#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACTRT2	140625	broad.mit.edu	37	1	2939049	2939049	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:2939049C>G	ENST00000378404.2	+	1	1004	c.799C>G	c.(799-801)Cag>Gag	p.Q267E		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	267						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q267E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		GTTCGTGCCCCAGCAGCTGGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	49.0	46.0					1																	2939049		2201	4296	6497	2928909	SO:0001583	missense	140625			AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.799C>G	1.37:g.2939049C>G	ENSP00000367658:p.Gln267Glu	Unknown		x	x	x	2928909	B1AN52|Q8NHS6|Q8TDG1	Missense_Mutation	SNP	ENST00000378404.2	37	CCDS45.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	2.515	-0.312042	0.05422	.	.	ENSG00000169717	ENST00000378404;ENST00000543312	T	0.06933	3.24	4.85	3.92	0.45320	.	0.910652	0.09313	N	0.819310	T	0.03305	0.0096	N	0.00873	-1.125	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37619	-0.9698	10	0.87932	D	0	.	9.1494	0.36953	0.0:0.1629:0.6752:0.1619	.	267	Q8TDY3	ACTT2_HUMAN	E	267	ENSP00000367658:Q267E	ENSP00000367658:Q267E	Q	+	1	0	ACTRT2	2928909	0.013000	0.17824	0.633000	0.29310	0.085000	0.17905	1.374000	0.34283	1.024000	0.39682	-0.270000	0.10280	CAG		0.632	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1	NM_080431		Missense_Mutation
TP73-AS1	57212	broad.mit.edu	37	1	3662744	3662744	+	RNA	SNP	G	G	A	rs541058441		TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:3662744G>A	ENST00000452079.1	-	0	1142				TP73-AS1_ENST00000423764.1_RNA|TP73-AS1_ENST00000544565.1_RNA|TP73-AS1_ENST00000418088.1_RNA|TP73-AS1_ENST00000608600.1_RNA	NR_033711.1		Q9UF72	T73AS_HUMAN	TP73 antisense RNA 1							extracellular region (GO:0005576)											GATCCGAGGCGGCTGAGCTGG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		17467	0.001		0.0	False		,,,				2504	0.0															0			1											35.0	41.0	39.0					1																	3662744		2189	4281	6470	3652604			57212					1p36.32	2014-01-20	2014-01-20	2014-01-20	ENSG00000227372	ENSG00000227372		"""Long non-coding RNAs"""	29052	non-coding RNA	RNA, long non-coding	"""p53-dependent apoptosis modulator"""		"""KIAA0495"""	KIAA0495		9455484, 20477830, 23726844	Standard	NR_033708		Approved	PDAM	uc009vlm.3	Q9UF72	OTTHUMG00000003414		1.37:g.3662744G>A		Unknown		x	x	x	3652604		Silent	SNP	ENST00000452079.1	37		SNP	39	Broad																																																																																				0.577	TP73-AS1-003	KNOWN	basic	antisense	antisense	OTTHUMT00000009558.1	NR_033708		Silent
CLCNKB	1188	broad.mit.edu	37	1	16378692	16378692	+	Splice_Site	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:16378692G>A	ENST00000375679.4	+	15	1519		c.e15-1		CLCNKB_ENST00000375667.3_Splice_Site	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCCTTGCAGGGGCTGCAGC	0.642																																																1	Unknown(1)	ovary(1)	1											40.0	41.0	40.0					1																	16378692		2202	4297	6499	16251279	SO:0001630	splice_region_variant	1188			AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.1409-1G>A	1.37:g.16378692G>A		Unknown		x	x	x	16251279	B3KUY3|Q5T5Q7|Q5T5Q8	Splice_Site_SNP	SNP	ENST00000375679.4	37	CCDS168.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	.	19.03	3.748746	0.69533	.	.	ENSG00000184908	ENST00000375679;ENST00000331579;ENST00000375667	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9387	0.79736	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CLCNKB	16251279	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.276000	0.95745	2.089000	0.63090	0.555000	0.69702	.		0.642	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	Intron	Splice_Site_SNP
AGBL4	84871	broad.mit.edu	37	1	49511278	49511278	+	Missense_Mutation	SNP	C	C	T	rs200395475	byFrequency	TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:49511278C>T	ENST00000371839.1	-	5	688	c.572G>A	c.(571-573)cGg>cAg	p.R191Q	AGBL4_ENST00000371838.1_Missense_Mutation_p.R191Q|RP11-141A19.1_ENST00000456002.1_RNA|AGBL4_ENST00000371836.1_Missense_Mutation_p.R191Q	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	191					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.R191Q(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CAGCTGCTCCCGAAAGAAGTA	0.453													C|||	2	0.000399361	0.0	0.0	5008	,	,		15471	0.001		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	1											50.0	52.0	51.0					1																	49511278		1931	4140	6071	49283865	SO:0001583	missense	84871			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.572G>A	1.37:g.49511278C>T	ENSP00000360905:p.Arg191Gln	Unknown		x	x	x	49283865	B3KT26|B4DG37	Missense_Mutation	SNP	ENST00000371839.1	37	CCDS44137.1	SNP	23	Broad	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	C|C	35|35	5.548862|5.548862	0.96488|0.96488	.|.	.|.	ENSG00000186094|ENSG00000186094	ENST00000416121|ENST00000371839;ENST00000411952;ENST00000371838;ENST00000371836	.|T;T;T	.|0.26660	.|2.85;2.85;1.72	5.6|5.6	5.6|5.6	0.85130|0.85130	.|Peptidase M14, carboxypeptidase A (1);	.|0.344140	.|0.24467	.|N	.|0.038270	T|T	0.48390|0.48390	0.1497|0.1497	L|L	0.55834|0.55834	1.745|1.745	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.85130	.|0.928;0.933;0.98;0.997	T|T	0.23190|0.23190	-1.0195|-1.0195	5|9	.|.	.|.	.|.	-10.2808|-10.2808	18.6038|18.6038	0.91259|0.91259	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|6;203;36;191	.|A0AVJ2;Q5VU57-2;B1AMW2;Q5VU57	.|.;.;.;CBPC6_HUMAN	R|Q	37|191;185;191;191	.|ENSP00000360905:R191Q;ENSP00000360904:R191Q;ENSP00000360902:R191Q	.|.	G|R	-|-	1|2	0|0	AGBL4|AGBL4	49283865|49283865	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.431000|7.431000	0.80335|0.80335	2.640000|2.640000	0.89533|0.89533	0.563000|0.563000	0.77884|0.77884	GGG|CGG		0.453	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021346.4	NM_032785		Missense_Mutation
ZYG11B	79699	broad.mit.edu	37	1	53267785	53267785	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:53267785A>T	ENST00000294353.6	+	10	1814	c.1669A>T	c.(1669-1671)Att>Ttt	p.I557F	ZYG11B_ENST00000545132.1_Missense_Mutation_p.I557F|RNU6-969P_ENST00000383900.1_RNA|ZYG11B_ENST00000443756.2_Intron	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	557								p.I557F(1)		breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TGAGTCATCCATTCAGCAGAA	0.299																																																1	Substitution - Missense(1)	ovary(1)	1											117.0	121.0	120.0					1																	53267785		2203	4300	6503	53040373	SO:0001583	missense	79699			AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.1669A>T	1.37:g.53267785A>T	ENSP00000294353:p.Ile557Phe	Unknown		x	x	x	53040373	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	37	CCDS30717.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	24.9	4.577349	0.86645	.	.	ENSG00000162378	ENST00000545132;ENST00000294353	T;T	0.57907	0.37;0.37	5.42	5.42	0.78866	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	M	0.79475	2.455	0.58432	D	0.999999	D	0.56287	0.975	P	0.55824	0.785	T	0.74074	-0.3782	10	0.87932	D	0	.	15.4463	0.75232	1.0:0.0:0.0:0.0	.	557	Q9C0D3	ZY11B_HUMAN	F	557	ENSP00000441315:I557F;ENSP00000294353:I557F	ENSP00000294353:I557F	I	+	1	0	ZYG11B	53040373	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.190000	0.77755	2.048000	0.60808	0.482000	0.46254	ATT		0.299	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646		Missense_Mutation
INADL	10207	broad.mit.edu	37	1	62228765	62228765	+	Silent	SNP	T	T	C			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:62228765T>C	ENST00000371158.2	+	3	217	c.103T>C	c.(103-105)Tta>Cta	p.L35L	INADL_ENST00000316485.6_Silent_p.L35L	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	35	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.L35L(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GAATGAGAAGTTATCTATGTT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	1											91.0	82.0	85.0					1																	62228765		2203	4300	6503	62001353	SO:0001819	synonymous_variant	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.103T>C	1.37:g.62228765T>C		Unknown		x	x	x	62001353	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	ENST00000371158.2	37	CCDS617.2	SNP	60	Broad																																																																																				0.433	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605		Silent
UAP1	6675	broad.mit.edu	37	1	162546747	162546747	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:162546747A>G	ENST00000367925.1	+	2	493	c.461A>G	c.(460-462)tAt>tGt	p.Y154C	UAP1_ENST00000367924.1_Missense_Mutation_p.Y154C|UAP1_ENST00000271469.3_Missense_Mutation_p.Y154C|UAP1_ENST00000367926.4_Missense_Mutation_p.Y154C			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	154					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)	p.Y154C(1)		breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			GAAAAATATTATGGCAACAAA	0.353																																																1	Substitution - Missense(1)	ovary(1)	1											93.0	84.0	87.0					1																	162546747		2203	4300	6503	160813371	SO:0001583	missense	6675			AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.461A>G	1.37:g.162546747A>G	ENSP00000356902:p.Tyr154Cys	Unknown		x	x	x	160813371	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Missense_Mutation	SNP	ENST00000367925.1	37		SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463397	0.43736	.	.	ENSG00000117143	ENST00000412525;ENST00000367926;ENST00000271469;ENST00000367925;ENST00000367924	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.13	2.64	0.31445	.	0.267778	0.42821	D	0.000653	T	0.07007	0.0178	N	0.12887	0.27	0.25211	N	0.989971	B	0.02656	0.0	B	0.04013	0.001	T	0.16719	-1.0393	9	0.36615	T	0.2	-5.5673	5.9987	0.19509	0.7729:0.0:0.0817:0.1454	.	154	Q16222-2	.	C	154	ENSP00000395648:Y154C;ENSP00000356903:Y154C;ENSP00000271469:Y154C;ENSP00000356902:Y154C;ENSP00000356901:Y154C	ENSP00000271469:Y154C	Y	+	2	0	UAP1	160813371	0.976000	0.34144	0.114000	0.21550	0.745000	0.42441	4.487000	0.60293	0.906000	0.36621	0.482000	0.46254	TAT		0.353	UAP1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000083203.1	NM_003115		Missense_Mutation
CFHR3	10878	broad.mit.edu	37	1	196759356	196759356	+	Splice_Site	SNP	A	A	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:196759356A>T	ENST00000367425.4	+	5	887	c.795A>T	c.(793-795)atA>atT	p.I265I	CFHR3_ENST00000391985.3_Splice_Site_p.I204I	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	265	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.I265I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						CAAGATGCATACGTAAGTTCT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	1											22.0	30.0	28.0					1																	196759356		1497	3835	5332	195025979	SO:0001630	splice_region_variant	10878			X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.796+1A>T	1.37:g.196759356A>T		Unknown		x	x	x	195025979	B4DPR0|Q9UJ16	Silent	SNP	ENST00000367425.4	37	CCDS30958.1	SNP	14	Broad																																																																																				0.358	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087505.2	NM_021023	Silent	Silent
NEURL1	9148	broad.mit.edu	37	10	105344923	105344923	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr10:105344923C>T	ENST00000369780.4	+	4	1689	c.1280C>T	c.(1279-1281)tCg>tTg	p.S427L	NEURL_ENST00000369777.2_Missense_Mutation_p.S410L	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		427	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S427L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GTGGACGCCTCGCAGCCGCTT	0.687																																																1	Substitution - Missense(1)	ovary(1)	10											8.0	8.0	8.0					10																	105344923		2057	4105	6162	105334913	SO:0001583	missense	9148																														ENST00000369780.4:c.1280C>T	10.37:g.105344923C>T	ENSP00000358795:p.Ser427Leu	Unknown		x	x	x	105334913	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	CCDS7551.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840753	0.91197	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	4.82	4.82	0.62117	NEUZ (1);	0.000000	0.85682	D	0.000000	T	0.79299	0.4422	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.82004	-0.0672	9	0.62326	D	0.03	-16.5207	17.8895	0.88867	0.0:1.0:0.0:0.0	.	427	O76050	NEU1A_HUMAN	L	427;410	.	ENSP00000358792:S410L	S	+	2	0	NEURL	105334913	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	7.818000	0.86416	2.223000	0.72356	0.313000	0.20887	TCG		0.687	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			Missense_Mutation
PDCD4	27250	broad.mit.edu	37	10	112641175	112641175	+	Silent	SNP	G	G	T	rs372715017	byFrequency	TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr10:112641175G>T	ENST00000280154.7	+	3	502	c.228G>T	c.(226-228)tcG>tcT	p.S76S	PDCD4_ENST00000393104.2_Silent_p.S65S	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	76					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.S76S(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GAGGCGATTCGGTCAGCGACA	0.498																																					Ovarian(115;1498 1603 9363 40056 40885)											1	Substitution - coding silent(1)	ovary(1)	10											92.0	99.0	97.0					10																	112641175		2203	4300	6503	112631165	SO:0001819	synonymous_variant	27250			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.228G>T	10.37:g.112641175G>T		Unknown		x	x	x	112631165	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Silent	SNP	ENST00000280154.7	37	CCDS7567.1	SNP	39	Broad																																																																																				0.498	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456		Silent
OR51T1	401665	broad.mit.edu	37	11	4903555	4903555	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr11:4903555G>A	ENST00000322049.1	+	1	426	c.426G>A	c.(424-426)atG>atA	p.M142I	OR51T1_ENST00000380378.1_Missense_Mutation_p.M169I|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M142I(1)|p.M169I(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGACAGGATGGTCCTGGTGA	0.512																																																2	Substitution - Missense(2)	ovary(2)	11											156.0	136.0	143.0					11																	4903555		2201	4298	6499	4860131	SO:0001583	missense	401665			BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.426G>A	11.37:g.4903555G>A	ENSP00000322679:p.Met142Ile	Unknown		x	x	x	4860131	Q6IFH9	Missense_Mutation	SNP	ENST00000322049.1	37		SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	0.175	-1.067281	0.01934	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.36520	1.25;1.25	4.68	-2.25	0.06888	GPCR, rhodopsin-like superfamily (1);	0.745901	0.11988	N	0.510130	T	0.12689	0.0308	N	0.04787	-0.16	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.21895	-1.0232	10	0.22706	T	0.39	.	1.7882	0.03046	0.2606:0.2987:0.3276:0.113	.	142	Q8NGJ9	O51T1_HUMAN	I	169;142	ENSP00000369738:M169I;ENSP00000322679:M142I	ENSP00000322679:M142I	M	+	3	0	OR51T1	4860131	0.000000	0.05858	0.043000	0.18650	0.008000	0.06430	-1.396000	0.02513	-0.218000	0.10018	0.484000	0.47621	ATG		0.512	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759		Missense_Mutation
KIF18A	81930	broad.mit.edu	37	11	28056981	28056981	+	Silent	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr11:28056981G>A	ENST00000263181.6	-	15	2747	c.2457C>T	c.(2455-2457)tcC>tcT	p.S819S		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	819					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)	p.S819S(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						TTGCCATGTAGGATGGCACCA	0.328																																																1	Substitution - coding silent(1)	ovary(1)	11											78.0	71.0	74.0					11																	28056981		2201	4299	6500	28013557	SO:0001819	synonymous_variant	81930			AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.2457C>T	11.37:g.28056981G>A		Unknown		x	x	x	28013557	Q4VPE3|Q86VS5|Q9H0F3	Silent	SNP	ENST00000263181.6	37	CCDS7867.1	SNP	35	Broad																																																																																				0.328	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	NM_031217		Silent
NADSYN1	55191	broad.mit.edu	37	11	71201976	71201976	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr11:71201976T>A	ENST00000319023.2	+	17	1836	c.1648T>A	c.(1648-1650)Ttc>Atc	p.F550I	NADSYN1_ENST00000530055.1_Missense_Mutation_p.F179I|NADSYN1_ENST00000539574.1_Missense_Mutation_p.F290I	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	550	Ligase. {ECO:0000250}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)	p.F550I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	CCTCAGGGCCTTCGTCCAGTT	0.632																																					Ovarian(79;763 1781 6490 50276)											1	Substitution - Missense(1)	ovary(1)	11											170.0	124.0	139.0					11																	71201976		2200	4294	6494	70879624	SO:0001583	missense	55191			AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.1648T>A	11.37:g.71201976T>A	ENSP00000326424:p.Phe550Ile	Unknown		x	x	x	70879624	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	ENST00000319023.2	37	CCDS8201.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	.	18.24	3.580964	0.65992	.	.	ENSG00000172890	ENST00000319023;ENST00000539574;ENST00000530055	T;T;T	0.38401	1.14;1.14;1.14	4.79	4.79	0.61399	NAD/GMP synthase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.58793	0.2147	M	0.73753	2.245	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.968;1.0	T	0.63422	-0.6641	10	0.72032	D	0.01	-34.7443	12.2903	0.54815	0.0:0.0:0.0:1.0	.	290;550	B3KUU4;Q6IA69	.;NADE_HUMAN	I	550;290;179	ENSP00000326424:F550I;ENSP00000443718:F290I;ENSP00000431820:F179I	ENSP00000326424:F550I	F	+	1	0	NADSYN1	70879624	1.000000	0.71417	0.749000	0.31150	0.009000	0.06853	6.974000	0.76122	1.797000	0.52628	0.459000	0.35465	TTC		0.632	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	NM_018161		Missense_Mutation
ACSM4	341392	broad.mit.edu	37	12	7457110	7457110	+	Silent	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr12:7457110G>A	ENST00000399422.4	+	1	231	c.183G>A	c.(181-183)caG>caA	p.Q61Q		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	61					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						TGCTGGACCAGTGGTCCCAAA	0.473																																																0			12											92.0	88.0	89.0					12																	7457110		1978	4158	6136	7348377	SO:0001819	synonymous_variant	341392				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.183G>A	12.37:g.7457110G>A		Unknown		x	x	x	7348377	A8MTI6	Silent	SNP	ENST00000399422.4	37	CCDS44825.1	SNP	36	Broad																																																																																				0.473	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454		Silent
SOX5	6660	broad.mit.edu	37	12	23716277	23716277	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr12:23716277T>G	ENST00000451604.2	-	11	1504	c.1403A>C	c.(1402-1404)gAg>gCg	p.E468A	SOX5_ENST00000381381.2_Intron|SOX5_ENST00000396007.2_Missense_Mutation_p.E82A|SOX5_ENST00000545921.1_Missense_Mutation_p.E458A|SOX5_ENST00000546136.1_Missense_Mutation_p.E455A|SOX5_ENST00000541536.1_Intron|SOX5_ENST00000309359.1_Missense_Mutation_p.E455A|SOX5_ENST00000537393.1_Missense_Mutation_p.E433A			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	468					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E468A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TCGGAGTTGCTCCTTCATTTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											180.0	154.0	163.0					12																	23716277		2203	4300	6503	23607544	SO:0001583	missense	6660			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1403A>C	12.37:g.23716277T>G	ENSP00000398273:p.Glu468Ala	Unknown		x	x	x	23607544	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	24.1	4.488545	0.84854	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000396007;ENST00000545921	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.62146	0.2404	M	0.77820	2.39	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.996	D;D;D	0.77557	0.99;0.978;0.987	T	0.63959	-0.6519	10	0.49607	T	0.09	.	16.3871	0.83514	0.0:0.0:0.0:1.0	.	433;468;82	F5H0I3;P35711;P35711-3	.;SOX5_HUMAN;.	A	455;455;468;420;433;82;458	ENSP00000437487:E455A;ENSP00000308927:E455A;ENSP00000398273:E468A;ENSP00000439832:E433A;ENSP00000379328:E82A;ENSP00000443520:E458A	ENSP00000308927:E455A	E	-	2	0	SOX5	23607544	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	7.684000	0.84104	2.270000	0.75569	0.482000	0.46254	GAG		0.428	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		Missense_Mutation
AMDHD1	144193	broad.mit.edu	37	12	96354201	96354201	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr12:96354201G>T	ENST00000266736.2	+	5	719	c.613G>T	c.(613-615)Gat>Tat	p.D205Y		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	205					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						TGAAGCTGCTGATGACATCAT	0.408																																																0			12											85.0	80.0	81.0					12																	96354201		2203	4300	6503	94878332	SO:0001583	missense	144193			AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.613G>T	12.37:g.96354201G>T	ENSP00000266736:p.Asp205Tyr	Unknown		x	x	x	94878332	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402281	0.62288	.	.	ENSG00000139344	ENST00000266736	T	0.50548	0.74	5.55	5.55	0.83447	Metal-dependent hydrolase, composite domain (1);	0.225081	0.53938	D	0.000054	T	0.64505	0.2604	M	0.78049	2.395	0.49130	D	0.999759	P	0.46457	0.878	P	0.51229	0.663	T	0.68368	-0.5427	10	0.87932	D	0	-2.3336	19.8741	0.96863	0.0:0.0:1.0:0.0	.	205	Q96NU7	HUTI_HUMAN	Y	205	ENSP00000266736:D205Y	ENSP00000266736:D205Y	D	+	1	0	AMDHD1	94878332	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	5.983000	0.70540	2.761000	0.94854	0.655000	0.94253	GAT		0.408	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435		Missense_Mutation
TBX3	6926	broad.mit.edu	37	12	115114271	115114271	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr12:115114271G>C	ENST00000257566.3	-	6	1335	c.946C>G	c.(946-948)Cag>Gag	p.Q316E	TBX3_ENST00000349155.2_Missense_Mutation_p.Q296E	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	316					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q316E(1)		breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		AGGGTGAGCTGTTTTCTGTGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											109.0	100.0	103.0					12																	115114271		2203	4300	6503	113598654	SO:0001583	missense	6926			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.946C>G	12.37:g.115114271G>C	ENSP00000257566:p.Gln316Glu	Unknown		x	x	x	113598654	Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	37	CCDS9176.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706661	0.89018	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.88586	-2.4;-2.39	5.11	5.11	0.69529	.	0.436911	0.26605	N	0.023441	D	0.93812	0.8021	M	0.76838	2.35	0.80722	D	1	D;D	0.63046	0.992;0.969	P;D	0.64877	0.888;0.93	D	0.93324	0.6695	10	0.40728	T	0.16	.	17.516	0.87773	0.0:0.0:1.0:0.0	.	296;316	O15119-2;O15119	.;TBX3_HUMAN	E	296;316;316	ENSP00000257567:Q296E;ENSP00000257566:Q316E	ENSP00000257566:Q316E	Q	-	1	0	TBX3	113598654	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.188000	0.94921	2.363000	0.80096	0.655000	0.94253	CAG		0.478	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996		Missense_Mutation
COL4A1	1282	broad.mit.edu	37	13	110831691	110831691	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr13:110831691C>G	ENST00000375820.4	-	30	2392	c.2271G>C	c.(2269-2271)aaG>aaC	p.K757N		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	757	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.K757N(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CAATGCTCCCCTTCTCCCCGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	13											78.0	81.0	80.0					13																	110831691		2203	4300	6503	109629692	SO:0001583	missense	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2271G>C	13.37:g.110831691C>G	ENSP00000364979:p.Lys757Asn	Unknown		x	x	x	109629692	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578559	0.46006	.	.	ENSG00000187498	ENST00000375820	D	0.93547	-3.24	4.7	1.99	0.26369	.	0.000000	0.85682	D	0.000000	D	0.94591	0.8257	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91544	0.5252	10	0.49607	T	0.09	.	5.4805	0.16721	0.1283:0.5376:0.0:0.3341	.	757	P02462	CO4A1_HUMAN	N	757	ENSP00000364979:K757N	ENSP00000364979:K757N	K	-	3	2	COL4A1	109629692	0.979000	0.34478	0.989000	0.46669	0.386000	0.30323	0.183000	0.16919	0.155000	0.19261	0.655000	0.94253	AAG		0.587	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			Missense_Mutation
ARHGEF40	55701	broad.mit.edu	37	14	21547122	21547122	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr14:21547122C>A	ENST00000298694.4	+	11	2453	c.2326C>A	c.(2326-2328)Cac>Aac	p.H776N	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.H776N			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	776						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H776N(1)		large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						CTCCAACCTGCACGTGCAGCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	14											61.0	55.0	57.0					14																	21547122		2203	4300	6503	20616962	SO:0001583	missense	55701				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.2326C>A	14.37:g.21547122C>A	ENSP00000298694:p.His776Asn	Unknown		x	x	x	20616962	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	11.88	1.770771	0.31320	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02216	4.45;4.39	5.3	4.33	0.51752	.	0.411593	0.21075	N	0.080583	T	0.02193	0.0068	L	0.36672	1.1	0.09310	N	1	B;B	0.18310	0.027;0.009	B;B	0.16289	0.015;0.007	T	0.43245	-0.9403	10	0.27785	T	0.31	.	7.9979	0.30280	0.0:0.8892:0.0:0.1108	.	776;776	Q8TER5-4;Q8TER5	.;ARH40_HUMAN	N	776	ENSP00000298694:H776N;ENSP00000298693:H776N	ENSP00000298693:H776N	H	+	1	0	ARHGEF40	20616962	0.020000	0.18652	0.398000	0.26321	0.969000	0.65631	0.979000	0.29500	2.756000	0.94617	0.563000	0.77884	CAC		0.627	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1			Missense_Mutation
SLC25A29	123096	broad.mit.edu	37	14	100759630	100759630	+	Splice_Site	SNP	C	C	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr14:100759630C>A	ENST00000359232.3	-	3	463		c.e3+1		AL157871.2_ENST00000553954.1_RNA|RP11-638I2.6_ENST00000556458.1_lincRNA|SLC25A29_ENST00000539621.1_Splice_Site|SLC25A29_ENST00000554912.1_Splice_Site|SLC25A29_ENST00000556505.1_Splice_Site|SLC25A29_ENST00000555927.1_Splice_Site|SLC25A29_ENST00000392908.3_Splice_Site	NM_001039355.1	NP_001034444.1	Q8N8R3	MCATL_HUMAN	solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29							integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	acyl carnitine transmembrane transporter activity (GO:0015227)	p.?(1)		NS(1)|endometrium(1)|ovary(1)	3		Melanoma(154;0.152)			L-Carnitine(DB00583)	AGGCCACTCACGCTCTCTTGC	0.622																																																1	Unknown(1)	ovary(1)	14											66.0	43.0	50.0					14																	100759630		2202	4300	6502	99829383	SO:0001630	splice_region_variant	123096			AK095532	CCDS32156.1	14q32.2	2013-05-22	2012-03-29	2004-01-21	ENSG00000197119	ENSG00000197119		"""Solute carriers"""	20116	protein-coding gene	gene with protein product		615064	"""chromosome 14 open reading frame 69"", ""solute carrier family 25, member 29"""	C14orf69			Standard	XM_005267343		Approved	FLJ38975	uc010twx.2	Q8N8R3	OTTHUMG00000171569	ENST00000359232.3:c.162+1G>T	14.37:g.100759630C>A		Unknown		x	x	x	99829383	A3KMR5|Q541V0	Splice_Site_SNP	SNP	ENST00000359232.3	37	CCDS32156.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845929	0.32606	.	.	ENSG00000197119	ENST00000359232;ENST00000392908;ENST00000554060	.	.	.	4.25	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.665	0.85250	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC25A29	99829383	1.000000	0.71417	0.980000	0.43619	0.095000	0.18619	7.188000	0.77739	1.932000	0.55993	0.467000	0.42956	.		0.622	SLC25A29-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072449.3		Intron	Splice_Site_SNP
HERC2	8924	broad.mit.edu	37	15	28408371	28408371	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr15:28408371T>A	ENST00000261609.7	-	69	10723	c.10615A>T	c.(10615-10617)Agt>Tgt	p.S3539C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.S3539C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATCAGCAGACTGGTGAACTCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	15											126.0	113.0	117.0					15																	28408371		2203	4300	6503	26081966	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10615A>T	15.37:g.28408371T>A	ENSP00000261609:p.Ser3539Cys	Unknown		x	x	x	26081966		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652575	0.47362	.	.	ENSG00000128731	ENST00000261609	T	0.40756	1.02	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	N	0.22421	0.69	0.58432	D	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.07404	-1.0774	10	0.41790	T	0.15	.	10.5237	0.44934	0.0:0.0761:0.0:0.9239	.	3539	O95714	HERC2_HUMAN	C	3539	ENSP00000261609:S3539C	ENSP00000261609:S3539C	S	-	1	0	HERC2	26081966	1.000000	0.71417	0.994000	0.49952	0.912000	0.54170	4.084000	0.57650	2.063000	0.61619	0.533000	0.62120	AGT		0.537	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		Missense_Mutation
CASC4	113201	broad.mit.edu	37	15	44673004	44673004	+	Splice_Site	SNP	A	A	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr15:44673004A>G	ENST00000345795.2	+	8	1172	c.902A>G	c.(901-903)gAt>gGt	p.D301G	CASC4_ENST00000299957.6_Splice_Site_p.D301G|CASC4_ENST00000360824.3_3'UTR	NM_177974.2	NP_816929.1	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4	301						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.D301G(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(2)	17		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		TATGCCACAGATTCACACATA	0.348																																																1	Substitution - Missense(1)	ovary(1)	15											48.0	47.0	47.0					15																	44673004		2198	4298	6496	42460296	SO:0001630	splice_region_variant	113201			AF103804	CCDS10108.1, CCDS10109.1	15q15.1	2010-11-24			ENSG00000166734	ENSG00000166734			24892	protein-coding gene	gene with protein product						10497265	Standard	NM_138423		Approved	H63, DKFZp459F1927	uc001ztp.3	Q6P4E1	OTTHUMG00000131133	ENST00000345795.2:c.902-1A>G	15.37:g.44673004A>G		Unknown		x	x	x	42460296	B4DPZ6|G5E934|Q6UY45|Q96EM1	Missense_Mutation	SNP	ENST00000345795.2	37	CCDS10109.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	6.468	0.454472	0.12283	.	.	ENSG00000166734	ENST00000299957;ENST00000345795;ENST00000416522	.	.	.	4.68	1.01	0.19927	.	0.638794	0.14759	N	0.300084	T	0.27098	0.0664	N	0.14661	0.345	0.80722	D	1	B;B;B	0.12630	0.001;0.001;0.006	B;B;B	0.09377	0.001;0.0;0.004	T	0.06215	-1.0839	8	.	.	.	.	3.3446	0.07131	0.5633:0.2084:0.2284:0.0	.	301;301;301	Q6P4E1-2;G5E934;Q6P4E1	.;.;CASC4_HUMAN	G	301;301;280	.	.	D	+	2	0	CASC4	42460296	0.998000	0.40836	0.995000	0.50966	0.350000	0.29205	0.308000	0.19314	0.162000	0.19483	0.397000	0.26171	GAT		0.348	CASC4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253816.1	NM_138423	Missense_Mutation	Missense_Mutation
FAHD1	81889	broad.mit.edu	37	16	1877886	1877887	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr16:1877886_1877887TG>CT	ENST00000427358.2	+	1	662_663	c.656_657TG>CT	c.(655-657)gTG>gCT	p.V219A	HAGH_ENST00000566709.1_5'Flank|FAHD1_ENST00000382668.4_Intron|FAHD1_ENST00000382666.4_Intron|HAGH_ENST00000455446.2_5'Flank|HAGH_ENST00000397356.3_5'Flank|HAGH_ENST00000397353.2_5'Flank	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	219						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)	p.V219A(1)		NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						ACATTTAAAGTGGAAAAGCCAG	0.416																																																1	Substitution - Missense(1)	ovary(1)	16																																								1817888	SO:0001583	missense	81889			BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	Exception_encountered	16.37:g.1877886_1877887delinsCT	ENSP00000398053:p.Val219Ala	Unknown		x	x	x	1817887	B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Missense_Mutation	DNP	ENST00000427358.2	37	CCDS10448.1	DNP	59	Broad																																																																																				0.416	FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250550.2	NM_001018104		Missense_Mutation
PDP2	57546	broad.mit.edu	37	16	66919156	66919156	+	Silent	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr16:66919156G>A	ENST00000311765.2	+	2	1303	c.969G>A	c.(967-969)gaG>gaA	p.E323E	RP11-61A14.2_ENST00000561475.1_lincRNA|PDP2_ENST00000568720.1_Intron	NM_020786.2	NP_065837.1	Q9P2J9	PDP2_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 2	323					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|magnesium-dependent protein serine/threonine phosphatase activity (GO:0004724)|metal ion binding (GO:0046872)	p.E323E(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		TAAAGAGGGAGCACCCTGAGT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	16											73.0	69.0	70.0					16																	66919156		2200	4300	6500	65476657	SO:0001819	synonymous_variant	57546			AB037769	CCDS10822.1	16q22.1	2012-04-17			ENSG00000172840	ENSG00000172840		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	30263	protein-coding gene	gene with protein product	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit 2"""	615499				9651365	Standard	NM_020786		Approved	KIAA1348, PPM2C2	uc002eqk.2	Q9P2J9	OTTHUMG00000137512	ENST00000311765.2:c.969G>A	16.37:g.66919156G>A		Unknown		x	x	x	65476657	A8K924	Silent	SNP	ENST00000311765.2	37	CCDS10822.1	SNP	34	Broad																																																																																				0.577	PDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268831.2	NM_020786		Silent
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	G	rs28934575|rs397516437		TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr17:7577548C>G	ENST00000269305.4	-	7	922	c.733G>C	c.(733-735)Ggc>Cgc	p.G245R	TP53_ENST00000420246.2_Missense_Mutation_p.G245R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G245R|TP53_ENST00000445888.2_Missense_Mutation_p.G245R|TP53_ENST00000413465.2_Missense_Mutation_p.G245R|TP53_ENST00000359597.4_Missense_Mutation_p.G245R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575						149.0	112.0	125.0					17																	7577548		2203	4300	6503	7518273	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>C	17.37:g.7577548C>G	ENSP00000269305:p.Gly245Arg	Unknown		x	x	x	7518273	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664558	0.88251	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.63;-7.63;-7.63;-7.63;-7.63;-7.63;-7.63;-7.63	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;0.996;1.0	D;D;D;D;D;D	0.97110	0.988;1.0;1.0;0.993;0.993;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	R	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245R;ENSP00000352610:G245R;ENSP00000269305:G245R;ENSP00000398846:G245R;ENSP00000391127:G245R;ENSP00000391478:G245R;ENSP00000425104:G113R;ENSP00000423862:G152R	ENSP00000269305:G245R	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
KRT24	192666	broad.mit.edu	37	17	38857520	38857520	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr17:38857520T>C	ENST00000264651.2	-	3	783	c.727A>G	c.(727-729)Agc>Ggc	p.S243G		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	243	Coil 1B.|Rod.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)	p.S243G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				GCCTCCACGCTCTGCCGGAGA	0.537																																					GBM(61;380 1051 14702 23642 31441)											1	Substitution - Missense(1)	ovary(1)	17											71.0	64.0	67.0					17																	38857520		2203	4300	6503	36111046	SO:0001583	missense	192666				CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.727A>G	17.37:g.38857520T>C	ENSP00000264651:p.Ser243Gly	Unknown		x	x	x	36111046	Q9NXG7	Missense_Mutation	SNP	ENST00000264651.2	37	CCDS11372.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	13.08	2.131431	0.37630	.	.	ENSG00000167916	ENST00000264651	D	0.81908	-1.55	5.82	-2.51	0.06365	Filament (1);	.	.	.	.	T	0.72953	0.3525	L	0.58302	1.8	0.09310	N	0.999997	B	0.02656	0.0	B	0.09377	0.004	T	0.58758	-0.7580	9	0.42905	T	0.14	.	0.7981	0.01070	0.2345:0.2662:0.1158:0.3834	.	243	Q2M2I5	K1C24_HUMAN	G	243	ENSP00000264651:S243G	ENSP00000264651:S243G	S	-	1	0	KRT24	36111046	0.007000	0.16637	0.742000	0.31022	0.572000	0.35998	0.103000	0.15292	-0.392000	0.07751	0.456000	0.33151	AGC		0.537	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1	NM_019016		Missense_Mutation
HEATR6	63897	broad.mit.edu	37	17	58121135	58121135	+	Nonsense_Mutation	SNP	G	G	C			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr17:58121135G>C	ENST00000184956.6	-	20	3351	c.3335C>G	c.(3334-3336)tCa>tGa	p.S1112*	AC005702.3_ENST00000582298.1_RNA|HEATR6_ENST00000585976.1_Nonsense_Mutation_p.S1000*|AC005702.1_ENST00000581326.1_RNA|MIR4737_ENST00000583979.1_RNA|AC005702.2_ENST00000577558.1_RNA|AC005702.4_ENST00000583144.1_RNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	1112							poly(A) RNA binding (GO:0044822)	p.S1112*(1)		NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			CTCTGCTCCTGATTTTAAAAA	0.507																																																1	Substitution - Nonsense(1)	ovary(1)	17											102.0	92.0	95.0					17																	58121135		2203	4300	6503	55475917	SO:0001587	stop_gained	63897			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.3335C>G	17.37:g.58121135G>C	ENSP00000184956:p.Ser1112*	Unknown		x	x	x	55475917	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Nonsense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	40	8.069085	0.98638	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	.	.	.	4.96	4.96	0.65561	.	0.316936	0.30437	N	0.009625	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-11.8845	17.6263	0.88095	0.0:0.0:1.0:0.0	.	.	.	.	X	1112;847	.	ENSP00000184956:S1112X	S	-	2	0	HEATR6	55475917	0.978000	0.34361	1.000000	0.80357	0.957000	0.61999	1.884000	0.39668	2.471000	0.83476	0.650000	0.86243	TCA		0.507	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070		Nonsense_Mutation
SLC39A11	201266	broad.mit.edu	37	17	70645400	70645400	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr17:70645400C>G	ENST00000542342.2	-	8	788	c.700G>C	c.(700-702)Gcc>Ccc	p.A234P	SLC39A11_ENST00000579988.1_5'UTR|SLC39A11_ENST00000255559.3_Missense_Mutation_p.A227P	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	234					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.A227P(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						ATTCCAATGGCCAAATTCCTG	0.572																																					NSCLC(95;736 1527 12296 39625 41839)											1	Substitution - Missense(1)	ovary(1)	17											39.0	42.0	41.0					17																	70645400		2203	4300	6503	68156995	SO:0001583	missense	201266			AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.700G>C	17.37:g.70645400C>G	ENSP00000445829:p.Ala234Pro	Unknown		x	x	x	68156995	B2R8H7|Q8WZ81	Missense_Mutation	SNP	ENST00000542342.2	37	CCDS54160.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725508	0.48833	.	.	ENSG00000133195	ENST00000542342;ENST00000255559	T;T	0.50001	0.76;0.76	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.81259	0.4785	H	0.97829	4.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88687	0.3206	10	0.87932	D	0	.	18.3766	0.90437	0.0:1.0:0.0:0.0	.	234;227	Q8N1S5;Q8N1S5-2	S39AB_HUMAN;.	P	234;227	ENSP00000445829:A234P;ENSP00000255559:A227P	ENSP00000255559:A227P	A	-	1	0	SLC39A11	68156995	1.000000	0.71417	0.995000	0.50966	0.873000	0.50193	7.013000	0.76373	2.504000	0.84457	0.655000	0.94253	GCC		0.572	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1			Missense_Mutation
ATP8B1	5205	broad.mit.edu	37	18	55328437	55328437	+	Silent	SNP	T	T	C			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr18:55328437T>C	ENST00000283684.4	-	21	2675	c.2676A>G	c.(2674-2676)ggA>ggG	p.G892G	RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA|RP11-35G9.3_ENST00000591854.1_RNA|RP11-35G9.3_ENST00000599199.1_RNA|ATP8B1_ENST00000536015.1_Silent_p.G892G			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	892			G -> R (in PFIC1 and BRIC1). {ECO:0000269|PubMed:15239083, ECO:0000269|PubMed:9500542}.		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G892G(1)		breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TGGCCCCATCTCCGATGGCCA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	18											91.0	74.0	80.0					18																	55328437		2203	4300	6503	53479435	SO:0001819	synonymous_variant	5205			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.2676A>G	18.37:g.55328437T>C		Unknown		x	x	x	53479435	Q9BTP8	Silent	SNP	ENST00000283684.4	37	CCDS11965.1	SNP	54	Broad																																																																																				0.572	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603		Silent
ZNF407	55628	broad.mit.edu	37	18	72775178	72775178	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr18:72775178T>A	ENST00000299687.5	+	8	5501	c.5501T>A	c.(5500-5502)tTc>tAc	p.F1834Y		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1834					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.F1834Y(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GACAGCCCCTTCACCGCGGCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	18											94.0	108.0	103.0					18																	72775178		2076	4200	6276	70904166	SO:0001583	missense	55628			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5501T>A	18.37:g.72775178T>A	ENSP00000299687:p.Phe1834Tyr	Unknown		x	x	x	70904166	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	25.5	4.648891	0.87958	.	.	ENSG00000215421	ENST00000299687	T	0.11169	2.8	4.97	4.97	0.65823	.	.	.	.	.	T	0.21186	0.0510	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.00939	-1.1507	9	0.66056	D	0.02	.	13.25	0.60045	0.0:0.0:0.0:1.0	.	1834	Q9C0G0	ZN407_HUMAN	Y	1834	ENSP00000299687:F1834Y	ENSP00000299687:F1834Y	F	+	2	0	ZNF407	70904166	1.000000	0.71417	0.999000	0.59377	0.839000	0.47603	5.440000	0.66563	2.298000	0.77334	0.655000	0.94253	TTC		0.622	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757		Missense_Mutation
ZNF236	7776	broad.mit.edu	37	18	74672732	74672732	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr18:74672732C>A	ENST00000253159.8	+	30	5532	c.5334C>A	c.(5332-5334)taC>taA	p.Y1778*	ZNF236_ENST00000320610.9_Nonsense_Mutation_p.Y1780*	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1778					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y1778*(3)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AGCGGCCCTACAAGTGTGCCT	0.587																																																3	Substitution - Nonsense(3)	lung(2)|ovary(1)	18											61.0	66.0	65.0					18																	74672732		2091	4228	6319	72801720	SO:0001587	stop_gained	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.5334C>A	18.37:g.74672732C>A	ENSP00000253159:p.Tyr1778*	Unknown		x	x	x	72801720	B2RTX9|Q9UL37	Nonsense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	45	11.712292	0.99594	.	.	ENSG00000130856	ENST00000253159	.	.	.	5.61	4.75	0.60458	.	0.073375	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0757	0.48030	0.0:0.8406:0.0:0.1594	.	.	.	.	X	1778	.	ENSP00000253159:Y1778X	Y	+	3	2	ZNF236	72801720	1.000000	0.71417	0.007000	0.13788	0.991000	0.79684	2.510000	0.45468	1.385000	0.46445	0.655000	0.94253	TAC		0.587	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			Nonsense_Mutation
ARID3A	1820	broad.mit.edu	37	19	968497	968497	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr19:968497T>G	ENST00000263620.3	+	8	1915	c.1588T>G	c.(1588-1590)Tac>Gac	p.Y530D		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	530	REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.Y530D(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCATCATGTACACAGGTAG	0.632																																					Pancreas(29;54 1022 32760 50921)											1	Substitution - Missense(1)	ovary(1)	19											84.0	67.0	73.0					19																	968497		2203	4300	6503	919497	SO:0001583	missense	1820			U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.1588T>G	19.37:g.968497T>G	ENSP00000263620:p.Tyr530Asp	Unknown		x	x	x	919497	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	4.005035	0.74932	.	.	ENSG00000116017	ENST00000263620	T	0.61627	0.09	5.03	4.0	0.46444	REKLES domain (1);	0.061993	0.64402	D	0.000003	T	0.74465	0.3720	M	0.81942	2.565	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.75560	-0.3275	10	0.72032	D	0.01	0.048	10.1624	0.42860	0.1495:0.0:0.0:0.8505	.	530	Q99856	ARI3A_HUMAN	D	530	ENSP00000263620:Y530D	ENSP00000263620:Y530D	Y	+	1	0	ARID3A	919497	1.000000	0.71417	0.994000	0.49952	0.908000	0.53690	7.524000	0.81866	0.743000	0.32719	0.374000	0.22700	TAC		0.632	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224		Missense_Mutation
FCGBP	8857	broad.mit.edu	37	19	40398441	40398442	+	Missense_Mutation	DNP	CG	CG	AT			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr19:40398441_40398442CG>AT	ENST00000221347.6	-	14	6532_6533	c.6525_6526CG>AT	c.(6523-6528)gcCGac>gcATac	p.D2176Y		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2176	VWFD 5. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.D2176Y(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			ACCACCACGTCGGCGCCGCTCA	0.688																																																1	Substitution - Missense(1)	ovary(1)	19																																								45090282	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.6525_6526delinsAT	19.37:g.40398441_40398442delinsAT	ENSP00000221347:p.Asp2176Tyr	Unknown		x	x	x	45090281	O95784	Missense_Mutation	DNP	ENST00000221347.6	37	CCDS12546.1	DNP	31	Broad																																																																																				0.688	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		Missense_Mutation
MOV10L1	54456	broad.mit.edu	37	22	50555736	50555736	+	Silent	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr22:50555736G>A	ENST00000262794.5	+	9	1493	c.1410G>A	c.(1408-1410)gcG>gcA	p.A470A	MOV10L1_ENST00000540615.1_Silent_p.A450A|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Silent_p.A470A|MOV10L1_ENST00000395858.3_Silent_p.A470A	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	470					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.A470A(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTTCACAAGCGTTAACATCCG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	22											64.0	60.0	61.0					22																	50555736		2203	4300	6503	48897863	SO:0001819	synonymous_variant	54456			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1410G>A	22.37:g.50555736G>A		Unknown		x	x	x	48897863	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	CCDS14084.1	SNP	40	Broad																																																																																				0.423	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		Silent
PCDHA3	56145	broad.mit.edu	37	5	140182630	140182630	+	Silent	SNP	C	C	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr5:140182630C>T	ENST00000522353.2	+	1	1848	c.1848C>T	c.(1846-1848)ggC>ggT	p.G616G	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Silent_p.G616G	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	616	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G616G(1)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGGACCGGCGGTGCGCGCA	0.677																																																1	Substitution - coding silent(1)	ovary(1)	5											79.0	79.0	79.0					5																	140182630		2203	4300	6503	140162814	SO:0001819	synonymous_variant	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1848C>T	5.37:g.140182630C>T		Unknown		x	x	x	140162814	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1	SNP	27	Broad																																																																																				0.677	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		Silent
PCDHB7	56129	broad.mit.edu	37	5	140553042	140553042	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr5:140553042G>A	ENST00000231137.3	+	1	800	c.626G>A	c.(625-627)aGt>aAt	p.S209N		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	209	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S209N(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAGAGTTCAGTTTAACCCTC	0.502																																																1	Substitution - Missense(1)	ovary(1)	5											73.0	71.0	72.0					5																	140553042		2203	4300	6503	140533226	SO:0001583	missense	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.626G>A	5.37:g.140553042G>A	ENSP00000231137:p.Ser209Asn	Unknown		x	x	x	140533226	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	0.034	-1.316588	0.01331	.	.	ENSG00000113212	ENST00000231137	T	0.03065	4.06	4.61	0.952	0.19584	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03011	0.0089	N	0.26042	0.785	0.09310	N	1	B	0.12013	0.005	B	0.18561	0.022	T	0.43327	-0.9398	9	0.42905	T	0.14	.	5.7995	0.18406	0.2369:0.2094:0.5536:0.0	.	209	Q9Y5E2	PCDB7_HUMAN	N	209	ENSP00000231137:S209N	ENSP00000231137:S209N	S	+	2	0	PCDHB7	140533226	0.000000	0.05858	0.976000	0.42696	0.030000	0.12068	-0.588000	0.05774	0.359000	0.24239	0.655000	0.94253	AGT		0.502	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		Missense_Mutation
NOD1	10392	broad.mit.edu	37	7	30491300	30491300	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr7:30491300A>G	ENST00000222823.4	-	6	2258	c.1733T>C	c.(1732-1734)cTc>cCc	p.L578P		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	578					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)	p.L578P(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GTTCTTGAAGAGGTCTTCCCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											54.0	60.0	58.0					7																	30491300		2203	4300	6503	30457825	SO:0001583	missense	10392			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1733T>C	7.37:g.30491300A>G	ENSP00000222823:p.Leu578Pro	Unknown		x	x	x	30457825	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	CCDS5427.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	4.326	0.059849	0.08339	.	.	ENSG00000106100	ENST00000222823	T	0.70631	-0.5	5.28	2.48	0.30137	.	0.283582	0.39687	N	0.001296	T	0.41743	0.1172	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16364	-1.0405	10	0.49607	T	0.09	.	9.2007	0.37256	0.2398:0.0:0.7602:0.0	.	578	Q9Y239	NOD1_HUMAN	P	578	ENSP00000222823:L578P	ENSP00000222823:L578P	L	-	2	0	NOD1	30457825	1.000000	0.71417	0.787000	0.31911	0.268000	0.26511	2.858000	0.48356	0.221000	0.20879	-0.242000	0.12053	CTC		0.622	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2			Missense_Mutation
CREB3L2	64764	broad.mit.edu	37	7	137569784	137569784	+	Silent	SNP	C	C	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr7:137569784C>T	ENST00000330387.6	-	10	1578	c.1227G>A	c.(1225-1227)ctG>ctA	p.L409L	CREB3L2_ENST00000456390.1_Silent_p.L409L	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	409					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.L409L(1)	FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						GCTGGCTGGGCAGAGCCATCT	0.562			T	FUS	fibromyxoid sarcoma																																		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	1	Substitution - coding silent(1)	ovary(1)	7											81.0	75.0	77.0					7																	137569784		2203	4300	6503	137220324	SO:0001819	synonymous_variant	64764			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.1227G>A	7.37:g.137569784C>T		Unknown		x	x	x	137220324	Q6P454|Q6ZMR6	Silent	SNP	ENST00000330387.6	37	CCDS34760.1	SNP	25	Broad																																																																																				0.562	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341462.1	NM_194071		Silent
MMP16	4325	broad.mit.edu	37	8	89053814	89053814	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr8:89053814T>C	ENST00000286614.6	-	10	1980	c.1699A>G	c.(1699-1701)Att>Gtt	p.I567V		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	567					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I567V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GGAATGACAATAGCTATGGCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											297.0	231.0	253.0					8																	89053814		2203	4300	6503	89122930	SO:0001583	missense	4325			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1699A>G	8.37:g.89053814T>C	ENSP00000286614:p.Ile567Val	Unknown		x	x	x	89122930	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	3.904	-0.021459	0.07634	.	.	ENSG00000156103	ENST00000286614	T	0.19105	2.17	5.72	5.72	0.89469	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.13372	0.0324	N	0.20530	0.585	0.58432	D	0.999999	B	0.12630	0.006	B	0.18871	0.023	T	0.05386	-1.0888	10	0.02654	T	1	.	15.9899	0.80197	0.0:0.0:0.0:1.0	.	567	P51512	MMP16_HUMAN	V	567	ENSP00000286614:I567V	ENSP00000286614:I567V	I	-	1	0	MMP16	89122930	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.286000	0.72665	2.168000	0.68352	0.533000	0.62120	ATT		0.463	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		Missense_Mutation
SLC6A14	11254	broad.mit.edu	37	X	115582751	115582751	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chrX:115582751G>T	ENST00000371900.4	+	8	1163	c.1075G>T	c.(1075-1077)Gtg>Ttg	p.V359L		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	359					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.V359L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TCTCACTAGCGTGTTTGCTGG	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											173.0	155.0	161.0					X																	115582751		2203	4300	6503	115496779	SO:0001583	missense	11254			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1075G>T	X.37:g.115582751G>T	ENSP00000360967:p.Val359Leu	Unknown		x	x	x	115496779	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941620	0.73557	.	.	ENSG00000087916	ENST00000371900	T	0.75050	-0.9	5.43	5.43	0.79202	.	0.057776	0.64402	D	0.000002	T	0.58438	0.2122	N	0.11131	0.1	0.41420	D	0.987796	P	0.40731	0.728	B	0.40228	0.323	T	0.61242	-0.7102	10	0.27082	T	0.32	.	15.4779	0.75501	0.0:0.0:1.0:0.0	.	359	Q9UN76	S6A14_HUMAN	L	359	ENSP00000360967:V359L	ENSP00000360967:V359L	V	+	1	0	SLC6A14	115496779	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.034000	0.49751	2.248000	0.74166	0.538000	0.68166	GTG		0.373	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1			Missense_Mutation
TENM1	10178	broad.mit.edu	37	X	123787438	123787438	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chrX:123787438G>T	ENST00000371130.3	-	7	1427	c.1364C>A	c.(1363-1365)aCt>aAt	p.T455N	TENM1_ENST00000422452.2_Missense_Mutation_p.T455N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	455					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.T457N(1)									AAATACCTGAGTATGTGTAGG	0.363																																																1	Substitution - Missense(1)	ovary(1)	X											99.0	97.0	98.0					X																	123787438		2203	4300	6503	123615119	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1364C>A	X.37:g.123787438G>T	ENSP00000360171:p.Thr455Asn	Unknown		x	x	x	123615119	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475272	0.84640	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.31510	1.49;1.49	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.991;0.997;0.997	T	0.63800	-0.6555	10	0.87932	D	0	.	19.0086	0.92863	0.0:0.0:1.0:0.0	.	454;455;455	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	455	ENSP00000360171:T455N;ENSP00000403954:T455N	ENSP00000360171:T455N	T	-	2	0	ODZ1	123615119	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	9.869000	0.99810	2.437000	0.82529	0.523000	0.50628	ACT		0.363	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
PRAMEF18	391003	broad.mit.edu	37	1	13475115	13475125	+	Frame_Shift_Del	DEL	CTCAAGACGGA	CTCAAGACGGA	-			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr1:13475115_13475125delCTCAAGACGGA	ENST00000376126.2	-	3	1003_1013	c.1004_1014delTCCGTCTTGAG	c.(1003-1014)atccgtcttgagfs	p.IRLE335fs		NM_001099850.1	NP_001093320.1	Q5VWM3	PRA18_HUMAN	PRAME family member 18	335					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.I335fs*50(1)		lung(2)|ovary(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTCGGAGGGGCTCAAGACGGATGAAGCGCAG	0.526																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								13347712	SO:0001589	frameshift_variant	645414					1p36.21	2013-01-17			ENSG00000204491			"""-"""	30693	protein-coding gene	gene with protein product							Standard			Approved	OTTHUMG00000002932		Q5VWM3	OTTHUMG00000002932	ENST00000376126.2:c.1004_1014delTCCGTCTTGAG	1.37:g.13475115_13475125delCTCAAGACGGA	ENSP00000365294:p.Ile335fs	Unknown		Capture	Illumina GAIIx	Phase_I	13347702		Frame_Shift_Del	DEL	ENST00000376126.2	37	CCDS41258.1	DEL	28	Broad																																																																																				0.526	PRAMEF18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008177.2	NM_001099850		Frame_Shift_Del
SSTR1	6751	broad.mit.edu	37	14	38679480	38679480	+	Frame_Shift_Del	DEL	T	T	-			TCGA-61-1736-01	TCGA-61-1736-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1736-01	TCGA-61-1736-11	g.chr14:38679480delT	ENST00000267377.2	+	3	1503	c.886delT	c.(886-888)tttfs	p.F296fs		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	296					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.F296fs*9(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	GGTCAACGTGTTTGCTGAGCA	0.552																																																1	Deletion - Frameshift(1)	ovary(1)	14											145.0	124.0	131.0					14																	38679480		2203	4300	6503	37749231	SO:0001589	frameshift_variant	6751				CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.886delT	14.37:g.38679480delT	ENSP00000267377:p.Phe296fs	Unknown		Capture	Illumina GAIIx	Phase_I	37749231		Frame_Shift_Del	DEL	ENST00000267377.2	37	CCDS9666.1	DEL	60	Broad																																																																																				0.552	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			Frame_Shift_Del
