#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CMPK1	51727	broad.mit.edu	37	1	47838691	47838691	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr1:47838691G>T	ENST00000371873.5	+	3	532	c.383G>T	c.(382-384)aGa>aTa	p.R128I	CMPK1_ENST00000450808.2_Missense_Mutation_p.R79I	NM_001136140.1|NM_016308.2	NP_001129612.1|NP_057392.1			cytidine monophosphate (UMP-CMP) kinase 1, cytosolic									p.R128I(1)		endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(2)	8						GGGTTTCCAAGAAATCAAGAC	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											122.0	108.0	113.0					1																	47838691		2203	4300	6503	47611278	SO:0001583	missense	51727			AF070416	CCDS549.1, CCDS44135.1	1p34.1-p33	2008-02-05	2008-01-25	2008-01-25	ENSG00000162368	ENSG00000162368	2.7.4.14		18170	protein-coding gene	gene with protein product	"""UMP-CMP kinase"", ""Cytidine monophosphate kinase"""	191710	"""cytidylate kinase"""	CMPK		10462544	Standard	NM_016308		Approved	UMP-CMPK	uc001cri.3	P30085	OTTHUMG00000007849	ENST00000371873.5:c.383G>T	1.37:g.47838691G>T	ENSP00000360939:p.Arg128Ile	Unknown		x	x	x	47611278		Missense_Mutation	SNP	ENST00000371873.5	37	CCDS549.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.296755	0.95574	.	.	ENSG00000162368	ENST00000371873;ENST00000450808	D;D	0.87029	-2.2;-2.2	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.96131	0.8739	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.97392	0.9990	10	0.87932	D	0	-14.8976	19.275	0.94027	0.0:0.0:1.0:0.0	.	79;128	E9PGI8;B2R6S5	.;.	I	128;79	ENSP00000360939:R128I;ENSP00000398192:R79I	ENSP00000360937:R128I	R	+	2	0	CMPK1	47611278	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.471000	0.97696	2.523000	0.85059	0.563000	0.77884	AGA		0.363	CMPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021646.2	NM_016308		Missense_Mutation
FNDC7	163479	broad.mit.edu	37	1	109273510	109273510	+	Silent	SNP	C	C	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr1:109273510C>A	ENST00000370017.3	+	9	2116	c.1839C>A	c.(1837-1839)acC>acA	p.T613T	FNDC7_ENST00000271311.2_Silent_p.T614T	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	613	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)		p.T380T(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TTAGTGCCACCGGGTTGACTG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	1											127.0	106.0	113.0					1																	109273510		2203	4300	6503	109075033	SO:0001819	synonymous_variant	163479				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.1839C>A	1.37:g.109273510C>A		Unknown		x	x	x	109075033	A1L468|E9PAZ5|Q6PF16|Q8NA51	Silent	SNP	ENST00000370017.3	37	CCDS44185.1	SNP	23	Broad																																																																																				0.438	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532		Silent
CA14	23632	broad.mit.edu	37	1	150235522	150235522	+	Missense_Mutation	SNP	C	C	T	rs199642489		TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr1:150235522C>T	ENST00000369111.4	+	7	1614	c.644C>T	c.(643-645)tCg>tTg	p.S215L	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	215					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)	p.S215L(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	TACAATGGCTCGCTCACAACT	0.522																																																1	Substitution - Missense(1)	ovary(1)	1						C	LEU/SER	0,4406		0,0,2203	89.0	87.0	88.0		644	5.7	1.0	1		88	1,8599	1.2+/-3.3	0,1,4299	no	missense	CA14	NM_012113.1	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	215/338	150235522	1,13005	2203	4300	6503	148502146	SO:0001583	missense	23632			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.644C>T	1.37:g.150235522C>T	ENSP00000358107:p.Ser215Leu	Unknown		x	x	x	148502146	Q5TB24|Q8NCF4	Missense_Mutation	SNP	ENST00000369111.4	37	CCDS947.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.522924	0.96431	0.0	1.16E-4	ENSG00000118298	ENST00000369111	T	0.77877	-1.13	5.65	5.65	0.86999	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.92619	0.7655	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94537	0.7741	10	0.87932	D	0	.	17.2626	0.87075	0.0:1.0:0.0:0.0	.	215	Q9ULX7	CAH14_HUMAN	L	215	ENSP00000358107:S215L	ENSP00000358107:S215L	S	+	2	0	CA14	148502146	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.081000	0.76844	2.941000	0.99782	0.655000	0.94253	TCG		0.522	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035064.2	NM_012113		Missense_Mutation
BRINP3	339479	broad.mit.edu	37	1	190234068	190234068	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr1:190234068G>A	ENST00000367462.3	-	4	776	c.545C>T	c.(544-546)gCt>gTt	p.A182V	BRINP3_ENST00000534846.1_Missense_Mutation_p.A80V|RP11-547I7.1_ENST00000452178.1_RNA	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	182	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.A182V(1)									GAAATAAGAAGCGGCTAGCTG	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											135.0	124.0	128.0					1																	190234068		2203	4300	6503	188500691	SO:0001583	missense	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.545C>T	1.37:g.190234068G>A	ENSP00000356432:p.Ala182Val	Unknown		x	x	x	188500691	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988811	0.74589	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.23147	2.16;1.92	5.75	5.75	0.90469	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.52158	0.1717	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.69078	0.996;0.997	D;D	0.79108	0.986;0.992	T	0.52200	-0.8607	10	0.87932	D	0	.	17.4435	0.87572	0.0:0.0:1.0:0.0	.	80;182	B7Z260;Q76B58	.;FAM5C_HUMAN	V	182;80	ENSP00000356432:A182V;ENSP00000438022:A80V	ENSP00000356432:A182V	A	-	2	0	FAM5C	188500691	1.000000	0.71417	0.308000	0.25141	0.242000	0.25591	9.275000	0.95738	2.721000	0.93114	0.585000	0.79938	GCT		0.448	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		Missense_Mutation
GGPS1	9453	broad.mit.edu	37	1	235498582	235498582	+	Start_Codon_SNP	SNP	G	G	C			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr1:235498582G>C	ENST00000282841.5	+	2	235	c.3G>C	c.(1-3)atG>atC	p.M1I	GGPS1_ENST00000476121.1_Start_Codon_SNP_p.M1I|GGPS1_ENST00000391855.2_Intron|GGPS1_ENST00000488594.1_Start_Codon_SNP_p.M1I|GGPS1_ENST00000358966.2_Start_Codon_SNP_p.M1I			O95749	GGPPS_HUMAN	geranylgeranyl diphosphate synthase 1	1					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|geranylgeranyl diphosphate biosynthetic process (GO:0033386)|isoprenoid metabolic process (GO:0006720)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	dimethylallyltranstransferase activity (GO:0004161)|farnesyltranstransferase activity (GO:0004311)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)	p.M1I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)		Zoledronate(DB00399)	TAAATCCAATGGAGAAGACTC	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	72.0	71.0					1																	235498582		2203	4300	6503	233565205	SO:0001582	initiator_codon_variant	9453			AB016043	CCDS1604.1	1q43	2010-04-27			ENSG00000152904	ENSG00000152904	2.5.1.1, 2.5.1.10, 2.5.1.29		4249	protein-coding gene	gene with protein product		606982				9741684, 10101267	Standard	NR_036605		Approved	GGPPS1	uc001hwv.3	O95749	OTTHUMG00000037963	ENST00000282841.5:c.3G>C	1.37:g.235498582G>C	ENSP00000282841:p.Met1Ile	Unknown		x	x	x	233565205	A8MVQ8|Q5T2C8|Q6NW19	Missense_Mutation	SNP	ENST00000282841.5	37	CCDS1604.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213111	0.58452	.	.	ENSG00000152904	ENST00000488594;ENST00000471812;ENST00000358966;ENST00000282841;ENST00000476121;ENST00000497327	T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	5.8	5.8	0.92144	.	0.200603	0.56097	D	0.000035	T	0.74160	0.3680	.	.	.	0.80722	D	1	B	0.30211	0.273	B	0.42214	0.38	T	0.66909	-0.5804	9	0.17832	T	0.49	-17.2661	18.8273	0.92123	0.0:0.0:1.0:0.0	.	1	O95749	GGPPS_HUMAN	I	1	ENSP00000418690:M1I;ENSP00000417772:M1I;ENSP00000351852:M1I;ENSP00000282841:M1I;ENSP00000420183:M1I;ENSP00000417865:M1I	ENSP00000282841:M1I	M	+	3	0	GGPS1	233565205	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	6.929000	0.75852	2.744000	0.94065	0.544000	0.68410	ATG		0.333	GGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092656.1	NM_004837	Missense_Mutation	Missense_Mutation
MYO3A	53904	broad.mit.edu	37	10	26286098	26286098	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr10:26286098A>T	ENST00000265944.5	+	6	585	c.419A>T	c.(418-420)cAt>cTt	p.H140L	MYO3A_ENST00000543632.1_Missense_Mutation_p.H140L|MYO3A_ENST00000376302.1_Missense_Mutation_p.H140L|MYO3A_ENST00000376301.1_Missense_Mutation_p.H140L	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.H140L(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GGACTTCAACATTTGCATAAC	0.318																																																1	Substitution - Missense(1)	ovary(1)	10											78.0	74.0	75.0					10																	26286098		2203	4297	6500	26326104	SO:0001583	missense	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.419A>T	10.37:g.26286098A>T	ENSP00000265944:p.His140Leu	Unknown		x	x	x	26326104	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	24.6	4.550733	0.86127	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632;ENST00000376301	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.044050	0.85682	D	0.000000	T	0.73659	0.3615	L	0.48218	1.51	0.80722	D	1	D;D;D;P	0.56287	0.96;0.968;0.975;0.843	B;P;P;P	0.58620	0.415;0.55;0.842;0.551	T	0.75357	-0.3346	10	0.54805	T	0.06	.	15.416	0.74970	1.0:0.0:0.0:0.0	.	140;140;140;140	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	L	140	ENSP00000265944:H140L;ENSP00000365479:H140L;ENSP00000445909:H140L;ENSP00000365478:H140L	ENSP00000265944:H140L	H	+	2	0	MYO3A	26326104	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	8.948000	0.93006	2.178000	0.69098	0.482000	0.46254	CAT		0.318	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		Missense_Mutation
RPS24	6229	broad.mit.edu	37	10	79795312	79795312	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr10:79795312C>G	ENST00000372360.3	+	3	150	c.113C>G	c.(112-114)aCa>aGa	p.T38R	RPS24_ENST00000360830.4_Missense_Mutation_p.T38R|RPS24_ENST00000440692.1_Missense_Mutation_p.T38R|RPS24_ENST00000476545.1_3'UTR|RPS24_ENST00000435275.1_Missense_Mutation_p.T38R	NM_001026.4	NP_001017.1	P62847	RS24_HUMAN	ribosomal protein S24	38					cellular protein metabolic process (GO:0044267)|erythrocyte homeostasis (GO:0034101)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)|translation initiation factor binding (GO:0031369)	p.T38R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(2)|skin(1)	5	all_cancers(46;0.0343)|all_epithelial(25;0.000959)|Breast(12;0.00113)|Prostate(51;0.0095)		Epithelial(14;0.00128)|OV - Ovarian serous cystadenocarcinoma(4;0.00248)|all cancers(16;0.00428)			GTGCCTAAGACAGAAATTCGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											64.0	63.0	63.0					10																	79795312		2203	4300	6503	79465318	SO:0001583	missense	6229			AB007159	CCDS7355.1, CCDS7356.1, CCDS44443.1	10q22	2011-04-06			ENSG00000138326	ENSG00000138326		"""S ribosomal proteins"""	10411	protein-coding gene	gene with protein product		602412				9027498, 9582194	Standard	NM_001142283		Approved	S24	uc001jzs.3	P62847	OTTHUMG00000018549	ENST00000372360.3:c.113C>G	10.37:g.79795312C>G	ENSP00000361435:p.Thr38Arg	Unknown		x	x	x	79465318	E7EPK6|P16632|Q5T0P7|Q5T0P8|Q7Z3D1	Missense_Mutation	SNP	ENST00000372360.3	37	CCDS7355.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611922	0.87258	.	.	ENSG00000138326	ENST00000440692;ENST00000435275;ENST00000372360;ENST00000401656;ENST00000360830	.	.	.	5.07	5.07	0.68467	Ribosomal protein L23/L15e (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.84750	0.5541	M	0.89030	3	0.80722	D	1	D;D;D;D	0.63880	0.981;0.993;0.992;0.992	D;D;D;D	0.72625	0.929;0.978;0.958;0.958	D	0.87293	0.2300	8	.	.	.	.	18.4677	0.90761	0.0:1.0:0.0:0.0	.	38;38;38;38	P62847-3;E7EPK6;P62847;E7ETK0	.;.;RS24_HUMAN;.	R	38	.	.	T	+	2	0	RPS24	79465318	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	5.993000	0.70616	2.337000	0.79520	0.609000	0.83330	ACA		0.408	RPS24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048910.1	NM_001026		Missense_Mutation
OR10AG1	282770	broad.mit.edu	37	11	55735772	55735772	+	Silent	SNP	A	A	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr11:55735772A>G	ENST00000312345.2	-	1	218	c.168T>C	c.(166-168)aaT>aaC	p.N56N		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N56N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					AAAGGGAAAAATTGCTAAGAA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	11											56.0	64.0	62.0					11																	55735772		2200	4296	6496	55492348	SO:0001819	synonymous_variant	282770			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.168T>C	11.37:g.55735772A>G		Unknown		x	x	x	55492348	B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	CCDS31514.1	SNP	4	Broad																																																																																				0.343	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		Silent
SLCO2B1	11309	broad.mit.edu	37	11	74880279	74880279	+	Silent	SNP	G	G	C	rs376609135		TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr11:74880279G>C	ENST00000289575.5	+	5	905	c.510G>C	c.(508-510)tcG>tcC	p.S170S	SLCO2B1_ENST00000532236.1_Silent_p.S54S|SLCO2B1_ENST00000341411.4_Intron|SLCO2B1_ENST00000526660.1_Intron|SLCO2B1_ENST00000428359.2_Silent_p.S148S|SLCO2B1_ENST00000525650.1_Silent_p.S26S|SLCO2B1_ENST00000454962.2_Intron|SLCO2B1_ENST00000531756.1_Intron	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	170					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.S170S(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CCCCAGCCTCGGCCCCCTCCA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	11											53.0	54.0	54.0					11																	74880279		2200	4293	6493	74557927	SO:0001819	synonymous_variant	11309			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.510G>C	11.37:g.74880279G>C		Unknown		x	x	x	74557927	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Silent	SNP	ENST00000289575.5	37	CCDS8235.1	SNP	39	Broad																																																																																				0.557	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256		Silent
FMNL3	91010	broad.mit.edu	37	12	50045938	50045938	+	Missense_Mutation	SNP	T	T	C	rs559972863	byFrequency	TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr12:50045938T>C	ENST00000293590.5	-	14	1614	c.1381A>G	c.(1381-1383)Aag>Gag	p.K461E	FMNL3_ENST00000335154.5_Missense_Mutation_p.K461E|FMNL3_ENST00000352151.5_Missense_Mutation_p.K410E|FMNL3_ENST00000550488.1_Missense_Mutation_p.K461E			Q8IVF7	FMNL3_HUMAN	formin-like 3	461	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)	p.K461E(1)		breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						GCCTCCTCCTTCTCTTTAATG	0.572													T|||	3	0.000599042	0.0	0.0014	5008	,	,		18461	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	12											22.0	26.0	25.0					12																	50045938		2019	4171	6190	48332205	SO:0001583	missense	91010			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.1381A>G	12.37:g.50045938T>C	ENSP00000293590:p.Lys461Glu	Unknown		x	x	x	48332205	B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	ENST00000293590.5	37		SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	24.6	4.547320	0.86022	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	T;T;T;T	0.09255	3.0;3.0;3.0;3.0	5.36	5.36	0.76844	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.270316	0.37530	N	0.002050	T	0.24928	0.0605	L	0.58428	1.81	0.80722	D	1	D;D;D	0.71674	0.996;0.979;0.998	D;P;D	0.76071	0.987;0.789;0.972	T	0.06481	-1.0824	10	0.07175	T	0.84	.	14.6471	0.68769	0.0:0.0:0.0:1.0	.	410;461;461	Q8IVF7-2;Q8IVF7-3;Q8IVF7	.;.;FMNL3_HUMAN	E	461;461;410;461	ENSP00000335655:K461E;ENSP00000447479:K461E;ENSP00000344311:K410E;ENSP00000293590:K461E	ENSP00000293590:K461E	K	-	1	0	FMNL3	48332205	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	5.781000	0.68964	2.171000	0.68590	0.459000	0.35465	AAG		0.572	FMNL3-201	KNOWN	basic	protein_coding	protein_coding		NM_175736		Missense_Mutation
STAT6	6778	broad.mit.edu	37	12	57502029	57502029	+	Silent	SNP	G	G	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr12:57502029G>A	ENST00000300134.3	-	2	358	c.33C>T	c.(31-33)ccC>ccT	p.P11P	STAT6_ENST00000556155.1_Silent_p.P11P|STAT6_ENST00000538913.2_Intron|STAT6_ENST00000543873.2_Silent_p.P11P|STAT6_ENST00000537215.2_Intron|STAT6_ENST00000454075.3_Silent_p.P11P	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	11					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.P11P(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						CTTTTTCTGGGGGCATCTTGG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	12											45.0	40.0	41.0					12																	57502029		2203	4300	6503	55788296	SO:0001819	synonymous_variant	6778			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.33C>T	12.37:g.57502029G>A		Unknown		x	x	x	55788296	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Silent	SNP	ENST00000300134.3	37	CCDS8931.1	SNP	43	Broad																																																																																				0.572	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153		Silent
FAM222A	84915	broad.mit.edu	37	12	110206355	110206355	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr12:110206355C>G	ENST00000538780.1	+	3	1337	c.621C>G	c.(619-621)aaC>aaG	p.N207K	FAM222A-AS1_ENST00000541460.1_RNA|FAM222A-AS1_ENST00000541723.1_RNA|FAM222A_ENST00000358906.3_Missense_Mutation_p.N207K	NM_032829.2	NP_116218.2	Q5U5X8	F222A_HUMAN	family with sequence similarity 222, member A	207	Pro-rich.							p.N207K(1)									ACCAGCTCAACCAGCAGTGCC	0.721																																																1	Substitution - Missense(1)	ovary(1)	12											23.0	25.0	25.0					12																	110206355		2142	4230	6372	108690738	SO:0001583	missense	84915			AK027627	CCDS9133.1	12q24.11	2012-04-27	2012-04-27	2012-04-27	ENSG00000139438	ENSG00000139438			25915	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 34"""	C12orf34		12477932	Standard	NM_032829		Approved	FLJ14721	uc001tpd.2	Q5U5X8	OTTHUMG00000169260	ENST00000538780.1:c.621C>G	12.37:g.110206355C>G	ENSP00000443292:p.Asn207Lys	Unknown		x	x	x	108690738	Q8NCD5|Q96SP6	Missense_Mutation	SNP	ENST00000538780.1	37	CCDS9133.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.95	2.689827	0.48097	.	.	ENSG00000139438	ENST00000538780;ENST00000358906	T;T	0.36699	1.24;1.24	3.96	3.96	0.45880	.	0.048659	0.85682	D	0.000000	T	0.37839	0.1018	M	0.71581	2.175	0.58432	D	0.999998	B	0.29301	0.241	B	0.30316	0.114	T	0.42666	-0.9438	10	0.66056	D	0.02	-24.2703	10.9145	0.47129	0.0:0.9037:0.0:0.0963	.	207	Q5U5X8	CL034_HUMAN	K	207	ENSP00000443292:N207K;ENSP00000351783:N207K	ENSP00000351783:N207K	N	+	3	2	C12orf34	108690738	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.857000	0.55972	2.044000	0.60594	0.491000	0.48974	AAC		0.721	FAM222A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403175.1	NM_032829		Missense_Mutation
CDK8	1024	broad.mit.edu	37	13	26956987	26956987	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr13:26956987G>C	ENST00000381527.3	+	5	996	c.493G>C	c.(493-495)Gag>Cag	p.E165Q	CDK8_ENST00000536792.1_Intron	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.E165Q(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TGAAGGTCCTGAGCGAGGAAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	13											107.0	111.0	110.0					13																	26956987		2203	4300	6503	25854987	SO:0001583	missense	1024			X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.493G>C	13.37:g.26956987G>C	ENSP00000370938:p.Glu165Gln	Unknown		x	x	x	25854987	Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	CCDS9317.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849125	0.91277	.	.	ENSG00000132964	ENST00000381527	T	0.66460	-0.21	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75466	0.3853	L	0.28400	0.85	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.72625	0.962;0.978	T	0.76124	-0.3074	10	0.66056	D	0.02	-16.3225	20.5827	0.99408	0.0:0.0:1.0:0.0	.	165;165	P49336-2;P49336	.;CDK8_HUMAN	Q	165	ENSP00000370938:E165Q	ENSP00000370938:E165Q	E	+	1	0	CDK8	25854987	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.142000	0.94618	2.941000	0.99782	0.655000	0.94253	GAG		0.323	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1			Missense_Mutation
RCBTB1	55213	broad.mit.edu	37	13	50115925	50115925	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr13:50115925T>G	ENST00000378302.2	-	11	1471	c.1211A>C	c.(1210-1212)aAt>aCt	p.N404T	RCBTB1_ENST00000471984.1_5'Flank|RCBTB1_ENST00000258646.3_Missense_Mutation_p.N404T	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	404	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.N404T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		CATGTCTTCATTCCAATACGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	13											123.0	97.0	106.0					13																	50115925		2203	4300	6503	49013926	SO:0001583	missense	55213			AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1211A>C	13.37:g.50115925T>G	ENSP00000367552:p.Asn404Thr	Unknown		x	x	x	49013926	Q8IY29|Q969U9	Missense_Mutation	SNP	ENST00000378302.2	37	CCDS9418.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	12.44	1.938873	0.34189	.	.	ENSG00000136144	ENST00000258646;ENST00000378302	T;T	0.67171	-0.25;-0.25	5.68	5.68	0.88126	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.129174	0.64402	D	0.000001	T	0.50188	0.1601	N	0.16833	0.445	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.46693	-0.9173	10	0.12430	T	0.62	-12.1874	15.9389	0.79739	0.0:0.0:0.0:1.0	.	404	Q8NDN9	RCBT1_HUMAN	T	404	ENSP00000258646:N404T;ENSP00000367552:N404T	ENSP00000258646:N404T	N	-	2	0	RCBTB1	49013926	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	5.915000	0.69973	2.160000	0.67779	0.533000	0.62120	AAT		0.393	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191		Missense_Mutation
AP3S2	10239	broad.mit.edu	37	15	90414753	90414753	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr15:90414753C>T	ENST00000336418.4	-	4	691	c.299G>A	c.(298-300)tGt>tAt	p.C100Y	AP3S2_ENST00000560940.1_Missense_Mutation_p.C100Y|AP3S2_ENST00000558011.1_Missense_Mutation_p.C112Y|C15orf38-AP3S2_ENST00000560224.1_5'UTR|C15orf38-AP3S2_ENST00000398333.3_Missense_Mutation_p.C301Y	NM_005829.4	NP_005820.1	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2 subunit	100					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)	protein transporter activity (GO:0008565)	p.C100Y(1)		NS(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(1)	6	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			ATTTTCGAAACACTTATCCAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	15											85.0	82.0	83.0					15																	90414753		2200	4299	6499	88215757	SO:0001583	missense	10239			X99459	CCDS10357.1	15q26.1	2010-08-13			ENSG00000157823	ENSG00000157823			571	protein-coding gene	gene with protein product		602416				9118953	Standard	NM_005829		Approved	sigma3b		P59780	OTTHUMG00000149811	ENST00000336418.4:c.299G>A	15.37:g.90414753C>T	ENSP00000338777:p.Cys100Tyr	Unknown		x	x	x	88215757	B2R677|B4DGQ3|O09077|O09149|Q53H83|Q99589	Missense_Mutation	SNP	ENST00000336418.4	37	CCDS10357.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988951	0.74589	.	.	ENSG00000157823;ENSG00000250021	ENST00000336418;ENST00000398333	T;T	0.39997	1.05;1.08	5.84	5.84	0.93424	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	L	0.35414	1.06	0.38211	D	0.940488	B;D	0.53151	0.425;0.958	B;P	0.55667	0.18;0.781	T	0.20140	-1.0284	10	0.02654	T	1	-8.545	15.6455	0.77046	0.0:1.0:0.0:0.0	.	301;100	E2QRD5;P59780	.;AP3S2_HUMAN	Y	100;301	ENSP00000338777:C100Y;ENSP00000381377:C301Y	ENSP00000338777:C100Y	C	-	2	0	C15orf38-AP3S2;AP3S2	88215757	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.794000	0.69067	2.748000	0.94277	0.650000	0.86243	TGT		0.353	AP3S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313422.1			Missense_Mutation
MYH11	4629	broad.mit.edu	37	16	15841959	15841959	+	Missense_Mutation	SNP	G	G	A	rs567285465		TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr16:15841959G>A	ENST00000300036.5	-	17	2234	c.2125C>T	c.(2125-2127)Cgc>Tgc	p.R709C	MYH11_ENST00000396324.3_Missense_Mutation_p.R716C|MYH11_ENST00000576790.2_Missense_Mutation_p.R709C|MYH11_ENST00000452625.2_Missense_Mutation_p.R716C	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	709	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.R709C(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGGCAGATGCGAATGCCTTCC	0.637			T	CBFB	AML								G|||	1	0.000199681	0.0	0.0	5008	,	,		19090	0.0		0.0	False		,,,				2504	0.001						Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	1	Substitution - Missense(1)	ovary(1)	16											72.0	60.0	64.0					16																	15841959		2197	4300	6497	15749460	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2125C>T	16.37:g.15841959G>A	ENSP00000300036:p.Arg709Cys	Unknown		x	x	x	15749460	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267897	0.80469	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	4.94	4.94	0.65067	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.91673	0.7368	H	0.97707	4.06	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	D	0.93794	0.7095	10	0.87932	D	0	.	12.3052	0.54898	0.0:0.0:0.831:0.169	.	716;709;716;709;716	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	C	709;709;716;716;716	ENSP00000300036:R709C;ENSP00000345136:R709C;ENSP00000379616:R716C;ENSP00000407821:R716C	ENSP00000300036:R709C	R	-	1	0	MYH11	15749460	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.545000	0.60698	2.285000	0.76669	0.561000	0.74099	CGC		0.637	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		Missense_Mutation
AP1G1	164	broad.mit.edu	37	16	71808378	71808378	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr16:71808378T>G	ENST00000299980.4	-	3	760	c.319A>C	c.(319-321)Atc>Ctc	p.I107L	AP1G1_ENST00000423132.2_Missense_Mutation_p.I107L|AP1G1_ENST00000569748.1_Missense_Mutation_p.I107L|AP1G1_ENST00000393512.3_Missense_Mutation_p.I107L|AP1G1_ENST00000433195.2_Missense_Mutation_p.I130L	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	107					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.I107L(1)		breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TACTTCTTGATACAGTTGGTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	16											147.0	143.0	145.0					16																	71808378		2198	4300	6498	70365879	SO:0001583	missense	164			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.319A>C	16.37:g.71808378T>G	ENSP00000299980:p.Ile107Leu	Unknown		x	x	x	70365879	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	37	CCDS32480.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	9.334	1.061293	0.19987	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000425422;ENST00000450149	T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32	4.72	4.72	0.59763	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.049906	0.85682	D	0.000000	T	0.02156	0.0067	N	0.01122	-1.005	0.58432	D	0.999997	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.13407	0.009;0.007;0.009;0.001	T	0.37596	-0.9699	10	0.02654	T	1	-3.099	14.6404	0.68720	0.0:0.0:0.0:1.0	.	189;107;130;107	B4DS96;O43747;B3KXW5;O43747-2	.;AP1G1_HUMAN;.;.	L	107;107;107;130;189;107	ENSP00000299980:I107L;ENSP00000377148:I107L;ENSP00000409153:I107L;ENSP00000403259:I130L;ENSP00000405836:I107L	ENSP00000299980:I107L	I	-	1	0	AP1G1	70365879	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.686000	0.84128	1.915000	0.55452	0.467000	0.42956	ATC		0.373	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1			Missense_Mutation
FOXC2	2303	broad.mit.edu	37	16	86601400	86601400	+	Nonsense_Mutation	SNP	C	C	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr16:86601400C>G	ENST00000320354.4	+	1	544	c.459C>G	c.(457-459)taC>taG	p.Y153*	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	153					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Y153*(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						CGGACTCCTACAACATGTTCG	0.632									Late-onset Hereditary Lymphedema																																							1	Substitution - Nonsense(1)	ovary(1)	16											50.0	61.0	57.0					16																	86601400		2198	4300	6498	85158901	SO:0001587	stop_gained	2303	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.459C>G	16.37:g.86601400C>G	ENSP00000326371:p.Tyr153*	Unknown		x	x	x	85158901	C6KMR9|Q14DA6	Nonsense_Mutation	SNP	ENST00000320354.4	37	CCDS10958.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.056282	0.97241	.	.	ENSG00000176692	ENST00000320354	.	.	.	4.54	3.59	0.41128	.	0.000000	0.50627	U	0.000112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5474	0.50700	0.0:0.91:0.0:0.09	.	.	.	.	X	153	.	ENSP00000326371:Y153X	Y	+	3	2	FOXC2	85158901	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.756000	0.38390	0.905000	0.36596	-0.253000	0.11424	TAC		0.632	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	NM_005251		Nonsense_Mutation
TP53	7157	broad.mit.edu	37	17	7578536	7578536	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr17:7578536T>C	ENST00000269305.4	-	5	583	c.394A>G	c.(394-396)Aag>Gag	p.K132E	TP53_ENST00000420246.2_Missense_Mutation_p.K132E|TP53_ENST00000413465.2_Missense_Mutation_p.K132E|TP53_ENST00000445888.2_Missense_Mutation_p.K132E|TP53_ENST00000359597.4_Missense_Mutation_p.K132E|TP53_ENST00000455263.2_Missense_Mutation_p.K132E|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132E(20)|p.K132Q(13)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.N131del(3)|p.K132*(3)|p.N131fs*27(2)|p.K132fs*38(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.L130fs*16(1)|p.K132W(1)|p.K39E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAAACATCTTGTTGAGGGCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(35)|Deletion - In frame(13)|Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)	breast(11)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(7)|ovary(6)|large_intestine(5)|urinary_tract(5)|lung(5)|bone(4)|upper_aerodigestive_tract(3)|adrenal_gland(2)|stomach(2)|oesophagus(2)|prostate(2)|soft_tissue(1)|cervix(1)|kidney(1)|biliary_tract(1)|pancreas(1)|liver(1)	17	GRCh37	CM086989|CM973641	TP53	M							46.0	47.0	46.0					17																	7578536		2203	4300	6503	7519261	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.394A>G	17.37:g.7578536T>C	ENSP00000269305:p.Lys132Glu	Unknown		x	x	x	7519261	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	25.8	4.670498	0.88348	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.91768	3.24	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.991;0.999;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.992;0.992;0.953;0.98;0.995;0.989;1.0	D	0.96352	0.9259	10	0.87932	D	0	-14.0777	13.8301	0.63375	0.0:0.0:0.0:1.0	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132E;ENSP00000352610:K132E;ENSP00000269305:K132E;ENSP00000398846:K132E;ENSP00000391127:K132E;ENSP00000391478:K132E;ENSP00000423862:K39E;ENSP00000424104:K132E	ENSP00000269305:K132E	K	-	1	0	TP53	7519261	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.993000	0.88291	2.206000	0.71126	0.533000	0.62120	AAG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
GAA	2548	broad.mit.edu	37	17	78081431	78081431	+	Nonsense_Mutation	SNP	T	T	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr17:78081431T>G	ENST00000302262.3	+	4	987	c.768T>G	c.(766-768)taT>taG	p.Y256*	GAA_ENST00000390015.3_Nonsense_Mutation_p.Y256*	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	256					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)	p.Y256*(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	CCTCGCAGTATATCACAGGCC	0.652																																																1	Substitution - Nonsense(1)	ovary(1)	17	GRCh37	CI084281	GAA	I							86.0	83.0	84.0					17																	78081431		2203	4300	6503	75696026	SO:0001587	stop_gained	2548				CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.768T>G	17.37:g.78081431T>G	ENSP00000305692:p.Tyr256*	Unknown		x	x	x	75696026	Q09GN4|Q14351|Q16302|Q8IWE7	Nonsense_Mutation	SNP	ENST00000302262.3	37	CCDS32760.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071127	0.55646	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	.	.	.	5.08	1.65	0.23941	.	0.843593	0.11048	N	0.605328	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3324	9.3183	0.37948	0.0:0.6664:0.0:0.3336	.	.	.	.	X	256	.	ENSP00000305692:Y256X	Y	+	3	2	GAA	75696026	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.465000	0.06680	0.170000	0.19704	-0.119000	0.15052	TAT		0.652	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1			Nonsense_Mutation
MYO5B	4645	broad.mit.edu	37	18	47432877	47432877	+	Missense_Mutation	SNP	G	G	A	rs201966606		TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr18:47432877G>A	ENST00000285039.7	-	19	2625	c.2326C>T	c.(2326-2328)Cgg>Tgg	p.R776W		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	776	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.R776W(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGCCATCCCCGGACAGTTTTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	18											63.0	66.0	65.0					18																	47432877		1959	4140	6099	45686875	SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2326C>T	18.37:g.47432877G>A	ENSP00000285039:p.Arg776Trp	Unknown		x	x	x	45686875	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130912	0.77549	.	.	ENSG00000167306	ENST00000285039	D	0.97430	-4.38	5.42	3.5	0.40072	.	0.000000	0.85682	D	0.000000	D	0.99070	0.9681	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98847	1.0757	10	0.87932	D	0	.	13.9952	0.64392	0.0:0.0:0.6158:0.3842	.	776	Q9ULV0	MYO5B_HUMAN	W	776	ENSP00000285039:R776W	ENSP00000285039:R776W	R	-	1	2	MYO5B	45686875	1.000000	0.71417	0.993000	0.49108	0.966000	0.64601	2.708000	0.47152	1.452000	0.47756	0.655000	0.94253	CGG		0.592	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			Missense_Mutation
MAP1S	55201	broad.mit.edu	37	19	17845155	17845155	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr19:17845155C>T	ENST00000324096.4	+	7	3249	c.3098C>T	c.(3097-3099)gCg>gTg	p.A1033V	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.A1007V	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	1033	Necessary for association with actin. {ECO:0000250}.|Necessary for interaction with RASSF1 isoform A and isoform C.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.A1033V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CGGCACCAGGCGCTGGGCATC	0.657																																																1	Substitution - Missense(1)	ovary(1)	19											101.0	71.0	81.0					19																	17845155		2203	4300	6503	17706155	SO:0001583	missense	55201			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.3098C>T	19.37:g.17845155C>T	ENSP00000325313:p.Ala1033Val	Unknown		x	x	x	17706155	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310939	0.60414	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.18502	2.21;2.21	4.59	2.06	0.26882	.	0.164825	0.28748	N	0.014277	T	0.18002	0.0432	L	0.44542	1.39	0.26452	N	0.975588	D;P	0.63880	0.993;0.935	P;B	0.49332	0.607;0.288	T	0.05241	-1.0897	10	0.41790	T	0.15	-30.2601	8.2941	0.31976	0.2144:0.6398:0.1457:0.0	.	1007;1033	B4DH53;Q66K74	.;MAP1S_HUMAN	V	1033;1007	ENSP00000325313:A1033V;ENSP00000439243:A1007V	ENSP00000325313:A1033V	A	+	2	0	MAP1S	17706155	1.000000	0.71417	0.778000	0.31720	0.455000	0.32408	4.380000	0.59581	1.018000	0.39521	0.561000	0.74099	GCG		0.657	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174		Missense_Mutation
APOB	338	broad.mit.edu	37	2	21241896	21241896	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr2:21241896A>C	ENST00000233242.1	-	20	3216	c.3089T>G	c.(3088-3090)gTg>gGg	p.V1030G		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1030					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.V1030G(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGTATCCACCAAGGCTCT	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											134.0	124.0	127.0					2																	21241896		2203	4300	6503	21095401	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3089T>G	2.37:g.21241896A>C	ENSP00000233242:p.Val1030Gly	Unknown		x	x	x	21095401	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	22.1	4.241970	0.79912	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01359	4.98	4.3	4.3	0.51218	Lipid transport, open beta-sheet (1);Vitellinogen, open beta-sheet, subdomain 2 (1);	0.000000	0.46442	D	0.000284	T	0.08133	0.0203	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.02477	-1.1153	10	0.62326	D	0.03	.	14.1463	0.65353	1.0:0.0:0.0:0.0	.	1030	P04114	APOB_HUMAN	G	1030	ENSP00000233242:V1030G	ENSP00000233242:V1030G	V	-	2	0	APOB	21095401	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.652000	0.83633	1.884000	0.54569	0.377000	0.23210	GTG		0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
PLB1	151056	broad.mit.edu	37	2	28801011	28801011	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr2:28801011A>G	ENST00000327757.5	+	22	1515	c.1471A>G	c.(1471-1473)Atg>Gtg	p.M491V	PLB1_ENST00000329020.6_Missense_Mutation_p.M179V|PLB1_ENST00000422425.2_Missense_Mutation_p.M502V	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	491	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.M491V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGTGGACCTGATGAAGAATGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	2											74.0	68.0	70.0					2																	28801011		2203	4300	6503	28654515	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1471A>G	2.37:g.28801011A>G	ENSP00000330442:p.Met491Val	Unknown		x	x	x	28654515	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	SNP	12	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.44|19.44	3.827708|3.827708	0.71143|0.71143	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020|ENST00000404858	T;T;T;T|.	0.12039|.	2.72;2.72;2.72;2.72|.	5.63|5.63	4.45|4.45	0.53987|0.53987	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);|.	0.093124|.	0.64402|.	D|.	0.000001|.	T|.	0.76835|.	0.4043|.	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	D;D;P;P|.	0.71674|.	0.997;0.998;0.851;0.852|.	D;D;P;P|.	0.71414|.	0.93;0.973;0.493;0.59|.	T|.	0.78018|.	-0.2368|.	10|.	0.33141|.	T|.	0.24|.	-34.5506|-34.5506	9.7859|9.7859	0.40675|0.40675	0.8463:0.0:0.0:0.1537|0.8463:0.0:0.0:0.1537	.|.	502;491;179;491|.	Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6|.	.;.;.;PLB1_HUMAN|.	V|W	491;502;201;179|500	ENSP00000330442:M491V;ENSP00000416440:M502V;ENSP00000392493:M201V;ENSP00000330729:M179V|.	ENSP00000330442:M491V|.	M|X	+|+	1|3	0|0	PLB1|PLB1	28654515|28654515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.896000|2.896000	0.48656|0.48656	0.918000|0.918000	0.36919|0.36919	0.459000|0.459000	0.35465|0.35465	ATG|TGA		0.577	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			Missense_Mutation
RASGRP3	25780	broad.mit.edu	37	2	33752244	33752244	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr2:33752244A>G	ENST00000403687.3	+	10	1588	c.848A>G	c.(847-849)aAt>aGt	p.N283S	RASGRP3_ENST00000407811.1_Missense_Mutation_p.N283S|RASGRP3_ENST00000402538.3_Missense_Mutation_p.N283S	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	283	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.N283S(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					TCCAACGGCAATTACTGCAAT	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											58.0	55.0	56.0					2																	33752244		1890	4111	6001	33605748	SO:0001583	missense	25780			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.848A>G	2.37:g.33752244A>G	ENSP00000384192:p.Asn283Ser	Unknown		x	x	x	33605748	D6W583|O94931|Q53SD7	Missense_Mutation	SNP	ENST00000403687.3	37	CCDS46256.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638299	0.87760	.	.	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	T;T;T	0.48201	0.82;0.82;0.82	5.74	5.74	0.90152	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.69531	0.3121	M	0.77486	2.375	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.74348	0.983;0.983	T	0.72683	-0.4219	10	0.56958	D	0.05	-21.5936	16.0546	0.80788	1.0:0.0:0.0:0.0	.	283;283	D6W583;Q8IV61	.;GRP3_HUMAN	S	283	ENSP00000385886:N283S;ENSP00000384192:N283S;ENSP00000383917:N283S	ENSP00000385886:N283S	N	+	2	0	RASGRP3	33605748	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.339000	0.96797	2.191000	0.70037	0.528000	0.53228	AAT		0.473	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376		Missense_Mutation
KRTAP19-4	337971	broad.mit.edu	37	21	31869187	31869187	+	Nonsense_Mutation	SNP	A	A	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr21:31869187A>T	ENST00000334058.2	-	1	264	c.242T>A	c.(241-243)tTa>tAa	p.L81*		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	81						intermediate filament (GO:0005882)		p.L81*(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ATATTTGGTTAAATTGAATGA	0.358																																																1	Substitution - Nonsense(1)	ovary(1)	21											172.0	170.0	171.0					21																	31869187		2203	4300	6503	30791058	SO:0001587	stop_gained	337971			AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.242T>A	21.37:g.31869187A>T	ENSP00000335567:p.Leu81*	Unknown		x	x	x	30791058	Q17RT4|Q17RT6	Nonsense_Mutation	SNP	ENST00000334058.2	37	CCDS33534.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	8.994	0.978498	0.18812	.	.	ENSG00000186967	ENST00000334058	.	.	.	3.97	-1.9	0.07665	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.7458	0.40446	0.3084:0.0:0.6916:0.0	.	.	.	.	X	81	.	ENSP00000335567:L81X	L	-	2	0	KRTAP19-4	30791058	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.026000	0.12392	-0.323000	0.08602	-0.353000	0.07706	TTA		0.358	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128219.2			Nonsense_Mutation
TTLL8	164714	broad.mit.edu	37	22	50470487	50470487	+	Silent	SNP	C	C	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr22:50470487C>A	ENST00000266182.6	-	11	1334	c.1335G>T	c.(1333-1335)gtG>gtT	p.V445V	TTLL8_ENST00000440475.1_Silent_p.V425V			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	461	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.V445V(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		GGCTGCGGCCCACATCATTCT	0.672																																																1	Substitution - coding silent(1)	ovary(1)	22											57.0	65.0	62.0					22																	50470487		2112	4223	6335	48812614	SO:0001819	synonymous_variant	164714					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.1335G>T	22.37:g.50470487C>A		Unknown		x	x	x	48812614	B5MDV0	Silent	SNP	ENST00000266182.6	37		SNP	21	Broad																																																																																				0.672	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001080447		Silent
CHDH	55349	broad.mit.edu	37	3	53852119	53852119	+	Silent	SNP	G	G	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr3:53852119G>A	ENST00000315251.6	-	9	1907	c.1470C>T	c.(1468-1470)agC>agT	p.S490S		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	490					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)	p.S490S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ACTGAATGTGGCTTCCTGGCT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	3											89.0	84.0	86.0					3																	53852119		2203	4300	6503	53827159	SO:0001819	synonymous_variant	55349			AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1470C>T	3.37:g.53852119G>A		Unknown		x	x	x	53827159	Q9NY17	Silent	SNP	ENST00000315251.6	37	CCDS2873.1	SNP	42	Broad																																																																																				0.542	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397		Silent
H1FX	8971	broad.mit.edu	37	3	129034682	129034682	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr3:129034682T>G	ENST00000333762.4	-	1	438	c.64A>C	c.(64-66)Acc>Ccc	p.T22P	H1FX-AS1_ENST00000383461.2_RNA|H1FX-AS1_ENST00000502789.2_RNA|H1FX-AS1_ENST00000537780.1_RNA|H1FX-AS1_ENST00000433902.2_RNA|H1FX-AS1_ENST00000511998.1_RNA	NM_006026.3	NP_006017.1	Q92522	H1X_HUMAN	H1 histone family, member X	22					nucleosome assembly (GO:0006334)	nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.T22P(1)		kidney(1)|ovary(1)|urinary_tract(2)	4						CCAGCCTTGGTCACCTTCTTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											16.0	13.0	14.0					3																	129034682		2202	4295	6497	130517372	SO:0001583	missense	8971			D64142	CCDS3057.1	3q21.3	2011-08-16			ENSG00000184897	ENSG00000184897		"""Histones / Replication-independent"""	4722	protein-coding gene	gene with protein product		602785				8964515, 9439656	Standard	NM_006026		Approved	MGC15959, MGC8350, H1X	uc003elx.3	Q92522	OTTHUMG00000159450	ENST00000333762.4:c.64A>C	3.37:g.129034682T>G	ENSP00000329662:p.Thr22Pro	Unknown		x	x	x	130517372		Missense_Mutation	SNP	ENST00000333762.4	37	CCDS3057.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	3.717	-0.058290	0.07317	.	.	ENSG00000184897	ENST00000333762	T	0.10192	2.9	3.21	0.874	0.19124	.	6.596590	0.03001	U	0.148169	T	0.06690	0.0171	N	0.14661	0.345	0.22842	N	0.998662	B	0.15473	0.013	B	0.15484	0.013	T	0.33445	-0.9868	10	0.27082	T	0.32	-4.6127	2.7292	0.05222	0.2096:0.4705:0.0:0.3199	.	22	Q92522	H1X_HUMAN	P	22	ENSP00000329662:T22P	ENSP00000329662:T22P	T	-	1	0	H1FX	130517372	0.973000	0.33851	0.019000	0.16419	0.004000	0.04260	1.595000	0.36708	-0.299000	0.08909	-0.732000	0.03574	ACC		0.627	H1FX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355455.2	NM_006026		Missense_Mutation
UGT2A1	10941	broad.mit.edu	37	4	70512978	70512978	+	Missense_Mutation	SNP	C	C	A	rs151326445	byFrequency	TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr4:70512978C>A	ENST00000503640.1	-	1	440	c.385G>T	c.(385-387)Gtt>Ttt	p.V129F	UGT2A1_ENST00000512704.1_Missense_Mutation_p.V129F|UGT2A1_ENST00000514019.1_Missense_Mutation_p.V129F|UGT2A1_ENST00000286604.4_Missense_Mutation_p.V129F	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	129					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.V129F(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TTTTTAAGAACGCCATCACAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	4											108.0	103.0	105.0					4																	70512978		2203	4299	6502	70547567	SO:0001583	missense	10941			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.385G>T	4.37:g.70512978C>A	ENSP00000424478:p.Val129Phe	Unknown		x	x	x	70547567	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	37	CCDS3529.1	SNP	19	Broad	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	13.49	2.253796	0.39896	.	.	ENSG00000173610	ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604;ENST00000505512	T;T;T;T;T	0.64260	-0.09;0.09;-0.09;-0.09;-0.09	5.78	5.78	0.91487	.	0.065079	0.64402	D	0.000013	T	0.75191	0.3816	L	0.51422	1.61	.	.	.	D;D;D;D	0.89917	1.0;0.979;0.994;0.993	D;P;D;D	0.80764	0.994;0.771;0.961;0.929	T	0.74636	-0.3599	9	0.52906	T	0.07	.	17.4952	0.87715	0.0:1.0:0.0:0.0	.	129;129;129;129	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1	.;.;.;UD2A1_HUMAN	F	129	ENSP00000424478:V129F;ENSP00000421432:V129F;ENSP00000425497:V129F;ENSP00000286604:V129F;ENSP00000427709:V129F	ENSP00000286604:V129F	V	-	1	0	UGT2A1	70547567	0.993000	0.37304	0.998000	0.56505	0.551000	0.35334	2.540000	0.45727	2.744000	0.94065	0.591000	0.81541	GTT		0.418	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798		Missense_Mutation
GUCY1B3	2983	broad.mit.edu	37	4	156723554	156723554	+	Silent	SNP	G	G	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr4:156723554G>A	ENST00000264424.8	+	10	1318	c.1236G>A	c.(1234-1236)gtG>gtA	p.V412V	GUCY1B3_ENST00000505154.1_Silent_p.V344V|GUCY1B3_ENST00000502959.1_Silent_p.V434V|GUCY1B3_ENST00000505764.1_Silent_p.V392V|GUCY1B3_ENST00000507146.1_Silent_p.V387V|GUCY1B3_ENST00000513437.1_Silent_p.V344V|GUCY1B3_ENST00000503520.1_Intron	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	412					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.V412V(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		AGCGTCCAGTGCCTGCCAAAA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	4											115.0	112.0	113.0					4																	156723554		2054	4216	6270	156943004	SO:0001819	synonymous_variant	2983			AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.1236G>A	4.37:g.156723554G>A		Unknown		x	x	x	156943004	B7Z426|Q86WY5	Silent	SNP	ENST00000264424.8	37	CCDS47154.1	SNP	46	Broad																																																																																				0.483	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2			Silent
GRIA2	2891	broad.mit.edu	37	4	158254480	158254480	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr4:158254480A>T	ENST00000264426.9	+	8	1409	c.1130A>T	c.(1129-1131)gAg>gTg	p.E377V	GRIA2_ENST00000296526.7_Missense_Mutation_p.E377V|GRIA2_ENST00000393815.2_Missense_Mutation_p.E330V|GRIA2_ENST00000507898.1_Missense_Mutation_p.E330V|GRIA2_ENST00000449365.1_Missense_Mutation_p.E330V	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	377					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.E377V(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AACATCATGGAGCTCAAAACT	0.398																																																1	Substitution - Missense(1)	ovary(1)	4											42.0	45.0	44.0					4																	158254480		2200	4294	6494	158473930	SO:0001583	missense	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1130A>T	4.37:g.158254480A>T	ENSP00000264426:p.Glu377Val	Unknown		x	x	x	158473930	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702528	0.88924	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.42	5.42	0.78866	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90923	0.7147	M	0.78049	2.395	0.80722	D	1	P;D;D	0.89917	0.896;1.0;0.998	P;D;D	0.91635	0.451;0.999;0.995	D	0.92141	0.5720	10	0.87932	D	0	.	15.4581	0.75330	1.0:0.0:0.0:0.0	.	377;377;330	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	V	330;330;377;377;330	ENSP00000426845:E330V;ENSP00000377403:E330V;ENSP00000296526:E377V;ENSP00000264426:E377V;ENSP00000389837:E330V	ENSP00000264426:E377V	E	+	2	0	GRIA2	158473930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.049000	0.60858	0.528000	0.53228	GAG		0.398	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			Missense_Mutation
TRPC7	57113	broad.mit.edu	37	5	135651465	135651465	+	Silent	SNP	G	G	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr5:135651465G>A	ENST00000513104.1	-	3	1065	c.783C>T	c.(781-783)aaC>aaT	p.N261N	TRPC7_ENST00000355180.3_Intron|TRPC7-AS2_ENST00000513958.1_RNA|TRPC7_ENST00000426057.2_Intron	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	261					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.N261N(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCCTGTAATCGTTCTAACAGA	0.483																																																2	Substitution - coding silent(2)	ovary(2)	5											52.0	52.0	52.0					5																	135651465		2052	4212	6264	135679364	SO:0001819	synonymous_variant	57113			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.783C>T	5.37:g.135651465G>A		Unknown		x	x	x	135679364	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Silent	SNP	ENST00000513104.1	37	CCDS47267.2	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684882	0.47991	.	.	ENSG00000069018	ENST00000502753	.	.	.	5.64	-0.625	0.11548	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-31.6411	11.0594	0.47938	0.546:0.0:0.454:0.0	.	.	.	.	X	261	.	.	R	-	1	2	TRPC7	135679364	0.115000	0.22152	0.997000	0.53966	0.997000	0.91878	-0.339000	0.07832	-0.028000	0.13850	0.650000	0.86243	CGA		0.483	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389		Silent
PCDHGA10	56106	broad.mit.edu	37	5	140792858	140792858	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr5:140792858T>G	ENST00000398610.2	+	1	116	c.116T>G	c.(115-117)aTt>aGt	p.I39S	PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	39	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTACTCAATTCCTGAGGAA	0.577											OREG0016862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			5											48.0	56.0	54.0					5																	140792858		1938	4164	6102	140773042	SO:0001583	missense	56106				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.116T>G	5.37:g.140792858T>G	ENSP00000381611:p.Ile39Ser	Unknown	1659	x	x	x	140773042	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	t	14.75	2.627229	0.46944	.	.	ENSG00000253846	ENST00000398610	T	0.36340	1.26	5.49	5.49	0.81192	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.69405	0.3107	H	0.94847	3.59	0.29606	N	0.847322	P;P	0.50443	0.843;0.935	P;P	0.62885	0.625;0.908	T	0.74137	-0.3762	9	0.87932	D	0	.	15.2786	0.73764	0.0:0.0:0.0:1.0	.	39;39	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	S	39	ENSP00000381611:I39S	ENSP00000381611:I39S	I	+	2	0	PCDHGA10	140773042	0.974000	0.33945	0.287000	0.24848	0.224000	0.24922	7.676000	0.84012	2.083000	0.62718	0.377000	0.23210	ATT		0.577	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913		Missense_Mutation
CSF1R	1436	broad.mit.edu	37	5	149460470	149460470	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr5:149460470G>C	ENST00000286301.3	-	3	458	c.167C>G	c.(166-168)cCt>cGt	p.P56R	CSF1R_ENST00000543093.1_Missense_Mutation_p.P56R	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	56	Ig-like C2-type 1.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)	p.P56R(1)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GGTCCAGTGAGGTGATGGGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	5											127.0	89.0	102.0					5																	149460470		2203	4300	6503	149440663	SO:0001583	missense	1436			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.167C>G	5.37:g.149460470G>C	ENSP00000286301:p.Pro56Arg	Unknown		x	x	x	149440663	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	37	CCDS4302.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	2.544	-0.305668	0.05495	.	.	ENSG00000182578	ENST00000286301;ENST00000543093	T;T	0.03004	4.08;4.08	5.46	2.59	0.31030	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.854926	0.09973	N	0.732057	T	0.04003	0.0112	L	0.47016	1.485	0.09310	N	1	B;B;B	0.29037	0.149;0.231;0.005	B;B;B	0.26202	0.053;0.067;0.007	T	0.44406	-0.9330	10	0.27082	T	0.32	.	5.4801	0.16719	0.1776:0.0:0.6593:0.1631	.	56;56;56	B4DG86;B5A955;P07333	.;.;CSF1R_HUMAN	R	56	ENSP00000286301:P56R;ENSP00000445282:P56R	ENSP00000286301:P56R	P	-	2	0	CSF1R	149440663	0.002000	0.14202	0.001000	0.08648	0.051000	0.14879	0.878000	0.28126	0.750000	0.32877	0.655000	0.94253	CCT		0.592	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211		Missense_Mutation
THBS2	7058	broad.mit.edu	37	6	169648689	169648689	+	Silent	SNP	C	C	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr6:169648689C>T	ENST00000366787.3	-	4	681	c.432G>A	c.(430-432)ctG>ctA	p.L144L		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	144	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.L144L(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GCGAGTCAGCCAGGCCGACGT	0.637																																					Esophageal Squamous(91;219 1934 18562 44706)											1	Substitution - coding silent(1)	ovary(1)	6											84.0	66.0	72.0					6																	169648689		2203	4300	6503	169390614	SO:0001819	synonymous_variant	7058				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.432G>A	6.37:g.169648689C>T		Unknown		x	x	x	169390614	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	CCDS34574.1	SNP	21	Broad																																																																																				0.637	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		Silent
DNAH11	8701	broad.mit.edu	37	7	21828945	21828945	+	Silent	SNP	C	C	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr7:21828945C>T	ENST00000409508.3	+	61	10042	c.10011C>T	c.(10009-10011)atC>atT	p.I3337I	DNAH11_ENST00000328843.6_Silent_p.I3344I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3344	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I3344I(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TAGAGGCTATCAGGAAAAAGC	0.468									Kartagener syndrome																																							1	Substitution - coding silent(1)	ovary(1)	7											68.0	66.0	67.0					7																	21828945		1962	4146	6108	21795470	SO:0001819	synonymous_variant	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.10011C>T	7.37:g.21828945C>T		Unknown		x	x	x	21795470	Q9UJ82	Silent	SNP	ENST00000409508.3	37		SNP	29	Broad																																																																																				0.468	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		Silent
DBF4	10926	broad.mit.edu	37	7	87536848	87536848	+	Silent	SNP	C	C	G	rs377207959		TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr7:87536848C>G	ENST00000265728.1	+	12	1899	c.1395C>G	c.(1393-1395)tcC>tcG	p.S465S		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	465					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S465S(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				TTGACATTTCCGAACACACAT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	7											63.0	60.0	61.0					7																	87536848		2203	4300	6503	87374784	SO:0001819	synonymous_variant	10926			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1395C>G	7.37:g.87536848C>G		Unknown		x	x	x	87374784	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Silent	SNP	ENST00000265728.1	37	CCDS5611.1	SNP	23	Broad																																																																																				0.333	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253678.1	NM_006716		Silent
LZTS1	11178	broad.mit.edu	37	8	20110385	20110386	+	Missense_Mutation	DNP	TG	TG	AC			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr8:20110385_20110386TG>AC	ENST00000381569.1	-	3	1413_1414	c.1056_1057CA>GT	c.(1054-1059)ctCAtg>ctGTtg	p.M353L	LZTS1_ENST00000265801.6_Missense_Mutation_p.M353L|LZTS1_ENST00000522290.1_Missense_Mutation_p.M353L			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	353					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M353L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		TGCTCCTTCATGAGGCTCTCGA	0.658																																																1	Substitution - Missense(1)	ovary(1)	8																																								20154666	SO:0001583	missense	11178			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1056_1057delinsAC	8.37:g.20110385_20110386delinsAC	ENSP00000370981:p.Met353Leu	Unknown		x	x	x	20154665	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	DNP	ENST00000381569.1	37	CCDS6015.1	DNP	51	Broad																																																																																				0.658	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		Missense_Mutation
XPO7	23039	broad.mit.edu	37	8	21861441	21861441	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr8:21861441G>C	ENST00000252512.9	+	27	3170	c.3070G>C	c.(3070-3072)Gtg>Ctg	p.V1024L	XPO7_ENST00000434536.1_Missense_Mutation_p.V1033L|XPO7_ENST00000433566.4_Missense_Mutation_p.V1025L	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	1024					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)	p.V1024L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		AAACAGTATTGTGAACAGCCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	65.0	65.0					8																	21861441		1976	4154	6130	21917387	SO:0001583	missense	23039			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.3070G>C	8.37:g.21861441G>C	ENSP00000252512:p.Val1024Leu	Unknown		x	x	x	21917387	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	37	CCDS47818.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099692	0.56183	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.20463	2.07;2.07;2.07	5.21	5.21	0.72293	.	0.059063	0.64402	D	0.000003	T	0.11665	0.0284	N	0.10760	0.04	0.80722	D	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.13202	-1.0518	10	0.09338	T	0.73	-15.3471	17.8982	0.88896	0.0:0.0:1.0:0.0	.	1025;1033;1024	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	L	1033;1024;1025	ENSP00000404853:V1033L;ENSP00000252512:V1024L;ENSP00000410249:V1025L	ENSP00000252512:V1024L	V	+	1	0	XPO7	21917387	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.830000	0.86741	2.601000	0.87937	0.650000	0.86243	GTG		0.502	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024		Missense_Mutation
ACO1	48	broad.mit.edu	37	9	32408612	32408612	+	Missense_Mutation	SNP	G	G	T	rs41304757	byFrequency	TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr9:32408612G>T	ENST00000309951.6	+	4	505	c.367G>T	c.(367-369)Gta>Tta	p.V123L	ACO1_ENST00000379923.1_Missense_Mutation_p.V123L|ACO1_ENST00000541043.1_Missense_Mutation_p.V24L	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	123					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.V123L(1)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TGCTGATCTTGTAATAGATCA	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											148.0	141.0	143.0					9																	32408612		2203	4300	6503	32398612	SO:0001583	missense	48			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.367G>T	9.37:g.32408612G>T	ENSP00000309477:p.Val123Leu	Unknown		x	x	x	32398612	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	37	CCDS6525.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734649	0.69189	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.18960	2.18;2.18;2.18	5.67	5.67	0.87782	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.051830	0.85682	D	0.000000	T	0.52208	0.1720	H	0.98005	4.125	0.80722	D	1	B	0.22003	0.063	B	0.35413	0.202	T	0.63484	-0.6627	10	0.87932	D	0	-10.8756	18.5377	0.91017	0.0:0.0:1.0:0.0	.	123	P21399	ACOC_HUMAN	L	159;123;123;123;24	ENSP00000309477:V123L;ENSP00000369255:V123L;ENSP00000438733:V24L	ENSP00000309477:V123L	V	+	1	0	ACO1	32398612	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	5.660000	0.68018	2.663000	0.90544	0.655000	0.94253	GTA		0.433	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197		Missense_Mutation
VSIG4	11326	broad.mit.edu	37	X	65253606	65253606	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chrX:65253606C>T	ENST00000374737.4	-	2	230	c.122G>A	c.(121-123)tGc>tAc	p.C41Y	VSIG4_ENST00000455586.2_Missense_Mutation_p.C41Y|VSIG4_ENST00000412866.2_Missense_Mutation_p.C41Y	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	41	Ig-like 1.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.C41Y(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTCATAGGTGCAGGGAAGATT	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											120.0	78.0	92.0					X																	65253606		2203	4300	6503	65170331	SO:0001583	missense	11326			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.122G>A	X.37:g.65253606C>T	ENSP00000363869:p.Cys41Tyr	Unknown		x	x	x	65170331	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	CCDS14383.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	7.725	0.698031	0.15106	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866;ENST00000423830	T;T;T;T	0.40476	1.03;1.03;1.03;1.64	4.93	4.93	0.64822	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.65154	0.2664	M	0.81341	2.54	0.43965	D	0.996647	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.998;0.998;1.0	T	0.70375	-0.4889	10	0.87932	D	0	-14.3301	12.5823	0.56397	0.0:1.0:0.0:0.0	.	41;41;31;41;41	C9J1L3;Q9Y279-2;C9JH67;Q9Y279-3;Q9Y279	.;.;.;.;VSIG4_HUMAN	Y	41	ENSP00000363869:C41Y;ENSP00000411581:C41Y;ENSP00000394143:C41Y;ENSP00000414594:C41Y	ENSP00000363869:C41Y	C	-	2	0	VSIG4	65170331	1.000000	0.71417	0.408000	0.26446	0.008000	0.06430	2.087000	0.41653	2.019000	0.59389	0.594000	0.82650	TGC		0.537	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268		Missense_Mutation
PBDC1	51260	broad.mit.edu	37	X	75395316	75395316	+	Silent	SNP	A	A	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chrX:75395316A>T	ENST00000373358.3	+	4	368	c.165A>T	c.(163-165)tcA>tcT	p.S55S	PBDC1_ENST00000373357.3_Silent_p.S55S	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	55								p.S55S(1)									AGCTGATTTCATCAGTTGACC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	X											89.0	77.0	81.0					X																	75395316		2203	4300	6503	75311718	SO:0001819	synonymous_variant	51260			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.165A>T	X.37:g.75395316A>T		Unknown		x	x	x	75311718		Silent	SNP	ENST00000373358.3	37	CCDS14432.1	SNP	8	Broad																																																																																				0.408	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500		Silent
P2RY10	27334	broad.mit.edu	37	X	78216164	78216164	+	Silent	SNP	T	T	A			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chrX:78216164T>A	ENST00000171757.2	+	4	427	c.147T>A	c.(145-147)ctT>ctA	p.L49L	P2RY10_ENST00000475374.1_3'UTR|P2RY10_ENST00000544091.1_Silent_p.L49L	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.L49L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TTCCTGGTCTTCTGGCTAACA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	X											172.0	135.0	147.0					X																	78216164		2203	4300	6503	78102820	SO:0001819	synonymous_variant	27334			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.147T>A	X.37:g.78216164T>A		Unknown		x	x	x	78102820	D3DTE5|Q4VBN7|Q86V16	Silent	SNP	ENST00000171757.2	37	CCDS14442.1	SNP	62	Broad																																																																																				0.433	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			Silent
GAB3	139716	broad.mit.edu	37	X	153924291	153924291	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chrX:153924291A>T	ENST00000369575.3	-	8	1459	c.1428T>A	c.(1426-1428)agT>agA	p.S476R	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Missense_Mutation_p.S477R	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	476					macrophage differentiation (GO:0030225)			p.S476R(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGCTGGTTCGACTGCTAAGAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											47.0	41.0	43.0					X																	153924291		2202	4300	6502	153577485	SO:0001583	missense	139716			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1428T>A	X.37:g.153924291A>T	ENSP00000358588:p.Ser476Arg	Unknown		x	x	x	153577485	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	12.91	2.078644	0.36662	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.18810	2.19;2.19;2.19	5.57	4.21	0.49690	.	0.340366	0.34484	N	0.003940	T	0.15609	0.0376	L	0.38175	1.15	0.27967	N	0.936541	B;B;B	0.23937	0.09;0.094;0.09	B;B;B	0.16722	0.016;0.016;0.016	T	0.09164	-1.0687	10	0.42905	T	0.14	-17.3143	8.7436	0.34571	0.8927:0.0:0.1073:0.0	.	477;477;476	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	R	476;477;477	ENSP00000358588:S476R;ENSP00000358581:S477R;ENSP00000399588:S477R	ENSP00000358581:S477R	S	-	3	2	GAB3	153577485	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.579000	0.53900	1.872000	0.54250	0.486000	0.48141	AGT		0.423	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573		Missense_Mutation
CAMK2B	816	broad.mit.edu	37	7	44286765	44286776	+	In_Frame_Del	DEL	GCCTCCAGGATC	GCCTCCAGGATC	-			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr7:44286765_44286776delGCCTCCAGGATC	ENST00000395749.2	-	6	433_444	c.357_368delGATCCTGGAGGC	c.(355-369)cagatcctggaggcc>cac	p.119_123QILEA>H	CAMK2B_ENST00000440254.2_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000350811.3_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000395747.2_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000353625.4_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000502837.2_5'UTR|CAMK2B_ENST00000358707.3_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000457475.1_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000258682.6_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000347193.4_In_Frame_Del_p.119_123QILEA>H|CAMK2B_ENST00000346990.4_In_Frame_Del_p.119_123QILEA>H	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)	p.Q119_A123>H(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						ATGGAGAACGGCCTCCAGGATCTGCTGGATAC	0.599																																																1	Complex - deletion inframe(1)	ovary(1)	7																																								44253301	SO:0001651	inframe_deletion	816			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.357_368delGATCCTGGAGGC	7.37:g.44286765_44286776delGCCTCCAGGATC	ENSP00000379098:p.Gln119_Ala123delinsHis	Unknown		Capture	Illumina GAIIx	Phase_I	44253290	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	In_Frame_Del	DEL	ENST00000395749.2	37	CCDS5483.1	DEL	42	Broad																																																																																				0.599	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084		In_Frame_Del
OR4F21	441308	broad.mit.edu	37	8	116893	116894	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-61-2000-01	TCGA-61-2000-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2000-01	TCGA-61-2000-11	g.chr8:116893_116894delGA	ENST00000320901.3	-	1	149_150	c.131_132delTC	c.(130-132)ttcfs	p.F44fs		NM_001005504.1	NP_001005504.1	O95013	O4F21_HUMAN	olfactory receptor, family 4, subfamily F, member 21	44				F -> L (in Ref. 1; AAD05195). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						all_cancers(2;8.42e-24)|all_epithelial(2;5.38e-15)|Lung NSC(2;2.68e-06)|all_lung(2;5.05e-06)|Ovarian(12;0.0731)|Colorectal(14;0.0785)|all_hematologic(2;0.157)|Myeloproliferative disorder(644;0.185)|all_neural(12;0.186)|Acute lymphoblastic leukemia(644;0.244)		Epithelial(5;5.01e-18)|all cancers(2;6.06e-17)|OV - Ovarian serous cystadenocarcinoma(5;8.27e-09)|BRCA - Breast invasive adenocarcinoma(11;1.63e-06)|Colorectal(2;5.31e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0649)		AAAACACAATGAAGATGTTTCC	0.47																																																0			8																																								106894	SO:0001589	frameshift_variant	441308				CCDS34792.1	8p23.3	2012-08-09		2004-03-10	ENSG00000176269	ENSG00000176269		"""GPCR / Class A : Olfactory receptors"""	19583	protein-coding gene	gene with protein product				OR4F21P			Standard	NM_001005504		Approved		uc011kwf.2	O95013	OTTHUMG00000163908	ENST00000320901.3:c.131_132delTC	8.37:g.116893_116894delGA	ENSP00000318878:p.Phe44fs	Unknown		Capture	Illumina GAIIx	Phase_I	106893	A6NIU1	Frame_Shift_Del	DEL	ENST00000320901.3	37	CCDS34792.1	DEL	45	Broad																																																																																				0.470	OR4F21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376340.1			Frame_Shift_Del
