#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
TMCO2	127391	broad.mit.edu	37	1	40717246	40717246	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:40717246G>C	ENST00000372766.3	+	2	622	c.529G>C	c.(529-531)Ggg>Cgg	p.G177R	TMCO2_ENST00000468258.1_3'UTR	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	177						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.G177R(1)		kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GTCCACATCAGGGTTTACTTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	64.0	63.0					1																	40717246		2203	4300	6503	40489833	SO:0001583	missense	127391			AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.529G>C	1.37:g.40717246G>C	ENSP00000361852:p.Gly177Arg	Unknown		x	x	x	40489833		Missense_Mutation	SNP	ENST00000372766.3	37	CCDS30684.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079868	0.76528	.	.	ENSG00000188800	ENST00000372766	.	.	.	5.02	5.02	0.67125	.	0.000000	0.56097	D	0.000034	T	0.57021	0.2025	L	0.29908	0.895	0.36837	D	0.887185	D	0.59767	0.986	P	0.60173	0.87	T	0.64980	-0.6279	9	0.66056	D	0.02	-8.2827	13.7095	0.62659	0.0:0.0:1.0:0.0	.	177	Q7Z6W1	TMCO2_HUMAN	R	177	.	ENSP00000361852:G177R	G	+	1	0	TMCO2	40489833	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.773000	0.47686	2.615000	0.88500	0.585000	0.79938	GGG		0.478	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015769.1	NM_001008740		Missense_Mutation
RPS8	6202	broad.mit.edu	37	1	45243437	45243437	+	Silent	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:45243437G>T	ENST00000396651.3	+	4	523	c.363G>T	c.(361-363)ctG>ctT	p.L121L	SNORD46_ENST00000364043.1_RNA|RPS8_ENST00000485390.1_3'UTR|SNORD38B_ENST00000384690.1_RNA|SNORD55_ENST00000581525.1_RNA|SNORD38A_ENST00000365161.1_RNA|RPS8_ENST00000372209.3_Silent_p.L101L|RP11-269F19.2_ENST00000428791.1_RNA			P62241	RS8_HUMAN	ribosomal protein S8	121					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.L121L(1)		central_nervous_system(2)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	10	Acute lymphoblastic leukemia(166;0.155)					CGCTGCCCCTGGGCCGCAAGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											46.0	44.0	45.0					1																	45243437		2203	4300	6503	45016024	SO:0001819	synonymous_variant	6202			BC070875	CCDS513.1	1p34.1-p32	2011-04-05			ENSG00000142937	ENSG00000142937		"""S ribosomal proteins"""	10441	protein-coding gene	gene with protein product		600357				8432552	Standard	NM_001012		Approved	S8	uc001cmi.3	P62241	OTTHUMG00000008494	ENST00000396651.3:c.363G>T	1.37:g.45243437G>T		Unknown		x	x	x	45016024	P09058|Q6IRL7	Silent	SNP	ENST00000396651.3	37	CCDS513.1	SNP	47	Broad																																																																																				0.582	RPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023439.1	NM_001012		Silent
OSBPL9	114883	broad.mit.edu	37	1	52179728	52179728	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:52179728C>A	ENST00000428468.1	+	4	297	c.295C>A	c.(295-297)Ctt>Att	p.L99I	OSBPL9_ENST00000453295.1_Missense_Mutation_p.L82I|OSBPL9_ENST00000371714.1_Missense_Mutation_p.L99I|OSBPL9_ENST00000371710.3_Missense_Mutation_p.L117I|OSBPL9_ENST00000435686.2_5'UTR|OSBPL9_ENST00000530544.1_Missense_Mutation_p.L31I|OSBPL9_ENST00000337809.4_Missense_Mutation_p.L117I|OSBPL9_ENST00000447887.1_Missense_Mutation_p.L99I			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9	99	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.L99I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						AGAAACAATTCTTCGACATAC	0.328																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	84.0	85.0					1																	52179728		1849	4096	5945	51952316	SO:0001583	missense	114883			AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234	ENST00000428468.1:c.295C>A	1.37:g.52179728C>A	ENSP00000407168:p.Leu99Ile	Unknown		x	x	x	51952316	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Missense_Mutation	SNP	ENST00000428468.1	37	CCDS41332.3	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468202	0.84533	.	.	ENSG00000117859	ENST00000371714;ENST00000371710;ENST00000337809;ENST00000447887;ENST00000428468;ENST00000453295;ENST00000530544	T;T;T;T;T	0.15718	2.41;2.62;2.63;2.48;2.4	5.77	5.77	0.91146	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	M	0.78801	2.425	0.80722	D	1	P;D;P;P	0.89917	0.629;1.0;0.946;0.775	B;D;P;P	0.85130	0.134;0.997;0.476;0.497	T	0.15009	-1.0452	10	0.52906	T	0.07	-16.659	12.465	0.55753	0.0:0.9222:0.0:0.0778	.	82;105;99;117	Q86YQ3;B1AKJ7;Q96SU4;B1AKJ6	.;.;OSBL9_HUMAN;.	I	99;117;117;99;99;82;31	ENSP00000360779:L99I;ENSP00000360775:L117I;ENSP00000337265:L117I;ENSP00000412733:L99I;ENSP00000407168:L99I	ENSP00000337265:L117I	L	+	1	0	OSBPL9	51952316	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.962000	0.56766	2.890000	0.99128	0.650000	0.86243	CTT		0.328	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022584.4			Missense_Mutation
EPS8L3	79574	broad.mit.edu	37	1	110302310	110302310	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:110302310A>G	ENST00000361965.4	-	4	351	c.245T>C	c.(244-246)aTt>aCt	p.I82T	EPS8L3_ENST00000369805.3_Missense_Mutation_p.I82T|EPS8L3_ENST00000494151.1_5'Flank|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000361852.4_Missense_Mutation_p.I82T	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	82						cytoplasm (GO:0005737)		p.I82T(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		CTTGGTCTCAATGTCCAGCAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	48.0	51.0					1																	110302310		2203	4300	6503	110103833	SO:0001583	missense	79574			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.245T>C	1.37:g.110302310A>G	ENSP00000355255:p.Ile82Thr	Unknown		x	x	x	110103833	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	18.59	3.657183	0.67586	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.30981	1.51;1.51;1.51	5.24	5.24	0.73138	Tensin phosphotyrosine-binding domain (1);	0.250242	0.45867	D	0.000332	T	0.43545	0.1252	M	0.77103	2.36	0.44462	D	0.997392	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	T	0.37798	-0.9690	10	0.22706	T	0.39	-17.0778	12.9503	0.58397	1.0:0.0:0.0:0.0	.	82;82;82	Q8TE67-2;Q8TE67;Q8TE67-3	.;ES8L3_HUMAN;.	T	82	ENSP00000354551:I82T;ENSP00000358820:I82T;ENSP00000355255:I82T	ENSP00000354551:I82T	I	-	2	0	EPS8L3	110103833	1.000000	0.71417	0.950000	0.38849	0.976000	0.68499	6.551000	0.73909	2.107000	0.64212	0.533000	0.62120	ATT		0.592	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		Missense_Mutation
OLFML2B	25903	broad.mit.edu	37	1	161970050	161970051	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:161970050_161970051CC>AA	ENST00000294794.3	-	5	1224_1225	c.801_802GG>TT	c.(799-804)ctGGct>ctTTct	p.A268S	OLFML2B_ENST00000367940.2_Missense_Mutation_p.A269S	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	268					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.A268S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TCAGGCAGAGCCAGGGGTCGCG	0.619																																																1	Substitution - Missense(1)	ovary(1)	1																																								160236675	SO:0001583	missense	25903			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.801_802delinsAA	1.37:g.161970050_161970051delinsAA	ENSP00000294794:p.Ala268Ser	Unknown		x	x	x	160236674	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	DNP	ENST00000294794.3	37	CCDS1236.1	DNP	26	Broad																																																																																				0.619	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441		Missense_Mutation
SLC26A9	115019	broad.mit.edu	37	1	205904883	205904883	+	Missense_Mutation	SNP	A	A	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:205904883A>T	ENST00000367135.3	-	2	179	c.66T>A	c.(64-66)gaT>gaA	p.D22E	RP4-681L3.2_ENST00000421166.1_RNA|SLC26A9_ENST00000340781.4_Missense_Mutation_p.D22E|SLC26A9_ENST00000367134.2_Missense_Mutation_p.D22E	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	22					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.D22E(1)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TCTCAAACTCATCGTCGAAGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											210.0	186.0	194.0					1																	205904883		2203	4300	6503	204171506	SO:0001583	missense	115019			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.66T>A	1.37:g.205904883A>T	ENSP00000356103:p.Asp22Glu	Unknown		x	x	x	204171506	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	13.81	2.349180	0.41599	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.91464	-2.85;-2.81;-2.85	5.21	-6.03	0.02185	.	0.344623	0.29178	N	0.012903	T	0.56891	0.2016	N	0.00525	-1.395	0.29174	N	0.876926	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.68250	-0.5458	10	0.02654	T	1	.	4.8146	0.13360	0.1494:0.5362:0.1498:0.1646	.	22;22	Q7LBE3;B1AVM8	S26A9_HUMAN;.	E	22	ENSP00000341682:D22E;ENSP00000356103:D22E;ENSP00000356102:D22E	ENSP00000341682:D22E	D	-	3	2	SLC26A9	204171506	0.039000	0.19947	0.971000	0.41717	0.994000	0.84299	-1.059000	0.03479	-0.648000	0.05437	0.533000	0.62120	GAT		0.557	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934		Missense_Mutation
HLX	3142	broad.mit.edu	37	1	221053253	221053253	+	Silent	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr1:221053253G>T	ENST00000366903.6	+	1	1555	c.54G>T	c.(52-54)tcG>tcT	p.S18S	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_5'Flank	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	18					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S18S(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		GCCTCTGGTCGGCCGCTTACT	0.687																																																1	Substitution - coding silent(1)	ovary(1)	1											7.0	9.0	8.0					1																	221053253		2141	4213	6354	219119876	SO:0001819	synonymous_variant	3142			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.54G>T	1.37:g.221053253G>T		Unknown		x	x	x	219119876	B2R8A8|Q15988|Q59HE7|Q9NZ75	Silent	SNP	ENST00000366903.6	37	CCDS1527.1	SNP	39	Broad																																																																																				0.687	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958		Silent
LRRC18	474354	broad.mit.edu	37	10	50122131	50122131	+	Missense_Mutation	SNP	T	T	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr10:50122131T>A	ENST00000374160.3	-	1	146	c.70A>T	c.(70-72)Atc>Ttc	p.I24F	LRRC18_ENST00000298124.3_Missense_Mutation_p.I24F|WDFY4_ENST00000413659.2_Intron|WDFY4_ENST00000325239.5_Intron|RP11-523O18.7_ENST00000430438.1_RNA	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	24						cytoplasm (GO:0005737)		p.I24F(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TCAAAAGTGATTTTGATGCAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	10											77.0	70.0	72.0					10																	50122131		2203	4300	6503	49792137	SO:0001583	missense	474354			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.70A>T	10.37:g.50122131T>A	ENSP00000363275:p.Ile24Phe	Unknown		x	x	x	49792137	Q6UY02	Missense_Mutation	SNP	ENST00000374160.3	37	CCDS31197.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	13.96	2.391761	0.42410	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.59502	0.44;0.26	6.06	-2.5	0.06384	.	0.800810	0.12006	N	0.508310	T	0.49047	0.1534	L	0.54323	1.7	0.09310	N	0.999999	P	0.39216	0.664	B	0.36030	0.216	T	0.37033	-0.9723	9	.	.	.	.	14.2162	0.65795	0.0:0.6137:0.0:0.3863	.	24	Q8N456	LRC18_HUMAN	F	24	ENSP00000363275:I24F;ENSP00000298124:I24F	.	I	-	1	0	LRRC18	49792137	0.001000	0.12720	0.410000	0.26471	0.980000	0.70556	-0.277000	0.08502	-0.745000	0.04772	-0.248000	0.11899	ATC		0.468	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939		Missense_Mutation
BMPR1A	657	broad.mit.edu	37	10	88651963	88651963	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr10:88651963G>A	ENST00000372037.3	+	5	847	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	RNU1-19P_ENST00000363306.1_RNA	NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	104					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.E104K(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						TATGAAATATGAAGGATCTGA	0.393			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)	yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	2	Substitution - Missense(2)	ovary(2)	10											81.0	79.0	80.0					10																	88651963		2203	4300	6503	88641943	SO:0001583	missense	657	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.310G>A	10.37:g.88651963G>A	ENSP00000361107:p.Glu104Lys	Unknown		x	x	x	88641943	A8K6U9|Q8NEN8	Missense_Mutation	SNP	ENST00000372037.3	37	CCDS7378.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.112307	0.94339	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	D	0.97811	-4.55	5.59	5.59	0.84812	TGF-beta receptor/activin receptor, type I/II (1);	0.095506	0.64402	D	0.000001	D	0.98058	0.9360	M	0.75447	2.3	0.80722	D	1	P	0.42649	0.786	P	0.51945	0.685	D	0.98198	1.0466	10	0.48119	T	0.1	.	17.7786	0.88517	0.0:0.0:1.0:0.0	.	104	P36894	BMR1A_HUMAN	K	104	ENSP00000361107:E104K	ENSP00000224764:E104K	E	+	1	0	BMPR1A	88641943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.020000	0.93667	2.650000	0.89964	0.555000	0.69702	GAA		0.393	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329		Missense_Mutation
OR5J2	282775	broad.mit.edu	37	11	55944594	55944594	+	Silent	SNP	C	C	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr11:55944594C>G	ENST00000312298.1	+	1	501	c.501C>G	c.(499-501)tcC>tcG	p.S167S		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S167S(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					GGAGACTGTCCTTTTGTAGGC	0.428																																																2	Substitution - coding silent(2)	large_intestine(1)|ovary(1)	11											173.0	151.0	158.0					11																	55944594		2201	4296	6497	55701170	SO:0001819	synonymous_variant	282775			AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.501C>G	11.37:g.55944594C>G		Unknown		x	x	x	55701170	Q6IEU5	Silent	SNP	ENST00000312298.1	37	CCDS31522.1	SNP	24	Broad																																																																																				0.428	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		Silent
STIP1	10963	broad.mit.edu	37	11	63962067	63962067	+	Nonsense_Mutation	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr11:63962067C>T	ENST00000305218.4	+	4	625	c.478C>T	c.(478-480)Cga>Tga	p.R160*	STIP1_ENST00000538945.1_Nonsense_Mutation_p.R136*|STIP1_ENST00000540501.1_3'UTR|STIP1_ENST00000358794.5_Nonsense_Mutation_p.R207*|STIP1_ENST00000543847.1_Nonsense_Mutation_p.R160*	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	160	STI1 1.				response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R160*(2)		endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						AGAGCAGCTACGAAACAAGCC	0.507																																																2	Substitution - Nonsense(2)	ovary(1)|endometrium(1)	11											99.0	81.0	88.0					11																	63962067		2201	4297	6498	63718643	SO:0001587	stop_gained	10963			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.478C>T	11.37:g.63962067C>T	ENSP00000305958:p.Arg160*	Unknown		x	x	x	63718643	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Nonsense_Mutation	SNP	ENST00000305218.4	37	CCDS8058.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559244	0.45590	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945;ENST00000543847	.	.	.	5.57	4.65	0.58169	.	0.064919	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-4.4194	12.952	0.58407	0.2941:0.7059:0.0:0.0	.	.	.	.	X	207;160;136;160	.	ENSP00000305958:R160X	R	+	1	2	STIP1	63718643	0.830000	0.29337	0.138000	0.22173	0.080000	0.17528	1.940000	0.40223	1.479000	0.48272	0.650000	0.86243	CGA		0.507	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819		Nonsense_Mutation
CTSF	8722	broad.mit.edu	37	11	66330572	66330572	+	IGR	SNP	C	C	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr11:66330572C>A	ENST00000310325.5	-	0	2035				CTD-3074O7.2_ENST00000504911.1_lincRNA|ACTN3_ENST00000502692.1_RNA|ACTN3_ENST00000513398.1_RNA	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CTGCATCCGCCGTATGGTGCC	0.657																																																0			11											38.0	44.0	42.0					11																	66330572		1968	4136	6104	66087148	SO:0001628	intergenic_variant	89			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090		11.37:g.66330572C>A		Unknown		x	x	x	66087148	B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	ENST00000310325.5	37	CCDS8144.1	SNP	23	Broad																																																																																				0.657	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393047.1	NM_003793		Missense_Mutation
SLC36A4	120103	broad.mit.edu	37	11	92901196	92901196	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr11:92901196C>G	ENST00000326402.4	-	7	812	c.682G>C	c.(682-684)Gaa>Caa	p.E228Q	SLC36A4_ENST00000529184.1_Missense_Mutation_p.E93Q	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4	228					L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.E228Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTCTTTAGTTCACGAATGAAG	0.348																																																1	Substitution - Missense(1)	ovary(1)	11											113.0	111.0	112.0					11																	92901196		2201	4296	6497	92540844	SO:0001583	missense	120103			AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.682G>C	11.37:g.92901196C>G	ENSP00000317382:p.Glu228Gln	Unknown		x	x	x	92540844	Q86X30|Q8IVM5|Q8N8S6	Missense_Mutation	SNP	ENST00000326402.4	37	CCDS8291.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221478	0.39300	.	.	ENSG00000180773	ENST00000326402;ENST00000529184;ENST00000534116	T;T;T	0.02258	4.37;4.37;4.37	5.59	5.59	0.84812	.	0.253274	0.36778	N	0.002418	T	0.03348	0.0097	N	0.20574	0.59	0.42043	D	0.991082	B	0.27013	0.166	B	0.34346	0.18	T	0.57952	-0.7722	10	0.87932	D	0	-3.3701	19.585	0.95487	0.0:1.0:0.0:0.0	.	228	Q6YBV0	S36A4_HUMAN	Q	228;93;122	ENSP00000317382:E228Q;ENSP00000436570:E93Q;ENSP00000432061:E122Q	ENSP00000317382:E228Q	E	-	1	0	SLC36A4	92540844	1.000000	0.71417	0.997000	0.53966	0.175000	0.22909	3.646000	0.54396	2.615000	0.88500	0.557000	0.71058	GAA		0.348	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394329.2			Missense_Mutation
CD163L1	283316	broad.mit.edu	37	12	7522197	7522197	+	Silent	SNP	G	G	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr12:7522197G>A	ENST00000313599.3	-	15	3852	c.3795C>T	c.(3793-3795)ggC>ggT	p.G1265G	CD163L1_ENST00000416109.2_Silent_p.G1275G|CD163L1_ENST00000396630.1_Silent_p.G1265G			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1265	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.G1265G(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TGCCCCAGGAGCCTGCGTGCC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	12											89.0	86.0	87.0					12																	7522197		2203	4300	6503	7413464	SO:0001819	synonymous_variant	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3795C>T	12.37:g.7522197G>A		Unknown		x	x	x	7413464	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	37	CCDS8577.1	SNP	34	Broad																																																																																				0.592	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		Silent
CNTN1	1272	broad.mit.edu	37	12	41408099	41408099	+	Splice_Site	SNP	C	C	T	rs201782849		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr12:41408099C>T	ENST00000551295.2	+	18	2300	c.2183C>T	c.(2182-2184)gCg>gTg	p.A728V	CNTN1_ENST00000348761.2_Splice_Site_p.A717V|CNTN1_ENST00000550305.1_3'UTR|CNTN1_ENST00000347616.1_Splice_Site_p.A728V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	728	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.A728V(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ATAACATGGGCGGTAAGTATT	0.388																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	12											153.0	137.0	143.0					12																	41408099		2203	4300	6503	39694366	SO:0001630	splice_region_variant	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2184+1C>T	12.37:g.41408099C>T		Unknown		x	x	x	39694366	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344981	0.41498	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.57273	0.41;0.41;0.41	5.45	3.56	0.40772	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.372699	0.30969	N	0.008508	T	0.23532	0.0569	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.09185	-1.0686	10	0.48119	T	0.1	.	2.6163	0.04905	0.2205:0.4885:0.0:0.291	.	717;728	Q12860-2;Q12860	.;CNTN1_HUMAN	V	728;728;717	ENSP00000447006:A728V;ENSP00000325660:A728V;ENSP00000261160:A717V	ENSP00000325660:A728V	A	+	2	0	CNTN1	39694366	1.000000	0.71417	0.995000	0.50966	0.882000	0.50991	2.795000	0.47861	1.560000	0.49568	0.655000	0.94253	GCG		0.388	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	Missense_Mutation	Missense_Mutation
VDR	7421	broad.mit.edu	37	12	48251311	48251311	+	Silent	SNP	G	G	C	rs543098804		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr12:48251311G>C	ENST00000395324.2	-	5	706	c.438C>G	c.(436-438)acC>acG	p.T146T	VDR_ENST00000550325.1_Silent_p.T196T|VDR_ENST00000229022.3_Silent_p.T146T|VDR_ENST00000549336.1_Silent_p.T146T|VDR_ENST00000535672.1_Silent_p.T114T			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	146	Hinge.				bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.T146T(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	AGTCGGAGTAGGTGGGGTCGT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	12											119.0	106.0	110.0					12																	48251311		2203	4300	6503	46537578	SO:0001819	synonymous_variant	7421			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.438C>G	12.37:g.48251311G>C		Unknown		x	x	x	46537578	B2R5Q1|G3V1V9|Q5PSV3	Silent	SNP	ENST00000395324.2	37	CCDS8757.1	SNP	35	Broad																																																																																				0.612	VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406433.1			Silent
PAH	5053	broad.mit.edu	37	12	103246708	103246708	+	Nonsense_Mutation	SNP	G	G	A	rs5030846		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr12:103246708G>A	ENST00000553106.1	-	7	1199	c.727C>T	c.(727-729)Cga>Tga	p.R243*	PAH_ENST00000307000.2_Nonsense_Mutation_p.R238*|PAH_ENST00000551988.1_5'Flank	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	243			R -> Q (in non-PKU HPA and PKU; haplotypes 4,7,9). {ECO:0000269|PubMed:9600453, ECO:0000269|PubMed:9852673}.		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)	p.R243*(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	GCCACAGGTCGGAGGCGGAAA	0.527																																																1	Substitution - Nonsense(1)	ovary(1)	12	GRCh37	CM900176	PAH	M	rs5030846						62.0	69.0	67.0					12																	103246708		2203	4300	6503	101770838	SO:0001587	stop_gained	5053			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.727C>T	12.37:g.103246708G>A	ENSP00000448059:p.Arg243*	Unknown		x	x	x	101770838	Q16717|Q8TC14	Nonsense_Mutation	SNP	ENST00000553106.1	37	CCDS9092.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	43	10.170476	0.99351	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	.	.	.	5.92	3.03	0.35002	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5929	9.9352	0.41548	0.0645:0.0:0.686:0.2495	rs5030846	.	.	.	X	243;238	.	ENSP00000303500:R238X	R	-	1	2	PAH	101770838	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.973000	0.88032	0.368000	0.24481	-0.319000	0.08680	CGA		0.527	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1			Nonsense_Mutation
CRY1	1407	broad.mit.edu	37	12	107393837	107393837	+	Silent	SNP	T	T	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr12:107393837T>C	ENST00000008527.5	-	6	1575	c.708A>G	c.(706-708)agA>agG	p.R236R		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	236					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)	p.R236R(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						TCATTCGAGGTCTTTCAAAAT	0.353																																																1	Substitution - coding silent(1)	ovary(1)	12											73.0	74.0	74.0					12																	107393837		2203	4300	6503	105917967	SO:0001819	synonymous_variant	1407			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.708A>G	12.37:g.107393837T>C		Unknown		x	x	x	105917967		Silent	SNP	ENST00000008527.5	37	CCDS9112.1	SNP	58	Broad																																																																																				0.353	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075		Silent
OR4K15	81127	broad.mit.edu	37	14	20444054	20444054	+	Missense_Mutation	SNP	T	T	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr14:20444054T>A	ENST00000305051.5	+	1	452	c.377T>A	c.(376-378)tTc>tAc	p.F126Y		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F126Y(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GCCCAGATTTTCTTTGTTCAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	14											128.0	130.0	129.0					14																	20444054		2203	4299	6502	19513894	SO:0001583	missense	81127				CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.377T>A	14.37:g.20444054T>A	ENSP00000304077:p.Phe126Tyr	Unknown		x	x	x	19513894	B9EIL3|Q6IEZ4	Missense_Mutation	SNP	ENST00000305051.5	37	CCDS32026.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	.	15.38	2.816626	0.50633	.	.	ENSG00000169488	ENST00000305051	T	0.00344	8.02	3.8	3.8	0.43715	GPCR, rhodopsin-like superfamily (1);	0.124998	0.36444	N	0.002581	T	0.00468	0.0015	L	0.45581	1.43	0.20074	N	0.999936	D	0.89917	1.0	D	0.77004	0.989	T	0.52859	-0.8519	10	0.66056	D	0.02	.	6.3745	0.21499	0.2196:0.0:0.0:0.7804	.	126	Q8NH41	OR4KF_HUMAN	Y	126	ENSP00000304077:F126Y	ENSP00000304077:F126Y	F	+	2	0	OR4K15	19513894	0.164000	0.22935	0.190000	0.23270	0.906000	0.53458	0.429000	0.21412	1.578000	0.49821	0.477000	0.44152	TTC		0.443	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409883.1			Missense_Mutation
PROX2	283571	broad.mit.edu	37	14	75329537	75329537	+	Nonsense_Mutation	SNP	A	A	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr14:75329537A>T	ENST00000445876.1	-	1	1000	c.1001T>A	c.(1000-1002)tTg>tAg	p.L334*	PROX2_ENST00000556084.2_Intron|PROX2_ENST00000556489.2_Nonsense_Mutation_p.L334*			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	334					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		AGGTGCAGTCAAGGGAAAGTT	0.502																																																0			14											62.0	66.0	65.0					14																	75329537		1871	4122	5993	74399290	SO:0001587	stop_gained	283571				CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.1001T>A	14.37:g.75329537A>T	ENSP00000405932:p.Leu334*	Unknown		x	x	x	74399290	C9J5W1|Q8N9Q3	Nonsense_Mutation	SNP	ENST00000445876.1	37	CCDS45136.2	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	15.17	2.753377	0.49362	.	.	ENSG00000119608	ENST00000556489;ENST00000389664;ENST00000445876	.	.	.	5.69	3.03	0.35002	.	0.474047	0.19193	N	0.120399	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9972	8.9095	0.35543	0.7797:0.0:0.2203:0.0	.	.	.	.	X	334	.	ENSP00000374315:L334X	L	-	2	0	PROX2	74399290	0.009000	0.17119	0.002000	0.10522	0.216000	0.24613	1.431000	0.34925	0.310000	0.22990	0.454000	0.30748	TTG		0.502	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				Nonsense_Mutation
TTBK2	146057	broad.mit.edu	37	15	43044268	43044268	+	Nonsense_Mutation	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr15:43044268C>T	ENST00000267890.6	-	14	3284	c.3176G>A	c.(3175-3177)tGg>tAg	p.W1059*		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	1059					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.W1059*(1)		NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TGTGTTGACCCATGAAACTGG	0.498																																																1	Substitution - Nonsense(1)	ovary(1)	15											148.0	156.0	153.0					15																	43044268		1987	4167	6154	40831560	SO:0001587	stop_gained	146057			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.3176G>A	15.37:g.43044268C>T	ENSP00000267890:p.Trp1059*	Unknown		x	x	x	40831560	O94932|Q6ZN52|Q8IVV1	Nonsense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.003259	0.98605	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	.	.	.	5.91	5.91	0.95273	.	0.067767	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2983	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	1059;989;1464	.	ENSP00000263802:W1464X	W	-	2	0	TTBK2	40831560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.648000	0.54410	2.802000	0.96397	0.655000	0.94253	TGG		0.498	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500		Nonsense_Mutation
ISL2	64843	broad.mit.edu	37	15	76630310	76630310	+	Splice_Site	SNP	T	T	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr15:76630310T>C	ENST00000290759.4	+	2	408		c.e2+2		RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2						negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						CTATGTCAGGTGAGGCCGGCG	0.721																																					GBM(97;953 1391 16164 31496 36951)											1	Unknown(1)	ovary(1)	15											40.0	31.0	34.0					15																	76630310		2196	4293	6489	74417365	SO:0001630	splice_region_variant	64843			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.248+2T>C	15.37:g.76630310T>C		Unknown		x	x	x	74417365	B3KM37	Splice_Site_SNP	SNP	ENST00000290759.4	37	CCDS10290.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	18.92	3.725095	0.68959	.	.	ENSG00000159556	ENST00000290759	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8378	0.57784	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ISL2	74417365	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	7.769000	0.85360	1.712000	0.51347	0.248000	0.18094	.		0.721	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289779.1		Intron	Splice_Site_SNP
NTRK3	4916	broad.mit.edu	37	15	88476380	88476380	+	Missense_Mutation	SNP	A	A	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr15:88476380A>T	ENST00000360948.2	-	15	1913	c.1752T>A	c.(1750-1752)gaT>gaA	p.D584E	NTRK3_ENST00000357724.2_Missense_Mutation_p.D576E|NTRK3_ENST00000394480.2_Missense_Mutation_p.D584E|NTRK3_ENST00000558676.1_Missense_Mutation_p.D576E|NTRK3_ENST00000542733.2_Missense_Mutation_p.D486E|NTRK3_ENST00000557856.1_Missense_Mutation_p.D576E|NTRK3_ENST00000355254.2_Missense_Mutation_p.D584E	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	584	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D584E(1)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCCTCTGGAAATCCTTCCGGG	0.562			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	1	Substitution - Missense(1)	ovary(1)	15											63.0	60.0	61.0					15																	88476380		2201	4299	6500	86277384	SO:0001583	missense	4916			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1752T>A	15.37:g.88476380A>T	ENSP00000354207:p.Asp584Glu	Unknown		x	x	x	86277384	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	22.9	4.352408	0.82132	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000343782	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	5.49	-4.98	0.03019	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80497	0.4634	N	0.16201	0.385	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.999;0.996;0.999	D;D;D;D;D	0.87578	0.998;0.994;0.991;0.99;0.991	T	0.79300	-0.1860	10	0.87932	D	0	.	14.7386	0.69437	0.3941:0.0:0.6059:0.0	.	486;576;576;584;584	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	E	584;584;576;584;486;80	ENSP00000377990:D584E;ENSP00000354207:D584E;ENSP00000350356:D576E;ENSP00000347397:D584E;ENSP00000437773:D486E	ENSP00000342792:D80E	D	-	3	2	NTRK3	86277384	0.010000	0.17322	0.914000	0.36105	0.992000	0.81027	-0.716000	0.04991	-1.170000	0.02769	-0.263000	0.10527	GAT		0.562	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				Missense_Mutation
OR2C1	4993	broad.mit.edu	37	16	3406249	3406249	+	Silent	SNP	C	C	T	rs373844589		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr16:3406249C>T	ENST00000304936.2	+	1	361	c.309C>T	c.(307-309)gtC>gtT	p.V103V		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	103					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V103V(1)		kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						AGCTCTATGTCTTCCTTTGGC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	16											60.0	48.0	52.0					16																	3406249		2197	4300	6497	3346250	SO:0001819	synonymous_variant	4993			AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.309C>T	16.37:g.3406249C>T		Unknown		x	x	x	3346250	A0AVA4|Q6IF34|Q6IF55	Silent	SNP	ENST00000304936.2	37	CCDS10502.1	SNP	32	Broad																																																																																				0.562	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206993.3			Silent
JPH3	57338	broad.mit.edu	37	16	87678297	87678297	+	Missense_Mutation	SNP	G	G	T	rs142310848		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr16:87678297G>T	ENST00000284262.2	+	2	1058	c.816G>T	c.(814-816)gaG>gaT	p.E272D		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	272					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)	p.E272D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CTGAGGCCGAGCTGGCGGTCA	0.662																																																1	Substitution - Missense(1)	ovary(1)	16											74.0	67.0	69.0					16																	87678297		2198	4300	6498	86235798	SO:0001583	missense	57338			AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.816G>T	16.37:g.87678297G>T	ENSP00000284262:p.Glu272Asp	Unknown		x	x	x	86235798	D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	37	CCDS10962.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092845	0.56075	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.43688	0.94	5.03	5.03	0.67393	.	0.054688	0.64402	D	0.000001	T	0.24431	0.0592	N	0.11064	0.09	0.54753	D	0.999987	B	0.10296	0.003	B	0.10450	0.005	T	0.09840	-1.0656	10	0.07325	T	0.83	.	17.3468	0.87311	0.0:0.0:1.0:0.0	.	272	Q8WXH2	JPH3_HUMAN	D	135;272	ENSP00000284262:E272D	ENSP00000284262:E272D	E	+	3	2	JPH3	86235798	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.874000	0.48483	2.334000	0.79466	0.462000	0.41574	GAG		0.662	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2			Missense_Mutation
STAT3	6774	broad.mit.edu	37	17	40498702	40498702	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr17:40498702G>C	ENST00000264657.5	-	3	470	c.158C>G	c.(157-159)gCc>gGc	p.A53G	STAT3_ENST00000404395.3_Missense_Mutation_p.A53G|STAT3_ENST00000588969.1_Missense_Mutation_p.A53G|STAT3_ENST00000585517.1_Missense_Mutation_p.A53G|STAT3_ENST00000389272.3_5'UTR	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	53					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A53G(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CACCAAAGTGGCATGTGATTC	0.453									Hyperimmunoglobulin E Recurrent Infection Syndrome																																							1	Substitution - Missense(1)	ovary(1)	17											199.0	197.0	197.0					17																	40498702		2203	4300	6503	37752228	SO:0001583	missense	6774	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.158C>G	17.37:g.40498702G>C	ENSP00000264657:p.Ala53Gly	Unknown		x	x	x	37752228	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.549610	0.96501	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.60171	0.21;0.21	5.66	5.66	0.87406	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.79604	0.4474	M	0.82823	2.61	0.80722	D	1	D;D;D	0.67145	0.996;0.992;0.992	D;D;D	0.77557	0.99;0.989;0.989	T	0.81342	-0.0976	10	0.87932	D	0	-21.9624	20.1041	0.97884	0.0:0.0:1.0:0.0	.	53;53;53	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	G	53	ENSP00000264657:A53G;ENSP00000384943:A53G	ENSP00000264657:A53G	A	-	2	0	STAT3	37752228	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.668000	0.98619	2.826000	0.97356	0.655000	0.94253	GCC		0.453	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150		Missense_Mutation
FZD2	2535	broad.mit.edu	37	17	42635860	42635860	+	Silent	SNP	A	A	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr17:42635860A>G	ENST00000315323.3	+	1	936	c.804A>G	c.(802-804)gtA>gtG	p.V268V		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	268					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.V268V(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CGTACTTGGTAGACATGCAGC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	17											81.0	76.0	78.0					17																	42635860		2203	4300	6503	39991386	SO:0001819	synonymous_variant	2535			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.804A>G	17.37:g.42635860A>G		Unknown		x	x	x	39991386	Q0VG82	Silent	SNP	ENST00000315323.3	37	CCDS11484.1	SNP	15	Broad																																																																																				0.597	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466		Silent
MGAT5B	146664	broad.mit.edu	37	17	74878256	74878256	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr17:74878256G>A	ENST00000569840.2	+	3	779	c.205G>A	c.(205-207)Ggc>Agc	p.G69S	MGAT5B_ENST00000374998.3_3'UTR|MGAT5B_ENST00000565675.1_Missense_Mutation_p.G69S|MGAT5B_ENST00000301618.4_Missense_Mutation_p.G69S|MGAT5B_ENST00000428789.2_Missense_Mutation_p.G80S	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	69					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)	p.G69S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CGAGTCCCGCGGCGTCCTGCG	0.687																																																1	Substitution - Missense(1)	ovary(1)	17											27.0	26.0	26.0					17																	74878256		2202	4293	6495	72389851	SO:0001583	missense	146664			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.205G>A	17.37:g.74878256G>A	ENSP00000456037:p.Gly69Ser	Unknown		x	x	x	72389851	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	37	CCDS59299.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012561	0.75161	.	.	ENSG00000167889	ENST00000374998;ENST00000301618;ENST00000428789	T;T	0.49139	0.8;0.79	5.23	5.23	0.72850	.	0.062596	0.64402	D	0.000006	T	0.41719	0.1171	N	0.16790	0.44	0.44462	D	0.997394	D;D	0.63880	0.993;0.987	P;P	0.56474	0.799;0.799	T	0.18713	-1.0328	10	0.06099	T	0.92	-23.7115	14.2918	0.66284	0.0:0.0:1.0:0.0	.	80;69	Q3V5L5-2;Q3V5L5-5	.;.	S	69;69;80	ENSP00000301618:G69S;ENSP00000391227:G80S	ENSP00000301618:G69S	G	+	1	0	MGAT5B	72389851	1.000000	0.71417	0.221000	0.23827	0.527000	0.34593	7.814000	0.86154	2.428000	0.82296	0.561000	0.74099	GGC		0.687	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677		Missense_Mutation
SUPT5H	6829	broad.mit.edu	37	19	39944005	39944005	+	Nonsense_Mutation	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr19:39944005G>T	ENST00000599117.1	+	4	452	c.85G>T	c.(85-87)Gag>Tag	p.E29*	SUPT5H_ENST00000359191.6_Nonsense_Mutation_p.E29*|SUPT5H_ENST00000432763.2_Nonsense_Mutation_p.E29*|SUPT5H_ENST00000402194.2_Nonsense_Mutation_p.E29*|SUPT5H_ENST00000598725.1_Nonsense_Mutation_p.E29*			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	29	Glu-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.E29*(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGTAGACGAAGAGCGGCGGAG	0.517																																																1	Substitution - Nonsense(1)	ovary(1)	19											30.0	24.0	26.0					19																	39944005		2203	4300	6503	44635845	SO:0001587	stop_gained	6829			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.85G>T	19.37:g.39944005G>T	ENSP00000470252:p.Glu29*	Unknown		x	x	x	44635845	O43279|Q59G52|Q99639	Nonsense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	36	5.705782	0.96812	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.69	4.69	0.59074	.	0.285500	0.31177	N	0.008105	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.092	16.7746	0.85548	0.0:0.0:1.0:0.0	.	.	.	.	X	29	.	.	E	+	1	0	SUPT5H	44635845	1.000000	0.71417	0.999000	0.59377	0.386000	0.30323	6.195000	0.72088	2.329000	0.79093	0.454000	0.30748	GAG		0.517	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169		Nonsense_Mutation
CEACAM1	634	broad.mit.edu	37	19	43025455	43025455	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr19:43025455A>C	ENST00000161559.6	-	4	1056	c.922T>G	c.(922-924)Tgc>Ggc	p.C308G	LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000352591.5_Missense_Mutation_p.C308G|CEACAM1_ENST00000351134.3_Intron|CEACAM1_ENST00000599389.1_Missense_Mutation_p.C308G|CEACAM1_ENST00000403444.3_Missense_Mutation_p.C308G|CEACAM1_ENST00000403461.1_Missense_Mutation_p.C308G|CEACAM1_ENST00000358394.3_Missense_Mutation_p.C308G|CEACAM1_ENST00000308072.4_Missense_Mutation_p.C268G|LIPE-AS1_ENST00000594688.1_RNA|LIPE-AS1_ENST00000457234.2_RNA	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	308	Ig-like C2-type 2.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.C308G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	GTCCTGTTGCAGCCAGTGACT	0.443																																																1	Substitution - Missense(1)	ovary(1)	19											207.0	187.0	194.0					19																	43025455		2203	4300	6503	47717295	SO:0001583	missense	634			M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.922T>G	19.37:g.43025455A>C	ENSP00000161559:p.Cys308Gly	Unknown		x	x	x	47717295	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Missense_Mutation	SNP	ENST00000161559.6	37	CCDS12609.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	g	1.289	-0.608013	0.03717	.	.	ENSG00000079385	ENST00000161559;ENST00000358394;ENST00000446434;ENST00000378065;ENST00000352591;ENST00000403444;ENST00000403461;ENST00000308072;ENST00000377806;ENST00000344391;ENST00000403136	T;T;T;T;T;T	0.14766	2.76;2.76;2.76;2.76;2.76;2.48	5.24	3.06	0.35304	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06188	0.0160	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.09022	0.002;0.0;0.0;0.0;0.002;0.0;0.001;0.0;0.001	B;B;B;B;B;B;B;B;B	0.20577	0.03;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.40251	-0.9573	9	0.28530	T	0.3	.	7.8353	0.29365	0.2631:0.0:0.7369:0.0	.	308;308;308;308;308;308;308;308;308	P13688-10;P13688-3;P13688-4;P13688-2;P13688-11;P13688-6;P13688-5;P13688-8;P13688	.;.;.;.;.;.;.;.;CEAM1_HUMAN	G	308;308;335;268;308;308;308;268;308;308;308	ENSP00000161559:C308G;ENSP00000351165:C308G;ENSP00000244291:C308G;ENSP00000384709:C308G;ENSP00000384083:C308G;ENSP00000312184:C268G	ENSP00000161559:C308G	C	-	1	0	CEACAM1	47717295	0.002000	0.14202	0.009000	0.14445	0.102000	0.19082	0.507000	0.22675	0.803000	0.34113	-0.227000	0.12334	TGC		0.443	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712		Missense_Mutation
SYMPK	8189	broad.mit.edu	37	19	46338388	46338388	+	Silent	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr19:46338388C>T	ENST00000245934.7	-	11	1585	c.1341G>A	c.(1339-1341)aaG>aaA	p.K447K		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	447					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.K447K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GAGCCAGGTGCTTGATCTGGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19											81.0	72.0	76.0					19																	46338388		2203	4300	6503	51030228	SO:0001819	synonymous_variant	8189			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1341G>A	19.37:g.46338388C>T		Unknown		x	x	x	51030228	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	CCDS12676.2	SNP	28	Broad																																																																																				0.627	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819		Silent
ZNF415	55786	broad.mit.edu	37	19	53619603	53619603	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr19:53619603A>C	ENST00000500065.4	-	3	432	c.99T>G	c.(97-99)gaT>gaG	p.D33E	ZNF415_ENST00000595193.1_Missense_Mutation_p.D33E|ZNF415_ENST00000440291.1_5'UTR|ZNF415_ENST00000595813.1_Missense_Mutation_p.D33E|ZNF415_ENST00000597748.1_Missense_Mutation_p.D33E|ZNF415_ENST00000600574.1_Missense_Mutation_p.D33E|ZNF415_ENST00000601493.1_Intron|ZNF415_ENST00000243643.4_Missense_Mutation_p.D33E|ZNF415_ENST00000455735.2_Missense_Mutation_p.C13G|ZNF415_ENST00000421033.1_Missense_Mutation_p.C13G|ZNF415_ENST00000601215.1_Intron|ZNF415_ENST00000597503.1_Missense_Mutation_p.D33E|ZNF415_ENST00000594011.1_Missense_Mutation_p.D33E|ZNF415_ENST00000448501.1_Missense_Mutation_p.C13G|ZNF415_ENST00000596683.1_5'UTR|ZNF415_ENST00000599261.1_Missense_Mutation_p.D33E	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D33E(1)		breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CCAACATCACATCCCTGTATA	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											123.0	121.0	122.0					19																	53619603		2203	4300	6503	58311415	SO:0001583	missense	55786			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.99T>G	19.37:g.53619603A>C	ENSP00000439435:p.Asp33Glu	Unknown		x	x	x	58311415	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	SNP	8	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.132|0.132	-1.112001|-1.112001	0.01813|0.01813	.|.	.|.	ENSG00000170954|ENSG00000170954	ENST00000448501;ENST00000421033;ENST00000455735|ENST00000243643;ENST00000500065	T;T;T|T;T	0.12984|0.02258	2.63;3.04;2.63|4.37;4.37	2.95|2.95	-5.91|-5.91	0.02269|0.02269	.|.	.|.	.|.	.|.	.|.	T|T	0.03305|0.03305	0.0096|0.0096	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	B;B;B|P;D	0.02656|0.61697	0.0;0.0;0.0|0.835;0.99	B;B;B|B;D	0.01281|0.72625	0.0;0.0;0.0|0.284;0.978	T|T	0.54105|0.54105	-0.8343|-0.8343	9|9	0.56958|0.34782	D|T	0.05|0.22	.|.	4.7647|4.7647	0.13127|0.13127	0.4698:0.3165:0.2136:0.0|0.4698:0.3165:0.2136:0.0	.|.	13;13;13|33;33	B3KTG1;Q09FC8;Q09FC8-2|F5H287;Q09FC8-5	.;ZN415_HUMAN;.|.;.	G|E	13|33	ENSP00000396492:C13G;ENSP00000395055:C13G;ENSP00000388787:C13G|ENSP00000243643:D33E;ENSP00000439435:D33E	ENSP00000395055:C13G|ENSP00000243643:D33E	C|D	-|-	1|3	0|2	ZNF415|ZNF415	58311415|58311415	0.001000|0.001000	0.12720|0.12720	0.969000|0.969000	0.41365|0.41365	0.959000|0.959000	0.62525|0.62525	-2.735000|-2.735000	0.00802|0.00802	-0.952000|-0.952000	0.03649|0.03649	-0.381000|-0.381000	0.06696|0.06696	TGT|GAT		0.438	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355		Missense_Mutation
PRKCE	5581	broad.mit.edu	37	2	46228562	46228562	+	Silent	SNP	C	C	T	rs576600856		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr2:46228562C>T	ENST00000306156.3	+	7	1170	c.843C>T	c.(841-843)caC>caT	p.H281H	PRKCE_ENST00000394874.1_Silent_p.H4H	NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	281					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)	p.H281H(1)	MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TGAATGTTCACCGTCGATGTG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	2											130.0	125.0	127.0					2																	46228562		1840	3768	5608	46082066	SO:0001819	synonymous_variant	5581				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.843C>T	2.37:g.46228562C>T		Unknown		x	x	x	46082066	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Silent	SNP	ENST00000306156.3	37	CCDS1824.1	SNP	18	Broad																																																																																				0.463	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2			Silent
VWA3B	200403	broad.mit.edu	37	2	98920176	98920176	+	Silent	SNP	T	T	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr2:98920176T>A	ENST00000477737.1	+	26	3636	c.3432T>A	c.(3430-3432)ccT>ccA	p.P1144P	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1144								p.P1144P(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AATTTTGCCCTCGGAGTGCAC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	2											124.0	107.0	112.0					2																	98920176		1855	4093	5948	98286608	SO:0001819	synonymous_variant	200403			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3432T>A	2.37:g.98920176T>A		Unknown		x	x	x	98286608	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Silent	SNP	ENST00000477737.1	37	CCDS42718.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	8.571	0.880158	0.17467	.	.	ENSG00000168658	ENST00000473149	.	.	.	4.47	-2.38	0.06622	.	.	.	.	.	T	0.36635	0.0974	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32771	-0.9894	4	.	.	.	.	0.1078	0.00054	0.3134:0.1862:0.1617:0.3386	.	.	.	.	T	555	.	.	S	+	1	0	VWA3B	98286608	0.996000	0.38824	0.994000	0.49952	0.826000	0.46750	0.071000	0.14594	-0.254000	0.09500	-0.344000	0.07964	TCG		0.378	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		Silent
TTN	7273	broad.mit.edu	37	2	179399085	179399085	+	Missense_Mutation	SNP	C	C	G	rs569650065		TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr2:179399085C>G	ENST00000591111.1	-	308	97558	c.97334G>C	c.(97333-97335)aGa>aCa	p.R32445T	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R25213T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R34086T|TTN_ENST00000342992.6_Missense_Mutation_p.R31518T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R25146T|TTN_ENST00000460472.2_Missense_Mutation_p.R25021T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000589842.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32445					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R31516T(2)|p.R25021T(2)|p.R25213T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTAATGTTCTGATAACTTT	0.463													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21421	0.0		0.0	False		,,,				2504	0.0															5	Substitution - Missense(5)	NS(3)|ovary(2)	2											134.0	129.0	130.0					2																	179399085		1914	4137	6051	179107331	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97334G>C	2.37:g.179399085C>G	ENSP00000465570:p.Arg32445Thr	Unknown		x	x	x	179107331	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.08	1.251770	0.22880	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.78	5.78	0.91487	Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.21674	0.0522	N	0.08118	0	0.30163	N	0.802015	P;P;P;P	0.35155	0.487;0.487;0.487;0.487	B;B;B;B	0.27380	0.079;0.079;0.079;0.079	T	0.10382	-1.0632	9	0.87932	D	0	.	8.9717	0.35910	0.0:0.8425:0.0:0.1575	.	25021;25146;25213;32445	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	31518;25021;25213;25146;25018	ENSP00000343764:R31518T;ENSP00000434586:R25021T;ENSP00000340554:R25213T;ENSP00000352154:R25146T	ENSP00000340554:R25213T	R	-	2	0	TTN	179107331	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.210000	0.51129	2.741000	0.93983	0.555000	0.69702	AGA		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
DIDO1	11083	broad.mit.edu	37	20	61513252	61513252	+	Silent	SNP	G	G	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr20:61513252G>A	ENST00000266070.4	-	16	4381	c.4056C>T	c.(4054-4056)gaC>gaT	p.D1352D	DIDO1_ENST00000395343.1_Silent_p.D1352D	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1352					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.D1352D(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CCGGCACCCCGTCCTCTGCTG	0.577																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											1	Substitution - coding silent(1)	ovary(1)	20											88.0	103.0	98.0					20																	61513252		2203	4300	6503	60983697	SO:0001819	synonymous_variant	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4056C>T	20.37:g.61513252G>A		Unknown		x	x	x	60983697	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1	SNP	40	Broad																																																																																				0.577	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		Silent
NPBWR2	2832	broad.mit.edu	37	20	62738077	62738077	+	Silent	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr20:62738077G>T	ENST00000369768.1	-	1	447	c.108C>A	c.(106-108)acC>acA	p.T36T		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	36					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)	p.T36T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					GCTCGGAGAAGGTGGCATTGT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	20											81.0	75.0	77.0					20																	62738077		2203	4300	6503	62208521	SO:0001819	synonymous_variant	2832			U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.108C>A	20.37:g.62738077G>T		Unknown		x	x	x	62208521	Q6NWQ6|Q9H4K3	Silent	SNP	ENST00000369768.1	37	CCDS13557.1	SNP	35	Broad																																																																																				0.632	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080300.1	NM_005286		Silent
SLC26A6	65010	broad.mit.edu	37	3	48670956	48670956	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr3:48670956G>T	ENST00000395550.2	-	2	183	c.136C>A	c.(136-138)Cgc>Agc	p.R46S	SLC26A6_ENST00000383733.3_Missense_Mutation_p.R46S|SLC26A6_ENST00000358747.6_Missense_Mutation_p.R25S|SLC26A6_ENST00000455886.2_Missense_Mutation_p.R46S|SLC26A6_ENST00000482282.1_5'UTR|SLC26A6_ENST00000337000.8_Missense_Mutation_p.R46S|SLC26A6_ENST00000420764.2_Missense_Mutation_p.R46S			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	46					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.R46S(1)	SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		GAGCCCCAGCGCCCCAGCTCC	0.647																																					NSCLC(13;369 479 28271 30152 44026)											1	Substitution - Missense(1)	ovary(1)	3											72.0	78.0	76.0					3																	48670956		2034	4187	6221	48645960	SO:0001583	missense	65010			AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.136C>A	3.37:g.48670956G>T	ENSP00000378920:p.Arg46Ser	Unknown		x	x	x	48645960	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	ENST00000395550.2	37	CCDS43087.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679084	0.47886	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000431739;ENST00000426599	D;D;D;D;D;D;D;D	0.92647	-2.92;-2.92;-3.03;-2.93;-2.92;-3.08;-2.67;-2.77	4.97	1.93	0.25924	.	.	.	.	.	T	0.81456	0.4826	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.22604	0.0;0.001;0.002;0.001;0.001;0.072	B;B;B;B;B;B	0.23150	0.001;0.002;0.006;0.004;0.004;0.044	T	0.69525	-0.5122	9	0.40728	T	0.16	.	7.0139	0.24877	0.0861:0.0:0.589:0.3249	.	46;46;46;46;46;3440	B4DMZ1;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;S26A6_HUMAN;.	S	46;46;46;46;46;25;46;46;46	ENSP00000404684:R46S;ENSP00000378920:R46S;ENSP00000373239:R46S;ENSP00000337648:R46S;ENSP00000351597:R25S;ENSP00000401066:R46S;ENSP00000401813:R46S;ENSP00000405872:R46S	ENSP00000307089:R46S	R	-	1	0	SLC26A6	48645960	0.000000	0.05858	0.016000	0.15963	0.562000	0.35680	0.733000	0.26087	0.179000	0.19938	0.561000	0.74099	CGC		0.647	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911		Missense_Mutation
C3orf22	152065	broad.mit.edu	37	3	126270868	126270868	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr3:126270868C>A	ENST00000318225.2	-	3	565	c.187G>T	c.(187-189)Gtg>Ttg	p.V63L		NM_152533.1	NP_689746.1	Q8N5N4	CC022_HUMAN	chromosome 3 open reading frame 22	63								p.V63L(1)		large_intestine(1)|lung(3)|ovary(2)|prostate(1)	7				GBM - Glioblastoma multiforme(114;0.147)		CTCGTTGGCACCAACCTCTTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	3											127.0	100.0	109.0					3																	126270868		2203	4300	6503	127753558	SO:0001583	missense	152065				CCDS3040.1	3q21.3	2011-09-30			ENSG00000180697	ENSG00000180697			28534	protein-coding gene	gene with protein product						12477932	Standard	NM_152533		Approved	MGC34728	uc003ejb.3	Q8N5N4	OTTHUMG00000162731	ENST00000318225.2:c.187G>T	3.37:g.126270868C>A	ENSP00000316644:p.Val63Leu	Unknown		x	x	x	127753558	B3KUS9	Missense_Mutation	SNP	ENST00000318225.2	37	CCDS3040.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129365	0.56721	.	.	ENSG00000180697	ENST00000318225	.	.	.	3.0	2.1	0.27182	.	.	.	.	.	T	0.21387	0.0515	N	0.20986	0.625	0.27046	N	0.963906	P	0.40107	0.703	B	0.34722	0.188	T	0.07654	-1.0761	8	0.45353	T	0.12	-12.934	8.0281	0.30448	0.0:0.7484:0.2516:0.0	.	63	Q8N5N4	CC022_HUMAN	L	63	.	ENSP00000316644:V63L	V	-	1	0	C3orf22	127753558	0.999000	0.42202	0.946000	0.38457	0.949000	0.60115	1.275000	0.33144	0.819000	0.34492	0.484000	0.47621	GTG		0.632	C3orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370231.2	NM_152533		Missense_Mutation
ACAD11	84129	broad.mit.edu	37	3	132363656	132363656	+	Silent	SNP	A	A	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr3:132363656A>G	ENST00000264990.6	-	2	1205	c.234T>C	c.(232-234)ctT>ctC	p.L78L	ACAD11_ENST00000545291.1_5'UTR|ACAD11_ENST00000355458.3_Silent_p.L78L|ACAD11_ENST00000489991.1_Intron|ACAD11_ENST00000481970.2_Silent_p.L78L	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	78					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.L78L(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						GTGCTTTAGGAAGAAGTGAAC	0.338																																																1	Substitution - coding silent(1)	ovary(1)	3											94.0	98.0	96.0					3																	132363656		2203	4300	6503	133846346	SO:0001819	synonymous_variant	84129			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.234T>C	3.37:g.132363656A>G		Unknown		x	x	x	133846346	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Silent	SNP	ENST00000264990.6	37	CCDS3074.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	9.099	1.003591	0.19121	.	.	ENSG00000113971	ENST00000393144	.	.	.	6.16	3.76	0.43208	.	.	.	.	.	T	0.56366	0.1980	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56019	-0.8048	5	0.56958	D	0.05	.	2.4117	0.04426	0.6104:0.1225:0.136:0.1312	.	.	.	.	P	637	.	ENSP00000376852:S637P	S	-	1	0	NPHP3	133846346	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.436000	0.21526	0.549000	0.28973	0.528000	0.53228	TCC		0.338	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169		Silent
KY	339855	broad.mit.edu	37	3	134339676	134339676	+	Silent	SNP	G	G	A	rs374650727	byFrequency	TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr3:134339676G>A	ENST00000423778.2	-	7	568	c.507C>T	c.(505-507)gaC>gaT	p.D169D	KY_ENST00000508956.1_Silent_p.D148D|KY_ENST00000503669.1_Silent_p.D169D|KY_ENST00000508041.1_5'UTR	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	169					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)	p.D169D(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						TCACCAGTTCGTCTAGGCCAC	0.617													G|||	2	0.000399361	0.0	0.0	5008	,	,		18809	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						G		1,4031		0,1,2015	49.0	56.0	54.0		507	-9.3	0.2	3		54	0,8386		0,0,4193	no	coding-synonymous	KY	NM_178554.4		0,1,6208	AA,AG,GG		0.0,0.0248,0.0081		169/662	134339676	1,12417	2016	4193	6209	135822366	SO:0001819	synonymous_variant	339855			AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.507C>T	3.37:g.134339676G>A		Unknown		x	x	x	135822366	B7Z1S4|Q6ZT15	Silent	SNP	ENST00000423778.2	37	CCDS46920.1	SNP	40	Broad																																																																																				0.617	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554		Silent
KCNAB1	7881	broad.mit.edu	37	3	156232199	156232199	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr3:156232199G>A	ENST00000490337.1	+	9	769	c.705G>A	c.(703-705)atG>atA	p.M235I	KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Missense_Mutation_p.M188I|KCNAB1_ENST00000471742.1_Missense_Mutation_p.M224I|KCNAB1_ENST00000389636.5_Missense_Mutation_p.M206I|KCNAB1_ENST00000302490.8_Missense_Mutation_p.M217I	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	235					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.M217I(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GCATGGCGATGTACTGGGGCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											193.0	186.0	189.0					3																	156232199		2203	4300	6503	157714893	SO:0001583	missense	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.705G>A	3.37:g.156232199G>A	ENSP00000419952:p.Met235Ile	Unknown		x	x	x	157714893	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	37	CCDS3174.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.479300	0.96307	.	.	ENSG00000169282	ENST00000472028;ENST00000490337;ENST00000389636;ENST00000471742;ENST00000302490;ENST00000389634	T;T;T;T;T;T	0.40756	1.02;1.86;1.86;1.86;1.86;1.86	5.49	5.49	0.81192	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.58836	0.2150	M	0.63428	1.95	0.80722	D	1	P;P;P;P;P	0.48016	0.904;0.824;0.882;0.776;0.812	P;P;P;P;P	0.56127	0.792;0.767;0.749;0.591;0.714	T	0.59947	-0.7358	10	0.62326	D	0.03	-3.8552	18.1683	0.89736	0.0:0.0:1.0:0.0	.	206;188;217;224;235	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	I	124;235;206;224;217;188	ENSP00000420755:M124I;ENSP00000419952:M235I;ENSP00000374287:M206I;ENSP00000418956:M224I;ENSP00000305858:M217I;ENSP00000374285:M188I	ENSP00000305858:M217I	M	+	3	0	KCNAB1	157714893	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.392000	0.97252	2.565000	0.86533	0.655000	0.94253	ATG		0.393	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471		Missense_Mutation
ANKRD17	26057	broad.mit.edu	37	4	74019693	74019693	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr4:74019693C>T	ENST00000358602.4	-	6	1254	c.1138G>A	c.(1138-1140)Gtg>Atg	p.V380M	ANKRD17_ENST00000514252.1_5'Flank|ANKRD17_ENST00000330838.6_Missense_Mutation_p.V380M|ANKRD17_ENST00000509867.2_Missense_Mutation_p.V267M	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	380					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V380M(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTACTTCCACATGTCCAGCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	4											139.0	129.0	133.0					4																	74019693		2203	4300	6503	74238557	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.1138G>A	4.37:g.74019693C>T	ENSP00000351416:p.Val380Met	Unknown		x	x	x	74238557	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803635	0.90623	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.65364	-0.15;-0.15;-0.15	4.95	4.95	0.65309	Ankyrin repeat-containing domain (3);	0.000000	0.53938	D	0.000050	T	0.75693	0.3884	L	0.51853	1.615	0.43994	D	0.996697	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.85130	0.992;0.988;0.997;0.995	T	0.78593	-0.2144	10	0.87932	D	0	.	18.1916	0.89808	0.0:1.0:0.0:0.0	.	380;380;380;267	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	M	380;380;380;267;380	ENSP00000351416:V380M;ENSP00000332265:V380M;ENSP00000427151:V267M	ENSP00000332265:V380M	V	-	1	0	ANKRD17	74238557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.295000	0.77249	0.557000	0.71058	GTG		0.428	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217		Missense_Mutation
GALNTL6	442117	broad.mit.edu	37	4	173730669	173730669	+	Silent	SNP	C	C	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr4:173730669C>A	ENST00000506823.1	+	6	1368	c.711C>A	c.(709-711)gtC>gtA	p.V237V	GALNTL6_ENST00000508122.1_Silent_p.V220V	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	237	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V237V(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ACTGCGAGGTCAATGTGAACT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	4											71.0	64.0	66.0					4																	173730669		2203	4300	6503	173967244	SO:0001819	synonymous_variant	442117				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.711C>A	4.37:g.173730669C>A		Unknown		x	x	x	173967244	Q2L4S6	Silent	SNP	ENST00000506823.1	37	CCDS34104.1	SNP	29	Broad																																																																																				0.547	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845		Silent
BTN3A1	11119	broad.mit.edu	37	6	26406166	26406166	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr6:26406166C>T	ENST00000289361.6	+	3	483	c.115C>T	c.(115-117)Ccc>Tcc	p.P39S	BTN3A1_ENST00000414912.2_Missense_Mutation_p.P39S|BTN3A1_ENST00000425234.2_Missense_Mutation_p.P39S|BTN3A1_ENST00000476549.2_Missense_Mutation_p.P39S	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	39	Ig-like V-type 1.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P39S(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						ACCCTCTGGGCCCATCCTGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	6											71.0	69.0	70.0					6																	26406166		2203	4300	6503	26514145	SO:0001583	missense	11119			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.115C>T	6.37:g.26406166C>T	ENSP00000289361:p.Pro39Ser	Unknown		x	x	x	26514145	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	CCDS4608.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	.	21.9	4.211753	0.79240	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000450085;ENST00000425234;ENST00000427334;ENST00000506698;ENST00000414912	T;T;T;T;T;T;T	0.80123	-0.18;-0.18;-0.18;-0.18;-1.34;4.27;-0.18	2.21	2.21	0.28008	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80752	0.4683	M	0.64080	1.96	0.18873	N	0.999982	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.66626	-0.5876	9	0.49607	T	0.09	.	8.0313	0.30467	0.0:1.0:0.0:0.0	.	39;39;39;39	E9PGB4;O00481-3;O00481-2;O00481	.;.;.;BT3A1_HUMAN	S	39	ENSP00000420010:P39S;ENSP00000289361:P39S;ENSP00000394937:P39S;ENSP00000396684:P39S;ENSP00000399393:P39S;ENSP00000427013:P39S;ENSP00000406667:P39S	ENSP00000289361:P39S	P	+	1	0	BTN3A1	26514145	0.001000	0.12720	0.016000	0.15963	0.922000	0.55478	0.977000	0.29475	1.552000	0.49463	0.556000	0.70494	CCC		0.572	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3			Missense_Mutation
PRRC2A	7916	broad.mit.edu	37	6	31595940	31595940	+	Silent	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr6:31595940G>T	ENST00000376033.2	+	12	1923	c.1689G>T	c.(1687-1689)gtG>gtT	p.V563V	PRRC2A_ENST00000376007.4_Silent_p.V563V	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	563	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V563V(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CTCCAGGTGTGGCTGCGGCTC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	6											90.0	80.0	84.0					6																	31595940		1511	2709	4220	31703919	SO:0001819	synonymous_variant	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1689G>T	6.37:g.31595940G>T		Unknown		x	x	x	31703919	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	ENST00000376033.2	37	CCDS4708.1	SNP	47	Broad																																																																																				0.602	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686		Silent
SYNGAP1	8831	broad.mit.edu	37	6	33400020	33400020	+	Silent	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr6:33400020C>T	ENST00000418600.2	+	4	479	c.378C>T	c.(376-378)ttC>ttT	p.F126F	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Silent_p.F67F|SYNGAP1_ENST00000293748.5_Silent_p.F126F	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	126					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.F111F(1)|p.F126F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CTGCGCCCTTCCGGCCCTCGG	0.647																																																2	Substitution - coding silent(2)	ovary(2)	6											40.0	39.0	39.0					6																	33400020		2203	4300	6503	33507998	SO:0001819	synonymous_variant	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.378C>T	6.37:g.33400020C>T		Unknown		x	x	x	33507998	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	37	CCDS34434.2	SNP	30	Broad																																																																																				0.647	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		Silent
PKHD1	5314	broad.mit.edu	37	6	51701201	51701201	+	Splice_Site	SNP	C	C	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr6:51701201C>A	ENST00000371117.3	-	51	8449		c.e51+1		PKHD1_ENST00000340994.4_Splice_Site	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)						cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.?(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTAATACTCACCTGAAATAGT	0.423																																																1	Unknown(1)	ovary(1)	6											159.0	135.0	143.0					6																	51701201		2203	4300	6503	51809160	SO:0001630	splice_region_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8173+1G>T	6.37:g.51701201C>A		Unknown		x	x	x	51809160	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Splice_Site_SNP	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310719	0.81358	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4432	0.94831	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PKHD1	51809160	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.285000	0.58989	2.941000	0.99782	0.655000	0.94253	.		0.423	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	Intron	Splice_Site_SNP
BEND3	57673	broad.mit.edu	37	6	107419800	107419800	+	Silent	SNP	C	C	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr6:107419800C>G	ENST00000369042.1	-	3	385	c.195G>C	c.(193-195)ctG>ctC	p.L65L	BEND3_ENST00000429433.2_Silent_p.L65L			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	65								p.L65L(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CAGAGTCTAGCAGGCCATCGC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	6											67.0	63.0	64.0					6																	107419800		2203	4300	6503	107526493	SO:0001819	synonymous_variant	57673			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.195G>C	6.37:g.107419800C>G		Unknown		x	x	x	107526493	A2RRH2|Q9HCL9	Silent	SNP	ENST00000369042.1	37	CCDS34507.1	SNP	25	Broad																																																																																				0.592	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913		Silent
PNLDC1	154197	broad.mit.edu	37	6	160240313	160240313	+	Silent	SNP	G	G	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr6:160240313G>C	ENST00000610273.1	+	18	1599	c.1428G>C	c.(1426-1428)cgG>cgC	p.R476R	PNLDC1_ENST00000392167.3_Silent_p.R487R	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	476						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.R476R(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGGAGTACCGGGACCACCCGA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	6											112.0	84.0	94.0					6																	160240313		2203	4300	6503	160160303	SO:0001819	synonymous_variant	154197			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1428G>C	6.37:g.160240313G>C		Unknown		x	x	x	160160303	Q5TAP7|Q8N7X5	Silent	SNP	ENST00000610273.1	37	CCDS5271.1	SNP	43	Broad																																																																																				0.617	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516		Silent
HIP1	3092	broad.mit.edu	37	7	75183482	75183482	+	Silent	SNP	G	G	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr7:75183482G>C	ENST00000336926.6	-	21	2114	c.2088C>G	c.(2086-2088)gcC>gcG	p.A696A	HIP1_ENST00000434438.2_Silent_p.A696A	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	696					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.A698A(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGTCAAGTGGGCCAGCAGGG	0.557			T	PDGFRB	CMML																																		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	1	Substitution - coding silent(1)	ovary(1)	7											75.0	67.0	70.0					7																	75183482		2203	4300	6503	75021418	SO:0001819	synonymous_variant	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2088C>G	7.37:g.75183482G>C		Unknown		x	x	x	75021418	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	ENST00000336926.6	37	CCDS34669.1	SNP	43	Broad																																																																																				0.557	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		Silent
FAM180A	389558	broad.mit.edu	37	7	135418868	135418868	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr7:135418868G>C	ENST00000338588.3	-	3	642	c.377C>G	c.(376-378)aCa>aGa	p.T126R	FAM180A_ENST00000415751.1_Missense_Mutation_p.T126R|FAM180A_ENST00000435869.1_Intron	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	126						extracellular region (GO:0005576)		p.T126R(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						GGTCAGCACTGTCCTTTCAAA	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											146.0	121.0	129.0					7																	135418868		2203	4300	6503	135069408	SO:0001583	missense	389558			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.377C>G	7.37:g.135418868G>C	ENSP00000342336:p.Thr126Arg	Unknown		x	x	x	135069408	B2RP85	Missense_Mutation	SNP	ENST00000338588.3	37	CCDS5841.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332297	0.81801	.	.	ENSG00000189320	ENST00000338588;ENST00000415751	T;T	0.34859	1.34;1.34	5.65	4.76	0.60689	.	0.046057	0.85682	D	0.000000	T	0.54143	0.1840	M	0.68952	2.095	0.46849	D	0.999225	D	0.76494	0.999	D	0.64410	0.925	T	0.56974	-0.7890	10	0.62326	D	0.03	-11.802	11.5276	0.50588	0.0881:0.0:0.9119:0.0	.	126	Q6UWF9	F180A_HUMAN	R	126	ENSP00000342336:T126R;ENSP00000395467:T126R	ENSP00000342336:T126R	T	-	2	0	FAM180A	135069408	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	5.465000	0.66725	1.372000	0.46190	0.561000	0.74099	ACA		0.607	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340554.2	NM_205855		Missense_Mutation
TNKS	8658	broad.mit.edu	37	8	9610113	9610113	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr8:9610113C>T	ENST00000310430.6	+	20	3156	c.3130C>T	c.(3130-3132)Cgg>Tgg	p.R1044W	TNKS_ENST00000518281.1_Missense_Mutation_p.R807W	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1044	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)	p.R1044W(1)		NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		TGAACACCTTCGGGATATCTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	8											87.0	91.0	90.0					8																	9610113		2203	4300	6503	9647523	SO:0001583	missense	8658			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3130C>T	8.37:g.9610113C>T	ENSP00000311579:p.Arg1044Trp	Unknown		x	x	x	9647523	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019495	0.75275	.	.	ENSG00000173273	ENST00000310430;ENST00000518281	D;D	0.84944	-1.92;-1.92	5.57	4.68	0.58851	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.86789	0.6017	L	0.31578	0.945	0.80722	D	1	D	0.69078	0.997	P	0.61658	0.892	D	0.88197	0.2881	10	0.62326	D	0.03	.	16.0331	0.80597	0.135:0.865:0.0:0.0	.	1044	O95271	TNKS1_HUMAN	W	1044;807	ENSP00000311579:R1044W;ENSP00000429890:R807W	ENSP00000311579:R1044W	R	+	1	2	TNKS	9647523	0.918000	0.31147	1.000000	0.80357	0.997000	0.91878	1.964000	0.40462	1.324000	0.45282	0.650000	0.86243	CGG		0.343	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747		Missense_Mutation
LGI3	203190	broad.mit.edu	37	8	22006036	22006036	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr8:22006036G>T	ENST00000306317.2	-	8	1573	c.1284C>A	c.(1282-1284)caC>caA	p.H428Q	LGI3_ENST00000424267.2_Missense_Mutation_p.H404Q	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	428					exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)	p.H428Q(1)		endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		CGGCACGAAAGTGTTTCACAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	8											70.0	57.0	62.0					8																	22006036		2203	4300	6503	22061981	SO:0001583	missense	203190			AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599	ENST00000306317.2:c.1284C>A	8.37:g.22006036G>T	ENSP00000302297:p.His428Gln	Unknown		x	x	x	22061981	A5PLP2|Q86TL4|Q8N296	Missense_Mutation	SNP	ENST00000306317.2	37	CCDS6025.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290791	0.59976	.	.	ENSG00000168481	ENST00000306317;ENST00000424267	D;D	0.81499	-1.5;-1.5	5.19	1.59	0.23543	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.85535	0.5719	M	0.68317	2.08	0.44570	D	0.997538	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	D	0.83729	0.0197	10	0.72032	D	0.01	-46.9199	7.862	0.29516	0.4113:0.0:0.5886:0.0	.	404;428	A5PLP2;Q8N145	.;LGI3_HUMAN	Q	428;404	ENSP00000302297:H428Q;ENSP00000399121:H404Q	ENSP00000302297:H428Q	H	-	3	2	LGI3	22061981	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.056000	0.30480	0.454000	0.26884	0.561000	0.74099	CAC		0.632	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254482.1			Missense_Mutation
ANK1	286	broad.mit.edu	37	8	41580729	41580729	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr8:41580729G>T	ENST00000347528.4	-	9	906	c.823C>A	c.(823-825)Cct>Act	p.P275T	ANK1_ENST00000396942.1_Missense_Mutation_p.P275T|ANK1_ENST00000265709.8_Missense_Mutation_p.P308T|ANK1_ENST00000352337.4_Missense_Mutation_p.P275T|ANK1_ENST00000289734.7_Missense_Mutation_p.P275T|ANK1_ENST00000396945.1_Missense_Mutation_p.P275T|ANK1_ENST00000379758.2_Missense_Mutation_p.P275T	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	275	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.P275T(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CAGTGGAGAGGTGTCAATTCG	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											133.0	119.0	124.0					8																	41580729		2203	4300	6503	41699886	SO:0001583	missense	286			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.823C>A	8.37:g.41580729G>T	ENSP00000339620:p.Pro275Thr	Unknown		x	x	x	41699886	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958558	0.92726	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	5.41	5.41	0.78517	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.91663	0.7365	M	0.89478	3.035	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.865;1.0;1.0	D;D;B;D;D	0.97110	1.0;1.0;0.408;0.994;1.0	D	0.92815	0.6267	10	0.72032	D	0.01	.	19.1876	0.93649	0.0:0.0:1.0:0.0	.	308;275;275;275;275	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	T	275;275;275;275;275;275;308;275	ENSP00000339620:P275T;ENSP00000289734:P275T;ENSP00000369082:P275T;ENSP00000380149:P275T;ENSP00000380147:P275T;ENSP00000309131:P275T;ENSP00000265709:P308T	ENSP00000265709:P308T	P	-	1	0	ANK1	41699886	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.537000	0.85549	0.655000	0.94253	CCT		0.502	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		Missense_Mutation
CHD7	55636	broad.mit.edu	37	8	61778184	61778184	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr8:61778184T>C	ENST00000423902.2	+	38	9165	c.8686T>C	c.(8686-8688)Tcc>Ccc	p.S2896P	CHD7_ENST00000524602.1_Missense_Mutation_p.S847P	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2896					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.S2896P(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTTCCTCCTGTCCACAATGGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	8											95.0	102.0	100.0					8																	61778184		2048	4193	6241	61940738	SO:0001583	missense	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.8686T>C	8.37:g.61778184T>C	ENSP00000392028:p.Ser2896Pro	Unknown		x	x	x	61940738	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	11.83	1.756402	0.31137	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602	T;T	0.81078	-1.45;2.05	4.94	4.94	0.65067	.	0.000000	0.64402	D	0.000001	T	0.78227	0.4250	N	0.11313	0.125	0.58432	D	0.999999	D	0.54601	0.967	D	0.63033	0.91	T	0.79638	-0.1720	10	0.35671	T	0.21	-12.237	14.5847	0.68315	0.0:0.0:0.0:1.0	.	2896	Q9P2D1	CHD7_HUMAN	P	2896;2896;847	ENSP00000392028:S2896P;ENSP00000437061:S847P	ENSP00000307304:S2896P	S	+	1	0	CHD7	61940738	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.624000	0.83124	1.828000	0.53243	0.533000	0.62120	TCC		0.582	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		Missense_Mutation
SLCO5A1	81796	broad.mit.edu	37	8	70585335	70585335	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr8:70585335C>G	ENST00000260126.4	-	10	3022	c.2316G>C	c.(2314-2316)caG>caC	p.Q772H	SLCO5A1_ENST00000524945.1_3'UTR|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.Q717H	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	772						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.Q772H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GAAATTCTCTCTGCCTCCGCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	8											98.0	87.0	91.0					8																	70585335		2203	4300	6503	70747889	SO:0001583	missense	81796			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2316G>C	8.37:g.70585335C>G	ENSP00000260126:p.Gln772His	Unknown		x	x	x	70747889	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	CCDS6205.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464527	0.26335	.	.	ENSG00000137571	ENST00000260126;ENST00000530307	T;T	0.40756	1.13;1.02	5.93	3.0	0.34707	Major facilitator superfamily domain, general substrate transporter (1);	0.565590	0.19348	N	0.116476	T	0.31009	0.0783	N	0.24115	0.695	0.23893	N	0.996548	B;B	0.30709	0.291;0.001	B;B	0.27262	0.078;0.001	T	0.16600	-1.0397	10	0.46703	T	0.11	.	16.7456	0.85470	0.0:0.6121:0.3879:0.0	.	717;772	E9PKK5;Q9H2Y9	.;SO5A1_HUMAN	H	772;717	ENSP00000260126:Q772H;ENSP00000431611:Q717H	ENSP00000260126:Q772H	Q	-	3	2	SLCO5A1	70747889	1.000000	0.71417	0.807000	0.32361	0.879000	0.50718	1.613000	0.36900	0.835000	0.34877	0.655000	0.94253	CAG		0.522	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		Missense_Mutation
ADAMTSL1	92949	broad.mit.edu	37	9	18906802	18906802	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr9:18906802G>T	ENST00000380548.4	+	28	5413	c.5074G>T	c.(5074-5076)Gtg>Ttg	p.V1692L	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.V393L	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1692	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1692L(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GTCCCGGCGTGTGGAGTGTGT	0.637																																																1	Substitution - Missense(1)	ovary(1)	9											53.0	67.0	62.0					9																	18906802		2133	4225	6358	18896802	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.5074G>T	9.37:g.18906802G>T	ENSP00000369921:p.Val1692Leu	Unknown		x	x	x	18896802	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.260183	0.95368	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239	T;T	0.62639	0.01;0.01	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000006	T	0.81432	0.4821	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.85130	0.997;0.994;0.978	T	0.81495	-0.0907	10	0.42905	T	0.14	.	19.2299	0.93834	0.0:0.0:1.0:0.0	.	1193;393;1692	A2A344;Q8N6G6-6;Q8N6G6	.;.;ATL1_HUMAN	L	1692;393;396	ENSP00000369921:V1692L;ENSP00000369918:V393L	ENSP00000325584:V396L	V	+	1	0	ADAMTSL1	18896802	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.765000	0.98953	2.549000	0.85964	0.563000	0.77884	GTG		0.637	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			Missense_Mutation
HAUS6	54801	broad.mit.edu	37	9	19063008	19063008	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr9:19063008C>T	ENST00000380502.3	-	14	2094	c.1627G>A	c.(1627-1629)Gag>Aag	p.E543K	HAUS6_ENST00000380496.1_Missense_Mutation_p.E407K|SCARNA8_ENST00000515924.1_RNA	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	543					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.E543K(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTTCTCACCTCTTCTACCAGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	9											164.0	149.0	154.0					9																	19063008		2203	4300	6503	19053008	SO:0001583	missense	54801			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.1627G>A	9.37:g.19063008C>T	ENSP00000369871:p.Glu543Lys	Unknown		x	x	x	19053008	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392034	0.83011	.	.	ENSG00000147874	ENST00000380502;ENST00000380496;ENST00000415524	T;T;T	0.53423	1.63;1.62;0.62	5.54	5.54	0.83059	.	0.101103	0.64402	D	0.000002	T	0.68412	0.2998	M	0.72479	2.2	0.40296	D	0.97855	P;P;D;P	0.89917	0.944;0.944;1.0;0.944	P;P;D;P	0.87578	0.651;0.558;0.998;0.651	T	0.71842	-0.4470	10	0.72032	D	0.01	-7.6635	16.2177	0.82239	0.0:1.0:0.0:0.0	.	508;543;407;543	Q7Z4H7-3;Q7Z4H7-2;Q5VY60;Q7Z4H7	.;.;.;HAUS6_HUMAN	K	543;407;59	ENSP00000369871:E543K;ENSP00000369865:E407K;ENSP00000409615:E59K	ENSP00000369865:E407K	E	-	1	0	HAUS6	19053008	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	2.950000	0.49081	2.606000	0.88127	0.563000	0.77884	GAG		0.413	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645		Missense_Mutation
NOL6	65083	broad.mit.edu	37	9	33466615	33466615	+	Silent	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr9:33466615C>T	ENST00000379471.2	-	16	2130	c.2043G>A	c.(2041-2043)ctG>ctA	p.L681L	NOL6_ENST00000464829.1_Intron|NOL6_ENST00000455041.2_Silent_p.L629L			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	681					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L681L(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CAGACACGGTCAGTGGGAGAC	0.622											OREG0019137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	9											86.0	76.0	80.0					9																	33466615		2203	4300	6503	33456615	SO:0001819	synonymous_variant	65083			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2043G>A	9.37:g.33466615C>T		Unknown	840	x	x	x	33456615	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	ENST00000379471.2	37		SNP	29	Broad																																																																																				0.622	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917		Silent
CCIN	881	broad.mit.edu	37	9	36170503	36170503	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr9:36170503C>A	ENST00000335119.2	+	1	1115	c.1004C>A	c.(1003-1005)aCc>aAc	p.T335N		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	335					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.T335N(1)		breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			TCTGGTGGCACCACTGAGCAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											105.0	94.0	98.0					9																	36170503		2203	4300	6503	36160503	SO:0001583	missense	881			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.1004C>A	9.37:g.36170503C>A	ENSP00000334996:p.Thr335Asn	Unknown		x	x	x	36160503	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	CCDS6599.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.48	2.844913	0.51164	.	.	ENSG00000185972	ENST00000335119	T	0.41065	1.01	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.000000	0.64402	D	0.000015	T	0.56156	0.1966	L	0.44542	1.39	0.39043	D	0.960174	D	0.62365	0.991	D	0.78314	0.991	T	0.49204	-0.8964	10	0.29301	T	0.29	.	15.9243	0.79603	0.0:1.0:0.0:0.0	.	335	Q13939	CALI_HUMAN	N	335	ENSP00000334996:T335N	ENSP00000334996:T335N	T	+	2	0	CCIN	36160503	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.995000	0.49441	2.839000	0.97877	0.655000	0.94253	ACC		0.557	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893		Missense_Mutation
HIATL1	84641	broad.mit.edu	37	9	97207275	97207275	+	Silent	SNP	C	C	T			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chr9:97207275C>T	ENST00000375344.3	+	6	809	c.540C>T	c.(538-540)gtC>gtT	p.V180V	HIATL1_ENST00000428393.2_Silent_p.V115V	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	180					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.V180V(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				CTAGTCTTGTCAGCAGCCCGG	0.557																																					Pancreas(77;1260 1915 1973 10423)											1	Substitution - coding silent(1)	ovary(1)	9											122.0	110.0	114.0					9																	97207275		2203	4300	6503	96247096	SO:0001819	synonymous_variant	84641			AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.540C>T	9.37:g.97207275C>T		Unknown		x	x	x	96247096	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Silent	SNP	ENST00000375344.3	37	CCDS6710.2	SNP	29	Broad																																																																																				0.557	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053184.1	NM_032558		Silent
USP26	83844	broad.mit.edu	37	X	132160330	132160330	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2354-01	TCGA-59-2354-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-59-2354-01	TCGA-59-2354-11	g.chrX:132160330G>C	ENST00000511190.1	-	6	2388	c.1919C>G	c.(1918-1920)tCt>tGt	p.S640C	USP26_ENST00000406273.1_Missense_Mutation_p.S640C|USP26_ENST00000370832.1_Missense_Mutation_p.S640C	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	640	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.S640C(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TGAGTATACAGATTCTAGCTC	0.403																																					NSCLC(104;342 1621 36940 47097 52632)											1	Substitution - Missense(1)	ovary(1)	X											96.0	82.0	87.0					X																	132160330		2203	4300	6503	131987996	SO:0001583	missense	83844			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1919C>G	X.37:g.132160330G>C	ENSP00000423390:p.Ser640Cys	Unknown		x	x	x	131987996	B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	CCDS14635.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	11.35	1.614148	0.28712	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.55760	0.5;0.5;0.5	3.91	-3.68	0.04463	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.602944	0.12675	N	0.448482	T	0.39963	0.1098	N	0.08118	0	0.09310	N	1	P	0.52170	0.951	P	0.59115	0.852	T	0.38457	-0.9660	10	0.72032	D	0.01	-0.7857	5.3235	0.15893	0.3593:0.1816:0.4591:0.0	.	640	Q9BXU7	UBP26_HUMAN	C	640	ENSP00000359869:S640C;ENSP00000423390:S640C;ENSP00000384360:S640C	ENSP00000359869:S640C	S	-	2	0	USP26	131987996	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.031000	0.12287	-0.761000	0.04670	-1.166000	0.01754	TCT		0.403	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		Missense_Mutation
