#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ARHGEF10L	55160	broad.mit.edu	37	1	17961046	17961046	+	Silent	SNP	T	T	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:17961046T>G	ENST00000361221.3	+	17	1893	c.1734T>G	c.(1732-1734)ccT>ccG	p.P578P	ARHGEF10L_ENST00000375408.3_Intron|ARHGEF10L_ENST00000167825.4_Intron|ARHGEF10L_ENST00000469726.1_Intron|ARHGEF10L_ENST00000375420.3_Silent_p.P336P|ARHGEF10L_ENST00000452522.1_Silent_p.P539P|ARHGEF10L_ENST00000375415.1_Silent_p.P539P|ARHGEF10L_ENST00000434513.1_Intron	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	578						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		TTCCCAGGCCTGCCAACCACA	0.617																																																0			1											104.0	106.0	106.0					1																	17961046		2203	4300	6503	17833633	SO:0001819	synonymous_variant	55160			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1734T>G	1.37:g.17961046T>G		Unknown		x	x	x	17833633	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Silent	SNP	ENST00000361221.3	37	CCDS182.1	SNP	55	Broad																																																																																				0.617	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125		Silent
BAI2	576	broad.mit.edu	37	1	32205635	32205635	+	Splice_Site	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:32205635C>T	ENST00000373658.3	-	14	2400	c.2059G>A	c.(2059-2061)Gtg>Atg	p.V687M	BAI2_ENST00000527361.1_Splice_Site_p.V687M|BAI2_ENST00000398556.3_Splice_Site_p.V635M|BAI2_ENST00000398538.1_Splice_Site_p.V675M|BAI2_ENST00000440175.2_Splice_Site_p.V329M|BAI2_ENST00000257070.4_Splice_Site_p.V687M|BAI2_ENST00000398542.1_Splice_Site_p.V620M|BAI2_ENST00000398547.1_Splice_Site_p.V620M|BAI2_ENST00000373655.2_Splice_Site_p.V687M	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	687					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V687M(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CCAGGGGACACCTGGGGACAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	90.0	92.0					1																	32205635		2203	4300	6503	31978222	SO:0001630	splice_region_variant	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2059-1G>A	1.37:g.32205635C>T		Unknown		x	x	x	31978222	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186625	0.57909	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125	T;T;T;T;T;T;T;T;T;T	0.09723	2.95;2.95;2.95;2.95;2.95;2.95;2.95;2.95;2.95;2.95	4.62	4.62	0.57501	Domain of unknown function DUF3497 (1);	0.000000	0.38897	N	0.001528	T	0.23370	0.0565	L	0.40543	1.245	0.45172	D	0.998189	D;P;P;P;D;P	0.71674	0.996;0.729;0.771;0.771;0.998;0.771	D;P;P;P;D;P	0.74023	0.973;0.544;0.475;0.475;0.982;0.673	T	0.01824	-1.1266	10	0.25106	T	0.35	.	16.6901	0.85319	0.0:1.0:0.0:0.0	.	687;675;329;620;687;687	O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	M	635;620;687;687;620;687;687;329;675;625	ENSP00000381564:V635M;ENSP00000381555:V620M;ENSP00000362762:V687M;ENSP00000362759:V687M;ENSP00000381550:V620M;ENSP00000257070:V687M;ENSP00000435397:V687M;ENSP00000391071:V329M;ENSP00000381548:V675M;ENSP00000410921:V625M	ENSP00000257070:V687M	V	-	1	0	BAI2	31978222	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.359000	0.44142	2.301000	0.77427	0.456000	0.33151	GTG		0.607	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	Missense_Mutation	Missense_Mutation
SNIP1	79753	broad.mit.edu	37	1	38019693	38019693	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:38019693C>T	ENST00000296215.6	-	1	210	c.138G>A	c.(136-138)ccG>ccA	p.P46P	DNALI1_ENST00000541606.1_5'Flank|SNIP1_ENST00000468040.1_Intron|DNALI1_ENST00000296218.7_5'Flank	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	46					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P46P(1)		breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				CGGAGTGGTCCGGACGGCGGT	0.736																																																1	Substitution - coding silent(1)	ovary(1)	1											15.0	16.0	16.0					1																	38019693		2189	4285	6474	37792280	SO:0001819	synonymous_variant	79753				CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.138G>A	1.37:g.38019693C>T		Unknown		x	x	x	37792280	Q96SP9|Q9H9T7	Silent	SNP	ENST00000296215.6	37	CCDS419.1	SNP	23	Broad																																																																																				0.736	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700		Silent
MMACHC	25974	broad.mit.edu	37	1	45965207	45965207	+	5'Flank	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:45965207A>T	ENST00000401061.4	+	0	0				CCDC163P_ENST00000432082.1_Missense_Mutation_p.N25K|CCDC163P_ENST00000488405.2_Missense_Mutation_p.N25K|CCDC163P_ENST00000502793.2_5'Flank|CCDC163P_ENST00000490551.3_Missense_Mutation_p.N25K	NM_015506.2	NP_056321.2	Q9Y4U1	MMAC_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria						cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8	Acute lymphoblastic leukemia(166;0.155)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCCTCACCTTATTCCGGACCA	0.552																																																0			1											77.0	76.0	76.0					1																	45965207		1935	4147	6082	45737794	SO:0001631	upstream_gene_variant	126661				CCDS41324.1	1p34.1	2011-05-12			ENSG00000132763	ENSG00000132763			24525	protein-coding gene	gene with protein product		609831				16311595	Standard	NM_015506		Approved	DKFZP564I122, cblC	uc009vxv.3	Q9Y4U1	OTTHUMG00000007742		1.37:g.45965207A>T	Exception_encountered	Unknown		x	x	x	45737794	Q5T157|Q9BRQ7	Missense_Mutation	SNP	ENST00000401061.4	37	CCDS41324.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	7.928	0.740130	0.15642	.	.	ENSG00000236624	ENST00000490551;ENST00000432082;ENST00000488405	.	.	.	5.27	1.56	0.23342	.	.	.	.	.	T	0.25269	0.0614	.	.	.	0.24235	N	0.995384	B;B	0.14012	0.009;0.009	B;B	0.08055	0.003;0.003	T	0.17992	-1.0351	7	0.37606	T	0.19	.	3.581	0.07952	0.5966:0.1969:0.2065:0.0	.	25;25	E9PLD6;F2Z3K3	.;.	K	25	.	ENSP00000431736:N25K	N	-	3	2	CCDC163P	45737794	1.000000	0.71417	0.999000	0.59377	0.097000	0.18754	1.667000	0.37471	0.434000	0.26340	-0.297000	0.09499	AAT		0.552	MMACHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020864.2	NM_015506		Missense_Mutation
CYP4A22	284541	broad.mit.edu	37	1	47607866	47607866	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:47607866C>T	ENST00000371891.3	+	4	500	c.469C>T	c.(469-471)Cca>Tca	p.P157S	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.P157S|CYP4A22_ENST00000294337.3_Missense_Mutation_p.P157S	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	157						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.P157S(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CATCCTGAAGCCATACGTGGG	0.557																																					Pancreas(88;1240 1470 2099 14214 37557)											1	Substitution - Missense(1)	ovary(1)	1											122.0	100.0	107.0					1																	47607866		2203	4300	6503	47380453	SO:0001583	missense	284541				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.469C>T	1.37:g.47607866C>T	ENSP00000360958:p.Pro157Ser	Unknown		x	x	x	47380453	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	c	5.301	0.240847	0.10077	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.66460	-0.21;-0.21;-0.21	1.7	0.722	0.18225	.	0.119600	0.56097	D	0.000022	T	0.56499	0.1989	L	0.42008	1.315	0.32003	N	0.60309	B;B	0.22276	0.007;0.067	B;B	0.34931	0.016;0.192	T	0.53872	-0.8377	10	0.45353	T	0.12	.	5.5165	0.16910	0.0:0.5949:0.2016:0.2036	.	157;157	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	S	157	ENSP00000360957:P157S;ENSP00000360958:P157S;ENSP00000294337:P157S	ENSP00000294337:P157S	P	+	1	0	CYP4A22	47380453	0.992000	0.36948	0.484000	0.27391	0.047000	0.14425	1.262000	0.32992	-0.386000	0.07821	-1.151000	0.01829	CCA		0.557	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213		Missense_Mutation
MROH7	374977	broad.mit.edu	37	1	55172128	55172128	+	Silent	SNP	C	C	T	rs148185761	byFrequency	TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:55172128C>T	ENST00000421030.2	+	22	3870	c.3585C>T	c.(3583-3585)agC>agT	p.S1195S	MROH7-TTC4_ENST00000414150.2_Silent_p.S1195S|MROH7_ENST00000409996.1_Silent_p.S763S|MROH7_ENST00000454855.2_Silent_p.S713S	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1195						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											ACCGAGACAGCGCCTTCATAT	0.537													C|||	17	0.00339457	0.0121	0.0014	5008	,	,		19769	0.0		0.0	False		,,,				2504	0.0															0			1						C		32,3846		1,30,1908	123.0	127.0	126.0		3585	-6.1	0.1	1	dbSNP_134	126	0,8300		0,0,4150	no	coding-synonymous	HEATR8	NM_001039464.2		1,30,6058	TT,TC,CC		0.0,0.8252,0.2628		1195/1324	55172128	32,12146	1939	4150	6089	54944716	SO:0001819	synonymous_variant	374977			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3585C>T	1.37:g.55172128C>T		Unknown		x	x	x	54944716	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	37	CCDS41342.2	SNP	27	Broad																																																																																				0.537	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547		Silent
ZNF644	84146	broad.mit.edu	37	1	91404919	91404919	+	Silent	SNP	T	T	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:91404919T>A	ENST00000370440.1	-	3	2209	c.1992A>T	c.(1990-1992)acA>acT	p.T664T	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Silent_p.T664T|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T664T(1)		breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTGATCCAAATGTTCGCTTCA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	1											141.0	139.0	140.0					1																	91404919		2203	4300	6503	91177507	SO:0001819	synonymous_variant	84146			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1992A>T	1.37:g.91404919T>A		Unknown		x	x	x	91177507	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	ENST00000370440.1	37	CCDS731.1	SNP	51	Broad																																																																																				0.368	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186		Silent
CRTC2	200186	broad.mit.edu	37	1	153925751	153925751	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:153925751G>A	ENST00000368633.1	-	6	725	c.598C>T	c.(598-600)Cga>Tga	p.R200*	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	200					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.R200*(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCCCCACGTCGGCTGGGCAGG	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	1											55.0	60.0	58.0					1																	153925751		2203	4300	6503	152192375	SO:0001587	stop_gained	200186			AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.598C>T	1.37:g.153925751G>A	ENSP00000357622:p.Arg200*	Unknown		x	x	x	152192375	Q6UUV8|Q7Z3X7|Q8N332	Nonsense_Mutation	SNP	ENST00000368633.1	37	CCDS30875.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307359	0.81247	.	.	ENSG00000160741	ENST00000368633	.	.	.	3.75	3.75	0.43078	.	0.099352	0.44483	D	0.000450	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.3333	11.2299	0.48905	0.0:0.0:1.0:0.0	.	.	.	.	X	200	.	ENSP00000357622:R200X	R	-	1	2	CRTC2	152192375	0.911000	0.30947	0.982000	0.44146	0.948000	0.59901	3.300000	0.51834	2.104000	0.64026	0.455000	0.32223	CGA		0.488	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715		Nonsense_Mutation
ADAR	103	broad.mit.edu	37	1	154574163	154574163	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:154574163C>A	ENST00000368474.4	-	2	1154	c.955G>T	c.(955-957)Gct>Tct	p.A319S	ADAR_ENST00000368471.3_Missense_Mutation_p.A24S|ADAR_ENST00000292205.5_Missense_Mutation_p.A362S|ADAR_ENST00000471068.1_5'Flank	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	319					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A319S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATATTTTTAGCCAAATTCAGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	75.0	75.0					1																	154574163		2203	4300	6503	152840787	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.955G>T	1.37:g.154574163C>A	ENSP00000357459:p.Ala319Ser	Unknown		x	x	x	152840787	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561836	0.86335	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.45	4.45	0.53987	Winged helix-turn-helix transcription repressor DNA-binding (1);Double-stranded RNA-specific adenosine deaminase (DRADA) (3);	0.120167	0.56097	D	0.000034	T	0.51363	0.1670	L	0.58583	1.82	0.48901	D	0.999729	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.83275	0.98;0.98;0.996	T	0.52961	-0.8505	10	0.59425	D	0.04	-15.007	13.3967	0.60858	0.0:0.8421:0.1579:0.0	.	319;319;319	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	S	362;319;24;314	ENSP00000292205:A362S;ENSP00000357459:A319S;ENSP00000357456:A24S;ENSP00000431794:A314S	ENSP00000292205:A362S	A	-	1	0	ADAR	152840787	1.000000	0.71417	0.907000	0.35723	0.989000	0.77384	5.068000	0.64364	2.450000	0.82876	0.491000	0.48974	GCT		0.458	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111		Missense_Mutation
IQGAP3	128239	broad.mit.edu	37	1	156509645	156509645	+	Silent	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:156509645G>A	ENST00000361170.2	-	24	2887	c.2877C>T	c.(2875-2877)ctC>ctT	p.L959L	IQGAP3_ENST00000498755.1_5'Flank	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	959					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCAGGTAGAAGAGGTGTTGGT	0.488																																																0			1											211.0	192.0	198.0					1																	156509645		2203	4300	6503	154776269	SO:0001819	synonymous_variant	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2877C>T	1.37:g.156509645G>A		Unknown		x	x	x	154776269	Q5T3H8	Silent	SNP	ENST00000361170.2	37	CCDS1144.1	SNP	33	Broad																																																																																				0.488	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229		Silent
TDRD5	163589	broad.mit.edu	37	1	179659906	179659906	+	Missense_Mutation	SNP	G	G	A	rs570123255		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:179659906G>A	ENST00000367614.1	+	17	3133	c.2774G>A	c.(2773-2775)cGt>cAt	p.R925H	TDRD5_ENST00000444136.1_Missense_Mutation_p.R979H|TDRD5_ENST00000294848.8_Missense_Mutation_p.R925H	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	925					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.R925H(2)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AAAGACAAGCGTCAAGAATCT	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		20527	0.0		0.0	False		,,,				2504	0.001															2	Substitution - Missense(2)	ovary(1)|central_nervous_system(1)	1											82.0	79.0	80.0					1																	179659906		2203	4300	6503	177926529	SO:0001583	missense	163589			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2774G>A	1.37:g.179659906G>A	ENSP00000356586:p.Arg925His	Unknown		x	x	x	177926529	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	7.090	0.571962	0.13623	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.29917	2.76;2.76;2.98;1.55	5.17	2.11	0.27256	.	0.965874	0.08577	N	0.925189	T	0.12178	0.0296	N	0.03608	-0.345	0.09310	N	1	P;B	0.35844	0.524;0.015	B;B	0.30855	0.121;0.001	T	0.10965	-1.0607	10	0.62326	D	0.03	-15.9539	4.4233	0.11492	0.2005:0.1872:0.6123:0.0	.	979;925	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	H	925;925;979;435	ENSP00000356586:R925H;ENSP00000294848:R925H;ENSP00000406052:R979H;ENSP00000410744:R435H	ENSP00000294848:R925H	R	+	2	0	TDRD5	177926529	0.007000	0.16637	0.080000	0.20451	0.272000	0.26649	0.730000	0.26043	1.302000	0.44855	0.655000	0.94253	CGT		0.418	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		Missense_Mutation
GPR25	2848	broad.mit.edu	37	1	200843143	200843143	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:200843143C>T	ENST00000304244.2	+	1	1061	c.978C>T	c.(976-978)acC>acT	p.T326T		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	326					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T326T(1)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						GCGGGCGCACCGGCCGCCTGG	0.706																																																1	Substitution - coding silent(1)	ovary(1)	1											15.0	16.0	16.0					1																	200843143		2167	4217	6384	199109766	SO:0001819	synonymous_variant	2848			U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.978C>T	1.37:g.200843143C>T		Unknown		x	x	x	199109766	A0AVJ5	Silent	SNP	ENST00000304244.2	37	CCDS1405.1	SNP	23	Broad																																																																																				0.706	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087056.1	NM_005298		Silent
PRELP	5549	broad.mit.edu	37	1	203453085	203453085	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:203453085C>T	ENST00000343110.2	+	2	900	c.773C>T	c.(772-774)cCt>cTt	p.P258L		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	258					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			GAGACCATCCCTAACGGATAC	0.512																																																0			1											126.0	127.0	127.0					1																	203453085		2203	4300	6503	201719708	SO:0001583	missense	5549			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.773C>T	1.37:g.203453085C>T	ENSP00000343924:p.Pro258Leu	Unknown		x	x	x	201719708	Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	37	CCDS1438.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586597	0.46110	.	.	ENSG00000188783	ENST00000343110	T	0.59906	0.23	4.77	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.75250	0.3824	M	0.81614	2.55	0.80722	D	1	D	0.60575	0.988	D	0.74348	0.983	T	0.78612	-0.2136	10	0.87932	D	0	-15.0475	12.9026	0.58133	0.164:0.836:0.0:0.0	.	258	P51888	PRELP_HUMAN	L	258	ENSP00000343924:P258L	ENSP00000343924:P258L	P	+	2	0	PRELP	201719708	1.000000	0.71417	0.778000	0.31720	0.158000	0.22134	7.818000	0.86416	0.987000	0.38709	0.462000	0.41574	CCT		0.512	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725		Missense_Mutation
SIPA1L2	57568	broad.mit.edu	37	1	232650408	232650408	+	Silent	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:232650408G>C	ENST00000366630.1	-	2	1036	c.678C>G	c.(676-678)gtC>gtG	p.V226V	SIPA1L2_ENST00000262861.4_Silent_p.V226V			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	226					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.V226V(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ACCCAAAAGGGACCATTGCTT	0.468																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	98.0	98.0					1																	232650408		1880	4108	5988	230717031	SO:0001819	synonymous_variant	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.678C>G	1.37:g.232650408G>C		Unknown		x	x	x	230717031	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	ENST00000366630.1	37	CCDS41474.1	SNP	41	Broad																																																																																				0.468	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		Silent
NLRP3	114548	broad.mit.edu	37	1	247597444	247597444	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:247597444C>G	ENST00000336119.3	+	5	3113	c.2367C>G	c.(2365-2367)gaC>gaG	p.D789E	NLRP3_ENST00000348069.2_Missense_Mutation_p.D732E|NLRP3_ENST00000366496.2_Missense_Mutation_p.D789E|NLRP3_ENST00000391828.3_Missense_Mutation_p.D789E|NLRP3_ENST00000366497.2_Missense_Mutation_p.D789E|NLRP3_ENST00000391827.2_Missense_Mutation_p.D732E	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	789					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GCTGCTTCGACATCTCCTTGG	0.562																																																0			1											142.0	132.0	135.0					1																	247597444		2203	4300	6503	245664067	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2367C>G	1.37:g.247597444C>G	ENSP00000337383:p.Asp789Glu	Unknown		x	x	x	245664067	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	c	3.959	-0.010721	0.07727	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;D;T;D	0.87412	0.67;0.68;0.67;-2.25;0.68;-2.25	3.44	2.53	0.30540	.	0.899489	0.09313	N	0.819296	T	0.79034	0.4378	L	0.39245	1.2	0.09310	N	1	B;B;B;B	0.29301	0.126;0.241;0.008;0.224	B;B;B;B	0.28991	0.016;0.058;0.012;0.097	T	0.63337	-0.6660	10	0.15499	T	0.54	.	5.6792	0.17765	0.0:0.7578:0.0:0.2422	.	732;732;789;789	Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;NALP3_HUMAN	E	789;789;789;732;789;732	ENSP00000375704:D789E;ENSP00000355453:D789E;ENSP00000337383:D789E;ENSP00000294752:D732E;ENSP00000355452:D789E;ENSP00000375703:D732E	ENSP00000337383:D789E	D	+	3	2	NLRP3	245664067	0.001000	0.12720	0.071000	0.20095	0.777000	0.43975	0.328000	0.19681	1.052000	0.40392	0.472000	0.43445	GAC		0.562	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		Missense_Mutation
OR2L2	26246	broad.mit.edu	37	1	248201606	248201606	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:248201606T>A	ENST00000366479.2	+	1	133	c.37T>A	c.(37-39)Tta>Ata	p.L13I	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L13I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TGATTTCATCTTATTGGGGCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											133.0	128.0	130.0					1																	248201606		2203	4300	6503	246268229	SO:0001583	missense	26246			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.37T>A	1.37:g.248201606T>A	ENSP00000355435:p.Leu13Ile	Unknown		x	x	x	246268229	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	.	12.95	2.091426	0.36952	.	.	ENSG00000203663	ENST00000366479	T	0.00540	6.7	2.13	-0.717	0.11208	.	.	.	.	.	T	0.01730	0.0055	M	0.86864	2.845	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.44544	-0.9321	9	0.72032	D	0.01	.	2.1238	0.03732	0.2439:0.3168:0.0:0.4393	.	13	Q8NH16	OR2L2_HUMAN	I	13	ENSP00000355435:L13I	ENSP00000355435:L13I	L	+	1	2	OR2L2	246268229	0.000000	0.05858	0.020000	0.16555	0.131000	0.20780	-2.292000	0.01146	-0.017000	0.14103	0.172000	0.16884	TTA		0.363	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		Missense_Mutation
DIP2C	22982	broad.mit.edu	37	10	390992	390992	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:390992C>T	ENST00000280886.6	-	27	3377	c.3290G>A	c.(3289-3291)aGg>aAg	p.R1097K		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1097						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CGCCGCCTCCCTGGACCGCAG	0.602																																																0			10											57.0	49.0	51.0					10																	390992		2203	4300	6503	380992	SO:0001583	missense	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3290G>A	10.37:g.390992C>T	ENSP00000280886:p.Arg1097Lys	Unknown		x	x	x	380992	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293075	0.23564	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.10477	2.87	5.59	5.59	0.84812	AMP-dependent synthetase/ligase (1);	0.048541	0.85682	D	0.000000	T	0.05410	0.0143	N	0.03948	-0.315	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23619	-1.0183	10	0.02654	T	1	-31.3809	19.59	0.95506	0.0:1.0:0.0:0.0	.	1097	Q9Y2E4	DIP2C_HUMAN	K	1097;22	ENSP00000280886:R1097K	ENSP00000280886:R1097K	R	-	2	0	DIP2C	380992	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.282000	0.51693	2.639000	0.89480	0.655000	0.94253	AGG		0.602	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974		Missense_Mutation
GTPBP4	23560	broad.mit.edu	37	10	1046802	1046802	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:1046802C>T	ENST00000360803.4	+	7	922	c.840C>T	c.(838-840)atC>atT	p.I280I	GTPBP4_ENST00000545048.1_Silent_p.I233I|GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000538293.1_Silent_p.I164I	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	280	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.I280I(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		CTCTCTTCATCAACAAGGTGT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	10											224.0	216.0	219.0					10																	1046802		2203	4300	6503	1036802	SO:0001819	synonymous_variant	23560			AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.840C>T	10.37:g.1046802C>T		Unknown		x	x	x	1036802	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Silent	SNP	ENST00000360803.4	37	CCDS31132.1	SNP	29	Broad																																																																																				0.458	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341		Silent
MAPK8	5599	broad.mit.edu	37	10	49628339	49628339	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:49628339C>T	ENST00000374189.1	+	6	773	c.592C>T	c.(592-594)Ctt>Ttt	p.L198F	MAPK8_ENST00000395611.3_Missense_Mutation_p.L198F|MAPK8_ENST00000360332.3_Missense_Mutation_p.L198F|MAPK8_ENST00000374182.3_Missense_Mutation_p.L198F|MAPK8_ENST00000374174.1_Missense_Mutation_p.L198F			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)	p.L198F(1)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		CGAGGTCATCCTTGGCATGGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											141.0	132.0	135.0					10																	49628339		2203	4300	6503	49298345	SO:0001583	missense	5599			L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.592C>T	10.37:g.49628339C>T	ENSP00000363304:p.Leu198Phe	Unknown		x	x	x	49298345	B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	ENST00000374189.1	37	CCDS7224.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715018	0.89112	.	.	ENSG00000107643	ENST00000374189;ENST00000374182;ENST00000374179;ENST00000360332;ENST00000374176;ENST00000374174;ENST00000395611	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.38	4.48	0.54585	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.148370	0.46758	D	0.000261	T	0.69860	0.3158	M	0.62209	1.925	0.80722	D	1	P;B;B;B;B	0.36837	0.571;0.158;0.19;0.19;0.158	P;B;B;B;B	0.46479	0.518;0.187;0.284;0.284;0.259	T	0.68036	-0.5515	9	.	.	.	.	11.6095	0.51052	0.0:0.855:0.0:0.145	.	198;198;198;198;198	Q308M2;P45983-2;P45983;A1L4K2;P45983-3	.;.;MK08_HUMAN;.;.	F	198	ENSP00000363304:L198F;ENSP00000363297:L198F;ENSP00000363294:L198F;ENSP00000353483:L198F;ENSP00000363291:L198F;ENSP00000363289:L198F;ENSP00000378974:L198F	.	L	+	1	0	MAPK8	49298345	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	3.266000	0.51569	1.398000	0.46701	0.655000	0.94253	CTT		0.393	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047931.1			Missense_Mutation
CSTF2T	23283	broad.mit.edu	37	10	53458890	53458890	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:53458890C>T	ENST00000331173.4	-	1	465	c.420G>A	c.(418-420)atG>atA	p.M140I	PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373985.1_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	140					mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M140I(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		TCAGCTCAAACATCTGCTCCG	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											142.0	138.0	140.0					10																	53458890		2203	4300	6503	53128896	SO:0001583	missense	23283			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.420G>A	10.37:g.53458890C>T	ENSP00000332444:p.Met140Ile	Unknown		x	x	x	53128896	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	37	CCDS7245.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329217	0.81690	.	.	ENSG00000177613	ENST00000331173	T	0.25250	1.81	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.54095	0.1837	M	0.85299	2.745	0.80722	D	1	D	0.59357	0.985	D	0.64877	0.93	T	0.59974	-0.7353	10	0.72032	D	0.01	-6.7129	16.1846	0.81942	0.0:1.0:0.0:0.0	.	140	Q9H0L4	CSTFT_HUMAN	I	140	ENSP00000332444:M140I	ENSP00000332444:M140I	M	-	3	0	CSTF2T	53128896	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.443000	0.66581	2.767000	0.95098	0.655000	0.94253	ATG		0.507	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235		Missense_Mutation
VCL	7414	broad.mit.edu	37	10	75857087	75857087	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:75857087A>T	ENST00000211998.4	+	13	1963	c.1869A>T	c.(1867-1869)gaA>gaT	p.E623D	VCL_ENST00000478896.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.E623D|VCL_ENST00000417648.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	623	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.E623D(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CTAACAGGGAAGAGGTGGGTA	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											89.0	86.0	87.0					10																	75857087		2203	4300	6503	75527093	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1869A>T	10.37:g.75857087A>T	ENSP00000211998:p.Glu623Asp	Unknown		x	x	x	75527093	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	11.59	1.684785	0.29872	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.62364	0.03;0.03;0.03	5.29	2.58	0.30949	.	0.233607	0.43919	D	0.000507	T	0.37839	0.1018	N	0.12471	0.22	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.12656	-1.0539	10	0.36615	T	0.2	.	6.0399	0.19728	0.6454:0.0:0.086:0.2687	.	550;623;623	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	D	623;623;530;550;295	ENSP00000361841:E623D;ENSP00000211998:E623D;ENSP00000415489:E295D	ENSP00000211998:E623D	E	+	3	2	VCL	75527093	0.999000	0.42202	1.000000	0.80357	0.477000	0.33069	0.652000	0.24888	0.953000	0.37825	0.524000	0.50904	GAA		0.498	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000		Missense_Mutation
LDB1	8861	broad.mit.edu	37	10	103869197	103869197	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:103869197C>T	ENST00000425280.1	-	9	1142	c.800G>A	c.(799-801)cGc>cAc	p.R267H	LDB1_ENST00000361198.5_Missense_Mutation_p.R231H|LDB1_ENST00000490751.1_5'Flank	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	267					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		GAGGCAGTCGCGGGGGCTGAG	0.597																																																0			10											85.0	77.0	80.0					10																	103869197		2203	4300	6503	103859187	SO:0001583	missense	8861			AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.800G>A	10.37:g.103869197C>T	ENSP00000392466:p.Arg267His	Unknown		x	x	x	103859187	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	37	CCDS44472.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033898	0.93575	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	T;T	0.21932	1.98;1.98	5.79	4.89	0.63831	.	0.048996	0.85682	D	0.000000	T	0.51312	0.1667	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.994;0.999	T	0.60424	-0.7266	10	0.87932	D	0	-7.6635	15.0447	0.71819	0.0:0.9319:0.0:0.0681	.	267;231	Q86U70;Q86U70-3	LDB1_HUMAN;.	H	231;267	ENSP00000354616:R231H;ENSP00000392466:R267H	ENSP00000354616:R231H	R	-	2	0	LDB1	103859187	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	7.818000	0.86416	1.466000	0.48025	0.555000	0.69702	CGC		0.597	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407		Missense_Mutation
SEC23IP	11196	broad.mit.edu	37	10	121685734	121685734	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:121685734G>A	ENST00000369075.3	+	13	2380	c.2308G>A	c.(2308-2310)Gga>Aga	p.G770R	SEC23IP_ENST00000543134.1_Missense_Mutation_p.G559R	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	770					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.G770R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		AGTTGGCGCCGGACAGGTGAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											135.0	139.0	138.0					10																	121685734		2203	4300	6503	121675724	SO:0001583	missense	11196			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.2308G>A	10.37:g.121685734G>A	ENSP00000358071:p.Gly770Arg	Unknown		x	x	x	121675724	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	37	CCDS7618.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109062	0.77096	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.43688	0.94;1.09	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.65801	0.2726	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66272	-0.5965	10	0.66056	D	0.02	-20.9074	19.8472	0.96713	0.0:0.0:1.0:0.0	.	559;770	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	R	770;559	ENSP00000358071:G770R;ENSP00000438773:G559R	ENSP00000358071:G770R	G	+	1	0	SEC23IP	121675724	1.000000	0.71417	0.934000	0.37439	0.310000	0.27922	9.148000	0.94652	2.701000	0.92244	0.591000	0.81541	GGA		0.393	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1			Missense_Mutation
MKI67	4288	broad.mit.edu	37	10	129901621	129901621	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr10:129901621G>A	ENST00000368654.3	-	13	8858	c.8483C>T	c.(8482-8484)tCa>tTa	p.S2828L	MKI67_ENST00000368653.3_Missense_Mutation_p.S2468L	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2828	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TAGTTCTGGTGATGATTTGCA	0.488																																																0			10											200.0	177.0	185.0					10																	129901621		2203	4300	6503	129791611	SO:0001583	missense	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8483C>T	10.37:g.129901621G>A	ENSP00000357643:p.Ser2828Leu	Unknown		x	x	x	129791611	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	6.395	0.440991	0.12164	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02177	4.41;4.41	3.27	-5.27	0.02763	.	.	.	.	.	T	0.01029	0.0034	N	0.11106	0.095	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.11329	0.004;0.006;0.005	T	0.48246	-0.9052	9	0.29301	T	0.29	.	0.1681	0.00110	0.3408:0.1503:0.2056:0.3033	.	2827;2468;2828	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	L	2828;2468;2827	ENSP00000357643:S2828L;ENSP00000357642:S2468L	ENSP00000357642:S2468L	S	-	2	0	MKI67	129791611	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.037000	0.13840	-0.896000	0.03915	-1.840000	0.00586	TCA		0.488	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		Missense_Mutation
MUC5B	727897	broad.mit.edu	37	11	1247994	1247994	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr11:1247994C>A	ENST00000529681.1	+	4	407	c.349C>A	c.(349-351)Cag>Aag	p.Q117K	MUC5B_ENST00000447027.1_Missense_Mutation_p.Q117K	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	117	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Q117K(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTTCAACGTCCAGCTACGCCG	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											36.0	39.0	38.0					11																	1247994		2121	4241	6362	1204570	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.349C>A	11.37:g.1247994C>A	ENSP00000436812:p.Gln117Lys	Unknown		x	x	x	1204570	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	7.099	0.573652	0.13623	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.58358	0.34;0.34	3.68	2.75	0.32379	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.66771	0.2823	M	0.79475	2.455	0.33353	D	0.57129	B;P;D	0.57899	0.375;0.889;0.981	B;P;P	0.57425	0.251;0.736;0.82	T	0.77480	-0.2572	9	0.87932	D	0	.	12.263	0.54661	0.1713:0.8287:0.0:0.0	.	117;773;117	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	K	117;117;117;150	ENSP00000436812:Q117K;ENSP00000415793:Q117K	ENSP00000343037:Q117K	Q	+	1	0	MUC5B	1204570	1.000000	0.71417	0.028000	0.17463	0.090000	0.18270	5.378000	0.66190	0.734000	0.32515	0.561000	0.74099	CAG		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		Missense_Mutation
RIC3	79608	broad.mit.edu	37	11	8132397	8132397	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr11:8132397C>G	ENST00000309737.6	-	6	957	c.958G>C	c.(958-960)Gct>Cct	p.A320P	RIC3_ENST00000396677.2_Missense_Mutation_p.A158P|RIC3_ENST00000343202.4_Missense_Mutation_p.A319P|RIC3_ENST00000335425.7_Missense_Mutation_p.A138P|RIC3_ENST00000425599.2_Missense_Mutation_p.A239P|RIC3_ENST00000530060.1_5'UTR|RIC3_ENST00000539720.1_Missense_Mutation_p.A271P			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone	320					cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.A319P(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		CTGAATCCAGCATTCTCTGCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											140.0	128.0	132.0					11																	8132397		2201	4296	6497	8088973	SO:0001583	missense	79608				CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.958G>C	11.37:g.8132397C>G	ENSP00000308820:p.Ala320Pro	Unknown		x	x	x	8088973	B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Missense_Mutation	SNP	ENST00000309737.6	37	CCDS55742.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234267	0.58886	.	.	ENSG00000166405	ENST00000396677;ENST00000335425;ENST00000343202;ENST00000309737;ENST00000539720;ENST00000425599	T;T;T;T	0.35605	1.34;1.34;1.35;1.3	5.96	1.46	0.22682	.	0.515676	0.20092	N	0.099436	T	0.50377	0.1612	M	0.67953	2.075	0.40134	D	0.976753	D;D;D;D;D	0.76494	0.989;0.996;0.999;0.999;0.966	P;P;D;D;P	0.66979	0.885;0.885;0.948;0.948;0.696	T	0.50021	-0.8876	10	0.72032	D	0.01	.	7.1573	0.25645	0.1235:0.63:0.0:0.2465	.	239;138;320;319;158	B0B1U0;Q7Z5B4-3;Q7Z5B4;Q7Z5B4-5;D3DQU6	.;.;RIC3_HUMAN;.;.	P	158;138;319;320;271;239	ENSP00000344904:A319P;ENSP00000308820:A320P;ENSP00000443871:A271P;ENSP00000395320:A239P	ENSP00000308820:A320P	A	-	1	0	RIC3	8088973	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	1.503000	0.35715	0.401000	0.25424	-0.142000	0.14014	GCT		0.473	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385900.1	NM_024557		Missense_Mutation
OR5T2	219464	broad.mit.edu	37	11	55999592	55999592	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr11:55999592G>T	ENST00000313264.4	-	1	1145	c.1070C>A	c.(1069-1071)aCt>aAt	p.T357N		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	357						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T357N(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TTATTTTTTAGTATGAAAATA	0.328																																																1	Substitution - Missense(1)	ovary(1)	11											13.0	14.0	14.0					11																	55999592		2139	4215	6354	55756168	SO:0001583	missense	219464			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.1070C>A	11.37:g.55999592G>T	ENSP00000323688:p.Thr357Asn	Unknown		x	x	x	55756168	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	2.772	-0.255558	0.05829	.	.	ENSG00000181718	ENST00000313264	T	0.00664	5.92	3.32	-4.66	0.03329	.	.	.	.	.	T	0.00440	0.0014	N	0.08118	0	0.09310	N	1	B	0.26400	0.148	B	0.17433	0.018	T	0.44050	-0.9353	9	0.30854	T	0.27	.	6.1779	0.20455	0.2693:0.3872:0.3435:0.0	.	357	Q8NGG2	OR5T2_HUMAN	N	357	ENSP00000323688:T357N	ENSP00000323688:T357N	T	-	2	0	OR5T2	55756168	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.916000	0.00696	-1.143000	0.02866	-0.875000	0.02981	ACT		0.328	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		Missense_Mutation
SYT7	9066	broad.mit.edu	37	11	61291333	61291333	+	Silent	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr11:61291333C>G	ENST00000263846.4	-	7	1200	c.873G>C	c.(871-873)cgG>cgC	p.R291R	SYT7_ENST00000542836.1_Silent_p.R335R|SYT7_ENST00000542670.1_Silent_p.R499R|SYT7_ENST00000540677.1_Silent_p.R366R|SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000535826.1_Silent_p.R410R|SYT7_ENST00000539008.1_Silent_p.R574R	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	291	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.R291R(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CTTTGAGGTTCCGGGCTTTGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											321.0	305.0	310.0					11																	61291333		2202	4299	6501	61047909	SO:0001819	synonymous_variant	9066			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.873G>C	11.37:g.61291333C>G		Unknown		x	x	x	61047909	F5GZU9|Q08AH6	Silent	SNP	ENST00000263846.4	37	CCDS31577.1	SNP	30	Broad																																																																																				0.612	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200		Silent
FADS3	3995	broad.mit.edu	37	11	61643837	61643837	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr11:61643837G>T	ENST00000278829.2	-	9	1226	c.1074C>A	c.(1072-1074)agC>agA	p.S358R	FADS3_ENST00000525588.1_Missense_Mutation_p.S330R|FADS3_ENST00000540820.1_3'UTR|FADS3_ENST00000527697.1_Missense_Mutation_p.S234R	NM_021727.3	NP_068373.1	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	358					unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717)	p.S358R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCACCTGAGAGCTGACCCAGT	0.652																																																1	Substitution - Missense(1)	ovary(1)	11											46.0	41.0	43.0					11																	61643837		2202	4299	6501	61400413	SO:0001583	missense	3995				CCDS8013.1	11q12-q13.1	2013-01-25			ENSG00000221968	ENSG00000221968	1.14.19.3	"""Fatty acid desaturases"""	3576	protein-coding gene	gene with protein product	"""delta-9-desaturase"""	606150		LLCDL3			Standard	NM_021727		Approved	CYB5RP	uc001nsm.3	Q9Y5Q0	OTTHUMG00000167500	ENST00000278829.2:c.1074C>A	11.37:g.61643837G>T	ENSP00000278829:p.Ser358Arg	Unknown		x	x	x	61400413	O60426	Missense_Mutation	SNP	ENST00000278829.2	37	CCDS8013.1	SNP	34	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.209|9.209	1.030445|1.030445	0.19512|0.19512	.|.	.|.	ENSG00000221968|ENSG00000221968	ENST00000527379|ENST00000527697;ENST00000278829;ENST00000525588	.|T;T;T	.|0.17213	.|2.29;2.29;2.29	4.65|4.65	3.74|3.74	0.42951|0.42951	.|Fatty acid desaturase, type 1 (1);	.|.	.|.	.|.	.|.	T|T	0.20659|0.20659	0.0497|0.0497	L|L	0.46947|0.46947	1.48|1.48	0.80722|0.80722	D|D	1|1	.|P;B	.|0.35982	.|0.531;0.347	.|P;P	.|0.47941	.|0.562;0.481	T|T	0.05852|0.05852	-1.0860|-1.0860	5|9	.|0.33141	.|T	.|0.24	-4.0E-4|-4.0E-4	4.6867|4.6867	0.12760|0.12760	0.1828:0.0:0.6427:0.1745|0.1828:0.0:0.6427:0.1745	.|.	.|234;358	.|E9PKP8;Q9Y5Q0	.|.;FADS3_HUMAN	D|R	133|234;358;330	.|ENSP00000431533:S234R;ENSP00000278829:S358R;ENSP00000432206:S330R	.|ENSP00000278829:S358R	A|S	-|-	2|3	0|2	FADS3|FADS3	61400413|61400413	0.905000|0.905000	0.30787|0.30787	0.140000|0.140000	0.22221|0.22221	0.009000|0.009000	0.06853|0.06853	1.072000|1.072000	0.30678|0.30678	1.112000|1.112000	0.41740|0.41740	-0.140000|-0.140000	0.14226|0.14226	GCT|AGC		0.652	FADS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394836.1			Missense_Mutation
CACNA1C	775	broad.mit.edu	37	12	2800095	2800095	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr12:2800095T>A	ENST00000347598.4	+	49	6291	c.6291T>A	c.(6289-6291)ttT>ttA	p.F2097L	CACNA1C_ENST00000402845.3_Missense_Mutation_p.F2068L|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399617.1_Missense_Mutation_p.F2084L|CACNA1C_ENST00000335762.5_Missense_Mutation_p.F2074L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.F2068L|CACNA1C_ENST00000399591.1_Missense_Mutation_p.F2057L|CACNA1C_ENST00000399601.1_Missense_Mutation_p.F2049L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.F2069L|CACNA1C_ENST00000399595.1_Missense_Mutation_p.F2057L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.F2068L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.F2090L|CACNA1C_ENST00000399655.1_Missense_Mutation_p.F2049L|CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C_ENST00000399634.1_Missense_Mutation_p.F2120L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.F2077L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.F2049L|CACNA1C_ENST00000399603.1_Missense_Mutation_p.F2049L|CACNA1C_ENST00000406454.3_Missense_Mutation_p.F2120L|CACNA1C_ENST00000399629.1_Missense_Mutation_p.F2066L|CACNA1C_ENST00000327702.7_Missense_Mutation_p.F2084L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.F2055L|CACNA1C_ENST00000399597.1_Missense_Mutation_p.F2049L|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399644.1_Missense_Mutation_p.F2049L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2132					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGGCAGTTTGCTCAAGATC	0.567																																																0			12											15.0	16.0	15.0					12																	2800095		1996	4167	6163	2670356	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6291T>A	12.37:g.2800095T>A	ENSP00000266376:p.Phe2097Leu	Unknown		x	x	x	2670356	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718771	0.48622	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.11	1.42	0.22433	.	0.190216	0.44285	D	0.000470	T	0.59280	0.2182	N	0.17474	0.49	0.35356	D	0.78775	P;D;B;B;D;P;P;P;B;P;P;B;P;P;B;B;P;B;P;B;P;B;P;B;B	0.63046	0.761;0.992;0.4;0.382;0.988;0.69;0.459;0.51;0.055;0.51;0.649;0.4;0.587;0.51;0.278;0.413;0.587;0.002;0.649;0.043;0.459;0.078;0.649;0.4;0.4	B;D;B;B;D;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.73708	0.265;0.923;0.225;0.146;0.981;0.439;0.287;0.384;0.089;0.311;0.384;0.164;0.266;0.384;0.079;0.254;0.266;0.005;0.297;0.087;0.16;0.127;0.297;0.164;0.225	T	0.59931	-0.7361	10	0.20046	T	0.44	.	10.9787	0.47482	0.0:0.1997:0.0:0.8003	.	740;2090;2046;2132;2084;2068;2049;2066;2077;2049;2069;2049;2080;2097;2049;2084;2120;2057;2055;2057;2038;2068;2068;2049;2049	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	2074;2049;2049;2077;2049;2068;2068;2057;2049;2097;2069;2049;2090;2066;2084;2055;2068;2049;2120;2084;2120;2057;1950	ENSP00000336982:F2074L;ENSP00000382563:F2049L;ENSP00000382552:F2049L;ENSP00000382547:F2077L;ENSP00000382506:F2049L;ENSP00000382530:F2068L;ENSP00000382546:F2068L;ENSP00000382500:F2057L;ENSP00000382549:F2049L;ENSP00000266376:F2097L;ENSP00000382515:F2069L;ENSP00000382510:F2049L;ENSP00000341092:F2090L;ENSP00000382537:F2066L;ENSP00000329877:F2084L;ENSP00000382557:F2055L;ENSP00000385724:F2068L;ENSP00000382512:F2049L;ENSP00000382542:F2120L;ENSP00000382526:F2084L;ENSP00000385896:F2120L;ENSP00000382504:F2057L	ENSP00000323129:F1950L	F	+	3	2	CACNA1C	2670356	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	2.029000	0.41098	0.045000	0.15804	-2.200000	0.00306	TTT		0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		Missense_Mutation
ARID2	196528	broad.mit.edu	37	12	46245336	46245336	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr12:46245336C>T	ENST00000334344.6	+	15	3602	c.3430C>T	c.(3430-3432)Ccc>Tcc	p.P1144S	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Missense_Mutation_p.P754S|ARID2_ENST00000422737.1_Missense_Mutation_p.P995S	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1144					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P1144S(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		ACAAACTGTGCCCATTTCGAA	0.493			"""N, S, F"""		hepatocellular carcinoma																																		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	ovary(1)	12											95.0	91.0	92.0					12																	46245336		2203	4300	6503	44531603	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3430C>T	12.37:g.46245336C>T	ENSP00000335044:p.Pro1144Ser	Unknown		x	x	x	44531603	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261392	0.39995	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.33865	1.39	5.86	5.86	0.93980	.	0.154543	0.64402	D	0.000016	T	0.28134	0.0694	L	0.27053	0.805	0.80722	D	1	B;B;B	0.33637	0.42;0.42;0.296	B;B;B	0.29176	0.099;0.099;0.027	T	0.03630	-1.1018	10	0.20046	T	0.44	-4.825	20.1931	0.98233	0.0:1.0:0.0:0.0	.	1144;754;1144	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	S	1144;261;261;995;754	ENSP00000335044:P1144S	ENSP00000335044:P1144S	P	+	1	0	ARID2	44531603	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.263000	0.78421	2.771000	0.95319	0.563000	0.77884	CCC		0.493	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		Missense_Mutation
ZDHHC17	23390	broad.mit.edu	37	12	77203581	77203581	+	Silent	SNP	C	C	T	rs368594858	byFrequency	TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr12:77203581C>T	ENST00000426126.2	+	5	1136	c.487C>T	c.(487-489)Ctg>Ttg	p.L163L	ZDHHC17_ENST00000334822.5_Silent_p.L163L|ZDHHC17_ENST00000359019.4_Silent_p.L113L	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	163					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						CTGTATTCATCTGGCTGCTCA	0.373													C|||	4	0.000798722	0.003	0.0	5008	,	,		15606	0.0		0.0	False		,,,				2504	0.0															0			12						C		3,3765		0,3,1881	108.0	99.0	102.0		487	3.5	1.0	12		102	0,8240		0,0,4120	no	coding-synonymous	ZDHHC17	NM_015336.2		0,3,6001	TT,TC,CC		0.0,0.0796,0.025		163/633	77203581	3,12005	1884	4120	6004	75727712	SO:0001819	synonymous_variant	23390			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.487C>T	12.37:g.77203581C>T		Unknown		x	x	x	75727712	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Silent	SNP	ENST00000426126.2	37	CCDS44946.1	SNP	32	Broad																																																																																				0.373	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406555.1	NM_015336		Silent
TMPO	7112	broad.mit.edu	37	12	98927521	98927521	+	Intron	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr12:98927521G>T	ENST00000556029.1	+	3	921				TMPO_ENST00000343315.5_Intron|TMPO_ENST00000266732.4_Nonsense_Mutation_p.E496*|TMPO_ENST00000393053.2_Intron|TMPO_ENST00000261210.5_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)	p.E496*(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCCCTTCCATGAATCTATTTT	0.413																																																2	Substitution - Nonsense(2)	ovary(1)|skin(1)	12											71.0	69.0	70.0					12																	98927521		2203	4300	6503	97451652	SO:0001627	intron_variant	7112				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.565+1905G>T	12.37:g.98927521G>T		Unknown		x	x	x	97451652	A2T926|Q14861	Nonsense_Mutation	SNP	ENST00000556029.1	37	CCDS31879.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.545722	0.97654	.	.	ENSG00000120802	ENST00000266732	.	.	.	5.65	4.76	0.60689	.	0.233772	0.37623	N	0.002017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-10.731	10.6226	0.45489	0.0883:0.0:0.9117:0.0	.	.	.	.	X	496	.	ENSP00000266732:E496X	E	+	1	0	TMPO	97451652	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.950000	0.49081	1.522000	0.49001	0.650000	0.86243	GAA		0.413	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276		Nonsense_Mutation
NOS1	4842	broad.mit.edu	37	12	117665296	117665296	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr12:117665296G>T	ENST00000338101.4	-	23	3662	c.3658C>A	c.(3658-3660)Cca>Aca	p.P1220T	NOS1_ENST00000317775.6_Missense_Mutation_p.P1186T|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.P1186T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TACATGTCTGGGGAGGAGCTG	0.607																																					Esophageal Squamous(162;1748 2599 51982 52956)											1	Substitution - Missense(1)	ovary(1)	12											70.0	83.0	79.0					12																	117665296		2103	4222	6325	116149679	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3658C>A	12.37:g.117665296G>T	ENSP00000337459:p.Pro1220Thr	Unknown		x	x	x	116149679		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858795	0.91433	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.68331	-0.32;-0.32	4.95	4.95	0.65309	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.90591	0.4537	10	0.72032	D	0.01	-16.6131	18.3687	0.90400	0.0:0.0:1.0:0.0	.	1186	P29475	NOS1_HUMAN	T	1081;1186;1186;1220	ENSP00000320758:P1186T;ENSP00000337459:P1220T	ENSP00000320758:P1186T	P	-	1	0	NOS1	116149679	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.733000	0.84916	2.557000	0.86248	0.591000	0.81541	CCA		0.607	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			Missense_Mutation
LECT1	11061	broad.mit.edu	37	13	53277821	53277821	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr13:53277821G>C	ENST00000377962.3	-	7	992	c.914C>G	c.(913-915)cCa>cGa	p.P305R	LECT1_ENST00000448904.2_Missense_Mutation_p.P304R			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	305					cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)		p.P305R(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		ATAAGGCCATGGGTAATAGCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	13											72.0	73.0	72.0					13																	53277821		2203	4300	6503	52175822	SO:0001583	missense	11061			AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.914C>G	13.37:g.53277821G>C	ENSP00000367198:p.Pro305Arg	Unknown		x	x	x	52175822	Q5TAM4|Q8TAY6|Q9UM18	Missense_Mutation	SNP	ENST00000377962.3	37	CCDS9437.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214631	0.79352	.	.	ENSG00000136110	ENST00000448904;ENST00000377962	T;T	0.36520	1.26;1.25	5.3	5.3	0.74995	.	0.108387	0.64402	D	0.000007	T	0.63920	0.2552	M	0.78637	2.42	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.972	T	0.67098	-0.5756	10	0.87932	D	0	.	19.1447	0.93459	0.0:0.0:1.0:0.0	.	304;305	O75829-2;O75829	.;LECT1_HUMAN	R	304;305	ENSP00000388576:P304R;ENSP00000367198:P305R	ENSP00000367198:P305R	P	-	2	0	LECT1	52175822	1.000000	0.71417	0.955000	0.39395	0.993000	0.82548	6.041000	0.70988	2.753000	0.94483	0.585000	0.79938	CCA		0.522	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045110.3			Missense_Mutation
SLC10A2	6555	broad.mit.edu	37	13	103703609	103703609	+	Nonsense_Mutation	SNP	G	G	C	rs150229163		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr13:103703609G>C	ENST00000245312.3	-	4	1355	c.759C>G	c.(757-759)taC>taG	p.Y253*		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	253					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.Y253*(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TGCCATACCTGTACCAGGGTA	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	13											70.0	72.0	71.0					13																	103703609		2203	4300	6503	102501610	SO:0001587	stop_gained	6555			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.759C>G	13.37:g.103703609G>C	ENSP00000245312:p.Tyr253*	Unknown		x	x	x	102501610	A1L4F4|Q13839	Nonsense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.407071	0.98265	.	.	ENSG00000125255	ENST00000245312	.	.	.	5.46	4.58	0.56647	.	0.574580	0.19974	N	0.101912	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-14.0415	16.3048	0.82843	0.0:0.1319:0.8681:0.0	.	.	.	.	X	253	.	ENSP00000245312:Y253X	Y	-	3	2	SLC10A2	102501610	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	3.578000	0.53892	2.576000	0.86940	0.460000	0.39030	TAC		0.428	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1			Nonsense_Mutation
GMPR2	51292	broad.mit.edu	37	14	24706359	24706359	+	Splice_Site	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:24706359G>C	ENST00000355299.4	+	6	1008		c.e6+1		GMPR2_ENST00000559104.1_Splice_Site|GMPR2_ENST00000559910.1_Splice_Site|GMPR2_ENST00000399440.2_Splice_Site|GMPR2_ENST00000456667.3_Splice_Site|GMPR2_ENST00000420554.2_Splice_Site|GMPR2_ENST00000560517.1_Splice_Site|GMPR2_ENST00000557854.1_Splice_Site|GMPR2_ENST00000348719.7_Splice_Site|GMPR2_ENST00000559836.1_Splice_Site	NM_001002000.1	NP_001002000.1	Q9P2T1	GMPR2_HUMAN	guanosine monophosphate reductase 2						GMP metabolic process (GO:0046037)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)	p.?(1)		large_intestine(4)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(265;0.0181)		ATTGGGCCAGGTAAGCTGGTT	0.512																																																1	Unknown(1)	ovary(1)	14											115.0	117.0	116.0					14																	24706359		1995	4196	6191	23776199	SO:0001630	splice_region_variant	51292				CCDS41935.1, CCDS45087.1, CCDS61419.1, CCDS73624.1	14q11.2	2006-11-24							4377	protein-coding gene	gene with protein product		610781					Standard	XM_005267742		Approved		uc001wnw.3	Q9P2T1		ENST00000355299.4:c.547+1G>C	14.37:g.24706359G>C		Unknown		x	x	x	23776199	D3DS66|Q567T0|Q6IAJ8|Q86T14	Splice_Site_SNP	SNP	ENST00000355299.4	37	CCDS41935.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310005	0.81247	.	.	ENSG00000100938	ENST00000355299;ENST00000421944;ENST00000420554;ENST00000399440;ENST00000348719;ENST00000456667	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0474	0.89337	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GMPR2	23776199	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.188000	0.94921	2.793000	0.96121	0.563000	0.77884	.		0.512	GMPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415821.2	NM_016576	Intron	Splice_Site_SNP
L2HGDH	79944	broad.mit.edu	37	14	50769692	50769692	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:50769692C>G	ENST00000267436.4	-	2	581	c.184G>C	c.(184-186)Gcc>Ccc	p.A62P	L2HGDH_ENST00000555423.1_Missense_Mutation_p.A62P|L2HGDH_ENST00000555610.1_Missense_Mutation_p.A62P|L2HGDH_ENST00000421284.3_Missense_Mutation_p.A62P|L2HGDH_ENST00000556393.1_5'UTR|L2HGDH_ENST00000261699.4_Missense_Mutation_p.A62P			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	62					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)	p.A62P(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					CTGGCAGAGGCAAGCCCCACA	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											123.0	123.0	123.0					14																	50769692		2203	4300	6503	49839442	SO:0001583	missense	79944				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.184G>C	14.37:g.50769692C>G	ENSP00000267436:p.Ala62Pro	Unknown		x	x	x	49839442	Q9BRR1	Missense_Mutation	SNP	ENST00000267436.4	37	CCDS9698.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.430251	0.96131	.	.	ENSG00000087299	ENST00000261699;ENST00000267436;ENST00000421284;ENST00000557131;ENST00000555423;ENST00000555610	D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73	5.35	5.35	0.76521	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.94978	0.8375	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.992	D	0.96243	0.9177	10	0.87932	D	0	-17.2031	19.9585	0.97232	0.0:1.0:0.0:0.0	.	62;62	C9JVN9;Q9H9P8	.;L2HDH_HUMAN	P	62	ENSP00000261699:A62P;ENSP00000267436:A62P;ENSP00000405559:A62P;ENSP00000450494:A62P;ENSP00000452483:A62P	ENSP00000261699:A62P	A	-	1	0	L2HGDH	49839442	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.365000	0.79537	2.894000	0.99253	0.655000	0.94253	GCC		0.393	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884		Missense_Mutation
NAA30	122830	broad.mit.edu	37	14	57858246	57858246	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:57858246C>T	ENST00000556492.1	+	2	725	c.571C>T	c.(571-573)Ctg>Ttg	p.L191L	NAA30_ENST00000554703.1_Intron|NAA30_ENST00000555166.1_Intron	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	191					metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)	p.L191L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						GTCTTCGTCCCTGACCGCCGA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											28.0	35.0	32.0					14																	57858246		2201	4294	6495	56927999	SO:0001819	synonymous_variant	122830			AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.571C>T	14.37:g.57858246C>T		Unknown		x	x	x	56927999	Q0IIN2	Silent	SNP	ENST00000556492.1	37	CCDS32088.1	SNP	24	Broad																																																																																				0.637	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412925.1	NM_001011713		Silent
POMT2	29954	broad.mit.edu	37	14	77762597	77762597	+	Silent	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:77762597C>A	ENST00000261534.4	-	9	1228	c.1026G>T	c.(1024-1026)gtG>gtT	p.V342V		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	342	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)	p.V342V(1)		breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		TCACAGTGATCACAGAGCCGT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											75.0	55.0	62.0					14																	77762597		2203	4300	6503	76832350	SO:0001819	synonymous_variant	29954			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1026G>T	14.37:g.77762597C>A		Unknown		x	x	x	76832350	Q9NSG6|Q9P1W0|Q9P1W2	Silent	SNP	ENST00000261534.4	37	CCDS9857.1	SNP	29	Broad																																																																																				0.637	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382		Silent
NRDE2	55051	broad.mit.edu	37	14	90769162	90769162	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:90769162T>G	ENST00000354366.3	-	6	1545	c.1313A>C	c.(1312-1314)cAc>cCc	p.H438P	NRDE2_ENST00000357904.3_Missense_Mutation_p.H207P	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	438								p.H438P(1)									ATAAAGACTGTGAATTTTTGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	14											69.0	70.0	69.0					14																	90769162		2203	4300	6503	89838915	SO:0001583	missense	55051			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1313A>C	14.37:g.90769162T>G	ENSP00000346335:p.His438Pro	Unknown		x	x	x	89838915	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	37	CCDS9890.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	16.94	3.260061	0.59321	.	.	ENSG00000119720	ENST00000354366;ENST00000357904;ENST00000554464	T;T	0.33654	1.4;1.4	5.51	5.51	0.81932	Domain of unknown function DUF1740 (1);	0.100932	0.64402	D	0.000005	T	0.31702	0.0805	L	0.40543	1.245	0.46823	D	0.999213	P	0.37122	0.583	B	0.35278	0.199	T	0.06752	-1.0809	10	0.36615	T	0.2	-14.0089	15.6476	0.77068	0.0:0.0:0.0:1.0	.	438	Q9H7Z3	CN102_HUMAN	P	438;207;7	ENSP00000346335:H438P;ENSP00000350579:H207P	ENSP00000346335:H438P	H	-	2	0	C14orf102	89838915	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	4.740000	0.62087	2.091000	0.63221	0.528000	0.53228	CAC		0.423	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970		Missense_Mutation
TTC7B	145567	broad.mit.edu	37	14	91084326	91084326	+	Silent	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:91084326A>T	ENST00000328459.6	-	16	1936	c.1815T>A	c.(1813-1815)acT>acA	p.T605T	TTC7B_ENST00000554654.1_5'UTR|TTC7B_ENST00000357056.2_Silent_p.T605T	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	605								p.T605T(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				TGTGCTTACAAGTCAGCAGTG	0.552																																																1	Substitution - coding silent(1)	ovary(1)	14											131.0	123.0	125.0					14																	91084326		2203	4300	6503	90154079	SO:0001819	synonymous_variant	145567			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.1815T>A	14.37:g.91084326A>T		Unknown		x	x	x	90154079	Q86U24|Q86VT3	Silent	SNP	ENST00000328459.6	37	CCDS32140.1	SNP	3	Broad																																																																																				0.552	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2			Silent
SERPINA4	5267	broad.mit.edu	37	14	95030122	95030122	+	Silent	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr14:95030122C>A	ENST00000557004.1	+	2	724	c.303C>A	c.(301-303)atC>atA	p.I101I	SERPINA4_ENST00000555095.1_Silent_p.I101I|SERPINA4_ENST00000298841.5_Silent_p.I101I|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	101					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.I101I(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GCAGCCAGATCCTTGAGGGCC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											41.0	43.0	42.0					14																	95030122		2203	4300	6503	94099875	SO:0001819	synonymous_variant	5267			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.303C>A	14.37:g.95030122C>A		Unknown		x	x	x	94099875	Q53XB5|Q86TR9|Q96BZ5	Silent	SNP	ENST00000557004.1	37	CCDS9927.1	SNP	30	Broad																																																																																				0.637	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		Silent
NPAP1	23742	broad.mit.edu	37	15	24921335	24921335	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:24921335G>T	ENST00000329468.2	+	1	795	c.321G>T	c.(319-321)agG>agT	p.R107S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	107					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R107S(1)									ACCCCCCGAGGTTTGGACACC	0.677																																																1	Substitution - Missense(1)	ovary(1)	15											46.0	38.0	41.0					15																	24921335		2199	4293	6492	22472428	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.321G>T	15.37:g.24921335G>T	ENSP00000333735:p.Arg107Ser	Unknown		x	x	x	22472428		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	.	2.239	-0.374263	0.05034	.	.	ENSG00000185823	ENST00000329468	T	0.06218	3.33	2.45	0.414	0.16406	.	3.487680	0.01209	N	0.007796	T	0.06872	0.0175	N	0.22421	0.69	0.09310	N	1	P	0.47253	0.892	P	0.47251	0.542	T	0.19516	-1.0303	10	0.27785	T	0.31	.	3.5165	0.07727	0.1633:0.2682:0.5684:0.0	.	107	Q9NZP6	CO002_HUMAN	S	107	ENSP00000333735:R107S	ENSP00000333735:R107S	R	+	3	2	C15orf2	22472428	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.109000	0.10840	0.121000	0.18284	0.484000	0.47621	AGG		0.677	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		Missense_Mutation
RYR3	6263	broad.mit.edu	37	15	33895399	33895399	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:33895399C>T	ENST00000389232.4	+	18	2068	c.1998C>T	c.(1996-1998)atC>atT	p.I666I	RYR3_ENST00000415757.3_Silent_p.I666I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	666	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.I666I(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGCTGATTATCGACCAGGTGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	15											135.0	141.0	139.0					15																	33895399		2004	4170	6174	31682691	SO:0001819	synonymous_variant	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1998C>T	15.37:g.33895399C>T		Unknown		x	x	x	31682691	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1	SNP	31	Broad																																																																																				0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			Silent
MTFMT	123263	broad.mit.edu	37	15	65313950	65313950	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:65313950C>T	ENST00000220058.4	-	4	560	c.547G>A	c.(547-549)Gat>Aat	p.D183N	MTFMT_ENST00000561025.1_5'UTR	NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	183						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)	p.D183N(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	GGGCCTACATCAAACCTAGCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	15											128.0	122.0	124.0					15																	65313950		1877	4110	5987	63101003	SO:0001583	missense	123263			AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.547G>A	15.37:g.65313950C>T	ENSP00000220058:p.Asp183Asn	Unknown		x	x	x	63101003	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681220	0.68042	.	.	ENSG00000103707	ENST00000220058	D	0.94966	-3.57	5.39	5.39	0.77823	Formyl transferase, N-terminal (3);	0.126678	0.56097	D	0.000023	D	0.98469	0.9490	H	0.98199	4.17	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.99774	1.1025	10	0.87932	D	0	-11.4188	17.9158	0.88950	0.0:1.0:0.0:0.0	.	183	Q96DP5	FMT_HUMAN	N	183	ENSP00000220058:D183N	ENSP00000220058:D183N	D	-	1	0	MTFMT	63101003	1.000000	0.71417	0.998000	0.56505	0.007000	0.05969	6.815000	0.75242	2.511000	0.84671	0.655000	0.94253	GAT		0.413	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242		Missense_Mutation
HEXA	3073	broad.mit.edu	37	15	72643496	72643496	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:72643496G>C	ENST00000268097.5	-	6	1153	c.650C>G	c.(649-651)aCt>aGt	p.T217S	HEXA_ENST00000567159.1_Missense_Mutation_p.T217S|HEXA_ENST00000429918.2_Missense_Mutation_p.T44S|HEXA_ENST00000457859.2_Missense_Mutation_p.T25S|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.T228S|RP11-106M3.3_ENST00000570175.1_RNA	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	217					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.T217S(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						CTCTGGAAAAGTGAAGCTCTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	15											162.0	130.0	141.0					15																	72643496		2199	4297	6496	70430550	SO:0001583	missense	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.650C>G	15.37:g.72643496G>C	ENSP00000268097:p.Thr217Ser	Unknown		x	x	x	70430550	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	CCDS10243.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604435	0.66445	.	.	ENSG00000213614	ENST00000268097;ENST00000457859;ENST00000429918	D;D;D	0.95272	-3.66;-3.66;-3.66	5.78	4.83	0.62350	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.111773	0.64402	D	0.000014	D	0.89876	0.6842	N	0.21617	0.685	0.46044	D	0.998835	B;B;B;B;B	0.11235	0.0;0.004;0.0;0.0;0.001	B;B;B;B;B	0.25614	0.004;0.062;0.004;0.004;0.01	D	0.84979	0.0887	10	0.21540	T	0.41	-15.6742	16.2242	0.82283	0.0:0.0:0.8665:0.1335	.	44;228;44;97;217	E9PGL4;B4DVA7;B4DVL8;Q9BVJ8;P06865	.;.;.;.;HEXA_HUMAN	S	217;25;44	ENSP00000268097:T217S;ENSP00000398026:T25S;ENSP00000416187:T44S	ENSP00000268097:T217S	T	-	2	0	HEXA	70430550	1.000000	0.71417	0.916000	0.36221	0.999000	0.98932	5.560000	0.67332	2.706000	0.92434	0.655000	0.94253	ACT		0.468	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520		Missense_Mutation
STOML1	9399	broad.mit.edu	37	15	74276403	74276403	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:74276403C>G	ENST00000316900.5	-	7	1196	c.1072G>C	c.(1072-1074)Gac>Cac	p.D358H	STOML1_ENST00000564777.1_Missense_Mutation_p.D307H|STOML1_ENST00000541638.1_Missense_Mutation_p.D315H|STOML1_ENST00000316911.6_Missense_Mutation_p.D308H|STOML1_ENST00000561656.1_Missense_Mutation_p.D270H|STOML1_ENST00000359750.4_Missense_Mutation_p.D287H	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	358	SCP2.					integral component of membrane (GO:0016021)		p.D358H(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						GCCCGCAGGTCTGCCTCGGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	15											41.0	40.0	40.0					15																	74276403		2198	4297	6495	72063456	SO:0001583	missense	9399			Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.1072G>C	15.37:g.74276403C>G	ENSP00000319323:p.Asp358His	Unknown		x	x	x	72063456	B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Missense_Mutation	SNP	ENST00000316900.5	37	CCDS10254.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007899	0.54361	.	.	ENSG00000067221	ENST00000316900;ENST00000316911;ENST00000541638;ENST00000359750	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	4.28	4.28	0.50868	SCP2 sterol-binding domain (2);	0.051039	0.85682	D	0.000000	T	0.50292	0.1607	M	0.71296	2.17	0.80722	D	1	D;D;D;D;D;D	0.89917	0.979;1.0;0.974;1.0;0.979;1.0	D;D;P;D;P;D	0.91635	0.931;0.999;0.746;0.999;0.835;0.988	T	0.56068	-0.8040	10	0.87932	D	0	-21.6128	15.4493	0.75259	0.0:1.0:0.0:0.0	.	315;287;308;287;357;358	B4DUU5;E7ESC0;Q9UBI4-2;Q4PNR4;Q53HB6;Q9UBI4	.;.;.;.;.;STML1_HUMAN	H	358;308;315;287	ENSP00000319323:D358H;ENSP00000319384:D308H;ENSP00000442478:D315H;ENSP00000352788:D287H	ENSP00000319323:D358H	D	-	1	0	STOML1	72063456	1.000000	0.71417	0.743000	0.31040	0.039000	0.13416	5.333000	0.65917	2.214000	0.71695	0.467000	0.42956	GAC		0.622	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269022.1	NM_004809		Missense_Mutation
CIB2	10518	broad.mit.edu	37	15	78403610	78403610	+	Missense_Mutation	SNP	G	G	A	rs151260624		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:78403610G>A	ENST00000258930.3	-	3	423	c.95C>T	c.(94-96)tCg>tTg	p.S32L	CIB2_ENST00000560618.1_5'UTR|CIB2_ENST00000557846.1_Intron|CIB2_ENST00000539011.1_5'UTR	NM_006383.2	NP_006374.1	O75838	CIB2_HUMAN	calcium and integrin binding family member 2	32					calcium ion homeostasis (GO:0055074)|photoreceptor cell maintenance (GO:0045494)	blood microparticle (GO:0072562)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|photoreceptor inner segment (GO:0001917)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	11						ATAGAATCGCGAATGCAGCCT	0.607																																																0			15						G	LEU/SER	1,4391	2.1+/-5.4	0,1,2195	81.0	78.0	79.0		95	3.8	0.5	15	dbSNP_134	79	0,8586		0,0,4293	no	missense	CIB2	NM_006383.2	145	0,1,6488	AA,AG,GG		0.0,0.0228,0.0077	benign	32/188	78403610	1,12977	2196	4293	6489	76190665	SO:0001583	missense	10518			BC047381	CCDS10296.1, CCDS61722.1, CCDS61723.1	15q24	2013-01-10			ENSG00000136425	ENSG00000136425		"""EF-hand domain containing"""	24579	protein-coding gene	gene with protein product		605564	"""deafness, autosomal recessive 48"", ""Usher syndrome 1J (autosomal recessive)"""	DFNB48, USH1J		9931475, 23023331	Standard	NM_006383		Approved	KIP2	uc002bdb.2	O75838	OTTHUMG00000143731	ENST00000258930.3:c.95C>T	15.37:g.78403610G>A	ENSP00000258930:p.Ser32Leu	Unknown		x	x	x	76190665	B4DDF0|H0YM71|Q05BT6	Missense_Mutation	SNP	ENST00000258930.3	37	CCDS10296.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462143	0.43736	2.28E-4	0.0	ENSG00000136425	ENST00000258930	T	0.67523	-0.27	4.83	3.84	0.44239	EF-hand-like domain (1);	0.200252	0.41712	D	0.000832	T	0.52008	0.1708	L	0.41492	1.28	0.80722	D	1	B;B	0.30439	0.279;0.088	B;B	0.23275	0.033;0.045	T	0.57505	-0.7800	10	0.66056	D	0.02	-22.6512	7.8971	0.29712	0.0:0.2941:0.5542:0.1517	.	32;32	B4DDF0;O75838	.;CIB2_HUMAN	L	32	ENSP00000258930:S32L	ENSP00000258930:S32L	S	-	2	0	CIB2	76190665	0.163000	0.22920	0.496000	0.27539	0.044000	0.14063	1.945000	0.40273	2.233000	0.73108	0.591000	0.81541	TCG		0.607	CIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289798.1	NM_006383		Missense_Mutation
ZFAND6	54469	broad.mit.edu	37	15	80415041	80415041	+	Splice_Site	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:80415041G>C	ENST00000261749.6	+	5	685		c.e5-1		ZFAND6_ENST00000561060.1_Splice_Site|ZFAND6_ENST00000558087.1_Splice_Site|ZFAND6_ENST00000559157.1_Splice_Site|ZFAND6_ENST00000558688.1_Splice_Site|ZFAND6_ENST00000559775.1_Splice_Site|ZFAND6_ENST00000559835.1_Splice_Site|ZFAND6_ENST00000558494.1_Splice_Site	NM_001242913.1|NM_001242914.1|NM_019006.3	NP_001229842.1|NP_001229843.1|NP_061879.2	Q6FIF0	ZFAN6_HUMAN	zinc finger, AN1-type domain 6						apoptotic process (GO:0006915)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|protein targeting to peroxisome (GO:0006625)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)	p.?(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						TGCTTTTCTAGCCCTGTATCA	0.338																																																1	Unknown(1)	ovary(1)	15											116.0	111.0	113.0					15																	80415041		2203	4300	6503	78202096	SO:0001630	splice_region_variant	54469			BC005283	CCDS10313.1, CCDS58395.1	15q24.3	2013-01-09	2006-07-07	2006-07-07	ENSG00000086666	ENSG00000086666		"""Zinc fingers, AN1-type domain containing"""	30164	protein-coding gene	gene with protein product	"""protein associated with PRK1"""	610183	"""zinc finger, A20 domain containing 3"""	ZA20D3		11054541	Standard	NM_019006		Approved	ZFAND5B, AWP1	uc002bff.2	Q6FIF0	OTTHUMG00000144169	ENST00000261749.6:c.264-1G>C	15.37:g.80415041G>C		Unknown		x	x	x	78202096	D3DW92|D3DW94|O95792|Q9BQF7|Q9GZY3	Splice_Site_SNP	SNP	ENST00000261749.6	37	CCDS10313.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030856	0.54790	.	.	ENSG00000086666	ENST00000261749	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3544	0.87331	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZFAND6	78202096	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	6.136000	0.71703	2.532000	0.85374	0.555000	0.69702	.		0.338	ZFAND6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291368.1	NM_019006	Intron	Splice_Site_SNP
FES	2242	broad.mit.edu	37	15	91437172	91437172	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr15:91437172A>G	ENST00000328850.3	+	18	2352	c.2210A>G	c.(2209-2211)tAc>tGc	p.Y737C	FES_ENST00000394302.1_Missense_Mutation_p.Y596C|FES_ENST00000450438.2_Missense_Mutation_p.Y609C|FES_ENST00000394300.3_Missense_Mutation_p.Y679C|FES_ENST00000444422.2_Missense_Mutation_p.Y667C|FES_ENST00000414248.2_Missense_Mutation_p.Y609C	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	737	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCAGGCCGCTACTCCTCCGAA	0.672																																																0			15											110.0	116.0	114.0					15																	91437172		2198	4298	6496	89238176	SO:0001583	missense	2242			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.2210A>G	15.37:g.91437172A>G	ENSP00000331504:p.Tyr737Cys	Unknown		x	x	x	89238176	B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	ENST00000328850.3	37	CCDS10365.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	14.83	2.652371	0.47362	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.31	5.31	0.75309	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.059623	0.64402	D	0.000001	D	0.82889	0.5135	M	0.84156	2.68	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.996;0.999;0.998	D	0.85881	0.1422	10	0.87932	D	0	-31.8393	15.3107	0.74028	1.0:0.0:0.0:0.0	.	719;609;596;679;667;737	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	C	737;609;596;667;679;609	ENSP00000331504:Y737C;ENSP00000414629:Y609C;ENSP00000377839:Y596C;ENSP00000400868:Y667C;ENSP00000377837:Y679C;ENSP00000409915:Y609C	ENSP00000331504:Y737C	Y	+	2	0	FES	89238176	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	7.386000	0.79775	2.034000	0.60081	0.454000	0.30748	TAC		0.672	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313497.1	NM_002005		Missense_Mutation
DNAH3	55567	broad.mit.edu	37	16	20970575	20970575	+	Silent	SNP	G	G	A	rs190043471		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr16:20970575G>A	ENST00000261383.3	-	54	10751	c.10752C>T	c.(10750-10752)gcC>gcT	p.A3584A	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3584	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCCAGCTTGCGGCCAGGTGGC	0.542																																																0			16											177.0	163.0	167.0					16																	20970575		2201	4300	6501	20878076	SO:0001819	synonymous_variant	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10752C>T	16.37:g.20970575G>A		Unknown		x	x	x	20878076	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	39	Broad																																																																																				0.542	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Silent
TANGO6	79613	broad.mit.edu	37	16	69074314	69074314	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr16:69074314A>T	ENST00000261778.1	+	17	3110	c.3098A>T	c.(3097-3099)aAa>aTa	p.K1033I	TANGO6_ENST00000561931.1_3'UTR	NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	1033						integral component of membrane (GO:0016021)											CTCAGCCAGAAAGCTACTGAG	0.488																																																0			16											108.0	102.0	104.0					16																	69074314		2005	4180	6185	67631815	SO:0001583	missense	79613				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.3098A>T	16.37:g.69074314A>T	ENSP00000261778:p.Lys1033Ile	Unknown		x	x	x	67631815	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	37	CCDS45516.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	23.1	4.368929	0.82463	.	.	ENSG00000103047	ENST00000261778	T	0.64991	-0.13	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.046113	0.85682	D	0.000000	T	0.73560	0.3602	L	0.60455	1.87	0.53005	D	0.999964	D	0.89917	1.0	D	0.71870	0.975	T	0.72643	-0.4231	10	0.37606	T	0.19	-19.2922	12.5563	0.56254	1.0:0.0:0.0:0.0	.	1033	Q9C0B7	TMCO7_HUMAN	I	1033	ENSP00000261778:K1033I	ENSP00000261778:K1033I	K	+	2	0	TMCO7	67631815	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.320000	0.51991	2.219000	0.72066	0.523000	0.50628	AAA		0.488	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2		Missense_Mutation
HYDIN	54768	broad.mit.edu	37	16	71004648	71004648	+	Silent	SNP	T	T	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr16:71004648T>C	ENST00000393567.2	-	36	5544	c.5394A>G	c.(5392-5394)caA>caG	p.Q1798Q		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1798					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.Q1749Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACACCAGGGTTTGGCTGTAGA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	16											24.0	24.0	24.0					16																	71004648		1798	4059	5857	69562149	SO:0001819	synonymous_variant	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.5394A>G	16.37:g.71004648T>C		Unknown		x	x	x	69562149	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1	SNP	64	Broad																																																																																				0.438	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			Silent
CNTNAP4	85445	broad.mit.edu	37	16	76486529	76486529	+	Missense_Mutation	SNP	G	G	A	rs570306162		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr16:76486529G>A	ENST00000476707.1	+	7	1344	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.R326Q|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.R350Q|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.R398Q|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	399	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.R374Q(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTTCAATTTCGAACTTGGAAT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		16483	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	16											99.0	98.0	99.0					16																	76486529		2198	4300	6498	75044030	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1205G>A	16.37:g.76486529G>A	ENSP00000417628:p.Arg402Gln	Unknown		x	x	x	75044030	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.397475	0.96009	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34435	N	0.003965	D	0.91788	0.7402	.	.	.	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.998;1.0;0.996	D;D;D;D	0.78314	0.988;0.949;0.991;0.957	D	0.92081	0.5672	9	0.87932	D	0	.	19.6434	0.95767	0.0:0.0:1.0:0.0	.	326;402;374;399	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	Q	398;350;326;402	ENSP00000306893:R398Q;ENSP00000439733:R350Q;ENSP00000418741:R326Q;ENSP00000417628:R402Q	ENSP00000306893:R398Q	R	+	2	0	CNTNAP4	75044030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.240000	0.95396	2.880000	0.98712	0.655000	0.94253	CGA		0.463	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		Missense_Mutation
PKD1L2	114780	broad.mit.edu	37	16	81219172	81219172	+	RNA	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr16:81219172C>G	ENST00000525539.1	-	0	1921				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.R641T(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CTCTTGGCCTCTCAGAACAGC	0.647																																																2	Substitution - Missense(2)	ovary(2)	16											36.0	45.0	42.0					16																	81219172		2067	4214	6281	79776673			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81219172C>G		Unknown		x	x	x	79776673	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37		SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.218|9.218	1.032673|1.032673	0.19590|0.19590	.|.	.|.	ENSG00000166473|ENSG00000166473	ENST00000526632|ENST00000337114	.|T	.|0.69926	.|-0.44	4.38|4.38	2.4|2.4	0.29515|0.29515	.|Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	.|0.367589	.|0.29266	.|N	.|0.012643	T|T	0.53222|0.53222	0.1783|0.1783	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|P;P	.|0.47253	.|0.892;0.574	.|B;B	.|0.39805	.|0.31;0.277	T|T	0.48210|0.48210	-0.9055|-0.9055	4|9	.|0.52906	.|T	.|0.07	-6.8753|-6.8753	7.5751|7.5751	0.27931|0.27931	0.0:0.7222:0.0:0.2778|0.0:0.7222:0.0:0.2778	.|.	.|641;641	.|Q7Z442-3;Q7Z442	.|.;PK1L2_HUMAN	D|T	168|641	.|ENSP00000337397:R641T	.|ENSP00000337397:R641T	E|R	-|-	3|2	2|0	PKD1L2|PKD1L2	79776673|79776673	0.000000|0.000000	0.05858|0.05858	0.072000|0.072000	0.20136|0.20136	0.290000|0.290000	0.27261|0.27261	-0.073000|-0.073000	0.11468|0.11468	0.411000|0.411000	0.25702|0.25702	0.551000|0.551000	0.68910|0.68910	GAG|AGA		0.647	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			Missense_Mutation
CPNE7	27132	broad.mit.edu	37	16	89651212	89651213	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr16:89651212_89651213GA>TC	ENST00000268720.5	+	7	893_894	c.763_764GA>TC	c.(763-765)GAg>TCg	p.E255S	CPNE7_ENST00000319518.8_Missense_Mutation_p.E180S	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	255	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)	p.E255S(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		CCCCTTCCTGGAGCTCTACAGG	0.639																																																1	Substitution - Missense(1)	ovary(1)	16																																								88178714	SO:0001583	missense	27132			AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	Exception_encountered	16.37:g.89651212_89651213delinsTC	ENSP00000268720:p.Glu255Ser	Unknown		x	x	x	88178713		Missense_Mutation	DNP	ENST00000268720.5	37	CCDS10980.1	DNP	41	Broad																																																																																				0.639	CPNE7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269929.2			Missense_Mutation
SCARF1	8578	broad.mit.edu	37	17	1548514	1548514	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:1548514A>T	ENST00000263071.4	-	2	170	c.121T>A	c.(121-123)Tgc>Agc	p.C41S	SCARF1_ENST00000574545.1_5'Flank|SCARF1_ENST00000571272.1_Missense_Mutation_p.C41S|SCARF1_ENST00000348987.3_Missense_Mutation_p.C41S	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	41					cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.C41S(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTGCGCAGCACTGCAGCTCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	17											52.0	43.0	46.0					17																	1548514		2202	4299	6501	1495264	SO:0001583	missense	8578			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.121T>A	17.37:g.1548514A>T	ENSP00000263071:p.Cys41Ser	Unknown		x	x	x	1495264	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	37	CCDS11007.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	31	5.065699	0.93898	.	.	ENSG00000074660	ENST00000263071;ENST00000348987;ENST00000434376	T;T;T	0.70164	-0.46;1.09;1.01	5.02	5.02	0.67125	.	0.000000	0.43747	D	0.000531	D	0.85155	0.5632	M	0.92923	3.36	0.51233	D	0.999911	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.998;1.0	D	0.88757	0.3254	10	0.87932	D	0	-12.7313	13.5699	0.61841	1.0:0.0:0.0:0.0	.	41;41;41	Q14162-2;Q14162;Q14162-3	.;SREC_HUMAN;.	S	41	ENSP00000263071:C41S;ENSP00000323964:C41S;ENSP00000411167:C41S	ENSP00000263071:C41S	C	-	1	0	SCARF1	1495264	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.153000	0.71819	1.887000	0.54652	0.454000	0.30748	TGC		0.622	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578204	7578204	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:7578204A>C	ENST00000269305.4	-	6	834	c.645T>G	c.(643-645)agT>agG	p.S215R	TP53_ENST00000455263.2_Missense_Mutation_p.S215R|TP53_ENST00000420246.2_Missense_Mutation_p.S215R|TP53_ENST00000359597.4_Missense_Mutation_p.S215R|TP53_ENST00000413465.2_Missense_Mutation_p.S215R|TP53_ENST00000445888.2_Missense_Mutation_p.S215R|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S215R(17)|p.0?(8)|p.?(5)|p.S215S(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)|p.V216fs*6(1)|p.T211_S215delTFRHS(1)|p.S83R(1)|p.D208fs*1(1)|p.S215fs*32(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)|p.S122R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACCACCACACTATGTCGAA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Missense(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(3)|Substitution - coding silent(2)|Insertion - In frame(1)|Complex - frameshift(1)	haematopoietic_and_lymphoid_tissue(9)|biliary_tract(5)|large_intestine(5)|bone(5)|breast(5)|stomach(4)|oesophagus(4)|ovary(4)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(2)|skin(2)|lung(2)|liver(1)|prostate(1)	17	GRCh37	CD941799	TP53	D							124.0	111.0	116.0					17																	7578204		2203	4300	6503	7518929	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.645T>G	17.37:g.7578204A>C	ENSP00000269305:p.Ser215Arg	Unknown		x	x	x	7518929	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	20.2	3.954051	0.73902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	5.28	-4.05	0.03998	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	M	0.90705	3.14	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98563	1.0642	10	0.87932	D	0	-18.3023	12.3136	0.54942	0.7185:0.0:0.2815:0.0	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215R;ENSP00000352610:S215R;ENSP00000269305:S215R;ENSP00000398846:S215R;ENSP00000391127:S215R;ENSP00000391478:S215R;ENSP00000425104:S83R;ENSP00000423862:S122R	ENSP00000269305:S215R	S	-	3	2	TP53	7518929	0.000000	0.05858	0.557000	0.28306	0.964000	0.63967	-1.515000	0.02252	-0.649000	0.05430	-0.468000	0.05107	AGT		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CHD3	1107	broad.mit.edu	37	17	7794288	7794288	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:7794288C>A	ENST00000330494.7	+	4	565	c.415C>A	c.(415-417)Ctt>Att	p.L139I	CHD3_ENST00000358181.4_Missense_Mutation_p.L139I|CHD3_ENST00000380358.4_Missense_Mutation_p.L198I	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	139					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				AGCAACTCTGCTTCTGACCTG	0.572																																																0			17											149.0	134.0	139.0					17																	7794288		2203	4300	6503	7735013	SO:0001583	missense	1107			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.415C>A	17.37:g.7794288C>A	ENSP00000332628:p.Leu139Ile	Unknown		x	x	x	7735013	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	SNP	28	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.54|15.54	2.864562|2.864562	0.51482|0.51482	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000452447|ENST00000380358;ENST00000358181;ENST00000330494	.|D;D;D	.|0.90504	.|-2.68;-2.6;-2.61	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	.|0.000000	.|0.41294	.|D	.|0.000910	D|D	0.88016|0.88016	0.6324|0.6324	L|L	0.52011|0.52011	1.625|1.625	0.48185|0.48185	D|D	0.9996|0.9996	.|P;P;B	.|0.40476	.|0.718;0.596;0.435	.|B;B;B	.|0.38616	.|0.277;0.143;0.104	D|D	0.88389|0.88389	0.3007|0.3007	5|10	.|0.42905	.|T	.|0.14	-12.0161|-12.0161	16.2267|16.2267	0.82300|0.82300	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|139;139;198	.|Q12873-2;Q12873;E9PG89	.|.;CHD3_HUMAN;.	D|I	13|198;139;139	.|ENSP00000369716:L198I;ENSP00000350907:L139I;ENSP00000332628:L139I	.|ENSP00000332628:L139I	A|L	+|+	2|1	0|0	CHD3|CHD3	7735013|7735013	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.260000|7.260000	0.78391|0.78391	2.349000|2.349000	0.79799|0.79799	0.557000|0.557000	0.71058|0.71058	GCT|CTT		0.572	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273		Missense_Mutation
KIAA0100	9703	broad.mit.edu	37	17	26940298	26940298	+	IGR	SNP	T	T	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:26940298T>A	ENST00000528896.2	-	0	7407				SGK494_ENST00000301037.5_Missense_Mutation_p.K130N|SGK494_ENST00000469832.3_5'UTR|RP11-192H23.4_ENST00000534850.1_Missense_Mutation_p.K130N|SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000554154.1_RNA|RP11-192H23.4_ENST00000577790.1_Intron|SPAG5-AS1_ENST00000424210.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)		p.K169N(1)|p.K130N(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CAAATACAGCTTTCTGGGTGC	0.463											OREG0024279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				2	Substitution - Missense(2)	ovary(2)	17											92.0	85.0	87.0					17																	26940298		2203	4300	6503	23964425	SO:0001628	intergenic_variant	124923			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		17.37:g.26940298T>A		Unknown	790	x	x	x	23964425	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	4.640	0.118943	0.08881	.	.	ENSG00000258472;ENSG00000167524;ENSG00000167524;ENSG00000167524;ENSG00000167524;ENSG00000167524	ENST00000531839;ENST00000378976;ENST00000481916;ENST00000301037;ENST00000534850;ENST00000530121	T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21	4.98	-3.57	0.04612	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.449356	0.25332	N	0.031427	T	0.03053	0.0090	N	0.13327	0.33	0.20764	N	0.99985	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.004	T	0.30001	-0.9993	10	0.39692	T	0.17	0.0955	0.4335	0.00475	0.3731:0.2088:0.1261:0.292	.	130;130	E9PMD0;Q96LW2	.;SG494_HUMAN	N	130	ENSP00000431165:K130N;ENSP00000436369:K130N;ENSP00000301037:K130N;ENSP00000437573:K130N;ENSP00000434603:K130N	ENSP00000301037:K130N	K	-	3	2	AC005726.6;RP11-192H23.4	23964425	0.226000	0.23696	0.670000	0.29842	0.375000	0.29983	-0.080000	0.11339	-0.643000	0.05473	-0.378000	0.06908	AAA		0.463	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680		Missense_Mutation
EPN3	55040	broad.mit.edu	37	17	48618164	48618164	+	Silent	SNP	G	G	A	rs372785882		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:48618164G>A	ENST00000268933.3	+	7	1569	c.990G>A	c.(988-990)ccG>ccA	p.P330P	EPN3_ENST00000537145.1_Silent_p.P358P|RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Missense_Mutation_p.R218Q	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	330	5 X 3 AA repeats of [DE]-P-W.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)	p.P330P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GTTTTAGGCCGAACACAGAGG	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17531	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17						G		1,4405	2.1+/-5.4	0,1,2202	57.0	57.0	57.0		990	-9.4	0.1	17		57	5,8595	3.7+/-12.6	0,5,4295	no	coding-synonymous	EPN3	NM_017957.2		0,6,6497	AA,AG,GG		0.0581,0.0227,0.0461		330/633	48618164	6,13000	2203	4300	6503	45973163	SO:0001819	synonymous_variant	55040			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.990G>A	17.37:g.48618164G>A		Unknown		x	x	x	45973163	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	ENST00000268933.3	37	CCDS11570.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793303	0.31685	2.27E-4	5.81E-4	ENSG00000049283	ENST00000541226	T	0.42513	0.97	5.23	-9.35	0.00633	.	.	.	.	.	T	0.16471	0.0396	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.15723	-1.0427	6	0.17369	T	0.5	-4.0579	3.5155	0.07723	0.1656:0.3825:0.3562:0.0957	.	.	.	.	Q	218	ENSP00000440540:R218Q	ENSP00000440540:R218Q	R	+	2	0	EPN3	45973163	0.000000	0.05858	0.063000	0.19743	0.909000	0.53808	-1.911000	0.01583	-1.351000	0.02197	-0.377000	0.06932	CGA		0.617	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957		Silent
HEATR6	63897	broad.mit.edu	37	17	58149580	58149580	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:58149580C>A	ENST00000184956.6	-	5	711	c.695G>T	c.(694-696)tGc>tTc	p.C232F	HEATR6_ENST00000585976.1_Missense_Mutation_p.C232F	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	232							poly(A) RNA binding (GO:0044822)	p.C232F(1)		NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			ACTTACCATGCAAAATGTGAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	17											79.0	70.0	73.0					17																	58149580		2203	4300	6503	55504362	SO:0001583	missense	63897			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.695G>T	17.37:g.58149580C>A	ENSP00000184956:p.Cys232Phe	Unknown		x	x	x	55504362	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303291	0.81136	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.45276	0.9	5.19	5.19	0.71726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64735	0.2625	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	T	0.61063	-0.7138	10	0.37606	T	0.19	-12.5743	18.6504	0.91429	0.0:1.0:0.0:0.0	.	79;232	E7ESB9;Q6AI08	.;HEAT6_HUMAN	F	232;79	ENSP00000184956:C232F	ENSP00000184956:C232F	C	-	2	0	HEATR6	55504362	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.234000	0.72326	2.820000	0.97059	0.650000	0.86243	TGC		0.388	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070		Missense_Mutation
TANC2	26115	broad.mit.edu	37	17	61417678	61417678	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:61417678G>A	ENST00000424789.2	+	10	1574	c.1570G>A	c.(1570-1572)Gaa>Aaa	p.E524K	AC037445.1_ENST00000581421.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.E524K	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	524					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						GGAGCCACTAGAAAATCTCCA	0.498																																																0			17											58.0	55.0	56.0					17																	61417678		1857	4111	5968	58771410	SO:0001583	missense	26115			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.1570G>A	17.37:g.61417678G>A	ENSP00000387593:p.Glu524Lys	Unknown		x	x	x	58771410	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	37	CCDS45754.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	7.936	0.741809	0.15642	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.22539	1.95;1.95	5.13	5.13	0.70059	.	0.054132	0.64402	D	0.000001	T	0.16599	0.0399	N	0.25647	0.755	0.43714	D	0.996182	B;B	0.26318	0.01;0.146	B;B	0.28465	0.037;0.09	T	0.05321	-1.0892	10	0.08837	T	0.75	.	18.5684	0.91126	0.0:0.0:1.0:0.0	.	524;524	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	K	524	ENSP00000374171:E524K;ENSP00000387593:E524K	ENSP00000374171:E524K	E	+	1	0	TANC2	58771410	1.000000	0.71417	0.997000	0.53966	0.207000	0.24258	4.073000	0.57570	2.379000	0.81126	0.563000	0.77884	GAA		0.498	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1			Missense_Mutation
SAP30BP	29115	broad.mit.edu	37	17	73698616	73698616	+	Silent	SNP	C	C	T	rs558970179		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr17:73698616C>T	ENST00000584667.1	+	6	710	c.453C>T	c.(451-453)taC>taT	p.Y151Y	SAP30BP_ENST00000579864.1_3'UTR|SAP30BP_ENST00000355423.3_Silent_p.Y135Y	NM_013260.6	NP_037392.1			SAP30 binding protein									p.Y151Y(1)		kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)	17	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ATATGAACTACATTATCCAAA	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20861	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17											78.0	79.0	78.0					17																	73698616		2203	4300	6503	71210211	SO:0001819	synonymous_variant	29115			AY082382	CCDS11726.1	17q25.1	2006-01-05				ENSG00000161526			30785	protein-coding gene	gene with protein product		610218				15496587	Standard	NM_013260		Approved	HCNGP, HTRG, HTRP	uc002jpe.3	Q9UHR5		ENST00000584667.1:c.453C>T	17.37:g.73698616C>T		Unknown		x	x	x	71210211		Silent	SNP	ENST00000584667.1	37	CCDS11726.1	SNP	17	Broad																																																																																				0.438	SAP30BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448227.1	NM_013260		Silent
EPG5	57724	broad.mit.edu	37	18	43438530	43438530	+	Splice_Site	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr18:43438530C>A	ENST00000282041.5	-	41	7261		c.e41+1		EPG5_ENST00000585906.1_Splice_Site	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)						autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.?(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GGCCAACGTACCTTGGGTACA	0.423																																																1	Unknown(1)	ovary(1)	18											48.0	44.0	46.0					18																	43438530		1908	4131	6039	41692528	SO:0001630	splice_region_variant	57724			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7226+1G>T	18.37:g.43438530C>A		Unknown		x	x	x	41692528	A2BDF3|Q9H8C8	Splice_Site_SNP	SNP	ENST00000282041.5	37	CCDS11926.2	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868489	0.72065	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPG5	41692528	1.000000	0.71417	0.971000	0.41717	0.539000	0.34962	7.487000	0.81328	2.873000	0.98535	0.561000	0.74099	.		0.423	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	Intron	Splice_Site_SNP
C18orf54	162681	broad.mit.edu	37	18	51887077	51887077	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr18:51887077C>A	ENST00000300091.5	+	2	467	c.135C>A	c.(133-135)taC>taA	p.Y45*	STARD6_ENST00000584040.1_5'Flank|STARD6_ENST00000577499.1_5'Flank|C18orf54_ENST00000382911.4_Nonsense_Mutation_p.Y45*|C18orf54_ENST00000578138.1_Intron|STARD6_ENST00000581310.1_5'Flank	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	45						extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		ATAAGCTGTACAGATCTGCTT	0.413																																																0			18											132.0	125.0	127.0					18																	51887077		2203	4300	6503	50141075	SO:0001587	stop_gained	162681			AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.135C>A	18.37:g.51887077C>A	ENSP00000300091:p.Tyr45*	Unknown		x	x	x	50141075	I7HFJ6|Q6MZU3|Q6ZTL6	Nonsense_Mutation	SNP	ENST00000300091.5	37	CCDS11956.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.218753	0.95104	.	.	ENSG00000166845	ENST00000300091;ENST00000382911	.	.	.	5.63	2.78	0.32641	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.7147	8.0876	0.30782	0.0:0.6652:0.0:0.3348	.	.	.	.	X	45	.	ENSP00000300091:Y45X	Y	+	3	2	C18orf54	50141075	0.958000	0.32768	0.900000	0.35374	0.276000	0.26787	0.058000	0.14301	0.285000	0.22329	-0.345000	0.07892	TAC		0.413	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256001.1	NM_173529		Nonsense_Mutation
ZCCHC2	54877	broad.mit.edu	37	18	60212089	60212089	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr18:60212089C>G	ENST00000269499.5	+	4	1601	c.1183C>G	c.(1183-1185)Cag>Gag	p.Q395E	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.Q74E	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	395						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CCAAGAACTACAGGAATTTCT	0.308																																																0			18											37.0	35.0	36.0					18																	60212089		1781	4029	5810	58363069	SO:0001583	missense	54877			AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.1183C>G	18.37:g.60212089C>G	ENSP00000269499:p.Gln395Glu	Unknown		x	x	x	58363069	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616680	0.46736	.	.	ENSG00000141664	ENST00000269499	T	0.03689	3.84	6.11	6.11	0.99139	Phox homologous domain (2);	0.272984	0.30244	N	0.010062	T	0.10852	0.0265	L	0.38531	1.155	0.43308	D	0.995312	D	0.58268	0.982	D	0.67548	0.952	T	0.40194	-0.9576	10	0.18276	T	0.48	-13.045	17.651	0.88164	0.0:1.0:0.0:0.0	.	395	Q9C0B9	ZCHC2_HUMAN	E	395	ENSP00000269499:Q395E	ENSP00000269499:Q395E	Q	+	1	0	ZCCHC2	58363069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.569000	0.60865	2.906000	0.99361	0.655000	0.94253	CAG		0.308	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742		Missense_Mutation
TRIP10	9322	broad.mit.edu	37	19	6744700	6744700	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:6744700G>A	ENST00000313244.9	+	8	813	c.778G>A	c.(778-780)Gat>Aat	p.D260N	TRIP10_ENST00000600428.1_Missense_Mutation_p.D152N|TRIP10_ENST00000596758.1_Missense_Mutation_p.D260N|TRIP10_ENST00000313285.8_Missense_Mutation_p.D260N			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	260	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.D260N(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						AAATGCTGTGGATCCCAAGAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											127.0	115.0	119.0					19																	6744700		2203	4300	6503	6695700	SO:0001583	missense	9322			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.778G>A	19.37:g.6744700G>A	ENSP00000320117:p.Asp260Asn	Unknown		x	x	x	6695700	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	ENST00000313244.9	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972526	0.34848	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.52057	0.68;2.32	4.97	1.66	0.24008	.	0.216607	0.46758	N	0.000278	T	0.37625	0.1010	N	0.10874	0.06	0.35555	D	0.804224	B;D;B	0.58970	0.409;0.984;0.004	B;P;B	0.60473	0.173;0.875;0.003	T	0.38373	-0.9664	10	0.18710	T	0.47	-12.9655	7.4353	0.27152	0.2721:0.0:0.7279:0.0	.	260;260;260	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	N	260	ENSP00000320493:D260N;ENSP00000320117:D260N	ENSP00000320117:D260N	D	+	1	0	TRIP10	6695700	1.000000	0.71417	0.984000	0.44739	0.864000	0.49448	2.045000	0.41250	0.233000	0.21120	0.462000	0.41574	GAT		0.622	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2			Missense_Mutation
ZNF791	163049	broad.mit.edu	37	19	12738844	12738844	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:12738844A>C	ENST00000343325.4	+	4	663	c.501A>C	c.(499-501)aaA>aaC	p.K167N	ZNF490_ENST00000465656.1_Intron|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000446165.1_3'UTR|ZNF791_ENST00000540038.1_Missense_Mutation_p.K58N|ZNF791_ENST00000458122.3_Missense_Mutation_p.K135N	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K167N(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AATGTGGAAAAACCTTCATAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	60.0	60.0					19																	12738844		2203	4300	6503	12599844	SO:0001583	missense	163049			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.501A>C	19.37:g.12738844A>C	ENSP00000342974:p.Lys167Asn	Unknown		x	x	x	12599844	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	CCDS12273.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	15.70	2.911369	0.52439	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.07908	3.15;3.15;3.15	1.83	0.769	0.18492	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29716	0.0742	M	0.91406	3.205	0.30052	N	0.811646	D	0.89917	1.0	D	0.87578	0.998	T	0.12016	-1.0564	9	0.87932	D	0	.	4.7119	0.12877	0.8022:0.0:0.1978:0.0	.	167	Q3KP31	ZN791_HUMAN	N	167;149;135;58	ENSP00000342974:K167N;ENSP00000441761:K135N;ENSP00000441038:K58N	ENSP00000342974:K167N	K	+	3	2	ZNF791	12599844	0.278000	0.24230	0.928000	0.36995	0.987000	0.75469	0.598000	0.24074	0.834000	0.34852	0.402000	0.26972	AAA		0.383	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358		Missense_Mutation
ARMC6	93436	broad.mit.edu	37	19	19168264	19168264	+	Missense_Mutation	SNP	G	G	A	rs200403367		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:19168264G>A	ENST00000535612.1	+	9	1765	c.1333G>A	c.(1333-1335)Ggc>Agc	p.G445S	ARMC6_ENST00000546344.1_Missense_Mutation_p.G352S|ARMC6_ENST00000392336.3_Missense_Mutation_p.G445S|ARMC6_ENST00000392335.2_Missense_Mutation_p.G420S|ARMC6_ENST00000269932.6_Missense_Mutation_p.G420S	NM_001199196.1	NP_001186125.1	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	445					hematopoietic progenitor cell differentiation (GO:0002244)			p.G420S(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|prostate(1)	14			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			GGTGGCCCACGGCCAGGCCTT	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											71.0	67.0	68.0					19																	19168264		2203	4300	6503	19029264	SO:0001583	missense	93436			BX648486	CCDS32965.1, CCDS56089.1	19p13	2013-02-14				ENSG00000105676		"""Armadillo repeat containing"""	25049	protein-coding gene	gene with protein product						12477932	Standard	NM_033415		Approved	MGC19595	uc002nlc.3	Q6NXE6		ENST00000535612.1:c.1333G>A	19.37:g.19168264G>A	ENSP00000444156:p.Gly445Ser	Unknown		x	x	x	19029264	B4DI98|O94999|Q9BTH5	Missense_Mutation	SNP	ENST00000535612.1	37	CCDS56089.1	SNP	39	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	0.458|0.458|0.458	-0.890644|-0.890644|-0.890644	0.02491|0.02491|0.02491	.|.|.	.|.|.	ENSG00000105676|ENSG00000105676|ENSG00000105676	ENST00000379532|ENST00000392335;ENST00000535612;ENST00000269932;ENST00000546344;ENST00000392336|ENST00000535478;ENST00000540634	.|T;T;T;T;T|.	.|0.43688|.	.|0.94;0.94;0.94;0.94;0.94|.	3.95|3.95|3.95	2.93|2.93|2.93	0.34026|0.34026|0.34026	.|Armadillo-like helical (1);Armadillo-type fold (1);|.	.|0.250283|.	.|0.42053|.	.|N|.	.|0.000775|.	.|T|T	.|0.07234|0.07234	.|0.0183|0.0183	N|N|N	0.00258|0.00258|0.00258	-1.755|-1.755|-1.755	0.20638|0.20638|0.20638	N|N|N	0.999877|0.999877|0.999877	.|B|.	.|0.11235|.	.|0.004|.	.|B|.	.|0.01281|.	.|0.0|.	.|T|T	.|0.33675|0.33675	.|-0.9859|-0.9859	.|10|5	.|0.05833|.	.|T|.	.|0.94|.	.|-7.8641|-7.8641	8.6623|8.6623|8.6623	0.34099|0.34099|0.34099	0.9055:0.0:0.0945:0.0|0.9055:0.0:0.0945:0.0|0.9055:0.0:0.0945:0.0	.|.|.	.|445|.	.|Q6NXE6|.	.|ARMC6_HUMAN|.	.|S|Q	-1|420;445;420;352;445|88;24	.|ENSP00000376147:G420S;ENSP00000444156:G445S;ENSP00000269932:G420S;ENSP00000444341:G352S;ENSP00000376148:G445S|.	.|ENSP00000269932:G420S|.	.|G|R	+|+|+	.|1|2	.|0|0	ARMC6|ARMC6|ARMC6	19029264|19029264|19029264	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.959000|0.959000|0.959000	0.39883|0.39883|0.39883	0.271000|0.271000|0.271000	0.26615|0.26615|0.26615	4.725000|4.725000|4.725000	0.61979|0.61979|0.61979	0.673000|0.673000|0.673000	0.31224|0.31224|0.31224	-0.415000|-0.415000|-0.415000	0.06103|0.06103|0.06103	.|GGC|CGG		0.637	ARMC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403226.1	NM_033415		Missense_Mutation
KMT2B	9757	broad.mit.edu	37	19	36211245	36211245	+	Silent	SNP	T	T	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:36211245T>C	ENST00000222270.7	+	3	996	c.996T>C	c.(994-996)caT>caC	p.H332H	KMT2B_ENST00000420124.1_Silent_p.H332H|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_Silent_p.H332H	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	332					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H332H(1)									AAGGTCAACATGAGGAAAGTT	0.498																																																1	Substitution - coding silent(1)	ovary(1)	19											22.0	24.0	23.0					19																	36211245		1983	4146	6129	40903085	SO:0001819	synonymous_variant	9757			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.996T>C	19.37:g.36211245T>C		Unknown		x	x	x	40903085	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Silent	SNP	ENST00000222270.7	37	CCDS46055.1	SNP	51	Broad																																																																																				0.498	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727		Silent
LGALS13	29124	broad.mit.edu	37	19	40095962	40095962	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:40095962C>T	ENST00000221797.4	+	3	282	c.237C>T	c.(235-237)gaC>gaT	p.D79D		NM_013268.2	NP_037400.1	Q9UHV8	PP13_HUMAN	lectin, galactoside-binding, soluble, 13	79	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)	p.D79D(1)		lung(5)|ovary(1)|urinary_tract(1)	7	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			AGACAACAGACTACGTGCCCT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	19											234.0	173.0	194.0					19																	40095962		2203	4300	6503	44787802	SO:0001819	synonymous_variant	29124			AF117383	CCDS33024.1	19q13.2	2014-03-19	2008-07-25		ENSG00000105198	ENSG00000105198		"""Lectins, galactoside-binding"""	15449	protein-coding gene	gene with protein product	"""galectin 13"""	608717				6856484, 10527825	Standard	NM_013268		Approved	PP13, PLAC8	uc002omb.3	Q9UHV8	OTTHUMG00000183073	ENST00000221797.4:c.237C>T	19.37:g.40095962C>T		Unknown		x	x	x	44787802	C5HZ15	Silent	SNP	ENST00000221797.4	37	CCDS33024.1	SNP	20	Broad																																																																																				0.493	LGALS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464968.1	NM_013268		Silent
CYP2A13	1553	broad.mit.edu	37	19	41594390	41594390	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:41594390G>A	ENST00000330436.3	+	1	14	c.14G>A	c.(13-15)gGg>gAg	p.G5E		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	5					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G5E(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CTGGCCTCAGGGCTGCTTCTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											64.0	53.0	56.0					19																	41594390		2203	4300	6503	46286230	SO:0001583	missense	1553			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.14G>A	19.37:g.41594390G>A	ENSP00000332679:p.Gly5Glu	Unknown		x	x	x	46286230	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	.	14.17	2.455093	0.43634	.	.	ENSG00000197838	ENST00000330436	T	0.68479	-0.33	3.3	3.3	0.37823	.	0.285165	0.29438	U	0.012142	T	0.74496	0.3724	M	0.68952	2.095	0.29049	N	0.884647	D	0.69078	0.997	P	0.59115	0.852	T	0.69771	-0.5055	10	0.41790	T	0.15	.	12.5425	0.56179	0.0:0.0:1.0:0.0	.	5	Q16696	CP2AD_HUMAN	E	5	ENSP00000332679:G5E	ENSP00000332679:G5E	G	+	2	0	CYP2A13	46286230	0.989000	0.36119	0.988000	0.46212	0.964000	0.63967	2.218000	0.42889	1.860000	0.53959	0.430000	0.28490	GGG		0.562	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766		Missense_Mutation
CIC	23152	broad.mit.edu	37	19	42798212	42798212	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:42798212C>T	ENST00000575354.2	+	17	4206	c.4166C>T	c.(4165-4167)tCt>tTt	p.S1389F	CIC_ENST00000160740.3_Missense_Mutation_p.S1387F|CIC_ENST00000572681.2_Missense_Mutation_p.S2295F	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S1389F(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				ATCCTGGGCTCTTACCGCAAG	0.632			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	ovary(1)	19											66.0	72.0	70.0					19																	42798212		2203	4300	6503	47490052	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.4166C>T	19.37:g.42798212C>T	ENSP00000458663:p.Ser1389Phe	Unknown		x	x	x	47490052	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.07	3.540778	0.65085	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	T	0.64371	0.2592	L	0.27053	0.805	0.42567	D	0.993168	D	0.71674	0.998	D	0.80764	0.994	T	0.69124	-0.5228	8	0.87932	D	0	-22.0098	14.9921	0.71396	0.0:1.0:0.0:0.0	.	1389	Q96RK0	CIC_HUMAN	F	1389	.	ENSP00000160740:S1389F	S	+	2	0	CIC	47490052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.915000	0.56409	2.489000	0.83994	0.591000	0.81541	TCT		0.632	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			Missense_Mutation
VASP	7408	broad.mit.edu	37	19	46021267	46021267	+	Silent	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:46021267C>G	ENST00000245932.6	+	3	614	c.258C>G	c.(256-258)cgC>cgG	p.R86R	VASP_ENST00000586619.1_3'UTR	NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	86	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)	p.R86R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		GCGACGCTCGCCAGGTCTGGG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19											39.0	41.0	40.0					19																	46021267		2203	4300	6503	50713107	SO:0001819	synonymous_variant	7408				CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552		ENST00000245932.6:c.258C>G	19.37:g.46021267C>G		Unknown		x	x	x	50713107	B2RBT9|Q6PIZ1|Q93035	Silent	SNP	ENST00000245932.6	37	CCDS33051.1	SNP	26	Broad																																																																																				0.637	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459589.1			Silent
CABP5	56344	broad.mit.edu	37	19	48543905	48543905	+	Silent	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:48543905C>A	ENST00000293255.2	-	3	325	c.195G>T	c.(193-195)acG>acT	p.T65T		NM_019855.4	NP_062829.1	Q9NP86	CABP5_HUMAN	calcium binding protein 5	65	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		T -> R (in dbSNP:rs34862923).		signal transduction (GO:0007165)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	11		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		GTTCCATCTCCGTGGGCATGT	0.537																																																0			19											118.0	92.0	101.0					19																	48543905		2203	4300	6503	53235717	SO:0001819	synonymous_variant	56344			AF169159	CCDS12709.1	19q13.33	2014-08-12			ENSG00000105507	ENSG00000105507		"""EF-hand domain containing"""	13714	protein-coding gene	gene with protein product		607315	"""calcium binding protein 3"""	CABP3		10625670	Standard	NM_019855		Approved	CaBP3	uc002phu.2	Q9NP86	OTTHUMG00000183139	ENST00000293255.2:c.195G>T	19.37:g.48543905C>A		Unknown		x	x	x	53235717	A0AUY4	Silent	SNP	ENST00000293255.2	37	CCDS12709.1	SNP	23	Broad																																																																																				0.537	CABP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465212.1	NM_019855		Silent
KLK2	3817	broad.mit.edu	37	19	51381738	51381738	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:51381738C>T	ENST00000325321.3	+	5	934	c.709C>T	c.(709-711)Cct>Tct	p.P237S	KLK2_ENST00000391810.2_Missense_Mutation_p.P135S|KLK2_ENST00000358049.4_3'UTR			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	237	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.P237S(1)	KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		ATGTGCCCTGCCTGAAAAGCC	0.562			T	ETV4	prostate																																		Dom	yes		19	19q13.41	3817	kallikrein-related peptidase 2		E	1	Substitution - Missense(1)	ovary(1)	19											203.0	193.0	196.0					19																	51381738		2203	4300	6503	56073550	SO:0001583	missense	3817			M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.709C>T	19.37:g.51381738C>T	ENSP00000313581:p.Pro237Ser	Unknown		x	x	x	56073550	B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	CCDS12808.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204203	0.38905	.	.	ENSG00000167751	ENST00000325321;ENST00000391810	D;D	0.88896	-2.44;-2.44	3.54	0.966	0.19667	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.676716	0.12259	N	0.484887	D	0.88603	0.6481	L	0.41124	1.26	0.09310	N	1	D;D	0.69078	0.997;0.963	P;P	0.60541	0.876;0.701	T	0.77897	-0.2416	10	0.59425	D	0.04	.	6.3015	0.21115	0.1954:0.4213:0.3833:0.0	.	220;237	B4DU77;P20151	.;KLK2_HUMAN	S	237;135	ENSP00000313581:P237S;ENSP00000375686:P135S	ENSP00000313581:P237S	P	+	1	0	KLK2	56073550	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.385000	0.07379	0.544000	0.28883	0.563000	0.77884	CCT		0.562	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3		Missense_Mutation
ZNF628	89887	broad.mit.edu	37	19	55992829	55992829	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:55992829G>T	ENST00000598519.1	+	3	822	c.269G>T	c.(268-270)cGg>cTg	p.R90L	ZNF628_ENST00000391718.2_Missense_Mutation_p.R86L			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	90					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R86L(1)		endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		ACGGGCGAGCGGCCCTACCAG	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											40.0	40.0	40.0					19																	55992829		2203	4298	6501	60684641	SO:0001583	missense	89887			AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.269G>T	19.37:g.55992829G>T	ENSP00000469591:p.Arg90Leu	Unknown		x	x	x	60684641	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	.	16.89	3.247152	0.59103	.	.	ENSG00000197483	ENST00000391718	T	0.20200	2.09	3.56	3.56	0.40772	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.290279	0.22897	U	0.054309	T	0.39989	0.1099	M	0.70275	2.135	0.31630	N	0.649192	D	0.63880	0.993	P	0.59546	0.859	T	0.52034	-0.8629	10	0.87932	D	0	-23.6383	13.0316	0.58845	0.0:0.0:1.0:0.0	.	86	Q5EBL2	ZN628_HUMAN	L	86	ENSP00000375598:R86L	ENSP00000375598:R86L	R	+	2	0	ZNF628	60684641	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	1.668000	0.37481	2.001000	0.58596	0.491000	0.48974	CGG		0.672	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964		Missense_Mutation
PEG3	5178	broad.mit.edu	37	19	57326014	57326014	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:57326014C>A	ENST00000326441.9	-	10	4159	c.3796G>T	c.(3796-3798)Ggc>Tgc	p.G1266C	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.G1140C|PEG3_ENST00000423103.2_Missense_Mutation_p.G1266C|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.G1142C|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1266					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G1266C(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGGGCTAAGCCTGGAATGATA	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	52.0	55.0					19																	57326014		2203	4300	6503	62017826	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3796G>T	19.37:g.57326014C>A	ENSP00000326581:p.Gly1266Cys	Unknown		x	x	x	62017826	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.01	2.406964	0.42715	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02787	4.16;4.16	4.11	1.98	0.26296	.	0.133319	0.35067	N	0.003467	T	0.05731	0.0150	L	0.27053	0.805	.	.	.	D;D;D	0.89917	0.997;1.0;1.0	P;D;D	0.77557	0.808;0.987;0.99	T	0.26985	-1.0087	9	0.51188	T	0.08	-14.2392	5.9521	0.19253	0.0:0.6799:0.0:0.3201	.	1142;1266;1201	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	C	1266	ENSP00000326581:G1266C;ENSP00000403051:G1266C	ENSP00000326581:G1266C	G	-	1	0	ZIM2	62017826	0.000000	0.05858	0.019000	0.16419	0.995000	0.86356	-0.062000	0.11674	0.686000	0.31488	0.655000	0.94253	GGC		0.468	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			Missense_Mutation
DUXA	503835	broad.mit.edu	37	19	57670639	57670639	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:57670639A>C	ENST00000554048.2	-	3	187	c.188T>G	c.(187-189)tTt>tGt	p.F63C		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	63					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.F63C(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		TCGATTCTGAAACCAAATCTA	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	67.0	69.0					19																	57670639		2203	4300	6503	62362451	SO:0001583	missense	503835				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.188T>G	19.37:g.57670639A>C	ENSP00000452398:p.Phe63Cys	Unknown		x	x	x	62362451		Missense_Mutation	SNP	ENST00000554048.2	37	CCDS33126.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	13.41	2.229214	0.39399	.	.	ENSG00000258873	ENST00000554048	D	0.99748	-6.62	2.54	2.54	0.30619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.34268	N	0.004102	D	0.99736	0.9896	H	0.97315	3.98	0.34594	D	0.715779	D	0.76494	0.999	D	0.70487	0.969	D	0.97311	0.9937	10	0.87932	D	0	-14.1296	7.0071	0.24842	1.0:0.0:0.0:0.0	.	63	A6NLW8	DUXA_HUMAN	C	63	ENSP00000452398:F63C	ENSP00000365415:F63C	F	-	2	0	DUXA	62362451	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	2.087000	0.41653	1.424000	0.47217	0.459000	0.35465	TTT		0.438	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410075.3	NM_001012729		Missense_Mutation
ZNF551	90233	broad.mit.edu	37	19	58199588	58199588	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr19:58199588G>T	ENST00000282296.5	+	3	2130	c.1945G>T	c.(1945-1947)Ggg>Tgg	p.G649W	AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.G633W			Q7Z340	ZN551_HUMAN	zinc finger protein 551	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G633W(1)		endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CAGTGAATGTGGGAAATCCTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	19											97.0	96.0	97.0					19																	58199588		2203	4300	6503	62891400	SO:0001583	missense	90233			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1945G>T	19.37:g.58199588G>T	ENSP00000282296:p.Gly649Trp	Unknown		x	x	x	62891400	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	37	CCDS12959.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562743	0.65538	.	.	ENSG00000204519	ENST00000356715;ENST00000282296	.	.	.	2.79	0.564	0.17302	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75199	0.3817	M	0.94101	3.495	0.25453	N	0.987988	D	0.89917	1.0	D	0.97110	1.0	T	0.62412	-0.6860	8	0.72032	D	0.01	.	7.4611	0.27296	0.2324:0.0:0.7676:0.0	.	649	Q7Z340	ZN551_HUMAN	W	649;633	.	ENSP00000282296:G633W	G	+	1	0	ZNF551	62891400	0.772000	0.28567	0.000000	0.03702	0.944000	0.59088	1.368000	0.34216	0.082000	0.17018	-0.258000	0.10820	GGG		0.428	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347		Missense_Mutation
FSHR	2492	broad.mit.edu	37	2	49190293	49190293	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:49190293A>T	ENST00000406846.2	-	10	1786	c.1667T>A	c.(1666-1668)gTg>gAg	p.V556E	FSHR_ENST00000541117.1_Missense_Mutation_p.V292E|FSHR_ENST00000346173.3_Missense_Mutation_p.V494E|FSHR_ENST00000304421.4_Missense_Mutation_p.V530E	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	556					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.V556E(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GGGGTTCCGCACTGTGAGGTA	0.532									Gonadal Dysgenesis, 46 XX																																							1	Substitution - Missense(1)	ovary(1)	2											119.0	97.0	105.0					2																	49190293		2203	4300	6503	49043797	SO:0001583	missense	2492	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1667T>A	2.37:g.49190293A>T	ENSP00000384708:p.Val556Glu	Unknown		x	x	x	49043797	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	20.7	4.026121	0.75390	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.284833	0.32935	N	0.005480	T	0.73760	0.3628	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.81831	-0.0752	9	.	.	.	.	14.958	0.71131	1.0:0.0:0.0:0.0	.	530;494;556	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	E	556;494;530;292	ENSP00000384708:V556E;ENSP00000333908:V494E;ENSP00000306780:V530E;ENSP00000444172:V292E	.	V	-	2	0	FSHR	49043797	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.087000	0.94110	2.371000	0.80710	0.533000	0.62120	GTG		0.532	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			Missense_Mutation
CNTNAP5	129684	broad.mit.edu	37	2	125530384	125530384	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:125530384G>A	ENST00000431078.1	+	17	2903	c.2539G>A	c.(2539-2541)Gag>Aag	p.E847K		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	847	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGCTCCTTCAGAGATCACCTT	0.483																																																0			2											147.0	135.0	139.0					2																	125530384		1932	4128	6060	125246854	SO:0001583	missense	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2539G>A	2.37:g.125530384G>A	ENSP00000399013:p.Glu847Lys	Unknown		x	x	x	125246854	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	19.82	3.899092	0.72754	.	.	ENSG00000155052	ENST00000431078	T	0.39997	1.05	5.49	5.49	0.81192	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.47852	D	0.000215	T	0.51058	0.1652	L	0.47078	1.49	0.40026	D	0.975475	D	0.62365	0.991	P	0.62435	0.902	T	0.37244	-0.9714	10	0.13108	T	0.6	.	14.0425	0.64684	0.0:0.1509:0.8491:0.0	.	847	Q8WYK1	CNTP5_HUMAN	K	847	ENSP00000399013:E847K	ENSP00000399013:E847K	E	+	1	0	CNTNAP5	125246854	1.000000	0.71417	0.955000	0.39395	0.764000	0.43329	3.835000	0.55805	2.594000	0.87642	0.645000	0.84053	GAG		0.483	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			Missense_Mutation
RIF1	55183	broad.mit.edu	37	2	152314397	152314397	+	Silent	SNP	A	A	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:152314397A>G	ENST00000243326.5	+	23	3258	c.2775A>G	c.(2773-2775)aaA>aaG	p.K925K	RIF1_ENST00000444746.2_Silent_p.K925K|RIF1_ENST00000428287.2_Silent_p.K925K|RIF1_ENST00000453091.2_Silent_p.K925K|RIF1_ENST00000430328.2_Silent_p.K925K			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.K925K(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		ACAAGAATAAACAGATTCGAA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	2											92.0	91.0	92.0					2																	152314397		2203	4300	6503	152022643	SO:0001819	synonymous_variant	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.2775A>G	2.37:g.152314397A>G		Unknown		x	x	x	152022643	A0AVS0|Q9NS16	Silent	SNP	ENST00000243326.5	37	CCDS2194.1	SNP	2	Broad																																																																																				0.368	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			Silent
TTN	7273	broad.mit.edu	37	2	179444569	179444569	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:179444569G>A	ENST00000591111.1	-	269	62656	c.62432C>T	c.(62431-62433)cCt>cTt	p.P20811L	TTN_ENST00000589042.1_Missense_Mutation_p.P22452L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P13579L|TTN_ENST00000342992.6_Missense_Mutation_p.P19884L|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P13512L|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P13387L|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20811	Fibronectin type-III 50. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACTGGTCCAGGAGTTTCTAA	0.423																																																0			2											114.0	106.0	109.0					2																	179444569		1867	4102	5969	179152815	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62432C>T	2.37:g.179444569G>A	ENSP00000465570:p.Pro20811Leu	Unknown		x	x	x	179152815	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371898	0.42003	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.1	5.1	0.69264	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87152	0.6106	H	0.97415	4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.997	D	0.91807	0.5456	9	0.87932	D	0	.	18.8515	0.92232	0.0:0.0:1.0:0.0	.	13387;13512;13579;20811	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	19884;13387;13579;13512;13385	ENSP00000343764:P19884L;ENSP00000434586:P13387L;ENSP00000340554:P13579L;ENSP00000352154:P13512L	ENSP00000340554:P13579L	P	-	2	0	TTN	179152815	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.751000	0.98889	2.525000	0.85131	0.313000	0.20887	CCT		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
MYO1B	4430	broad.mit.edu	37	2	192194709	192194709	+	Silent	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:192194709G>A	ENST00000392318.3	+	4	547	c.300G>A	c.(298-300)aaG>aaA	p.K100K	MYO1B_ENST00000339514.4_Silent_p.K100K|MYO1B_ENST00000392316.1_Silent_p.K100K|MYO1B_ENST00000304164.4_Silent_p.K100K	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	100	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ATCAAGATAAGGACCAATGTA	0.423																																																0			2											202.0	198.0	199.0					2																	192194709		2203	4300	6503	191902954	SO:0001819	synonymous_variant	4430			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.300G>A	2.37:g.192194709G>A		Unknown		x	x	x	191902954	O43794|Q7Z6L5	Silent	SNP	ENST00000392318.3	37	CCDS46477.1	SNP	35	Broad																																																																																				0.423	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223		Silent
PLEKHM3	389072	broad.mit.edu	37	2	208842237	208842237	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:208842237C>T	ENST00000427836.2	-	3	1173	c.684G>A	c.(682-684)tgG>tgA	p.W228*	PLEKHM3_ENST00000389247.4_Nonsense_Mutation_p.W228*|PLEKHM3_ENST00000457206.1_Nonsense_Mutation_p.W228*	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	228	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)	p.W228*(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AACAGCTTTGCCAGTAACTGT	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	2											241.0	229.0	233.0					2																	208842237		1923	4120	6043	208550482	SO:0001587	stop_gained	389072			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.684G>A	2.37:g.208842237C>T	ENSP00000417003:p.Trp228*	Unknown		x	x	x	208550482	B9EKV2|Q8WW68	Nonsense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	43	10.246887	0.99368	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.4116	0.99017	0.0:1.0:0.0:0.0	.	.	.	.	X	228	.	ENSP00000373899:W228X	W	-	3	0	PLEKHM3	208550482	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.294000	0.78760	2.827000	0.97445	0.655000	0.94253	TGG		0.418	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475		Nonsense_Mutation
DGKD	8527	broad.mit.edu	37	2	234377201	234377201	+	Splice_Site	SNP	T	T	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr2:234377201T>G	ENST00000264057.2	+	29	3567		c.e29+2		DGKD_ENST00000409813.3_Splice_Site	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa						blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GACCTCAAGGTACTTCCATAG	0.597																																																0			2											73.0	68.0	70.0					2																	234377201		2203	4300	6503	234041940	SO:0001630	splice_region_variant	8527			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.3555+2T>G	2.37:g.234377201T>G		Unknown		x	x	x	234041940	Q14158|Q6PK55|Q8NG53	Splice_Site_SNP	SNP	ENST00000264057.2	37	CCDS2504.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	25.0	4.596100	0.86953	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0485	0.71846	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DGKD	234041940	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.697000	0.84279	2.198000	0.70561	0.533000	0.62120	.		0.597	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	Intron	Splice_Site_SNP
RRBP1	6238	broad.mit.edu	37	20	17622516	17622516	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr20:17622516C>T	ENST00000377813.1	-	5	2413	c.2110G>A	c.(2110-2112)Gag>Aag	p.E704K	RRBP1_ENST00000246043.4_Missense_Mutation_p.E704K|RRBP1_ENST00000455029.2_Missense_Mutation_p.E45K|RRBP1_ENST00000377807.2_Missense_Mutation_p.E271K|RRBP1_ENST00000360807.4_Missense_Mutation_p.E271K			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	704					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TTTTCCTTCTCTTCCAGCTGG	0.542																																																0			20											148.0	134.0	139.0					20																	17622516		2203	4300	6503	17570516	SO:0001583	missense	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2110G>A	20.37:g.17622516C>T	ENSP00000367044:p.Glu704Lys	Unknown		x	x	x	17570516	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.757104	0.96898	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17	6.08	6.08	0.98989	.	0.000000	0.37906	N	0.001882	T	0.52709	0.1751	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46638	-0.9177	10	0.42905	T	0.14	-41.0811	19.6516	0.95815	0.0:1.0:0.0:0.0	.	271	Q9P2E9-3	.	K	271;704;271;704;45	ENSP00000354045:E271K;ENSP00000367044:E704K;ENSP00000367038:E271K;ENSP00000246043:E704K;ENSP00000401206:E45K	ENSP00000246043:E704K	E	-	1	0	RRBP1	17570516	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.344000	0.79328	2.894000	0.99253	0.655000	0.94253	GAG		0.542	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576		Missense_Mutation
CYYR1	116159	broad.mit.edu	37	21	27840846	27840847	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr21:27840846_27840847GA>TT	ENST00000299340.4	-	4	781_782	c.438_439TC>AA	c.(436-441)ccTCct>ccAAct	p.P147T	AP001596.6_ENST00000421771.1_RNA|AP001596.6_ENST00000444306.1_RNA|AP001596.6_ENST00000429340.1_RNA|CYYR1_ENST00000435845.2_3'UTR|AP001597.1_ENST00000357401.3_RNA|AP001597.1_ENST00000414486.1_RNA	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	147	Poly-Pro.					integral component of membrane (GO:0016021)		p.P147T(1)		large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						CCAGGATAAGGAGGGGGTGGAG	0.535																																																1	Substitution - Missense(1)	ovary(1)	21																																								26762718	SO:0001583	missense	116159			AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.438_439delinsTT	21.37:g.27840846_27840847delinsTT	ENSP00000299340:p.Pro147Thr	Unknown		x	x	x	26762717	A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Missense_Mutation	DNP	ENST00000299340.4	37	CCDS13578.1	DNP	41	Broad																																																																																				0.535	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954		Missense_Mutation
MX1	4599	broad.mit.edu	37	21	42830551	42830551	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr21:42830551C>A	ENST00000398600.2	+	19	2880	c.1855C>A	c.(1855-1857)Ctc>Atc	p.L619I	MX1_ENST00000288383.6_Missense_Mutation_p.L596I|MX1_ENST00000455164.2_Missense_Mutation_p.L619I|MX1_ENST00000398598.3_Missense_Mutation_p.L619I	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	619	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.|Stalk.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L619I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				CATGCTGCAGCTCCTGCAGGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	21											128.0	122.0	124.0					21																	42830551		2203	4300	6503	41752421	SO:0001583	missense	4599				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1855C>A	21.37:g.42830551C>A	ENSP00000381601:p.Leu619Ile	Unknown		x	x	x	41752421	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	ENST00000398600.2	37	CCDS13673.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922765	0.73213	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	4.7	4.7	0.59300	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.074107	0.64402	D	0.000020	T	0.59783	0.2219	M	0.69823	2.125	0.45502	D	0.99846	P	0.41848	0.763	P	0.46850	0.529	T	0.62590	-0.6822	10	0.48119	T	0.1	-29.2525	13.8894	0.63729	0.0:1.0:0.0:0.0	.	619	P20591	MX1_HUMAN	I	619;619;619;596	ENSP00000381601:L619I;ENSP00000381599:L619I;ENSP00000410523:L619I;ENSP00000288383:L596I	ENSP00000288383:L596I	L	+	1	0	MX1	41752421	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.846000	0.39289	2.547000	0.85894	0.655000	0.94253	CTC		0.602	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195161.2			Missense_Mutation
C2CD2	25966	broad.mit.edu	37	21	43327769	43327769	+	Splice_Site	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr21:43327769C>T	ENST00000380486.3	-	9	1384	c.1143G>A	c.(1141-1143)gaG>gaA	p.E381E	C2CD2_ENST00000329623.7_Splice_Site_p.E226E	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	381						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.E381E(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						CTCGCCCTACCTCTGCCGTGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	21											20.0	23.0	22.0					21																	43327769		2202	4299	6501	42200838	SO:0001630	splice_region_variant	25966			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.1143+1G>A	21.37:g.43327769C>T		Unknown		x	x	x	42200838	Q5R2V7|Q6AHX8|Q9NSE6	Silent	SNP	ENST00000380486.3	37	CCDS42933.1	SNP	24	Broad																																																																																				0.627	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195228.2	NM_015500	Silent	Silent
CCT8L2	150160	broad.mit.edu	37	22	17072357	17072357	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr22:17072357C>G	ENST00000359963.3	-	1	1343	c.1084G>C	c.(1084-1086)Gta>Cta	p.V362L		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	362					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.V362L(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CATTCAAATACCACAGCCAAA	0.617																																																1	Substitution - Missense(1)	ovary(1)	22											81.0	77.0	78.0					22																	17072357		2203	4300	6503	15452357	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1084G>C	22.37:g.17072357C>G	ENSP00000353048:p.Val362Leu	Unknown		x	x	x	15452357	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	c	6.897	0.535056	0.13188	.	.	ENSG00000198445	ENST00000359963	T	0.77229	-1.08	1.98	1.98	0.26296	.	0.203966	0.24107	U	0.041488	T	0.71316	0.3325	M	0.77103	2.36	0.22835	N	0.998675	B	0.29232	0.238	B	0.29353	0.101	T	0.55029	-0.8204	10	0.13108	T	0.6	-15.8215	7.4423	0.27190	0.0:1.0:0.0:0.0	.	362	Q96SF2	TCPQM_HUMAN	L	362	ENSP00000353048:V362L	ENSP00000353048:V362L	V	-	1	0	CCT8L2	15452357	0.002000	0.14202	0.062000	0.19696	0.064000	0.16182	0.943000	0.29030	1.115000	0.41800	0.379000	0.24179	GTA		0.617	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			Missense_Mutation
SPECC1L	23384	broad.mit.edu	37	22	24718635	24718635	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr22:24718635G>C	ENST00000314328.9	+	5	1972	c.1687G>C	c.(1687-1689)Gag>Cag	p.E563Q	SPECC1L_ENST00000541492.1_Missense_Mutation_p.E563Q|SPECC1L_ENST00000437398.1_Missense_Mutation_p.E563Q|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.E563Q|SPECC1L_ENST00000416735.1_Intron	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	563					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)		p.E563Q(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						AGCCACGTTAGAGGAATACAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	22											58.0	57.0	57.0					22																	24718635		2203	4300	6503	23048635	SO:0001583	missense	23384			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1687G>C	22.37:g.24718635G>C	ENSP00000325785:p.Glu563Gln	Unknown		x	x	x	23048635	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873066	0.72180	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.62364	0.03;2.5;0.03;3.01	5.5	5.5	0.81552	.	0.208574	0.49305	D	0.000149	T	0.77157	0.4089	M	0.71036	2.16	0.58432	D	0.999998	D;B	0.63046	0.992;0.319	P;B	0.61397	0.888;0.127	T	0.78804	-0.2060	10	0.62326	D	0.03	-28.6628	18.3864	0.90468	0.0:0.0:1.0:0.0	.	563;563	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	Q	591;563;563;563;563	ENSP00000393363:E563Q;ENSP00000405671:E563Q;ENSP00000325785:E563Q;ENSP00000439633:E563Q	ENSP00000325785:E563Q	E	+	1	0	SPECC1L	23048635	1.000000	0.71417	0.949000	0.38748	0.789000	0.44602	6.357000	0.73051	2.597000	0.87782	0.655000	0.94253	GAG		0.473	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330		Missense_Mutation
DEPDC5	9681	broad.mit.edu	37	22	32253538	32253538	+	Splice_Site	SNP	A	A	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr22:32253538A>G	ENST00000382112.3	+	31	3306	c.3236A>G	c.(3235-3237)aAg>aGg	p.K1079R	DEPDC5_ENST00000539165.1_5'UTR|DEPDC5_ENST00000382105.2_Splice_Site_p.K1010R|DEPDC5_ENST00000494060.1_3'UTR|DEPDC5_ENST00000535622.1_Splice_Site_p.K1010R|DEPDC5_ENST00000400248.2_Splice_Site_p.K1079R|DEPDC5_ENST00000266091.3_Splice_Site_p.K1088R|DEPDC5_ENST00000400246.1_Splice_Site_p.K1088R|DEPDC5_ENST00000400249.2_Splice_Site_p.K1079R|DEPDC5_ENST00000382111.2_Splice_Site_p.K1088R	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1088					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.K1079R(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGCCCACGAAAGGTAAAGGAA	0.582																																																1	Substitution - Missense(1)	ovary(1)	22											26.0	28.0	27.0					22																	32253538		2093	4226	6319	30583538	SO:0001630	splice_region_variant	9681			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.3237+1A>G	22.37:g.32253538A>G		Unknown		x	x	x	30583538	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.253868	0.80135	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T	0.37411	1.42;1.85;1.85;1.71;1.2;1.74;1.71;1.85	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.47764	0.1463	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.998;0.999;0.998;0.999;0.998;0.998;0.997	D;D;D;D;D;D;D	0.85130	0.996;0.991;0.991;0.997;0.991;0.987;0.98	T	0.31861	-0.9928	10	0.23891	T	0.37	.	14.7499	0.69516	1.0:0.0:0.0:0.0	.	409;1088;1010;474;1088;1079;1079	B4DSS1;B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;.;DEPD5_HUMAN	R	1010;1088;1079;1010;1088;1010;1079;1088;1079	ENSP00000440210:K1010R;ENSP00000266091:K1088R;ENSP00000383108:K1079R;ENSP00000383105:K1088R;ENSP00000371539:K1010R;ENSP00000371546:K1079R;ENSP00000371545:K1088R;ENSP00000383107:K1079R	ENSP00000266091:K1088R	K	+	2	0	DEPDC5	30583538	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.231000	0.65327	2.161000	0.67846	0.460000	0.39030	AAG		0.582	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	Missense_Mutation	Missense_Mutation
EFCAB6	64800	broad.mit.edu	37	22	44068186	44068186	+	Splice_Site	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr22:44068186C>A	ENST00000262726.7	-	14	1673		c.e14-1		EFCAB6_ENST00000396231.2_Splice_Site	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.?(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TCTTTCTCATCTAATTGGGAA	0.443																																																1	Unknown(1)	ovary(1)	22											91.0	83.0	86.0					22																	44068186		2203	4300	6503	42399519	SO:0001630	splice_region_variant	64800			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.1420-1G>T	22.37:g.44068186C>A		Unknown		x	x	x	42399519	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Splice_Site_SNP	SNP	ENST00000262726.7	37	CCDS14049.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858020	0.32791	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	.	.	.	5.26	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.32969	D	0.522035	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7104	0.40243	0.0:0.9073:0.0:0.0927	.	.	.	.	.	-1	.	.	.	-	.	.	EFCAB6	42399519	0.571000	0.26659	0.028000	0.17463	0.483000	0.33249	2.173000	0.42472	1.452000	0.47756	-0.145000	0.13849	.		0.443	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	Intron	Splice_Site_SNP
SLC9C1	285335	broad.mit.edu	37	3	111888085	111888085	+	Missense_Mutation	SNP	C	C	T	rs374547341		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr3:111888085C>T	ENST00000305815.5	-	24	3262	c.3010G>A	c.(3010-3012)Gct>Act	p.A1004T	SLC9C1_ENST00000487372.1_Missense_Mutation_p.A956T	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	1004					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.A1004T(1)									GCTGTAATAGCGAGTCCAAGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	3						C	THR/ALA	0,4406		0,0,2203	107.0	103.0	105.0		3010	1.0	0.6	3		105	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC9A10	NM_183061.1	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1004/1178	111888085	1,13005	2203	4300	6503	113370775	SO:0001583	missense	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.3010G>A	3.37:g.111888085C>T	ENSP00000306627:p.Ala1004Thr	Unknown		x	x	x	113370775	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147062	0.57151	0.0	1.16E-4	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.77358	-1.09;-1.09	5.83	1.0	0.19881	Cyclic nucleotide-binding-like (1);Cyclic nucleotide-binding domain (1);	0.821439	0.10954	N	0.615730	T	0.63046	0.2478	L	0.34521	1.04	0.19575	N	0.999967	P;P	0.44659	0.588;0.84	B;B	0.36030	0.216;0.17	T	0.50964	-0.8765	10	0.45353	T	0.12	4.47	8.6616	0.34097	0.3433:0.5616:0.0:0.0951	.	956;1004	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	T	1004;956	ENSP00000306627:A1004T;ENSP00000420688:A956T	ENSP00000306627:A1004T	A	-	1	0	SLC9A10	113370775	0.876000	0.30132	0.630000	0.29268	0.834000	0.47266	0.078000	0.14761	0.244000	0.21351	0.603000	0.83216	GCT		0.348	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		Missense_Mutation
TNFSF10	8743	broad.mit.edu	37	3	172241138	172241139	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr3:172241138_172241139CC>TT	ENST00000241261.2	-	1	158_159	c.36_37GG>AA	c.(34-39)ctGGga>ctAAga	p.G13R	TNFSF10_ENST00000420541.2_Missense_Mutation_p.G13R	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	13					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)	p.G13R(1)		breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CAGGTCTGTCCCAGGCTGGGTC	0.559																																																1	Substitution - Missense(1)	ovary(1)	3																																								173723833	SO:0001583	missense	8743			U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.36_37delinsTT	3.37:g.172241138_172241139delinsTT	ENSP00000241261:p.Gly13Arg	Unknown		x	x	x	173723832	A1Y9B3	Missense_Mutation	DNP	ENST00000241261.2	37	CCDS3219.1	DNP	22	Broad																																																																																				0.559	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1			Missense_Mutation
FAM193A	8603	broad.mit.edu	37	4	2701701	2701701	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr4:2701701G>A	ENST00000324666.5	+	17	3280	c.2929G>A	c.(2929-2931)Gaa>Aaa	p.E977K	FAM193A_ENST00000502458.1_Missense_Mutation_p.E999K|FAM193A_ENST00000545951.1_Missense_Mutation_p.E977K|FAM193A_ENST00000505311.1_Missense_Mutation_p.E977K|FAM193A_ENST00000382839.3_Missense_Mutation_p.E977K	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	977										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						AGAGCAAACTGAAGAACCAGA	0.532																																																0			4											89.0	90.0	90.0					4																	2701701		2203	4300	6503	2671499	SO:0001583	missense	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2929G>A	4.37:g.2701701G>A	ENSP00000324587:p.Glu977Lys	Unknown		x	x	x	2671499	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	13.60	2.285929	0.40394	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.32753	1.45;1.85;1.44;1.44;1.44	5.16	3.4	0.38934	.	0.291078	0.37393	N	0.002101	T	0.29321	0.0730	L	0.60455	1.87	0.38442	D	0.94672	B;B;P;B;B	0.42692	0.01;0.01;0.787;0.01;0.01	B;B;B;B;B	0.42771	0.016;0.016;0.397;0.004;0.016	T	0.09818	-1.0657	10	0.18276	T	0.48	-10.0975	9.4253	0.38576	0.0778:0.1451:0.7771:0.0	.	977;999;977;999;977	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	K	977;977;977;999;831	ENSP00000372290:E977K;ENSP00000324587:E977K;ENSP00000443617:E977K;ENSP00000427505:E999K;ENSP00000427260:E831K	ENSP00000324587:E977K	E	+	1	0	FAM193A	2671499	1.000000	0.71417	0.135000	0.22099	0.793000	0.44817	3.649000	0.54417	0.736000	0.32559	0.650000	0.86243	GAA		0.532	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		Missense_Mutation
UGT2B4	7363	broad.mit.edu	37	4	70359437	70359437	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr4:70359437A>T	ENST00000305107.6	-	2	890	c.844T>A	c.(844-846)Tgc>Agc	p.C282S	UGT2B4_ENST00000512583.1_Missense_Mutation_p.C282S|UGT2B4_ENST00000381096.3_Missense_Mutation_p.C146S|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	282					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GCAGGTTTGCAGTGGAGTCCT	0.403																																																0			4											115.0	124.0	121.0					4																	70359437		2196	4299	6495	70394026	SO:0001583	missense	7363			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.844T>A	4.37:g.70359437A>T	ENSP00000305221:p.Cys282Ser	Unknown		x	x	x	70394026	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	CCDS43234.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	15.68	2.905280	0.52333	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000381096	T;T;T	0.62498	0.02;0.02;0.02	1.85	1.85	0.25348	.	0.000000	0.85682	U	0.000000	T	0.78886	0.4354	M	0.91406	3.205	0.33925	D	0.641339	D;D;D	0.76494	0.997;0.999;0.979	D;D;P	0.71414	0.973;0.969;0.864	D	0.83693	0.0178	10	0.87932	D	0	.	7.7205	0.28729	1.0:0.0:0.0:0.0	.	146;282;282	A6NCP7;G5E9X8;P06133	.;.;UD2B4_HUMAN	S	282;282;146	ENSP00000421290:C282S;ENSP00000305221:C282S;ENSP00000370486:C146S	ENSP00000305221:C282S	C	-	1	0	UGT2B4	70394026	1.000000	0.71417	0.992000	0.48379	0.614000	0.37383	8.060000	0.89464	1.105000	0.41606	0.254000	0.18369	TGC		0.403	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		Missense_Mutation
NAA15	80155	broad.mit.edu	37	4	140283064	140283064	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr4:140283064G>C	ENST00000296543.5	+	14	2049	c.1726G>C	c.(1726-1728)Gag>Cag	p.E576Q	NAA15_ENST00000398947.1_Missense_Mutation_p.E576Q	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	576	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CCTTACAGATGAGAATAAAGA	0.338																																																0			4											107.0	101.0	103.0					4																	140283064		1828	4077	5905	140502514	SO:0001583	missense	80155			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1726G>C	4.37:g.140283064G>C	ENSP00000296543:p.Glu576Gln	Unknown		x	x	x	140502514	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	ENST00000296543.5	37	CCDS43270.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167425	0.57476	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	T;T	0.46819	0.86;0.86	5.73	5.73	0.89815	.	0.052692	0.64402	D	0.000001	T	0.58221	0.2107	L	0.46885	1.475	0.80722	D	1	B	0.31256	0.316	P	0.47705	0.555	T	0.46317	-0.9200	10	0.22706	T	0.39	-15.2591	20.2699	0.98469	0.0:0.0:1.0:0.0	.	576	Q9BXJ9	NAA15_HUMAN	Q	576;450;576	ENSP00000296543:E576Q;ENSP00000381920:E576Q	ENSP00000296543:E576Q	E	+	1	0	NAA15	140502514	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.499000	0.81566	2.854000	0.98071	0.655000	0.94253	GAG		0.338	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175		Missense_Mutation
FAT1	2195	broad.mit.edu	37	4	187542865	187542865	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr4:187542865T>G	ENST00000441802.2	-	10	5084	c.4875A>C	c.(4873-4875)ttA>ttC	p.L1625F		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1625	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1625F(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TACTTCGATCTAATTCTTTGG	0.358										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											31.0	30.0	31.0					4																	187542865		1846	4083	5929	187779859	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4875A>C	4.37:g.187542865T>G	ENSP00000406229:p.Leu1625Phe	Unknown		x	x	x	187779859		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	15.68	2.904852	0.52333	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.74737	-0.87	5.09	-0.16	0.13375	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000002	T	0.81019	0.4736	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76809	-0.2822	10	0.62326	D	0.03	.	4.0418	0.09755	0.2204:0.2106:0.0:0.5691	.	1625	Q14517	FAT1_HUMAN	F	1625;1627	ENSP00000406229:L1625F	ENSP00000260147:L1627F	L	-	3	2	FAT1	187779859	0.874000	0.30092	1.000000	0.80357	0.993000	0.82548	-0.092000	0.11129	0.176000	0.19873	0.528000	0.53228	TTA		0.358	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
PRDM9	56979	broad.mit.edu	37	5	23522908	23522908	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:23522908G>A	ENST00000296682.3	+	8	978	c.796G>A	c.(796-798)Gat>Aat	p.D266N		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	266	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.D266N(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						TGAGGCATCTGATCTGCCGCT	0.582										HNSCC(3;0.000094)																																						1	Substitution - Missense(1)	ovary(1)	5											72.0	69.0	70.0					5																	23522908		2203	4300	6503	23558665	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.796G>A	5.37:g.23522908G>A	ENSP00000296682:p.Asp266Asn	Unknown		x	x	x	23558665	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071374	0.55646	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.48522	0.81	4.14	2.96	0.34315	SET domain (2);	0.427699	0.17254	N	0.181029	T	0.48502	0.1503	M	0.64997	1.995	0.09310	N	1	D	0.56968	0.978	P	0.50825	0.651	T	0.39683	-0.9602	10	0.48119	T	0.1	-5.4201	5.1565	0.15038	0.2081:0.0:0.7919:0.0	.	266	Q9NQV7	PRDM9_HUMAN	N	266;60	ENSP00000296682:D266N	ENSP00000253473:D60N	D	+	1	0	PRDM9	23558665	0.038000	0.19896	0.435000	0.26784	0.739000	0.42172	1.087000	0.30865	2.012000	0.59069	0.597000	0.82753	GAT		0.582	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		Missense_Mutation
RAPGEF6	51735	broad.mit.edu	37	5	130764612	130764612	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:130764612G>T	ENST00000509018.1	-	27	4968	c.4763C>A	c.(4762-4764)gCa>gAa	p.A1588E	RAPGEF6_ENST00000307984.5_Intron|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.A1638E|RAPGEF6_ENST00000507093.1_Intron|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.A1596E	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1588					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.A1588E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TTCGCTATCTGCATCAGTCAC	0.408																																					Melanoma(168;435 1955 13113 13877 23213)											1	Substitution - Missense(1)	ovary(1)	5											121.0	115.0	117.0					5																	130764612		2203	4300	6503	130792511	SO:0001583	missense	51735			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.4763C>A	5.37:g.130764612G>T	ENSP00000421684:p.Ala1588Glu	Unknown		x	x	x	130792511	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948111	0.34377	.	.	ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000296859;ENST00000514667	T;T;T	0.23348	1.91;1.91;2.0	4.92	4.04	0.47022	.	0.326234	0.29972	N	0.010730	T	0.26846	0.0657	L	0.54323	1.7	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.07443	-1.0772	10	0.59425	D	0.04	.	13.9149	0.63890	0.0:0.2905:0.7095:0.0	.	1596;1638;1588	B7ZML2;E9PCH4;Q8TEU7	.;.;RPGF6_HUMAN	E	1588;1596;1638	ENSP00000421684:A1588E;ENSP00000296859:A1596E;ENSP00000426948:A1638E	ENSP00000426948:A1638E	A	-	2	0	RAPGEF6;FNIP1	130792511	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	3.795000	0.55499	1.304000	0.44892	0.655000	0.94253	GCA		0.408	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340		Missense_Mutation
PCDHA4	56144	broad.mit.edu	37	5	140187172	140187172	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:140187172C>T	ENST00000530339.1	+	1	400	c.400C>T	c.(400-402)Cca>Tca	p.P134S	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.P134S|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.P134S	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	134	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P134S(1)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCGGTGTTCCCAGCAACACA	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											83.0	86.0	85.0					5																	140187172		2203	4300	6503	140167356	SO:0001583	missense	56144			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.400C>T	5.37:g.140187172C>T	ENSP00000435300:p.Pro134Ser	Unknown		x	x	x	140167356	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	c	9.850	1.193449	0.22037	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.36878	1.23;1.23;1.23	4.62	3.73	0.42828	Cadherin (2);Cadherin-like (1);	0.398058	0.18106	N	0.151531	T	0.29620	0.0739	L	0.37507	1.11	0.33885	D	0.636606	B;B;B	0.21381	0.035;0.055;0.055	B;B;B	0.26310	0.031;0.068;0.027	T	0.31668	-0.9935	10	0.16420	T	0.52	.	14.1281	0.65235	0.1518:0.8482:0.0:0.0	.	134;134;134	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	S	134	ENSP00000423470:P134S;ENSP00000349344:P134S;ENSP00000435300:P134S	ENSP00000349344:P134S	P	+	1	0	PCDHA4	140167356	0.001000	0.12720	0.169000	0.22859	0.323000	0.28346	0.738000	0.26158	1.034000	0.39945	0.563000	0.77884	CCA		0.582	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		Missense_Mutation
PCDHGB7	56099	broad.mit.edu	37	5	140798423	140798423	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:140798423G>A	ENST00000398594.2	+	1	997	c.997G>A	c.(997-999)Gta>Ata	p.V333I	PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	333	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V333I(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGTGTAAAGTAATTGTAGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											74.0	70.0	71.0					5																	140798423		1881	4107	5988	140778607	SO:0001583	missense	56099			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.997G>A	5.37:g.140798423G>A	ENSP00000381594:p.Val333Ile	Unknown		x	x	x	140778607	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	g	4.959	0.178126	0.09443	.	.	ENSG00000254122	ENST00000398594	T	0.59906	0.23	5.57	1.71	0.24356	Cadherin (4);Cadherin-like (1);	0.324022	0.16289	U	0.220988	T	0.47266	0.1436	L	0.33710	1.025	0.22610	N	0.998934	B;B	0.23377	0.082;0.084	B;B	0.37508	0.252;0.094	T	0.43845	-0.9366	10	0.30078	T	0.28	.	6.4145	0.21710	0.2886:0.1206:0.5907:0.0	.	333;333	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	I	333	ENSP00000381594:V333I	ENSP00000381594:V333I	V	+	1	0	PCDHGB7	140778607	0.749000	0.28305	1.000000	0.80357	0.325000	0.28411	0.272000	0.18644	0.286000	0.22352	0.462000	0.41574	GTA		0.403	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		Missense_Mutation
NHP2	55651	broad.mit.edu	37	5	177576776	177576776	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:177576776C>T	ENST00000274606.3	-	4	549	c.400G>A	c.(400-402)Gag>Aag	p.E134K	RMND5B_ENST00000515098.1_3'UTR|NHP2_ENST00000314397.4_3'UTR	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	134					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.E134K(1)		endometrium(1)|kidney(1)|ovary(2)	4						TCCTGGTACTCCTCATGGGGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	5											59.0	65.0	63.0					5																	177576776		2203	4300	6503	177509382	SO:0001583	missense	55651			AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.400G>A	5.37:g.177576776C>T	ENSP00000274606:p.Glu134Lys	Unknown		x	x	x	177509382	A6NKY8|Q9P095	Missense_Mutation	SNP	ENST00000274606.3	37	CCDS4432.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	24.1	4.489543	0.84962	.	.	ENSG00000145912	ENST00000274606	T	0.58210	0.35	5.55	5.55	0.83447	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.306471	0.39210	N	0.001440	T	0.39627	0.1085	N	0.17474	0.49	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.14144	-1.0483	10	0.38643	T	0.18	-26.2529	17.0061	0.86393	0.0:1.0:0.0:0.0	.	134	Q9NX24	NHP2_HUMAN	K	134	ENSP00000274606:E134K	ENSP00000274606:E134K	E	-	1	0	NHP2	177509382	1.000000	0.71417	0.993000	0.49108	0.958000	0.62258	7.666000	0.83877	2.597000	0.87782	0.655000	0.94253	GAG		0.607	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253471.1	NM_017838		Missense_Mutation
NHP2	55651	broad.mit.edu	37	5	177576839	177576839	+	Splice_Site	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:177576839C>T	ENST00000274606.3	-	4	486	c.337G>A	c.(337-339)Gac>Aac	p.D113N	RMND5B_ENST00000515098.1_3'UTR|NHP2_ENST00000314397.4_Splice_Site_p.G77G	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	113					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.D113N(1)		endometrium(1)|kidney(1)|ovary(2)	4						GCACCCAGGTCCTACAGAGGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	5											62.0	73.0	69.0					5																	177576839		2203	4300	6503	177509445	SO:0001630	splice_region_variant	55651			AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.337-1G>A	5.37:g.177576839C>T		Unknown		x	x	x	177509445	A6NKY8|Q9P095	Missense_Mutation	SNP	ENST00000274606.3	37	CCDS4432.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	22.0	4.228973	0.79688	.	.	ENSG00000145912	ENST00000274606	T	0.53857	0.6	5.08	5.08	0.68730	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.45736	0.1357	.	.	.	0.80722	D	1	B	0.31040	0.305	B	0.25506	0.061	T	0.46816	-0.9164	9	0.51188	T	0.08	-19.876	15.9765	0.80071	0.0:1.0:0.0:0.0	.	113	Q9NX24	NHP2_HUMAN	N	113	ENSP00000274606:D113N	ENSP00000274606:D113N	D	-	1	0	NHP2	177509445	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.666000	0.83877	2.349000	0.79799	0.655000	0.94253	GAC		0.557	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253471.1	NM_017838	Missense_Mutation	Missense_Mutation
FLT4	2324	broad.mit.edu	37	5	180053199	180053200	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:180053199_180053200TG>CT	ENST00000261937.6	-	9	1247_1248	c.1169_1170CA>AG	c.(1168-1170)aCA>aAG	p.T390K	FLT4_ENST00000502649.1_Missense_Mutation_p.T390K|FLT4_ENST00000393347.3_Missense_Mutation_p.T390K|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	390	Ig-like C2-type 4.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.T390K(2)|p.T200K(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGCTGGCCTCTGTCACCTCCTT	0.624																																					Colon(97;1075 1466 27033 27547 35871)											3	Substitution - Missense(3)	ovary(3)	5																																								179985806	SO:0001583	missense	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1169_1170delinsCT	5.37:g.180053199_180053200delinsCT	ENSP00000261937:p.Thr390Lys	Unknown		x	x	x	179985805	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	DNP	ENST00000261937.6	37	CCDS4457.1	DNP	55	Broad																																																																																				0.624	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			Missense_Mutation
NUP153	9972	broad.mit.edu	37	6	17637764	17637764	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:17637764G>C	ENST00000262077.2	-	16	2083	c.2084C>G	c.(2083-2085)aCt>aGt	p.T695S	NUP153_ENST00000537253.1_Missense_Mutation_p.T726S	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	695					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.T695S(1)		NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TTCAATTCCAGTCTGTTTAGC	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											219.0	192.0	201.0					6																	17637764		2203	4300	6503	17745743	SO:0001583	missense	9972			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2084C>G	6.37:g.17637764G>C	ENSP00000262077:p.Thr695Ser	Unknown		x	x	x	17745743	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	11.02	1.516631	0.27123	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.07216	3.22;3.21	6.11	5.19	0.71726	.	0.391146	0.21995	N	0.066092	T	0.02304	0.0071	L	0.29908	0.895	0.31814	N	0.626834	B;B;B	0.28055	0.199;0.011;0.026	B;B;B	0.33620	0.167;0.014;0.021	T	0.44483	-0.9325	10	0.12766	T	0.61	-11.9288	7.5501	0.27790	0.1372:0.1416:0.7212:0.0	.	726;675;695	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	S	695;675;726	ENSP00000262077:T695S;ENSP00000444029:T726S	ENSP00000262077:T695S	T	-	2	0	NUP153	17745743	0.076000	0.21285	1.000000	0.80357	0.848000	0.48234	1.412000	0.34714	2.906000	0.99361	0.655000	0.94253	ACT		0.413	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1			Missense_Mutation
HIST1H2BH	8345	broad.mit.edu	37	6	26252104	26252104	+	Missense_Mutation	SNP	G	G	A	rs368637521		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:26252104G>A	ENST00000356350.2	+	1	226	c.226G>A	c.(226-228)Ggc>Agc	p.G76S	HIST1H3F_ENST00000446824.2_5'Flank	NM_003524.2	NP_003515.1	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	76					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(3)|breast(2)|large_intestine(1)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	17						GCGCATCGCCGGCGAGGCTTC	0.582																																																0			6											105.0	107.0	106.0					6																	26252104		2203	4300	6503	26360083	SO:0001583	missense	8345			Z80781	CCDS4601.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000197459	ENSG00000275713		"""Histones / Replication-dependent"""	4755	protein-coding gene	gene with protein product		602806	"""H2B histone family, member J"", ""histone 1, H2bh"""	H2BFJ		9119399, 12408966	Standard	NM_003524		Approved	H2B/j	uc003nhh.3	Q93079	OTTHUMG00000014447	ENST00000356350.2:c.226G>A	6.37:g.26252104G>A	ENSP00000348706:p.Gly76Ser	Unknown		x	x	x	26360083	B2R541|Q4VB74	Missense_Mutation	SNP	ENST00000356350.2	37	CCDS4601.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	.	11.25	1.583023	0.28268	.	.	ENSG00000197459	ENST00000356350	T	0.65178	-0.14	4.65	2.84	0.33178	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.48241	0.1489	N	0.20610	0.595	0.09310	N	1	D	0.57899	0.981	P	0.61874	0.895	T	0.52283	-0.8596	9	0.36615	T	0.2	.	14.3943	0.67001	0.1144:0.0:0.8856:0.0	.	76	Q93079	H2B1H_HUMAN	S	76	ENSP00000348706:G76S	ENSP00000348706:G76S	G	+	1	0	HIST1H2BH	26360083	0.999000	0.42202	0.806000	0.32338	0.001000	0.01503	2.900000	0.48687	0.266000	0.21894	-1.937000	0.00501	GGC		0.582	HIST1H2BH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040110.1	NM_003524		Missense_Mutation
Unknown	0	broad.mit.edu	37	6	28243995	28243995	+	IGR	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:28243995G>A								NKAPL (15259 upstream) : PGBD1 (5318 downstream)																							GATTGAGAATGGGAAGCTTAT	0.393																																																0			6											72.0	68.0	69.0					6																	28243995		1838	4097	5935	28351974	SO:0001628	intergenic_variant	7741																															6.37:g.28243995G>A		Unknown		x	x	x	28351974		Missense_Mutation	SNP		37		SNP	47	Broad																																																																																			0	0.393									Missense_Mutation
HLA-E	3133	broad.mit.edu	37	6	30457681	30457681	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:30457681G>T	ENST00000376630.4	+	2	308	c.243G>T	c.(241-243)tgG>tgT	p.W81C		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	81	Alpha-1.				antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)	p.W81C(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						CAGAGTATTGGGACCGGGAGA	0.647																																																1	Substitution - Missense(1)	ovary(1)	6											76.0	91.0	85.0					6																	30457681		1509	2708	4217	30565660	SO:0001583	missense	3133			M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.243G>T	6.37:g.30457681G>T	ENSP00000365817:p.Trp81Cys	Unknown		x	x	x	30565660	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	ENST00000376630.4	37	CCDS34379.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	.	13.99	2.402545	0.42613	.	.	ENSG00000204592	ENST00000376630	T	0.02498	4.27	1.67	1.67	0.24075	.	0.000000	0.30347	U	0.009840	T	0.13500	0.0327	H	0.98786	4.33	0.23855	N	0.996659	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.07271	-1.0781	10	0.87932	D	0	.	6.7735	0.23607	0.0:0.0:1.0:0.0	.	122;81	E7ENN9;Q6DU44	.;.	C	81	ENSP00000365817:W81C	ENSP00000365817:W81C	W	+	3	0	HLA-E	30565660	1.000000	0.71417	0.172000	0.22920	0.066000	0.16364	2.793000	0.47845	1.235000	0.43724	0.462000	0.41574	TGG		0.647	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516		Missense_Mutation
VARS2	57176	broad.mit.edu	37	6	30887984	30887984	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:30887984C>T	ENST00000321897.5	+	12	1916	c.1284C>T	c.(1282-1284)gaC>gaT	p.D428D	VARS2_ENST00000416670.2_Silent_p.D428D|VARS2_ENST00000542001.1_Silent_p.D288D|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000541562.1_Silent_p.D458D			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	428					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TCTGCGGGGACTGGCTGCAGG	0.577																																																0			6											51.0	48.0	49.0					6																	30887984		1511	2709	4220	30995963	SO:0001819	synonymous_variant	57176			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1284C>T	6.37:g.30887984C>T		Unknown		x	x	x	30995963	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Silent	SNP	ENST00000321897.5	37	CCDS34387.1	SNP	20	Broad																																																																																				0.577	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442		Silent
TAPBP	6892	broad.mit.edu	37	6	33273059	33273059	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:33273059G>A	ENST00000489157.1	-	3	526	c.314C>T	c.(313-315)gCc>gTc	p.A105V	TAPBP_ENST00000456592.2_Missense_Mutation_p.A192V|TAPBP_ENST00000475304.1_Missense_Mutation_p.A210V|TAPBP_ENST00000426633.2_Missense_Mutation_p.A192V|TAPBP_ENST00000434618.2_Missense_Mutation_p.A192V			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	192					amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)	p.A192V(1)		endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						CAGAGATGAGGCGGCCTCGGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	6											28.0	31.0	30.0					6																	33273059		2203	4300	6503	33381037	SO:0001583	missense	6892			Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.314C>T	6.37:g.33273059G>A	ENSP00000419659:p.Ala105Val	Unknown		x	x	x	33381037	A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Missense_Mutation	SNP	ENST00000489157.1	37	CCDS34427.2	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469304	0.26423	.	.	ENSG00000231925	ENST00000434618;ENST00000475304;ENST00000489157;ENST00000426633;ENST00000456592;ENST00000449540;ENST00000437741;ENST00000467025	T;T;T;T;T	0.33216	1.44;1.45;1.42;1.42;1.44	4.76	2.88	0.33553	.	0.680005	0.12761	N	0.441336	T	0.14657	0.0354	L	0.57536	1.79	0.09310	N	1	P;B;P;P;P;B	0.42296	0.62;0.337;0.717;0.62;0.775;0.337	B;B;B;B;B;B	0.41412	0.055;0.02;0.251;0.064;0.356;0.025	T	0.09640	-1.0665	10	0.51188	T	0.08	-11.3688	5.7466	0.18124	0.101:0.0:0.7068:0.1921	.	192;105;210;192;192;192	G5E9H8;E9PGM2;A2AB90;O15533-3;G3V0I4;O15533	.;.;.;.;.;TPSN_HUMAN	V	192;210;105;192;192;192;192;135	ENSP00000395701:A192V;ENSP00000417949:A210V;ENSP00000419659:A105V;ENSP00000404833:A192V;ENSP00000387803:A192V	ENSP00000404833:A192V	A	-	2	0	TAPBP	33381037	0.005000	0.15991	0.004000	0.12327	0.508000	0.34012	1.540000	0.36115	1.178000	0.42870	0.549000	0.68633	GCC		0.632	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276425.2			Missense_Mutation
PHF1	5252	broad.mit.edu	37	6	33382068	33382068	+	Silent	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:33382068G>A	ENST00000374516.3	+	9	1072	c.801G>A	c.(799-801)aaG>aaA	p.K267K	PHF1_ENST00000374512.3_Silent_p.K267K	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	267					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				TTTGCTGTAAGAAGAAATACT	0.478											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			6											150.0	149.0	149.0					6																	33382068		2203	4300	6503	33490046	SO:0001819	synonymous_variant	5252			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.801G>A	6.37:g.33382068G>A		Unknown	839	x	x	x	33490046	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Silent	SNP	ENST00000374516.3	37	CCDS4777.1	SNP	33	Broad																																																																																				0.478	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3			Silent
PNPLA1	285848	broad.mit.edu	37	6	36262168	36262168	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:36262168G>A	ENST00000394571.2	+	4	706	c.706G>A	c.(706-708)Gac>Aac	p.D236N	PNPLA1_ENST00000312917.5_Missense_Mutation_p.D150N|PNPLA1_ENST00000388715.3_Missense_Mutation_p.D141N	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	236					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						GTTCCCCCCGGACCTGGTGGT	0.607																																																0			6											52.0	48.0	50.0					6																	36262168		2203	4300	6503	36370146	SO:0001583	missense	285848				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.706G>A	6.37:g.36262168G>A	ENSP00000378072:p.Asp236Asn	Unknown		x	x	x	36370146	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	37	CCDS54997.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357740	0.82243	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	4.88	4.88	0.63580	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.237866	0.29668	N	0.011517	T	0.79021	0.4376	L	0.39147	1.195	0.46131	D	0.998881	D;D	0.63880	0.988;0.993	P;D	0.64776	0.789;0.929	T	0.81484	-0.0912	10	0.72032	D	0.01	-16.5935	15.5666	0.76298	0.0:0.0:1.0:0.0	.	236;150	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	N	141;150;237;236	ENSP00000373367:D141N;ENSP00000321116:D150N;ENSP00000391868:D237N;ENSP00000378072:D236N	ENSP00000321116:D150N	D	+	1	0	PNPLA1	36370146	1.000000	0.71417	1.000000	0.80357	0.600000	0.36913	5.129000	0.64739	2.546000	0.85860	0.561000	0.74099	GAC		0.607	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676		Missense_Mutation
GPR115	221393	broad.mit.edu	37	6	47682262	47682262	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:47682262G>A	ENST00000283303.2	+	6	1539	c.1281G>A	c.(1279-1281)tgG>tgA	p.W427*	GPR115_ENST00000327753.3_Nonsense_Mutation_p.W427*|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Nonsense_Mutation_p.W484*	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	427					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W427*(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						CCACAGTGTGGTCCCGGGTGG	0.488																																					GBM(22;431 510 9010 26644 32828)											1	Substitution - Nonsense(1)	ovary(1)	6											183.0	159.0	167.0					6																	47682262		2203	4300	6503	47790221	SO:0001587	stop_gained	221393			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1281G>A	6.37:g.47682262G>A	ENSP00000283303:p.Trp427*	Unknown		x	x	x	47790221	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Nonsense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.330668	0.97480	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	.	.	.	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.894	18.6292	0.91354	0.0:0.0:1.0:0.0	.	.	.	.	X	484;427;427	.	ENSP00000283303:W427X	W	+	3	0	GPR115	47790221	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	9.778000	0.99011	2.721000	0.93114	0.655000	0.94253	TGG		0.488	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		Nonsense_Mutation
BEND6	221336	broad.mit.edu	37	6	56857226	56857227	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:56857226_56857227GG>TT	ENST00000370746.3	+	3	440_441	c.171_172GG>TT	c.(169-174)gaGGat>gaTTat	p.57_58ED>DY	BEND6_ENST00000370745.1_Missense_Mutation_p.57_58ED>DY|BEND6_ENST00000370750.2_Missense_Mutation_p.57_58ED>DY|BEND6_ENST00000370748.3_Missense_Mutation_p.57_58ED>DY	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	57					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)	p.E57_D58>DY(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						GCTCCAGTGAGGATGAAGAGCC	0.416																																																1	Complex - compound substitution(1)	ovary(1)	6																																								56965186	SO:0001583	missense	221336			AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	Exception_encountered	6.37:g.56857226_56857227delinsTT	ENSP00000359782:p.E57_D58delinsDY	Unknown		x	x	x	56965185	Q4G0W8|Q8N662|Q96NS6	Missense_Mutation	DNP	ENST00000370746.3	37	CCDS43476.1	DNP	35	Broad																																																																																				0.416	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041032.4	NM_152731		Missense_Mutation
RIMS1	22999	broad.mit.edu	37	6	72984071	72984071	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:72984071C>T	ENST00000521978.1	+	23	3418	c.3418C>T	c.(3418-3420)Cta>Tta	p.L1140L	RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000517960.1_Intron|RIMS1_ENST00000518273.1_Silent_p.L1076L|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000401910.3_Intron|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000491071.2_Intron|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000264839.7_Intron|RIMS1_ENST00000520567.1_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1140					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.L1140L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GTCCCCCTCCCTAGATAGGAG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	6											73.0	70.0	71.0					6																	72984071		1883	4109	5992	73040792	SO:0001819	synonymous_variant	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3418C>T	6.37:g.72984071C>T		Unknown		x	x	x	73040792	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	37	CCDS47449.1	SNP	24	Broad																																																																																				0.473	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			Silent
TXLNB	167838	broad.mit.edu	37	6	139563822	139563822	+	Silent	SNP	A	A	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr6:139563822A>G	ENST00000358430.3	-	10	2128	c.1896T>C	c.(1894-1896)gcT>gcC	p.A632A	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	632						cytoplasm (GO:0005737)		p.A632A(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		CGCATGCTGGAGCAGGCACAT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	6											77.0	83.0	81.0					6																	139563822		2203	4300	6503	139605515	SO:0001819	synonymous_variant	167838				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1896T>C	6.37:g.139563822A>G		Unknown		x	x	x	139605515	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Silent	SNP	ENST00000358430.3	37	CCDS34545.1	SNP	11	Broad																																																																																				0.647	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235		Silent
ELMO1	9844	broad.mit.edu	37	7	37382282	37382282	+	Missense_Mutation	SNP	C	C	T	rs146510671		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:37382282C>T	ENST00000310758.4	-	2	660	c.13G>A	c.(13-15)Gcg>Acg	p.A5T	ELMO1_ENST00000448602.1_Missense_Mutation_p.A5T|ELMO1_ENST00000442504.1_Missense_Mutation_p.A5T	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	5					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.A5T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						ACGATGTCCGCGGGTGGCGGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	7						C	THR/ALA,THR/ALA,THR/ALA	2,4404	4.2+/-10.8	0,2,2201	116.0	121.0	119.0		13,13,13	4.0	0.0	7	dbSNP_134	119	0,8600		0,0,4300	no	missense,missense,missense	ELMO1	NM_001206480.1,NM_001206482.1,NM_014800.10	58,58,58	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,benign	5/728,5/728,5/728	37382282	2,13004	2203	4300	6503	37348807	SO:0001583	missense	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.13G>A	7.37:g.37382282C>T	ENSP00000312185:p.Ala5Thr	Unknown		x	x	x	37348807	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	18.04	3.533964	0.64972	4.54E-4	0.0	ENSG00000155849	ENST00000310758;ENST00000442504;ENST00000448602;ENST00000455119;ENST00000455879;ENST00000453399;ENST00000445322	T;T;T;T;T;T;T	0.44881	2.53;2.53;2.53;1.53;1.52;0.94;0.91	4.94	4.03	0.46877	.	0.200167	0.41823	D	0.000804	T	0.27594	0.0678	N	0.19112	0.55	0.44323	D	0.997201	B	0.14012	0.009	B	0.14578	0.011	T	0.04635	-1.0937	10	0.25106	T	0.35	.	12.5184	0.56046	0.1731:0.8269:0.0:0.0	.	5	Q92556	ELMO1_HUMAN	T	5	ENSP00000312185:A5T;ENSP00000406952:A5T;ENSP00000394458:A5T;ENSP00000406610:A5T;ENSP00000416090:A5T;ENSP00000391734:A5T;ENSP00000397857:A5T	ENSP00000312185:A5T	A	-	1	0	ELMO1	37348807	0.961000	0.32948	0.033000	0.17914	0.945000	0.59286	2.373000	0.44266	1.166000	0.42689	0.655000	0.94253	GCG		0.502	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		Missense_Mutation
ZMIZ2	83637	broad.mit.edu	37	7	44796130	44796130	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:44796130C>G	ENST00000309315.4	+	3	280	c.157C>G	c.(157-159)Cag>Gag	p.Q53E	ZMIZ2_ENST00000441627.1_Missense_Mutation_p.Q53E|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.Q53E|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.Q53E|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.Q53E	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	53	Gly-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.Q53E(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CAACGCGACACAGAGCCAGGT	0.592																																					NSCLC(20;604 852 1948 16908 50522)											1	Substitution - Missense(1)	ovary(1)	7											69.0	73.0	71.0					7																	44796130		2133	4243	6376	44762655	SO:0001583	missense	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.157C>G	7.37:g.44796130C>G	ENSP00000311778:p.Gln53Glu	Unknown		x	x	x	44762655	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566078	0.65651	.	.	ENSG00000122515	ENST00000413916;ENST00000457123;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	D;D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16;-4.16	4.34	4.34	0.51931	.	0.131249	0.32935	N	0.005475	D	0.95962	0.8685	M	0.62723	1.935	0.31237	N	0.695598	B;P;B	0.46656	0.288;0.882;0.185	B;P;B	0.47573	0.086;0.55;0.054	D	0.95822	0.8850	10	0.66056	D	0.02	-7.5575	15.7692	0.78152	0.0:1.0:0.0:0.0	.	53;53;53	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	E	53	ENSP00000409648:Q53E;ENSP00000415501:Q53E;ENSP00000311778:Q53E;ENSP00000414723:Q53E;ENSP00000396601:Q53E;ENSP00000265346:Q53E	ENSP00000265346:Q53E	Q	+	1	0	ZMIZ2	44762655	0.974000	0.33945	0.822000	0.32727	0.844000	0.47949	2.284000	0.43478	2.251000	0.74343	0.467000	0.42956	CAG		0.592	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449		Missense_Mutation
COBL	23242	broad.mit.edu	37	7	51152900	51152900	+	Silent	SNP	G	G	C			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:51152900G>C	ENST00000265136.7	-	7	1224	c.1059C>G	c.(1057-1059)cgC>cgG	p.R353R	COBL_ENST00000395540.2_Silent_p.R353R|COBL_ENST00000395542.2_Silent_p.R378R|COBL_ENST00000441453.1_Silent_p.R353R	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	353					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.R353R(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TATCCTCAGTGCGGTTGGGGA	0.587																																					NSCLC(189;2119 2138 12223 30818 34679)											1	Substitution - coding silent(1)	ovary(1)	7											182.0	129.0	147.0					7																	51152900		2203	4300	6503	51120394	SO:0001819	synonymous_variant	23242			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1059C>G	7.37:g.51152900G>C		Unknown		x	x	x	51120394	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	37	CCDS34637.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	7.940	0.742622	0.15642	.	.	ENSG00000106078	ENST00000452534	.	.	.	5.46	4.56	0.56223	.	.	.	.	.	T	0.56992	0.2023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54430	-0.8295	4	.	.	.	.	7.092	0.25289	0.0997:0.2619:0.6384:0.0	.	.	.	.	D	272	.	.	H	-	1	0	COBL	51120394	0.992000	0.36948	0.795000	0.32087	0.636000	0.38137	2.201000	0.42734	2.542000	0.85734	0.655000	0.94253	CAC		0.587	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		Silent
STAG3	10734	broad.mit.edu	37	7	99786618	99786618	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:99786618C>A	ENST00000426455.1	+	7	1101	c.694C>A	c.(694-696)Cgt>Agt	p.R232S	STAG3_ENST00000394018.2_Missense_Mutation_p.R174S|STAG3_ENST00000317296.5_Missense_Mutation_p.R232S	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	232					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.R232S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCGCGCCTTCCGTCACACTAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											90.0	89.0	89.0					7																	99786618		2203	4300	6503	99624554	SO:0001583	missense	10734			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.694C>A	7.37:g.99786618C>A	ENSP00000400359:p.Arg232Ser	Unknown		x	x	x	99624554	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	CCDS34703.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	.	22.3	4.275914	0.80580	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000317296;ENST00000439782	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.41	5.41	0.78517	STAG (1);	0.000000	0.48286	D	0.000189	D	0.84651	0.5519	M	0.88906	2.99	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.989;1.0	D	0.86997	0.2114	10	0.87932	D	0	-12.1306	16.7269	0.85424	0.0:1.0:0.0:0.0	.	174;232	B4DZ10;Q9UJ98	.;STAG3_HUMAN	S	232;174;190;232;174	ENSP00000400359:R232S;ENSP00000377586:R174S;ENSP00000319318:R232S;ENSP00000397067:R174S	ENSP00000319318:R232S	R	+	1	0	STAG3	99624554	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.952000	0.49097	2.821000	0.97095	0.555000	0.69702	CGT		0.517	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447		Missense_Mutation
GCC1	79571	broad.mit.edu	37	7	127222568	127222568	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:127222568C>A	ENST00000321407.2	-	2	2252	c.1828G>T	c.(1828-1830)Gcc>Tcc	p.A610S	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	610					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.A610S(1)		breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GAGGCCAAGGCCACAGAACGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											69.0	67.0	68.0					7																	127222568		2203	4300	6503	127009804	SO:0001583	missense	79571			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1828G>T	7.37:g.127222568C>A	ENSP00000318821:p.Ala610Ser	Unknown		x	x	x	127009804	Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	37	CCDS5796.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.95	1.791405	0.31685	.	.	ENSG00000179562	ENST00000321407	T	0.10960	2.82	5.1	5.1	0.69264	.	0.296786	0.37623	N	0.002014	T	0.08537	0.0212	L	0.41236	1.265	0.37468	D	0.915505	P	0.47106	0.89	B	0.38378	0.272	T	0.21143	-1.0254	10	0.07990	T	0.79	-14.8502	14.3609	0.66771	0.0:1.0:0.0:0.0	.	610	Q96CN9	GCC1_HUMAN	S	610	ENSP00000318821:A610S	ENSP00000318821:A610S	A	-	1	0	GCC1	127009804	0.949000	0.32298	1.000000	0.80357	0.995000	0.86356	1.213000	0.32407	2.518000	0.84900	0.655000	0.94253	GCC		0.607	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523		Missense_Mutation
C7orf33	202865	broad.mit.edu	37	7	148311284	148311284	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:148311284G>A	ENST00000307003.2	+	2	716	c.355G>A	c.(355-357)Ggc>Agc	p.G119S		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	119										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CACCAGGATGGGCTTGTCCTC	0.527																																																0			7											133.0	105.0	114.0					7																	148311284		2203	4300	6503	147942217	SO:0001583	missense	202865			BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.355G>A	7.37:g.148311284G>A	ENSP00000304071:p.Gly119Ser	Unknown		x	x	x	147942217		Missense_Mutation	SNP	ENST00000307003.2	37	CCDS5890.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577010	0.28092	.	.	ENSG00000170279	ENST00000307003	.	.	.	0.963	-0.166	0.13351	.	.	.	.	.	T	0.32346	0.0826	N	0.19112	0.55	0.09310	N	1	D	0.71674	0.998	P	0.57776	0.827	T	0.15809	-1.0424	8	0.87932	D	0	.	3.8977	0.09147	0.0:0.0:0.5833:0.4167	.	119	Q8WU49	CG033_HUMAN	S	119	.	ENSP00000304071:G119S	G	+	1	0	C7orf33	147942217	0.002000	0.14202	0.011000	0.14972	0.473000	0.32948	-0.052000	0.11865	-0.077000	0.12752	0.462000	0.41574	GGC		0.527	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304		Missense_Mutation
PLAG1	5324	broad.mit.edu	37	8	57079711	57079711	+	Silent	SNP	C	C	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr8:57079711C>T	ENST00000316981.3	-	5	1073	c.594G>A	c.(592-594)aaG>aaA	p.K198K	PLAG1_ENST00000423799.2_Silent_p.K116K|PLAG1_ENST00000429357.2_Silent_p.K198K	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	198	Decreased nuclear import with localization in the nucleus but also in the cytoplasm.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			TCCGGACATCCTTTCGGGTGT	0.493			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																		Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	0			8											79.0	75.0	76.0					8																	57079711		2203	4300	6503	57242265	SO:0001819	synonymous_variant	5324			U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.594G>A	8.37:g.57079711C>T		Unknown		x	x	x	57242265	B4DLC2|Q59GH8|Q9Y4L2	Silent	SNP	ENST00000316981.3	37	CCDS6165.1	SNP	24	Broad																																																																																				0.493	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655		Silent
RGS22	26166	broad.mit.edu	37	8	100999756	100999756	+	Missense_Mutation	SNP	C	C	A	rs182707509	byFrequency	TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr8:100999756C>A	ENST00000360863.6	-	21	3304	c.3110G>T	c.(3109-3111)cGt>cTt	p.R1037L	RGS22_ENST00000523287.1_Missense_Mutation_p.R856L|RGS22_ENST00000523437.1_Missense_Mutation_p.R1025L	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1037	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.R1037L(1)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AGCCACAAAACGTTGAAATTG	0.358																																																1	Substitution - Missense(1)	ovary(1)	8											97.0	89.0	92.0					8																	100999756		1826	4082	5908	101068932	SO:0001583	missense	26166			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3110G>T	8.37:g.100999756C>A	ENSP00000354109:p.Arg1037Leu	Unknown		x	x	x	101068932	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380137	0.61845	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.01918	4.56;4.56;4.56	5.76	1.02	0.19986	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.283837	0.33515	N	0.004831	T	0.05456	0.0144	L	0.56769	1.78	0.27924	N	0.938133	P;P;P	0.44946	0.846;0.846;0.815	P;P;B	0.50860	0.652;0.652;0.338	T	0.05716	-1.0868	10	0.72032	D	0.01	.	11.0112	0.47663	0.0:0.6475:0.0:0.3525	.	1025;1037;856	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	L	1037;1024;856;1025	ENSP00000354109:R1037L;ENSP00000429382:R856L;ENSP00000428212:R1025L	ENSP00000354109:R1037L	R	-	2	0	RGS22	101068932	0.990000	0.36364	0.424000	0.26647	0.936000	0.57629	0.858000	0.27845	-0.088000	0.12506	0.573000	0.79308	CGT		0.358	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		Missense_Mutation
DENND3	22898	broad.mit.edu	37	8	142199087	142199087	+	Silent	SNP	C	C	T	rs373262471		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr8:142199087C>T	ENST00000262585.2	+	19	3125	c.2847C>T	c.(2845-2847)aaC>aaT	p.N949N	DENND3_ENST00000519811.1_Silent_p.N1029N|DENND3_ENST00000523308.1_5'UTR|DENND3_ENST00000424248.1_Silent_p.N897N	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	949					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGTTAGAACTGCATGGTGA	0.498																																																0			8						C		0,4406		0,0,2203	95.0	73.0	81.0		2847	4.2	1.0	8		81	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DENND3	NM_014957.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		949/1199	142199087	2,13004	2203	4300	6503	142268269	SO:0001819	synonymous_variant	22898			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.2847C>T	8.37:g.142199087C>T		Unknown		x	x	x	142268269	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	CCDS34947.1	SNP	20	Broad																																																																																				0.498	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957		Silent
TMEM246	84302	broad.mit.edu	37	9	104239360	104239360	+	Silent	SNP	G	G	A	rs137861341		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr9:104239360G>A	ENST00000374851.1	-	4	1162	c.15C>T	c.(13-15)acC>acT	p.T5T	RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000450109.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|TMEM246_ENST00000374848.3_Silent_p.T5T|TMEM246_ENST00000374847.1_Silent_p.T5T|RP11-490D19.6_ENST00000425734.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	5						integral component of membrane (GO:0016021)		p.T5T(2)									CAGCTGGAGAGGTTGAAGTGC	0.532																																																2	Substitution - coding silent(2)	ovary(1)|central_nervous_system(1)	9											25.0	26.0	25.0					9																	104239360		2203	4300	6503	103279181	SO:0001819	synonymous_variant	84302			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.15C>T	9.37:g.104239360G>A		Unknown		x	x	x	103279181	Q49AQ4	Silent	SNP	ENST00000374851.1	37	CCDS6757.1	SNP	35	Broad																																																																																				0.532	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342		Silent
TSC1	7248	broad.mit.edu	37	9	135777066	135777067	+	Missense_Mutation	DNP	CC	CC	TG	rs118203689		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr9:135777066_135777067CC>TG	ENST00000298552.3	-	19	2632_2633	c.2411_2412GG>CA	c.(2410-2412)aGG>aCA	p.R804T	TSC1_ENST00000440111.2_Missense_Mutation_p.R804T|TSC1_ENST00000545250.1_Missense_Mutation_p.R753T	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	804					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)|p.R804T(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CAATCATGTTCCTGCAGTCCTC	0.525			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis		OREG0019577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|bone(1)	9																																								134766888	SO:0001583	missense	7248	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2411_2412delinsTG	9.37:g.135777066_135777067delinsTG	ENSP00000298552:p.Arg804Thr	Unknown	1620	x	x	x	134766887	B7Z897|Q5VVN5	Missense_Mutation	DNP	ENST00000298552.3	37	CCDS6956.1	DNP	30	Broad																																																																																				0.525	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1			Missense_Mutation
VAV2	7410	broad.mit.edu	37	9	136656973	136656973	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr9:136656973T>G	ENST00000371850.3	-	13	1151	c.1120A>C	c.(1120-1122)Aat>Cat	p.N374H	VAV2_ENST00000406606.3_Missense_Mutation_p.N369H|VAV2_ENST00000371851.1_Missense_Mutation_p.N369H	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	374	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N369H(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TTAACTTCATTGATGTACATC	0.488																																																1	Substitution - Missense(1)	ovary(1)	9											149.0	139.0	142.0					9																	136656973		2203	4300	6503	135646794	SO:0001583	missense	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.1120A>C	9.37:g.136656973T>G	ENSP00000360916:p.Asn374His	Unknown		x	x	x	135646794	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	CCDS48053.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	18.43	3.623109	0.66901	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.75821	-0.97;-0.97;-0.97	4.0	4.0	0.46444	Dbl homology (DH) domain (5);	0.109437	0.64402	D	0.000008	D	0.88731	0.6516	H	0.94582	3.555	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.69479	0.922;0.964	D	0.91626	0.5315	10	0.87932	D	0	.	13.2015	0.59772	0.0:0.0:0.0:1.0	.	374;369	P52735;P52735-3	VAV2_HUMAN;.	H	374;369;369;369	ENSP00000360916:N374H;ENSP00000360917:N369H;ENSP00000385362:N369H	ENSP00000317258:N369H	N	-	1	0	VAV2	135646794	1.000000	0.71417	0.932000	0.37286	0.756000	0.42949	7.803000	0.85983	1.570000	0.49709	0.448000	0.29417	AAT		0.488	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			Missense_Mutation
USP11	8237	broad.mit.edu	37	X	47100769	47100769	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chrX:47100769G>A	ENST00000218348.3	+	8	1069	c.1069G>A	c.(1069-1071)Gag>Aag	p.E357K	USP11_ENST00000377107.2_Missense_Mutation_p.E314K	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	357	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CATGAAGGGTGAGATCGCAGA	0.577																																																0			X											126.0	83.0	97.0					X																	47100769		2203	4300	6503	46985713	SO:0001583	missense	8237			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1069G>A	X.37:g.47100769G>A	ENSP00000218348:p.Glu357Lys	Unknown		x	x	x	46985713	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	CCDS14277.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.088303	0.94100	.	.	ENSG00000102226	ENST00000377107;ENST00000218348;ENST00000377078	T;T;T	0.31510	1.49;1.49;1.49	5.51	5.51	0.81932	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.48314	0.1493	L	0.39147	1.195	0.58432	D	0.999997	B;D	0.89917	0.363;1.0	P;D	0.87578	0.617;0.998	T	0.42481	-0.9449	10	0.51188	T	0.08	-26.8681	17.1048	0.86659	0.0:0.0:1.0:0.0	.	84;357	B3KP28;P51784	.;UBP11_HUMAN	K	314;357;84	ENSP00000366311:E314K;ENSP00000218348:E357K;ENSP00000366279:E84K	ENSP00000218348:E357K	E	+	1	0	USP11	46985713	1.000000	0.71417	0.613000	0.29037	0.984000	0.73092	6.677000	0.74503	2.304000	0.77564	0.600000	0.82982	GAG		0.577	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651		Missense_Mutation
SYP	6855	broad.mit.edu	37	X	49049789	49049789	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chrX:49049789C>G	ENST00000263233.4	-	5	627	c.555G>C	c.(553-555)caG>caC	p.Q185H	SYP_ENST00000538567.1_Missense_Mutation_p.Q67H|SYP_ENST00000479808.1_Missense_Mutation_p.Q185H	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	185	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)	p.Q185H(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				TGTTCCCTGTCTGGCGGCAGA	0.572																																																2	Substitution - Missense(2)	ovary(2)	X											103.0	71.0	82.0					X																	49049789		2203	4300	6503	48936733	SO:0001583	missense	6855			X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.555G>C	X.37:g.49049789C>G	ENSP00000263233:p.Gln185His	Unknown		x	x	x	48936733	B2R7L6|B7Z359|Q6P2F7	Missense_Mutation	SNP	ENST00000263233.4	37	CCDS14321.1	SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.95|13.95	2.390554|2.390554	0.42410|0.42410	.|.	.|.	ENSG00000102003|ENSG00000102003	ENST00000263233;ENST00000538567;ENST00000479808|ENST00000472598	T;T;T|.	0.70399|.	-0.48;-0.48;-0.48|.	5.11|5.11	5.11|5.11	0.69529|0.69529	Marvel (1);MARVEL-like domain (1);|.	0.278172|.	0.36665|.	N|.	0.002478|.	T|T	0.37404|0.37404	0.1002|0.1002	L|L	0.33245|0.33245	0.995|0.995	0.09310|0.09310	N|N	0.999995|0.999995	P|.	0.52692|.	0.955|.	P|.	0.49561|.	0.615|.	T|T	0.23261|0.23261	-1.0193|-1.0193	10|5	0.46703|.	T|.	0.11|.	-4.3796|-4.3796	10.3917|10.3917	0.44175|0.44175	0.0:0.905:0.0:0.095|0.0:0.905:0.0:0.095	.|.	185|.	P08247|.	SYPH_HUMAN|.	H|T	185;67;185|75	ENSP00000263233:Q185H;ENSP00000437456:Q67H;ENSP00000418169:Q185H|.	ENSP00000263233:Q185H|.	Q|R	-|-	3|2	2|0	SYP|SYP	48936733|48936733	0.827000|0.827000	0.29292|0.29292	0.926000|0.926000	0.36857|0.36857	0.979000|0.979000	0.70002|0.70002	1.499000|1.499000	0.35671|0.35671	2.358000|2.358000	0.79984|0.79984	0.600000|0.600000	0.82982|0.82982	CAG|AGA		0.572	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083625.2	NM_003179		Missense_Mutation
ITIH6	347365	broad.mit.edu	37	X	54785126	54785126	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chrX:54785126G>T	ENST00000218436.6	-	8	1410	c.1381C>A	c.(1381-1383)Cag>Aag	p.Q461K		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	461	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q461K(1)									CCCTTCAGCTGTAGGGCCGCA	0.592																																																1	Substitution - Missense(1)	ovary(1)	X											46.0	41.0	43.0					X																	54785126		2203	4300	6503	54801851	SO:0001583	missense	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1381C>A	X.37:g.54785126G>T	ENSP00000218436:p.Gln461Lys	Unknown		x	x	x	54801851	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176243	0.38413	.	.	ENSG00000102313	ENST00000218436	T	0.13196	2.61	3.66	3.66	0.41972	von Willebrand factor, type A (2);	0.000000	0.64402	U	0.000001	T	0.17704	0.0425	M	0.73372	2.23	0.40047	D	0.975726	B	0.13594	0.008	B	0.09377	0.004	T	0.04320	-1.0960	10	0.38643	T	0.18	.	13.6298	0.62189	0.0:0.0:1.0:0.0	.	461	Q6UXX5	ITH5L_HUMAN	K	461	ENSP00000218436:Q461K	ENSP00000218436:Q461K	Q	-	1	0	ITIH5L	54801851	1.000000	0.71417	0.020000	0.16555	0.007000	0.05969	6.143000	0.71756	1.402000	0.46780	0.597000	0.82753	CAG		0.592	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		Missense_Mutation
NBPF15	284565	broad.mit.edu	37	1	148753327	148753336	+	Frame_Shift_Del	DEL	AGATTATCTT	AGATTATCTT	-	rs201199563		TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:148753327_148753336delAGATTATCTT	ENST00000417839.1	+	12	1534_1543	c.1344_1353delAGATTATCTT	c.(1342-1353)tcagattatcttfs	p.SDYL448fs		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		448	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					CGACTCCTTCAGATTATCTTGAACTGCCTG	0.481																																																0			1																																								147019960	SO:0001589	frameshift_variant	728936																														ENST00000417839.1:c.1344_1353delAGATTATCTT	1.37:g.148753327_148753336delAGATTATCTT	ENSP00000395369:p.Ser448fs	Unknown		Capture	Illumina GAIIx	Phase_I	147019951	A8MPT6	Frame_Shift_Del	DEL	ENST00000417839.1	37	CCDS41384.1	DEL	7	Broad																																																																																				0.481	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1			Frame_Shift_Del
IGSF9	57549	broad.mit.edu	37	1	159904242	159904253	+	In_Frame_Del	DEL	AGGGTGGATGCA	AGGGTGGATGCA	-			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr1:159904242_159904253delAGGGTGGATGCA	ENST00000368094.1	-	8	1120_1131	c.923_934delTGCATCCACCCT	c.(922-936)ctgcatccaccctca>cca	p.308_312LHPPS>P	IGSF9_ENST00000361509.3_In_Frame_Del_p.308_312LHPPS>P|IGSF9_ENST00000493195.1_5'Flank	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	308	Ig-like 3.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.L308_S312>P(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GCAGAGGCTGAGGGTGGATGCAGGAGGCCATT	0.67																																																1	Complex - deletion inframe(1)	ovary(1)	1																																								158170877	SO:0001651	inframe_deletion	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.923_934delTGCATCCACCCT	1.37:g.159904242_159904253delAGGGTGGATGCA	ENSP00000357073:p.Leu308_Ser312delinsPro	Unknown		Capture	Illumina GAIIx	Phase_I	158170866		In_Frame_Del	DEL	ENST00000368094.1	37	CCDS44254.1	DEL	11	Broad																																																																																				0.670	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789		In_Frame_Del
SPEF2	79925	broad.mit.edu	37	5	35793313	35793313	+	Frame_Shift_Del	DEL	G	G	-	rs199996012	byFrequency	TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr5:35793313delG	ENST00000356031.3	+	32	4761	c.4607delG	c.(4606-4608)cggfs	p.R1536fs	SPEF2_ENST00000303129.4_Frame_Shift_Del_p.R333fs|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Frame_Shift_Del_p.R1531fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1536					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTGGACTGGCGGAAGTTCCTG	0.433																																																0			5											103.0	97.0	99.0					5																	35793313		1908	4119	6027	35829070	SO:0001589	frameshift_variant	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4607delG	5.37:g.35793313delG	ENSP00000348314:p.Arg1536fs	Unknown		Capture	Illumina GAIIx	Phase_I	35829070	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	ENST00000356031.3	37	CCDS43309.1	DEL	39	Broad																																																																																				0.433	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		Frame_Shift_Del
PLOD3	8985	broad.mit.edu	37	7	100853880	100853889	+	Frame_Shift_Del	DEL	TGGGGCAGCT	TGGGGCAGCT	-			TCGA-61-1998-01	TCGA-61-1998-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-1998-01	TCGA-61-1998-10	g.chr7:100853880_100853889delTGGGGCAGCT	ENST00000223127.3	-	13	1822_1831	c.1424_1433delAGCTGCCCCA	c.(1423-1434)gagctgccccagfs	p.ELPQ475fs		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	475					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.E475fs*29(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CACATCCCTCTGGGGCAGCTCCATCCGCAG	0.624																																																1	Deletion - Frameshift(1)	ovary(1)	7																																								100640609	SO:0001589	frameshift_variant	8985			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1424_1433delAGCTGCCCCA	7.37:g.100853880_100853889delTGGGGCAGCT	ENSP00000223127:p.Glu475fs	Unknown		Capture	Illumina GAIIx	Phase_I	100640600	B2R6W6|Q540C3	Frame_Shift_Del	DEL	ENST00000223127.3	37	CCDS5715.1	DEL	55	Broad																																																																																				0.624	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1			Frame_Shift_Del
