	0.40594	.	.	ENSG00000081148	ENST00000193391	T	0.76316	-1.01	5.52	-3.64	0.04515	.	0.131864	0.51477	N	0.000082	T	0.62441	0.2428	L	0.49126	1.545	0.30170	N	0.801336	B	0.20887	0.049	B	0.17433	0.018	T	0.51505	-0.8697	10	0.62326	D	0.03	-6.9647	3.1224	0.06396	0.1085:0.3172:0.1085:0.4658	.	106	Q9BZV3	IMPG2_HUMAN	N	106	ENSP00000193391:K106N	ENSP00000193391:K106N	K	-	3	2	IMPG2	102521134	0.316000	0.24580	0.992000	0.48379	0.662000	0.39071	-0.715000	0.04997	-0.282000	0.09128	-1.114000	0.02060	AAG		0.373	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			Missense_Mutation
KDM3B	51780	hgsc.bcm.edu	37	5	137761109	137761109	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr5:137761109G>C	ENST00000314358.5	+	17	4449	c.4249G>C	c.(4249-4251)Gtt>Ctt	p.V1417L	KDM3B_ENST00000542866.1_Missense_Mutation_p.V449L|KDM3B_ENST00000394866.1_Missense_Mutation_p.V1073L	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1417					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.V1417L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GCCAGTGCTGGTTTCGGGGGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											54.0	55.0	55.0					5																	137761109		2203	4300	6503	137789008	SO:0001583	missense	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4249G>C	5.37:g.137761109G>C	ENSP00000326563:p.Val1417Leu	Somatic		Capture	SOLID	Phase_III	137789008	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.195754	0.94960	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.70164	-0.46;-0.46;-0.46	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.81749	0.4888	M	0.73217	2.22	0.80722	D	1	D;D	0.61697	0.99;0.973	D;P	0.75484	0.986;0.841	D	0.83900	0.0289	10	0.87932	D	0	-20.911	18.6718	0.91514	0.0:0.0:1.0:0.0	.	1073;1417	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	L	1417;1207;1073;449	ENSP00000326563:V1417L;ENSP00000378335:V1073L;ENSP00000439462:V449L	ENSP00000326563:V1417L	V	+	1	0	KDM3B	137789008	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.403000	0.81681	0.563000	0.77884	GTT		0.483	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604		Missense_Mutation
KRT85	3891	hgsc.bcm.edu	37	12	52761140	52761141	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-36-1578-01	TCGA-36-1578-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr12:52761140_52761141delTT	ENST00000257901.3	-	1	124_125	c.49_50delAA	c.(49-51)aacfs	p.N17fs	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	17	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.N17fs*195(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGAGCTGAAGTTCCTGGTGACC	0.658																																																1	Deletion - Frameshift(1)	ovary(1)	12																																								51047408	SO:0001589	frameshift_variant	3891			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.49_50delAA	12.37:g.52761140_52761141delTT	ENSP00000257901:p.Asn17fs	Somatic		Capture	SOLID	Phase_III	51047407	Q9NSB1	Frame_Shift_Del	DEL	ENST00000257901.3	37	CCDS8824.1	DEL	60	Baylor																																																																																				0.658	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283		Frame_Shift_Del
LRRC1	55227	hgsc.bcm.edu	37	6	53660122	53660122	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr6:53660122C>A	ENST00000370888.1	+	1	345	c.68C>A	c.(67-69)tCg>tAg	p.S23*	RP13-476E20.1_ENST00000429053.1_RNA|LRRC1_ENST00000370882.1_Nonsense_Mutation_p.S23*	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	23						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.S23*(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CGCCACTGCTCGCTGGTCTAC	0.682																																																1	Substitution - Nonsense(1)	ovary(1)	6											47.0	41.0	43.0					6																	53660122		2203	4300	6503	53768081	SO:0001587	stop_gained	55227			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.68C>A	6.37:g.53660122C>A	ENSP00000359925:p.Ser23*	Somatic		Capture	SOLID	Phase_III	53768081	Q5TGN3|Q9HAC0|Q9NVF1	Nonsense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	44	11.040790	0.99507	.	.	ENSG00000137269	ENST00000370888;ENST00000370882	.	.	.	4.76	4.76	0.60689	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3331	0.83050	0.0:1.0:0.0:0.0	.	.	.	.	X	23	.	ENSP00000359919:S23X	S	+	2	0	LRRC1	53768081	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.819000	0.75262	2.158000	0.67659	0.563000	0.77884	TCG		0.682	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168		Nonsense_Mutation
MYOZ1	58529	hgsc.bcm.edu	37	10	75394423	75394423	+	Nonsense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr10:75394423G>C	ENST00000359322.4	-	4	685	c.321C>G	c.(319-321)taC>taG	p.Y107*		NM_021245.3	NP_067068.1			myozenin 1									p.Y107*(1)		central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					TGCTCTTGCTGTATGAGAATC	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	10											66.0	63.0	64.0					10																	75394423		2203	4300	6503	75064429	SO:0001587	stop_gained	58529			AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.321C>G	10.37:g.75394423G>C	ENSP00000352272:p.Tyr107*	Somatic		Capture	SOLID	Phase_III	75064429		Nonsense_Mutation	SNP	ENST00000359322.4	37	CCDS7330.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	35	5.588430	0.96590	.	.	ENSG00000177791	ENST00000359322	.	.	.	6.05	2.21	0.28008	.	0.385351	0.27495	N	0.019107	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.1279	7.6067	0.28105	0.4847:0.0:0.5153:0.0	.	.	.	.	X	107	.	ENSP00000352272:Y107X	Y	-	3	2	MYOZ1	75064429	0.828000	0.29307	0.994000	0.49952	0.915000	0.54546	-0.282000	0.08445	0.638000	0.30545	0.655000	0.94253	TAC		0.582	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048654.1			Nonsense_Mutation
NCF4	4689	hgsc.bcm.edu	37	22	37263466	37263466	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr22:37263466G>A	ENST00000248899.6	+	4	488	c.304G>A	c.(304-306)Gcc>Acc	p.A102T	CTA-833B7.2_ENST00000330602.2_RNA|CTA-833B7.2_ENST00000431290.1_RNA|NCF4_ENST00000397147.4_Missense_Mutation_p.A102T	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	102	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)	p.A102T(1)		cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	ACAGGAGATCGCCGAGATGCG	0.607																																																1	Substitution - Missense(1)	ovary(1)	22											105.0	73.0	84.0					22																	37263466		2203	4300	6503	35593412	SO:0001583	missense	4689			X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.304G>A	22.37:g.37263466G>A	ENSP00000248899:p.Ala102Thr	Somatic		Capture	SOLID	Phase_III	35593412	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	ENST00000248899.6	37	CCDS13934.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488259	0.84854	.	.	ENSG00000100365	ENST00000248899;ENST00000397147	T;T	0.40476	1.03;1.03	4.64	4.64	0.57946	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.61502	0.2352	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.63677	-0.6583	10	0.51188	T	0.08	-23.2504	17.0944	0.86631	0.0:0.0:1.0:0.0	.	102;102	A8K4F9;Q15080	.;NCF4_HUMAN	T	102	ENSP00000248899:A102T;ENSP00000380334:A102T	ENSP00000248899:A102T	A	+	1	0	NCF4	35593412	1.000000	0.71417	0.584000	0.28653	0.932000	0.56968	7.929000	0.87595	2.125000	0.65367	0.650000	0.86243	GCC		0.607	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631		Missense_Mutation
NDC80	10403	hgsc.bcm.edu	37	18	2616527	2616527	+	Frame_Shift_Del	DEL	A	A	-			TCGA-36-1578-01	TCGA-36-1578-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr18:2616527delA	ENST00000261597.4	+	17	2065	c.1883delA	c.(1882-1884)gatfs	p.D628fs		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	628	Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.D628fs*9(1)		NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GAGATTAGAGATAAGTATGAG	0.308																																																1	Deletion - Frameshift(1)	ovary(1)	18											39.0	42.0	41.0					18																	2616527		2198	4280	6478	2606527	SO:0001589	frameshift_variant	10403			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1883delA	18.37:g.2616527delA	ENSP00000261597:p.Asp628fs	Somatic		Capture	SOLID	Phase_III	2606527	Q6PJX2	Frame_Shift_Del	DEL	ENST00000261597.4	37	CCDS11827.1	DEL	12	Baylor																																																																																				0.308	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101		Frame_Shift_Del
OR6A2	8590	hgsc.bcm.edu	37	11	6816927	6816927	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr11:6816927T>C	ENST00000332601.3	-	1	201	c.13A>G	c.(13-15)Aac>Gac	p.N5D		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	5					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N5D(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCACTATGGTTCCGCCACTCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	11											84.0	71.0	75.0					11																	6816927		2201	4296	6497	6773503	SO:0001583	missense	8590			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.13A>G	11.37:g.6816927T>C	ENSP00000330384:p.Asn5Asp	Somatic		Capture	SOLID	Phase_III	6773503	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.48	1.361509	0.24684	.	.	ENSG00000184933	ENST00000332601	T	0.63417	-0.04	4.54	4.54	0.55810	.	0.525500	0.17758	N	0.163005	T	0.69797	0.3151	M	0.92268	3.29	0.31033	N	0.717234	B	0.10296	0.003	B	0.10450	0.005	T	0.71632	-0.4534	10	0.45353	T	0.12	.	12.1445	0.54016	0.0:0.0:0.0:1.0	.	5	O95222	OR6A2_HUMAN	D	5	ENSP00000330384:N5D	ENSP00000330384:N5D	N	-	1	0	OR6A2	6773503	0.997000	0.39634	0.709000	0.30452	0.041000	0.13682	3.330000	0.52068	2.042000	0.60477	0.482000	0.46254	AAC		0.502	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696		Missense_Mutation
OR8K5	219453	hgsc.bcm.edu	37	11	55927095	55927095	+	Silent	SNP	G	G	T			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr11:55927095G>T	ENST00000313447.1	-	1	698	c.699C>A	c.(697-699)ggC>ggA	p.G233G		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G233G(1)		large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CCTTTTTCCTGCCCTCTGCAG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	11											79.0	76.0	77.0					11																	55927095		2201	4296	6497	55683671	SO:0001819	synonymous_variant	219453			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.699C>A	11.37:g.55927095G>T		Somatic		Capture	SOLID	Phase_III	55683671	Q6IFB5	Silent	SNP	ENST00000313447.1	37	CCDS31521.1	SNP	46	Baylor																																																																																				0.403	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		Silent
OSBPL11	114885	hgsc.bcm.edu	37	3	125271292	125271292	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:125271292T>C	ENST00000296220.5	-	9	1676	c.1387A>G	c.(1387-1389)Atg>Gtg	p.M463V		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	463					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.M463V(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						CTTTTTGGCATCTTCCAGGAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											109.0	99.0	102.0					3																	125271292		2203	4300	6503	126753982	SO:0001583	missense	114885			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.1387A>G	3.37:g.125271292T>C	ENSP00000296220:p.Met463Val	Somatic		Capture	SOLID	Phase_III	126753982	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.350	-0.945368	0.02304	.	.	ENSG00000144909	ENST00000296220	T	0.27557	1.66	4.74	1.03	0.20045	.	0.293069	0.39759	N	0.001266	T	0.03477	0.0100	N	0.00036	-2.54	0.39674	D	0.970792	B	0.02656	0.0	B	0.01281	0.0	T	0.37430	-0.9706	10	0.02654	T	1	-21.0904	4.7671	0.13137	0.0:0.2324:0.1507:0.6169	.	463	Q9BXB4	OSB11_HUMAN	V	463	ENSP00000296220:M463V	ENSP00000296220:M463V	M	-	1	0	OSBPL11	126753982	0.292000	0.24362	0.916000	0.36221	0.954000	0.61252	0.339000	0.19875	0.033000	0.15463	0.482000	0.46254	ATG		0.458	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776		Missense_Mutation
PAX3	5077	hgsc.bcm.edu	37	2	223084971	223084971	+	Missense_Mutation	SNP	T	T	A			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:223084971T>A	ENST00000350526.4	-	7	1197	c.1061A>T	c.(1060-1062)tAc>tTc	p.Y354F	PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000344493.4_Missense_Mutation_p.Y354F|PAX3_ENST00000392069.2_Missense_Mutation_p.Y354F|PAX3_ENST00000392070.2_Missense_Mutation_p.Y354F|PAX3_ENST00000409551.3_Missense_Mutation_p.Y353F|PAX3_ENST00000336840.6_Missense_Mutation_p.Y354F	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	354					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y354F(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGAGGCAGTAGGCAGAGCT	0.577			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																																Dom	yes		2	2q35	5077	paired box gene 3	yes	M	1	Substitution - Missense(1)	ovary(1)	2											220.0	184.0	196.0					2																	223084971		2203	4300	6503	222793215	SO:0001583	missense	5077				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1061A>T	2.37:g.223084971T>A	ENSP00000343052:p.Tyr354Phe	Somatic		Capture	SOLID	Phase_III	222793215	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.3	4.725203	0.89298	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551;ENST00000464706;ENST00000555548	D;D;D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08;-3.08;-3.08	5.68	5.68	0.88126	.	0.926544	0.09373	N	0.811040	D	0.94853	0.8337	L	0.55743	1.74	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.998;1.0;0.998	D;D;D;D;D	0.91635	0.996;0.996;0.994;0.999;0.994	D	0.89387	0.3686	10	0.13853	T	0.58	.	15.9325	0.79675	0.0:0.0:0.0:1.0	.	354;353;354;354;354	P23760;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.	F	354;354;354;354;354;353;71;71	ENSP00000375921:Y354F;ENSP00000342092:Y354F;ENSP00000343052:Y354F;ENSP00000375922:Y354F;ENSP00000338767:Y354F;ENSP00000386750:Y353F	ENSP00000338767:Y354F	Y	-	2	0	PAX3	222793215	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.169000	0.68431	0.528000	0.53228	TAC		0.577	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			Missense_Mutation
PAX6	5080	hgsc.bcm.edu	37	11	31822359	31822359	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr11:31822359G>C	ENST00000379132.3	-	6	683	c.403C>G	c.(403-405)Caa>Gaa	p.Q135E	PAX6_ENST00000533156.1_5'Flank|PAX6_ENST00000379111.2_Missense_Mutation_p.Q135E|PAX6_ENST00000379123.5_Missense_Mutation_p.Q135E|PAX6_ENST00000379115.4_Missense_Mutation_p.Q149E|PAX6_ENST00000379129.2_Missense_Mutation_p.Q149E|PAX6_ENST00000419022.1_Missense_Mutation_p.Q149E|PAX6_ENST00000379107.2_Missense_Mutation_p.Q149E|PAX6_ENST00000241001.8_Missense_Mutation_p.Q135E			P26367	PAX6_HUMAN	paired box 6	135	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.Q149E(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					CCCATCTGTTGCTTTTCGCTA	0.502									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																							1	Substitution - Missense(1)	ovary(1)	11	GRCh37	CM981470	PAX6	M							138.0	116.0	124.0					11																	31822359		2202	4299	6501	31778935	SO:0001583	missense	5080	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.403C>G	11.37:g.31822359G>C	ENSP00000368427:p.Gln135Glu	Somatic		Capture	SOLID	Phase_III	31778935	Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	CCDS31451.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.958	0.969896	0.18659	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000379107;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000379109;ENST00000533333;ENST00000455099	D;D;D;D;D;D;D;D;D;D;D	0.98792	-3.15;-3.18;-3.15;-3.15;-3.18;-3.15;-3.18;-3.18;-3.18;-2.89;-5.14	4.35	4.35	0.52113	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.349556	0.31624	N	0.007330	D	0.94640	0.8272	N	0.11789	0.175	0.80722	D	1	B;B	0.15473	0.013;0.0	B;B	0.13407	0.009;0.0	D	0.92445	0.5965	10	0.07175	T	0.84	.	16.845	0.85978	0.0:0.0:1.0:0.0	.	149;135	F1T0F8;P26367	.;PAX6_HUMAN	E	149;135;149;149;135;149;135;135;135;90;82	ENSP00000404100:Q149E;ENSP00000368427:Q135E;ENSP00000368424:Q149E;ENSP00000368401:Q149E;ENSP00000241001:Q135E;ENSP00000368410:Q149E;ENSP00000368406:Q135E;ENSP00000368418:Q135E;ENSP00000368403:Q135E;ENSP00000451372:Q90E;ENSP00000397384:Q82E	ENSP00000241001:Q135E	Q	-	1	0	PAX6	31778935	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.219000	0.95173	2.130000	0.65690	0.561000	0.74099	CAA		0.502	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604		Missense_Mutation
PRICKLE1	144165	hgsc.bcm.edu	37	12	42858376	42858376	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr12:42858376C>G	ENST00000455697.1	-	7	1745	c.1460G>C	c.(1459-1461)aGc>aCc	p.S487T	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.S487T|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.S487T|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.S487T|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.S487T	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	487					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S487T(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GCCTGGGTGGCTGCCATAAGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	12											58.0	56.0	57.0					12																	42858376		2203	4300	6503	41144643	SO:0001583	missense	144165			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1460G>C	12.37:g.42858376C>G	ENSP00000401060:p.Ser487Thr	Somatic		Capture	SOLID	Phase_III	41144643	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157586	0.78114	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02	5.76	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.62744	0.2453	N	0.19112	0.55	0.80722	D	1	D	0.62365	0.991	P	0.57846	0.828	T	0.68610	-0.5363	10	0.72032	D	0.01	-1.4014	14.9681	0.71210	0.0:0.9316:0.0:0.0684	.	487	Q96MT3	PRIC1_HUMAN	T	487	ENSP00000401060:S487T;ENSP00000398947:S487T;ENSP00000448359:S487T;ENSP00000345064:S487T;ENSP00000449819:S487T	ENSP00000345064:S487T	S	-	2	0	PRICKLE1	41144643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	1.574000	0.49760	0.650000	0.86243	AGC		0.468	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1			Missense_Mutation
RAB27A	5873	hgsc.bcm.edu	37	15	55527082	55527082	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr15:55527082G>T	ENST00000396307.2	-	2	302	c.51C>A	c.(49-51)gaC>gaA	p.D17E	RAB27A_ENST00000569493.1_Missense_Mutation_p.D17E|RAB27A_ENST00000564609.1_Missense_Mutation_p.D17E|RAB27A_ENST00000336787.1_Missense_Mutation_p.D17E	NM_004580.4	NP_004571.2	P51159	RB27A_HUMAN	RAB27A, member RAS oncogene family	17					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cytotoxic T cell degranulation (GO:0043316)|exocytosis (GO:0006887)|exosomal secretion (GO:1990182)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|multivesicular body organization (GO:0036257)|multivesicular body sorting pathway (GO:0071985)|natural killer cell degranulation (GO:0043320)|positive regulation of exocytosis (GO:0045921)|positive regulation of gene expression (GO:0010628)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle transport (GO:0048489)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|photoreceptor outer segment (GO:0001750)|secretory granule membrane (GO:0030667)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)|skin(1)	9				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		CTACACCAGAGTCTCCCAAAG	0.343																																																0			15											83.0	82.0	82.0					15																	55527082		2193	4292	6485	53314374	SO:0001583	missense	5873			U38654	CCDS10153.1	15q15-q21.1	2014-09-17			ENSG00000069974	ENSG00000069974		"""RAB, member RAS oncogene"""	9766	protein-coding gene	gene with protein product		603868				7592656	Standard	NM_183235		Approved	RAB27, RAM, GS2, HsT18676	uc002acq.3	P51159	OTTHUMG00000131959	ENST00000396307.2:c.51C>A	15.37:g.55527082G>T	ENSP00000379601:p.Asp17Glu	Somatic		Capture	SOLID	Phase_III	53314374	O00195|Q6FI40|Q9UIR9|Q9Y5U3	Missense_Mutation	SNP	ENST00000396307.2	37	CCDS10153.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873403	0.72180	.	.	ENSG00000069974	ENST00000396307;ENST00000396304;ENST00000336787	T;T	0.79141	-1.24;-1.24	5.61	2.72	0.32119	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.80210	0.4581	L	0.35644	1.08	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.78445	-0.2201	10	0.87932	D	0	1.4811	8.8607	0.35256	0.366:0.0:0.634:0.0	.	17	P51159	RB27A_HUMAN	E	17	ENSP00000379601:D17E;ENSP00000337761:D17E	ENSP00000337761:D17E	D	-	3	2	RAB27A	53314374	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.599000	0.36751	0.321000	0.23259	0.650000	0.86243	GAC		0.343	RAB27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254918.1	NM_004580, NM_183236		Missense_Mutation
RASGRF2	5924	hgsc.bcm.edu	37	5	80409565	80409565	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr5:80409565C>G	ENST00000265080.4	+	15	2363	c.2296C>G	c.(2296-2298)Ccc>Gcc	p.P766A	CTD-2193P3.2_ENST00000508993.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	766					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P766A(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TTCCAGCAGTCCCACCACCAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	5											96.0	95.0	95.0					5																	80409565		2203	4300	6503	80445321	SO:0001583	missense	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2296C>G	5.37:g.80409565C>G	ENSP00000265080:p.Pro766Ala	Somatic		Capture	SOLID	Phase_III	80445321	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.42	1.633838	0.29068	.	.	ENSG00000113319	ENST00000265080	T	0.74209	-0.82	5.31	5.31	0.75309	Ras guanine nucleotide exchange factor, domain (1);	1.744180	0.02751	N	0.117475	T	0.56630	0.1998	N	0.00677	-1.265	0.32874	D	0.509635	P	0.49783	0.928	P	0.45610	0.487	T	0.64136	-0.6478	10	0.13108	T	0.6	.	18.6673	0.91495	0.0:1.0:0.0:0.0	.	766	O14827	RGRF2_HUMAN	A	766	ENSP00000265080:P766A	ENSP00000265080:P766A	P	+	1	0	RASGRF2	80445321	0.993000	0.37304	0.812000	0.32479	0.523000	0.34469	4.187000	0.58344	2.498000	0.84270	0.650000	0.86243	CCC		0.552	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		Missense_Mutation
RDH12	145226	hgsc.bcm.edu	37	14	68200554	68200554	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr14:68200554C>T	ENST00000551171.1	+	9	1264	c.940C>T	c.(940-942)Cgg>Tgg	p.R314W	RDH12_ENST00000539142.1_Missense_Mutation_p.R314W|RDH12_ENST00000267502.3_Missense_Mutation_p.R314W	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	314					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)	p.R314W(1)		large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	TCTAGGAATCCGGTGGGAGTA	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											60.0	55.0	57.0					14																	68200554		2203	4300	6503	67270307	SO:0001583	missense	145226			AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.940C>T	14.37:g.68200554C>T	ENSP00000449079:p.Arg314Trp	Somatic		Capture	SOLID	Phase_III	67270307	B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	37	CCDS9787.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202409	0.58234	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.89746	-2.56;-2.56;-2.56	5.81	2.6	0.31112	.	0.293446	0.38111	N	0.001816	T	0.80523	0.4639	L	0.47016	1.485	0.80722	D	1	D	0.54047	0.964	B	0.36766	0.232	T	0.79945	-0.1589	10	0.72032	D	0.01	.	6.2854	0.21031	0.1382:0.6491:0.1341:0.0787	.	314	Q96NR8	RDH12_HUMAN	W	314	ENSP00000449079:R314W;ENSP00000267502:R314W;ENSP00000438715:R314W	ENSP00000267502:R314W	R	+	1	2	RDH12	67270307	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.265000	0.43311	1.432000	0.47375	-0.293000	0.09583	CGG		0.537	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1			Missense_Mutation
RPTOR	57521	hgsc.bcm.edu	37	17	78704439	78704439	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr17:78704439G>A	ENST00000306801.3	+	5	949	c.587G>A	c.(586-588)tGc>tAc	p.C196Y	RPTOR_ENST00000570891.1_Missense_Mutation_p.C196Y|RPTOR_ENST00000544334.2_Missense_Mutation_p.C196Y|RPTOR_ENST00000537330.1_Missense_Mutation_p.C11Y	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	196					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GTCTACGACTGCTCCAATGCT	0.557																																																0			17											131.0	97.0	108.0					17																	78704439		2203	4300	6503	76319034	SO:0001583	missense	57521				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.587G>A	17.37:g.78704439G>A	ENSP00000307272:p.Cys196Tyr	Somatic		Capture	SOLID	Phase_III	76319034	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977136	0.74360	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	T;T	0.68479	-0.33;-0.27	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.86611	0.5974	M	0.94063	3.49	0.80722	D	1	D;B;D	0.89917	0.988;0.202;1.0	D;B;D	0.91635	0.989;0.158;0.999	D	0.90419	0.4415	10	0.87932	D	0	.	17.9664	0.89100	0.0:0.0:1.0:0.0	.	196;11;196	F5H7J5;F5GXV9;Q8N122	.;.;RPTOR_HUMAN	Y	11;196;196	ENSP00000307272:C196Y;ENSP00000442479:C196Y	ENSP00000307272:C196Y	C	+	2	0	RPTOR	76319034	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	9.534000	0.98061	2.445000	0.82738	0.655000	0.94253	TGC		0.557	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761		Missense_Mutation
SCN11A	11280	hgsc.bcm.edu	37	3	38921582	38921582	+	Silent	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:38921582G>C	ENST00000302328.3	-	19	3450	c.3252C>G	c.(3250-3252)ccC>ccG	p.P1084P	SCN11A_ENST00000444237.2_Silent_p.P1084P|SCN11A_ENST00000456224.3_Silent_p.P1046P|SCN11A_ENST00000450244.1_Silent_p.P1084P	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1084					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P1084P(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTGGATTTTGGGTTGGTTCT	0.338																																																1	Substitution - coding silent(1)	ovary(1)	3											53.0	55.0	54.0					3																	38921582		2203	4300	6503	38896586	SO:0001819	synonymous_variant	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3252C>G	3.37:g.38921582G>C		Somatic		Capture	SOLID	Phase_III	38896586	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1	SNP	47	Baylor																																																																																				0.338	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		Silent
SLC35F5	80255	hgsc.bcm.edu	37	2	114500277	114500277	+	Frame_Shift_Del	DEL	A	A	-			TCGA-36-1578-01	TCGA-36-1578-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:114500277delA	ENST00000245680.2	-	7	1155	c.742delT	c.(742-744)tgcfs	p.C248fs	SLC35F5_ENST00000409342.1_Frame_Shift_Del_p.C242fs	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	248					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.C248fs*22(2)|p.?(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						ACCACAAAGCAAAAAAAAAAG	0.343																																																3	Deletion - Frameshift(2)|Unknown(1)	ovary(2)|skin(1)	2											105.0	103.0	104.0					2																	114500277		2203	4300	6503	114216747	SO:0001589	frameshift_variant	80255			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.742delT	2.37:g.114500277delA	ENSP00000245680:p.Cys248fs	Somatic		Capture	SOLID	Phase_III	114216747	Q9H6P8|Q9H7D8	Frame_Shift_Del	DEL	ENST00000245680.2	37	CCDS2119.1	DEL	5	Baylor																																																																																				0.343	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181		Frame_Shift_Del
SLC6A20	54716	hgsc.bcm.edu	37	3	45801358	45801358	+	Silent	SNP	G	G	A			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:45801358G>A	ENST00000358525.4	-	10	1735	c.1620C>T	c.(1618-1620)gaC>gaT	p.D540D	SLC6A20_ENST00000353278.4_Silent_p.D503D|SLC6A20_ENST00000493980.1_5'Flank|SLC6A20_ENST00000456124.2_Silent_p.D540D	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	540					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.D503D(1)		breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		CCTGGGAGGCGTCCCAGGCTT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	3											102.0	101.0	101.0					3																	45801358		2203	4300	6503	45776362	SO:0001819	synonymous_variant	54716			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.1620C>T	3.37:g.45801358G>A		Somatic		Capture	SOLID	Phase_III	45776362	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	ENST00000358525.4	37	CCDS43077.1	SNP	40	Baylor																																																																																				0.567	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	NM_020208		Silent
SLC7A3	84889	hgsc.bcm.edu	37	X	70145724	70145724	+	Missense_Mutation	SNP	C	C	T	rs147665669	byFrequency	TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chrX:70145724C>T	ENST00000374299.3	-	12	1943	c.1799G>A	c.(1798-1800)cGc>cAc	p.R600H	SLC7A3_ENST00000298085.4_Missense_Mutation_p.R600H			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	600					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)	p.R600H(3)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TCTAGACTTGCGTGAGGGTTG	0.512													C|||	3	0.000794702	0.0	0.0014	3775	,	,		15019	0.0		0.002	False		,,,				2504	0.0															3	Substitution - Missense(3)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	X						C	HIS/ARG,HIS/ARG	0,3835		0,0,0,1632,571	248.0	191.0	210.0		1799,1799	-3.8	0.0	X	dbSNP_134	210	7,6721		0,6,1,2422,1871	yes	missense,missense	SLC7A3	NM_001048164.2,NM_032803.5	29,29	0,6,1,4054,2442	TT,TC,T,CC,C		0.104,0.0,0.0663	benign,benign	600/620,600/620	70145724	7,10556	2203	4300	6503	70062449	SO:0001583	missense	84889			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1799G>A	X.37:g.70145724C>T	ENSP00000363417:p.Arg600His	Somatic		Capture	SOLID	Phase_III	70062449	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	CCDS14404.1	SNP	27	Baylor	2	0.0012055455093429777	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	10.66	1.412292	0.25465	0.0	0.00104	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88046	-2.33;-2.33	4.43	-3.81	0.04294	.	1.491430	0.03535	N	0.223099	T	0.72819	0.3508	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.60786	-0.7194	10	0.45353	T	0.12	.	6.7819	0.23650	0.491:0.3784:0.1306:0.0	.	600	Q8WY07	CTR3_HUMAN	H	600	ENSP00000363417:R600H;ENSP00000298085:R600H	ENSP00000298085:R600H	R	-	2	0	SLC7A3	70062449	0.090000	0.21635	0.000000	0.03702	0.022000	0.10575	-0.002000	0.12924	-0.767000	0.04633	-0.545000	0.04230	CGC		0.512	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803		Missense_Mutation
SORCS3	22986	hgsc.bcm.edu	37	10	106970924	106970924	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr10:106970924G>A	ENST00000369701.3	+	17	2518	c.2291G>A	c.(2290-2292)aGc>aAc	p.S764N	SORCS3_ENST00000369699.4_Missense_Mutation_p.S50N	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	764					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.S764N(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CATGGGGAGAGCCAGTGTGTC	0.443																																					NSCLC(116;1497 1690 7108 13108 14106)											1	Substitution - Missense(1)	ovary(1)	10											114.0	95.0	102.0					10																	106970924		2203	4300	6503	106960914	SO:0001583	missense	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2291G>A	10.37:g.106970924G>A	ENSP00000358715:p.Ser764Asn	Somatic		Capture	SOLID	Phase_III	106960914	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.829	1.187895	0.21954	.	.	ENSG00000156395	ENST00000369701;ENST00000393176;ENST00000369699	T;T;T	0.31769	2.49;1.48;1.51	5.93	2.57	0.30868	VPS10 (1);	0.222920	0.49305	D	0.000144	T	0.10337	0.0253	N	0.03324	-0.35	0.27945	N	0.937362	B	0.06786	0.001	B	0.06405	0.002	T	0.20174	-1.0283	9	.	.	.	.	3.9291	0.09276	0.2022:0.5028:0.2949:0.0	.	764	Q9UPU3	SORC3_HUMAN	N	764;125;50	ENSP00000358715:S764N;ENSP00000376876:S125N;ENSP00000358713:S50N	.	S	+	2	0	SORCS3	106960914	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.320000	0.51991	0.779000	0.33543	0.655000	0.94253	AGC		0.443	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		Missense_Mutation
SRCAP	10847	hgsc.bcm.edu	37	16	30732196	30732196	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr16:30732196G>C	ENST00000262518.4	+	20	3535	c.3150G>C	c.(3148-3150)atG>atC	p.M1050I	SRCAP_ENST00000395059.2_Missense_Mutation_p.M1050I|SRCAP_ENST00000344771.4_Missense_Mutation_p.M1050I	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1050	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.M1050I(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CATCACTGATGGTTTCAGCCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	16											55.0	56.0	56.0					16																	30732196		2197	4300	6497	30639697	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3150G>C	16.37:g.30732196G>C	ENSP00000262518:p.Met1050Ile	Somatic		Capture	SOLID	Phase_III	30639697	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632606	0.29068	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.90563	-2.69;-2.66;-2.66	5.25	5.25	0.73442	.	0.094859	0.47093	D	0.000254	T	0.81403	0.4815	N	0.14661	0.345	0.25326	N	0.989079	B;B;B	0.14012	0.003;0.009;0.002	B;B;B	0.13407	0.002;0.009;0.001	T	0.69720	-0.5069	10	0.45353	T	0.12	-15.7728	9.7153	0.40270	0.0915:0.0:0.9085:0.0	.	1050;1050;1050	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	I	1050	ENSP00000262518:M1050I;ENSP00000378499:M1050I;ENSP00000343042:M1050I	ENSP00000262518:M1050I	M	+	3	0	SRCAP	30639697	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.383000	0.44354	2.729000	0.93468	0.557000	0.71058	ATG		0.667	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		Missense_Mutation
STAT1	6772	hgsc.bcm.edu	37	2	191844560	191844560	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr2:191844560C>G	ENST00000361099.3	-	20	2052	c.1665G>C	c.(1663-1665)tgG>tgC	p.W555C	STAT1_ENST00000409465.1_Missense_Mutation_p.W555C|STAT1_ENST00000392323.2_Missense_Mutation_p.W557C|STAT1_ENST00000392322.3_Missense_Mutation_p.W555C|STAT1_ENST00000540176.1_3'UTR	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	555					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)	p.W555C(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CAATCCAAAGCCAGAAGGGAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	85.0	83.0					2																	191844560		2203	4300	6503	191552805	SO:0001583	missense	6772				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1665G>C	2.37:g.191844560C>G	ENSP00000354394:p.Trp555Cys	Somatic		Capture	SOLID	Phase_III	191552805	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524849	0.85600	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71	5.73	5.73	0.89815	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.100249	0.85682	D	0.000000	D	0.98115	0.9378	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.98310	1.0523	10	0.72032	D	0.01	-12.6933	20.2602	0.98440	0.0:1.0:0.0:0.0	.	555;555	P42224-2;P42224	.;STAT1_HUMAN	C	555;555;555;557	ENSP00000354394:W555C;ENSP00000386244:W555C;ENSP00000376136:W555C;ENSP00000376137:W557C	ENSP00000354394:W555C	W	-	3	0	STAT1	191552805	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.861000	0.98227	0.655000	0.94253	TGG		0.358	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315		Missense_Mutation
TBXAS1	6916	hgsc.bcm.edu	37	7	139661920	139661920	+	Missense_Mutation	SNP	C	C	T	rs530584971		TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr7:139661920C>T	ENST00000336425.5	+	13	1411	c.1022C>T	c.(1021-1023)gCt>gTt	p.A341V	TBXAS1_ENST00000425687.1_Missense_Mutation_p.A274V|TBXAS1_ENST00000448866.1_Missense_Mutation_p.A341V|TBXAS1_ENST00000411653.1_Missense_Mutation_p.A341V|TBXAS1_ENST00000458722.1_Missense_Mutation_p.A387V|TBXAS1_ENST00000414508.2_Missense_Mutation_p.A342V|TBXAS1_ENST00000436047.2_Missense_Mutation_p.A342V|TBXAS1_ENST00000263552.6_Missense_Mutation_p.A342V|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000416849.2_Missense_Mutation_p.A388V			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	341					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)	p.A342V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	TTCCTCATCGCTGGCTATGAA	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		18664	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7											112.0	93.0	100.0					7																	139661920		2203	4300	6503	139308389	SO:0001583	missense	6916			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.1022C>T	7.37:g.139661920C>T	ENSP00000338087:p.Ala341Val	Somatic		Capture	SOLID	Phase_III	139308389	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	ENST00000336425.5	37		SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	31	5.080582	0.94050	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.98	5.98	0.97165	.	0.102733	0.64402	D	0.000002	D	0.91580	0.7340	M	0.92317	3.295	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;0.999;0.999	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.99;1.0;0.993;0.987;0.987	D	0.92509	0.6015	10	0.87932	D	0	.	20.4434	0.99119	0.0:1.0:0.0:0.0	.	322;388;293;274;342;342;341	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	V	274;342;341;388;342;342;341;387;341	ENSP00000388736:A274V;ENSP00000263552:A342V;ENSP00000338087:A341V;ENSP00000389414:A388V;ENSP00000392361:A342V;ENSP00000392702:A342V;ENSP00000402536:A341V;ENSP00000411274:A387V;ENSP00000411326:A341V	ENSP00000263552:A342V	A	+	2	0	TBXAS1	139308389	0.999000	0.42202	0.960000	0.40013	0.600000	0.36913	4.250000	0.58772	2.838000	0.97847	0.655000	0.94253	GCT		0.542	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1			Missense_Mutation
TM2D3	80213	hgsc.bcm.edu	37	15	102182761	102182761	+	Missense_Mutation	SNP	A	A	T			TCGA-36-1578-01	TCGA-36-1578-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr15:102182761A>T	ENST00000333202.3	-	6	670	c.665T>A	c.(664-666)cTg>cAg	p.L222Q	TM2D3_ENST00000561373.1_Missense_Mutation_p.L157Q|TM2D3_ENST00000428002.2_Intron|TM2D3_ENST00000559107.1_Intron|TM2D3_ENST00000347970.3_Missense_Mutation_p.L196Q	NM_078474.2	NP_510883.2	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3	222						integral component of membrane (GO:0016021)		p.L222Q(1)		central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)	10	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCATATTCCCAGGCCACCGAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	15											84.0	78.0	80.0					15																	102182761		2203	4300	6503	100000284	SO:0001583	missense	80213			AK094955	CCDS10392.1, CCDS10393.1	15q26.3	2014-02-12			ENSG00000184277	ENSG00000184277			24128	protein-coding gene	gene with protein product		610014				11278849	Standard	XM_005254980		Approved	BLP2, FLJ22604	uc002bxi.3	Q9BRN9	OTTHUMG00000149872	ENST00000333202.3:c.665T>A	15.37:g.102182761A>T	ENSP00000330433:p.Leu222Gln	Somatic		Capture	SOLID	Phase_III	100000284	B2RDK9|Q9H046|Q9H651	Missense_Mutation	SNP	ENST00000333202.3	37	CCDS10393.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.9	4.778790	0.90195	.	.	ENSG00000184277	ENST00000347970;ENST00000333202	.	.	.	5.34	5.34	0.76211	TM2 (1);	0.000000	0.64402	D	0.000001	D	0.86531	0.5955	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.90260	0.4300	9	0.87932	D	0	-21.1322	13.559	0.61777	1.0:0.0:0.0:0.0	.	196;222	Q9BRN9-2;Q9BRN9	.;TM2D3_HUMAN	Q	196;222	.	ENSP00000330433:L222Q	L	-	2	0	TM2D3	100000284	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.007000	0.93597	2.149000	0.67028	0.523000	0.50628	CTG		0.552	TM2D3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313623.1	NM_078474		Missense_Mutation
TM4SF5	9032	hgsc.bcm.edu	37	17	4685821	4685821	+	Silent	SNP	G	G	A	rs368661513		TCGA-36-1578-01	TCGA-36-1578-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr17:4685821G>A	ENST00000270560.3	+	3	313	c.282G>A	c.(280-282)tcG>tcA	p.S94S		NM_003963.2	NP_003954.2	O14894	T4S5_HUMAN	transmembrane 4 L six family member 5	94						integral component of plasma membrane (GO:0005887)		p.S94S(1)		large_intestine(2)|lung(3)|ovary(1)	6						TCTTCTCCTCGGCGTTCGGGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17						G		0,4406		0,0,2203	124.0	111.0	116.0		282	-10.1	0.0	17		116	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TM4SF5	NM_003963.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		94/198	4685821	1,13005	2203	4300	6503	4632568	SO:0001819	synonymous_variant	9032			AF027204	CCDS11054.1	17p13.3	2007-01-06	2005-03-21		ENSG00000142484	ENSG00000142484			11857	protein-coding gene	gene with protein product		604657	"""transmembrane 4 superfamily member 5"""			9479038	Standard	NM_003963		Approved		uc002fyw.1	O14894	OTTHUMG00000090776	ENST00000270560.3:c.282G>A	17.37:g.4685821G>A		Somatic		Capture	SOLID	Phase_III	4632568	Q17RW9|Q6IB79	Silent	SNP	ENST00000270560.3	37	CCDS11054.1	SNP	39	Baylor																																																																																				0.627	TM4SF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207558.2			Silent
TOP1MT	116447	hgsc.bcm.edu	37	8	144403385	144403394	+	Frame_Shift_Del	DEL	GCACTCTGTT	GCACTCTGTT	-			TCGA-36-1578-01	TCGA-36-1578-10	GCACTCTGTT	GCACTCTGTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr8:144403385_144403394delGCACTCTGTT	ENST00000329245.4	-	8	1157_1166	c.1123_1132delAACAGAGTGC	c.(1123-1134)aacagagtgccgfs	p.NRVP375fs	TOP1MT_ENST00000519148.1_Frame_Shift_Del_p.NRVP277fs|TOP1MT_ENST00000523676.1_Frame_Shift_Del_p.NRVP277fs|TOP1MT_ENST00000521193.1_Frame_Shift_Del_p.NRVP277fs	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	375					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)	p.N375fs*27(1)		endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	TTCTCCACCGGCACTCTGTTGTAGTAGCGG	0.643																																																1	Deletion - Frameshift(1)	ovary(1)	8																																								144474769	SO:0001589	frameshift_variant	116447			AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.1123_1132delAACAGAGTGC	8.37:g.144403385_144403394delGCACTCTGTT	ENSP00000328835:p.Asn375fs	Somatic		Capture	SOLID	Phase_III	144474760	B7ZAR5|E7ES89|Q86ST4|Q86V82	Frame_Shift_Del	DEL	ENST00000329245.4	37	CCDS6400.1	DEL	42	Baylor																																																																																				0.643	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963		Frame_Shift_Del
TP53	7157	hgsc.bcm.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		Capture	SOLID	Phase_III	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
USH2A	7399	hgsc.bcm.edu	37	1	215963604	215963604	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr1:215963604C>T	ENST00000307340.3	-	51	10365	c.9979G>A	c.(9979-9981)Gat>Aat	p.D3327N	USH2A_ENST00000366943.2_Missense_Mutation_p.D3327N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3327					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.D3327N(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCACATAATCCTGCCCACAA	0.363										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											105.0	99.0	101.0					1																	215963604		2203	4300	6503	214030227	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9979G>A	1.37:g.215963604C>T	ENSP00000305941:p.Asp3327Asn	Somatic		Capture	SOLID	Phase_III	214030227	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.94	3.920017	0.73098	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12984	2.64;2.63	5.91	4.99	0.66335	Fibronectin, type III (2);	0.142736	0.31772	N	0.007094	T	0.23133	0.0559	M	0.73598	2.24	0.41265	D	0.986801	D	0.53619	0.961	B	0.43360	0.417	T	0.10706	-1.0618	10	0.62326	D	0.03	.	17.0758	0.86586	0.0:0.8731:0.1268:0.0	.	3327	O75445	USH2A_HUMAN	N	3327	ENSP00000305941:D3327N;ENSP00000355910:D3327N	ENSP00000305941:D3327N	D	-	1	0	USH2A	214030227	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.313000	0.65798	1.478000	0.48253	0.655000	0.94253	GAT		0.363	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
USP28	57646	hgsc.bcm.edu	37	11	113701646	113701646	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr11:113701646C>A	ENST00000003302.4	-	9	921	c.853G>T	c.(853-855)Gaa>Taa	p.E285*	USP28_ENST00000542033.1_5'UTR|USP28_ENST00000537706.1_Nonsense_Mutation_p.E285*|USP28_ENST00000545540.1_Nonsense_Mutation_p.E160*|USP28_ENST00000544967.1_5'Flank|USP28_ENST00000260188.5_Nonsense_Mutation_p.E285*	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	285	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.E285*(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		ATTGGATTTTCAGATTTGTTC	0.383																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)											1	Substitution - Nonsense(1)	ovary(1)	11											159.0	151.0	154.0					11																	113701646		2201	4296	6497	113206856	SO:0001587	stop_gained	57646			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.853G>T	11.37:g.113701646C>A	ENSP00000003302:p.Glu285*	Somatic		Capture	SOLID	Phase_III	113206856	B0YJC0|B0YJC1|Q9P213	Nonsense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	38	6.705431	0.97776	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000545540;ENST00000538475;ENST00000537706;ENST00000537642	.	.	.	4.9	4.9	0.64082	.	0.257634	0.45606	D	0.000359	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-19.7349	18.6277	0.91347	0.0:1.0:0.0:0.0	.	.	.	.	X	285;285;160;49;285;184	.	ENSP00000003302:E285X	E	-	1	0	USP28	113206856	0.987000	0.35691	1.000000	0.80357	0.994000	0.84299	2.345000	0.44018	2.702000	0.92279	0.462000	0.41574	GAA		0.383	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1			Nonsense_Mutation
VAV1	7409	hgsc.bcm.edu	37	19	6828900	6828900	+	Silent	SNP	C	C	G			TCGA-36-1578-01	TCGA-36-1578-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr19:6828900C>G	ENST00000602142.1	+	13	1336	c.1254C>G	c.(1252-1254)tcC>tcG	p.S418S	VAV1_ENST00000599806.1_Silent_p.S363S|VAV1_ENST00000596764.1_Silent_p.S386S|VAV1_ENST00000539284.1_Silent_p.S321S|VAV1_ENST00000304076.2_Silent_p.S418S	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	418	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S418S(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						AACGGCGCTCCAAGATGGACA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	19											51.0	42.0	45.0					19																	6828900		2203	4300	6503	6779900	SO:0001819	synonymous_variant	7409				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1254C>G	19.37:g.6828900C>G		Somatic		Capture	SOLID	Phase_III	6779900	B4DVK9|M0QXX6|Q15860	Silent	SNP	ENST00000602142.1	37	CCDS12174.1	SNP	21	Baylor																																																																																				0.602	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1			Silent
XRN1	54464	hgsc.bcm.edu	37	3	142031519	142031519	+	Missense_Mutation	SNP	T	T	C			TCGA-36-1578-01	TCGA-36-1578-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-36-1578-01	TCGA-36-1578-10	g.chr3:142031519T>C	ENST00000264951.4	-	41	4856	c.4739A>G	c.(4738-4740)cAt>cGt	p.H1580R	XRN1_ENST00000392981.2_Missense_Mutation_p.H1568R	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1580					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.H1580R(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TAAAGTATGATGGAAGGGCTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											100.0	103.0	102.0					3																	142031519		2203	4300	6503	143514209	SO:0001583	missense	54464			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4739A>G	3.37:g.142031519T>C	ENSP00000264951:p.His1580Arg	Somatic		Capture	SOLID	Phase_III	143514209	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.87	2.665406	0.47677	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.35421	1.47;1.31	5.32	4.17	0.49024	.	0.184410	0.47455	D	0.000235	T	0.26448	0.0646	L	0.27053	0.805	0.80722	D	1	B;B	0.18166	0.026;0.015	B;B	0.18263	0.021;0.009	T	0.04579	-1.0941	10	0.59425	D	0.04	-4.2872	10.9927	0.47559	0.0:0.0732:0.0:0.9268	.	1568;1580	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	R	1580;1568	ENSP00000264951:H1580R;ENSP00000376707:H1568R	ENSP00000264951:H1580R	H	-	2	0	XRN1	143514209	1.000000	0.71417	0.889000	0.34880	0.936000	0.57629	3.882000	0.56160	0.863000	0.35553	-0.250000	0.11733	CAT		0.448	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		Missense_Mutation
