#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CASZ1	54897	broad.mit.edu	37	1	10713455	10713455	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr1:10713455G>C	ENST00000377022.3	-	11	2976	c.2659C>G	c.(2659-2661)Ccc>Gcc	p.P887A	CASZ1_ENST00000344008.5_Missense_Mutation_p.P887A|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	887					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P887A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GTGGCAGAGGGCTTGAGGGCA	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											32.0	37.0	35.0					1																	10713455		2202	4299	6501	10636042	SO:0001583	missense	54897			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2659C>G	1.37:g.10713455G>C	ENSP00000366221:p.Pro887Ala	Unknown		x	x	x	10636042	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082662	0.76528	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	3.9	3.9	0.45041	.	0.137485	0.50627	D	0.000110	T	0.59770	0.2218	L	0.29908	0.895	0.46222	D	0.998938	D;P;D	0.61697	0.99;0.925;0.971	P;P;P	0.55087	0.768;0.54;0.572	T	0.66866	-0.5815	9	0.72032	D	0.01	-21.9378	16.7942	0.85597	0.0:0.0:1.0:0.0	.	911;887;887	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	A	887	.	ENSP00000339445:P887A	P	-	1	0	CASZ1	10636042	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.253000	0.95501	2.117000	0.64856	0.563000	0.77884	CCC		0.647	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		Missense_Mutation
ST6GALNAC3	256435	broad.mit.edu	37	1	76877903	76877903	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr1:76877903T>C	ENST00000328299.3	+	3	572	c.424T>C	c.(424-426)Tat>Cat	p.Y142H	ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	142					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.Y142H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						AAACCCTGATTATTTTTTCAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	117.0	117.0					1																	76877903		2203	4300	6503	76650491	SO:0001583	missense	256435				CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.424T>C	1.37:g.76877903T>C	ENSP00000329214:p.Tyr142His	Unknown		x	x	x	76650491	Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	CCDS672.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	11.07	1.530725	0.27387	.	.	ENSG00000184005	ENST00000394994;ENST00000328299;ENST00000394993;ENST00000415813	T	0.28255	1.62	6.17	6.17	0.99709	.	0.122765	0.56097	D	0.000022	T	0.12390	0.0301	N	0.25825	0.765	0.52501	D	0.999956	B;B;P	0.44380	0.087;0.027;0.834	B;B;B	0.41666	0.168;0.082;0.363	T	0.05683	-1.0870	10	0.12430	T	0.62	-24.4319	16.0034	0.80327	0.0:0.0:0.0:1.0	.	77;142;142	B4DM98;Q8NDV1;Q8NDV1-2	.;SIA7C_HUMAN;.	H	142;142;141;76	ENSP00000329214:Y142H	ENSP00000329214:Y142H	Y	+	1	0	ST6GALNAC3	76650491	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.106000	0.41835	2.371000	0.80710	0.533000	0.62120	TAT		0.413	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		Missense_Mutation
SEMA6C	10500	broad.mit.edu	37	1	151110554	151110554	+	Missense_Mutation	SNP	G	G	C	rs376541339		TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr1:151110554G>C	ENST00000341697.3	-	9	2266	c.575C>G	c.(574-576)gCg>gGg	p.A192G				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	192	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A192G(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGGAAATCCGCAGCTGTGGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	56.0	55.0					1																	151110554		2203	4300	6503	149377178	SO:0001583	missense	10500			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.575C>G	1.37:g.151110554G>C	ENSP00000344148:p.Ala192Gly	Unknown		x	x	x	149377178	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	CCDS984.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563915	0.86335	.	.	ENSG00000143434	ENST00000368914;ENST00000368913;ENST00000341697;ENST00000392792	T;T;T	0.12147	2.71;2.71;2.71	4.85	4.85	0.62838	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.289020	0.38217	N	0.001764	T	0.26666	0.0652	M	0.84773	2.715	0.41954	D	0.990675	P;P;P	0.47034	0.889;0.66;0.577	P;B;B	0.54210	0.745;0.23;0.277	T	0.04242	-1.0966	10	0.87932	D	0	.	15.5202	0.75859	0.0:0.0:1.0:0.0	.	192;192;192	B4DZD4;Q9H3T2-3;Q9H3T2	.;.;SEM6C_HUMAN	G	192	ENSP00000357910:A192G;ENSP00000357909:A192G;ENSP00000344148:A192G	ENSP00000344148:A192G	A	-	2	0	SEMA6C	149377178	1.000000	0.71417	0.037000	0.18230	0.943000	0.58893	9.490000	0.97952	2.532000	0.85374	0.561000	0.74099	GCG		0.627	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913		Missense_Mutation
PVRL4	81607	broad.mit.edu	37	1	161047421	161047421	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr1:161047421G>T	ENST00000368012.3	-	3	854	c.552C>A	c.(550-552)gaC>gaA	p.D184E	PVRL4_ENST00000453926.2_5'Flank	NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	184	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D184E(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGACCTCCGTGTCCCAGGTCA	0.632																																					NSCLC(76;1160 1387 14476 16172 29359)											1	Substitution - Missense(1)	ovary(1)	1											55.0	46.0	49.0					1																	161047421		2203	4300	6503	159314045	SO:0001583	missense	81607			AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.552C>A	1.37:g.161047421G>T	ENSP00000356991:p.Asp184Glu	Unknown		x	x	x	159314045	B4DQW3|Q96K15	Missense_Mutation	SNP	ENST00000368012.3	37	CCDS1216.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	8.341	0.828697	0.16749	.	.	ENSG00000143217	ENST00000368012	D	0.86366	-2.11	5.78	4.82	0.62117	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.093569	0.47093	D	0.000249	T	0.52403	0.1732	N	0.03294	-0.36	0.80722	D	1	B	0.28667	0.219	B	0.28849	0.095	T	0.60662	-0.7219	10	0.02654	T	1	.	12.42	0.55514	0.0:0.2828:0.7172:0.0	.	184	Q96NY8	PVRL4_HUMAN	E	184	ENSP00000356991:D184E	ENSP00000356991:D184E	D	-	3	2	PVRL4	159314045	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.803000	0.38863	2.729000	0.93468	0.650000	0.86243	GAC		0.632	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916		Missense_Mutation
LPGAT1	9926	broad.mit.edu	37	1	211956632	211956632	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr1:211956632C>G	ENST00000366997.4	-	5	892	c.666G>C	c.(664-666)ttG>ttC	p.L222F	LPGAT1_ENST00000366996.1_Missense_Mutation_p.L222F	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	222					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)	p.L222F(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		CAAGTGCATTCAAAATAATTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	71.0	71.0					1																	211956632		2203	4300	6503	210023255	SO:0001583	missense	9926			D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.666G>C	1.37:g.211956632C>G	ENSP00000355964:p.Leu222Phe	Unknown		x	x	x	210023255	Q53YL2	Missense_Mutation	SNP	ENST00000366997.4	37	CCDS31018.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369879	0.82573	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	T;T	0.41065	1.01;1.01	5.93	5.93	0.95920	Phospholipid/glycerol acyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	L	0.52573	1.65	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.53892	-0.8374	10	0.38643	T	0.18	-17.068	20.3368	0.98748	0.0:1.0:0.0:0.0	.	222	Q92604	LGAT1_HUMAN	F	222	ENSP00000355964:L222F;ENSP00000355963:L222F	ENSP00000355963:L222F	L	-	3	2	LPGAT1	210023255	1.000000	0.71417	0.631000	0.29282	0.913000	0.54294	5.320000	0.65841	2.805000	0.96524	0.655000	0.94253	TTG		0.383	LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090150.1	NM_014873		Missense_Mutation
HSPA14	51182	broad.mit.edu	37	10	14897850	14897850	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr10:14897850G>C	ENST00000378372.3	+	10	1140	c.901G>C	c.(901-903)Gaa>Caa	p.E301Q		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	301					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.E301Q(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						AGCAAGATTTGAACTTCTTTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	10											69.0	68.0	69.0					10																	14897850		2203	4297	6500	14937856	SO:0001583	missense	51182			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.901G>C	10.37:g.14897850G>C	ENSP00000367623:p.Glu301Gln	Unknown		x	x	x	14937856	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	ENST00000378372.3	37	CCDS7103.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037621	0.75617	.	.	ENSG00000187522	ENST00000378372	T	0.01246	5.11	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.05686	0.0149	M	0.85099	2.735	0.80722	D	1	B	0.22909	0.077	B	0.33620	0.167	T	0.10177	-1.0641	10	0.87932	D	0	-31.0105	19.195	0.93684	0.0:0.0:1.0:0.0	.	301	Q0VDF9	HSP7E_HUMAN	Q	301	ENSP00000367623:E301Q	ENSP00000367623:E301Q	E	+	1	0	HSPA14	14937856	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.590000	0.90821	2.607000	0.88179	0.585000	0.79938	GAA		0.368	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299		Missense_Mutation
TCF7L2	6934	broad.mit.edu	37	10	114905822	114905822	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr10:114905822C>A	ENST00000355995.4	+	8	1348	c.841C>A	c.(841-843)Ccc>Acc	p.P281T	TCF7L2_ENST00000349937.2_Missense_Mutation_p.P277T|TCF7L2_ENST00000369397.4_Missense_Mutation_p.P258T|TCF7L2_ENST00000369389.1_5'UTR|TCF7L2_ENST00000355717.4_Missense_Mutation_p.P305T|TCF7L2_ENST00000538897.1_Missense_Mutation_p.P281T|TCF7L2_ENST00000534894.1_Missense_Mutation_p.P281T|TCF7L2_ENST00000536810.1_Missense_Mutation_p.P281T|TCF7L2_ENST00000369395.1_Missense_Mutation_p.P306T|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000352065.5_Missense_Mutation_p.P258T|TCF7L2_ENST00000543371.1_Missense_Mutation_p.P281T|TCF7L2_ENST00000545257.1_Missense_Mutation_p.P281T			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	281	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P258T(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		ACACCCCTACCCCACAGCTCT	0.512			T	VTI1A	colorectal																																		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	1	Substitution - Missense(1)	ovary(1)	10											199.0	179.0	186.0					10																	114905822		2203	4300	6503	114895812	SO:0001583	missense	6934			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.841C>A	10.37:g.114905822C>A	ENSP00000348274:p.Pro281Thr	Unknown		x	x	x	114895812	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	c	23.4	4.417004	0.83449	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000349937;ENST00000352065;ENST00000369395	D;D;D;D;D;D;D;D;D	0.99567	-5.81;-5.7;-5.74;-5.77;-6.06;-6.18;-6.11;-5.84;-6.09	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.99645	0.9869	M	0.83483	2.645	0.80722	D	1	D;D;D;D;B;D;D;D;P;D;P;D;D;D;D;D;D;D;D	0.89917	0.997;0.999;0.997;0.999;0.402;0.973;0.999;0.999;0.454;0.998;0.768;0.999;0.999;1.0;1.0;1.0;0.992;1.0;1.0	D;D;D;D;B;D;D;D;B;D;B;D;D;D;D;D;D;D;D	0.91635	0.946;0.979;0.971;0.968;0.186;0.909;0.94;0.979;0.17;0.926;0.418;0.986;0.971;0.999;0.999;0.98;0.939;0.991;0.98	D	0.98302	1.0519	10	0.87932	D	0	-6.835	20.1022	0.97879	0.0:1.0:0.0:0.0	.	138;98;175;281;152;196;254;258;258;224;281;258;258;258;305;258;281;254;258	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	T	281;281;281;281;305;281;281;258;277;258;306	ENSP00000348274:P281T;ENSP00000440547:P281T;ENSP00000444972:P281T;ENSP00000446238:P281T;ENSP00000347949:P305T;ENSP00000446172:P281T;ENSP00000443626:P281T;ENSP00000358404:P258T;ENSP00000344823:P258T	ENSP00000298692:P277T	P	+	1	0	TCF7L2	114895812	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.759000	0.94783	0.555000	0.69702	CCC		0.512	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756		Missense_Mutation
CLNS1A	1207	broad.mit.edu	37	11	77340943	77340943	+	Splice_Site	SNP	G	G	A	rs372932790		TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr11:77340943G>A	ENST00000525428.1	-	2	217	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	CLNS1A_ENST00000263309.3_Splice_Site_p.R43C|CLNS1A_ENST00000528364.1_Splice_Site_p.R43C|CLNS1A_ENST00000525064.1_Splice_Site_p.R43C|CLNS1A_ENST00000532069.1_Splice_Site_p.R43C	NM_001293.2	NP_001284.1	P54105	ICLN_HUMAN	chloride channel, nucleotide-sensitive, 1A	43					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.R43C(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	5	all_cancers(14;5.43e-17)|all_epithelial(13;1.78e-19)		Epithelial(5;1.02e-48)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			CAAGACAGGCGGCTGAAAAAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	11						G	CYS/ARG	1,4399	2.1+/-5.4	0,1,2199	71.0	68.0	69.0		127	4.3	1.0	11		69	0,8584		0,0,4292	no	missense-near-splice	CLNS1A	NM_001293.2	180	0,1,6491	AA,AG,GG		0.0,0.0227,0.0077	benign	43/238	77340943	1,12983	2200	4292	6492	77018591	SO:0001630	splice_region_variant	1207			U17899	CCDS8252.1	11q13.5-q14	2008-05-02							2080	protein-coding gene	gene with protein product		602158		CLCI		7887970, 8975725	Standard	NM_001293		Approved	ICln	uc001oyk.3	P54105		ENST00000525428.1:c.126-1C>T	11.37:g.77340943G>A		Unknown		x	x	x	77018591	B2RCS9|Q0VDK6|Q9NRD2|Q9NRD3	Missense_Mutation	SNP	ENST00000525428.1	37	CCDS8252.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265390	0.40095	2.27E-4	0.0	ENSG00000074201	ENST00000525428;ENST00000263309;ENST00000525064;ENST00000532069;ENST00000528364	T;T;T;T;T	0.35236	1.35;1.34;1.32;1.37;1.35	5.19	4.28	0.50868	.	0.110203	0.64402	D	0.000005	T	0.34716	0.0907	L	0.58354	1.805	0.80722	D	1	B;B	0.26081	0.141;0.003	B;B	0.17722	0.019;0.008	T	0.16988	-1.0384	10	0.40728	T	0.16	0.0154	14.0192	0.64543	0.0737:0.0:0.9263:0.0	.	43;43	E9PMI6;P54105	.;ICLN_HUMAN	C	43	ENSP00000433919:R43C;ENSP00000263309:R43C;ENSP00000433741:R43C;ENSP00000434963:R43C;ENSP00000434311:R43C	ENSP00000263309:R43C	R	-	1	0	CLNS1A	77018591	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.098000	0.94202	1.556000	0.49512	-0.157000	0.13467	CGC		0.383	CLNS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382156.2	NM_001293	Missense_Mutation	Missense_Mutation
PKNOX2	63876	broad.mit.edu	37	11	125221240	125221240	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr11:125221240G>C	ENST00000298282.9	+	4	310	c.39G>C	c.(37-39)atG>atC	p.M13I	PKNOX2_ENST00000530517.1_Intron|PKNOX2_ENST00000542175.1_5'UTR	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	13					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.M13I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CTCTGACGATGATGGCCACGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	11											37.0	42.0	40.0					11																	125221240		2092	4221	6313	124726450	SO:0001583	missense	63876			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.39G>C	11.37:g.125221240G>C	ENSP00000298282:p.Met13Ile	Unknown		x	x	x	124726450	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	g	15.93	2.979388	0.53827	.	.	ENSG00000165495	ENST00000298282;ENST00000527238;ENST00000531212;ENST00000535518	T;T	0.71934	-0.61;-0.61	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.69441	0.3111	L	0.43923	1.385	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	T	0.64786	-0.6325	10	0.24483	T	0.36	-12.8146	18.4197	0.90586	0.0:0.0:1.0:0.0	.	13	Q96KN3	PKNX2_HUMAN	I	13;13;13;1	ENSP00000298282:M13I;ENSP00000434255:M13I	ENSP00000298282:M13I	M	+	3	0	PKNOX2	124726450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.755000	0.91646	2.622000	0.88805	0.651000	0.88453	ATG		0.657	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3			Missense_Mutation
A2ML1	144568	broad.mit.edu	37	12	8990969	8990969	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr12:8990969T>A	ENST00000299698.7	+	9	1073	c.893T>A	c.(892-894)aTg>aAg	p.M298K		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CCTGTGGACATGGCCACCTTT	0.463																																																0			12											182.0	171.0	175.0					12																	8990969		1972	4167	6139	8882236	SO:0001583	missense	144568			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.893T>A	12.37:g.8990969T>A	ENSP00000299698:p.Met298Lys	Unknown		x	x	x	8882236		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460190	0.43736	.	.	ENSG00000166535	ENST00000299698;ENST00000539161	T	0.31510	1.49	3.75	3.75	0.43078	.	0.145907	0.33235	N	0.005127	T	0.27933	0.0688	L	0.59436	1.845	0.80722	D	1	B	0.33345	0.409	B	0.31495	0.131	T	0.15178	-1.0446	10	0.59425	D	0.04	.	9.1631	0.37035	0.0:0.0:0.0:1.0	.	298	A8K2U0	A2ML1_HUMAN	K	298	ENSP00000299698:M298K	ENSP00000299698:M298K	M	+	2	0	A2ML1	8882236	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	1.750000	0.38329	1.956000	0.56807	0.528000	0.53228	ATG		0.463	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670		Missense_Mutation
OSBPL8	114882	broad.mit.edu	37	12	76791502	76791502	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr12:76791502G>T	ENST00000261183.3	-	8	1123	c.644C>A	c.(643-645)cCt>cAt	p.P215H	OSBPL8_ENST00000393250.4_Missense_Mutation_p.P173H|OSBPL8_ENST00000393249.2_Missense_Mutation_p.P173H	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	215	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)	p.P215H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						TTGCTCCAAAGGATGGAAAAG	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											109.0	93.0	99.0					12																	76791502		2203	4300	6503	75315633	SO:0001583	missense	114882			AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.644C>A	12.37:g.76791502G>T	ENSP00000261183:p.Pro215His	Unknown		x	x	x	75315633	A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	ENST00000261183.3	37	CCDS31862.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.135674	0.94517	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540;ENST00000546946	T;T;T;T;T	0.75260	-0.92;2.4;-0.92;2.4;-0.92	5.74	5.74	0.90152	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.103332	0.64402	D	0.000002	D	0.86940	0.6054	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	D	0.87469	0.2413	10	0.87932	D	0	-16.1815	19.9326	0.97124	0.0:0.0:1.0:0.0	.	190;215	F8VUA7;Q9BZF1	.;OSBL8_HUMAN	H	173;215;200;173;215;215;190	ENSP00000376939:P173H;ENSP00000261183:P215H;ENSP00000376940:P173H;ENSP00000450238:P215H;ENSP00000447893:P190H	ENSP00000261183:P215H	P	-	2	0	OSBPL8	75315633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.720000	0.93068	0.650000	0.86243	CCT		0.378	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	NM_020841		Missense_Mutation
PLA2G4F	255189	broad.mit.edu	37	15	42442302	42442302	+	Splice_Site	SNP	C	C	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr15:42442302C>G	ENST00000382396.4	-	10	1009	c.923G>C	c.(922-924)aGc>aCc	p.S308T	PLA2G4F_ENST00000397272.3_Splice_Site_p.S308T			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	308	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)	p.S308T(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		TCCCACTCACCTCATTTCCAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											88.0	78.0	82.0					15																	42442302		2203	4299	6502	40229594	SO:0001630	splice_region_variant	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.923+1G>C	15.37:g.42442302C>G		Unknown		x	x	x	40229594	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282512	0.40394	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.01474	4.85;4.89	4.7	4.7	0.59300	Lysophospholipase, catalytic domain (2);	0.273852	0.30639	N	0.009197	T	0.02727	0.0082	L	0.52573	1.65	0.35207	D	0.774804	P;P	0.47106	0.89;0.89	B;B	0.40066	0.318;0.318	T	0.57814	-0.7746	9	.	.	.	-17.49	15.1647	0.72814	0.0:1.0:0.0:0.0	.	95;308	A2RRC4;Q68DD2	.;PA24F_HUMAN	T	304;308;308;308;308	ENSP00000380442:S308T;ENSP00000371833:S308T	.	S	-	2	0	PLA2G4F	40229594	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	4.062000	0.57492	2.329000	0.79093	0.655000	0.94253	AGC		0.592	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	Missense_Mutation	Missense_Mutation
TICRR	90381	broad.mit.edu	37	15	90167994	90167994	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr15:90167994G>C	ENST00000268138.7	+	20	4558	c.4453G>C	c.(4453-4455)Gtg>Ctg	p.V1485L	TICRR_ENST00000560985.1_Missense_Mutation_p.V1484L|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1485					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.V1485L(1)									CGTCTTATCAGTGGAAGAGGG	0.527																																																1	Substitution - Missense(1)	ovary(1)	15											119.0	112.0	115.0					15																	90167994		2200	4299	6499	87968998	SO:0001583	missense	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4453G>C	15.37:g.90167994G>C	ENSP00000268138:p.Val1485Leu	Unknown		x	x	x	87968998	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	5.190	0.220564	0.09863	.	.	ENSG00000140534	ENST00000268138	T	0.08193	3.12	4.54	1.53	0.23141	.	0.523050	0.18549	N	0.137941	T	0.05364	0.0142	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.45687	-0.9244	10	0.08837	T	0.75	-0.0405	4.2804	0.10829	0.4038:0.165:0.4311:0.0	.	1485	Q7Z2Z1	TICRR_HUMAN	L	1485	ENSP00000268138:V1485L	ENSP00000268138:V1485L	V	+	1	0	C15orf42	87968998	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.058000	0.14301	0.101000	0.17610	0.655000	0.94253	GTG		0.527	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259		Missense_Mutation
WDR93	56964	broad.mit.edu	37	15	90276309	90276309	+	Nonsense_Mutation	SNP	C	C	A	rs368092361		TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr15:90276309C>A	ENST00000268130.7	+	13	1504	c.1403C>A	c.(1402-1404)tCg>tAg	p.S468*	WDR93_ENST00000444934.2_Nonsense_Mutation_p.S185*|WDR93_ENST00000560294.1_Intron	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	468					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.S468*(1)		NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			AAATATTTCTCGGTCCACAAA	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	15											98.0	106.0	103.0					15																	90276309		2200	4299	6499	88077313	SO:0001587	stop_gained	56964				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1403C>A	15.37:g.90276309C>A	ENSP00000268130:p.Ser468*	Unknown		x	x	x	88077313	Q8N7Y8|Q9NP89	Nonsense_Mutation	SNP	ENST00000268130.7	37	CCDS32326.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	T	36	5.912087	0.97099	.	.	ENSG00000140527	ENST00000268130;ENST00000444934	.	.	.	5.73	3.38	0.38709	.	1.109770	0.06928	N	0.810584	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-0.4972	4.2488	0.10684	0.0:0.1852:0.1897:0.6251	.	.	.	.	X	468;185	.	ENSP00000268130:S468X	S	+	2	0	WDR93	88077313	0.001000	0.12720	0.195000	0.23364	0.877000	0.50540	0.744000	0.26245	1.002000	0.39104	-0.275000	0.10095	TCG		0.483	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212		Nonsense_Mutation
DNAH3	55567	broad.mit.edu	37	16	20975412	20975412	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr16:20975412G>A	ENST00000261383.3	-	53	9793	c.9794C>T	c.(9793-9795)tCc>tTc	p.S3265F	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3265	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.S3265F(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CACTTTGGAGGAGGACAGAAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	16											142.0	139.0	140.0					16																	20975412		2201	4300	6501	20882913	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9794C>T	16.37:g.20975412G>A	ENSP00000261383:p.Ser3265Phe	Unknown		x	x	x	20882913	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033209	0.54896	.	.	ENSG00000158486	ENST00000261383	T	0.55588	0.51	5.82	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.81908	0.4922	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87804	0.2627	10	0.87932	D	0	.	15.3086	0.74014	0.0683:0.0:0.9317:0.0	.	3265	Q8TD57	DYH3_HUMAN	F	3265	ENSP00000261383:S3265F	ENSP00000261383:S3265F	S	-	2	0	DNAH3	20882913	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	8.013000	0.88655	2.755000	0.94549	0.591000	0.81541	TCC		0.463	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
KDM8	79831	broad.mit.edu	37	16	27221648	27221648	+	Silent	SNP	C	C	T	rs372258213		TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr16:27221648C>T	ENST00000286096.4	+	2	377	c.204C>T	c.(202-204)agC>agT	p.S68S	CTD-3203P2.1_ENST00000567108.1_RNA|KDM8_ENST00000380948.2_Silent_p.S68S|KDM8_ENST00000441782.2_Silent_p.S106S|KDM8_ENST00000568965.1_Silent_p.S68S	NM_024773.2	NP_079049.2	Q8N371	KDM8_HUMAN	lysine (K)-specific demethylase 8	68					G2/M transition of mitotic cell cycle (GO:0000086)|histone H3-K36 demethylation (GO:0070544)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (H3-K36 specific) (GO:0051864)|metal ion binding (GO:0046872)	p.S68S(1)									TGCAGAGCAGCGAGGTGATCC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	16						C	,	0,4392		0,0,2196	86.0	58.0	67.0		318,204	-0.6	0.8	16		67	1,8589		0,1,4294	no	coding-synonymous,coding-synonymous	JMJD5	NM_001145348.1,NM_024773.2	,	0,1,6490	TT,TC,CC		0.0116,0.0,0.0077	,	106/455,68/417	27221648	1,12981	2196	4295	6491	27129149	SO:0001819	synonymous_variant	79831			AK023860	CCDS10627.1, CCDS45448.1	16p12.1	2012-03-28	2012-03-28	2012-03-28	ENSG00000155666	ENSG00000155666		"""Chromatin-modifying enzymes / K-demethylases"""	25840	protein-coding gene	gene with protein product		611917	"""jumonji domain containing 5"""	JMJD5		20457893	Standard	NM_024773		Approved	FLJ13798	uc010vcn.1	Q8N371	OTTHUMG00000131677	ENST00000286096.4:c.204C>T	16.37:g.27221648C>T		Unknown		x	x	x	27129149	B4DLU9|Q6VAK5|Q9H8B1	Silent	SNP	ENST00000286096.4	37	CCDS10627.1	SNP	27	Broad																																																																																				0.607	KDM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254580.3	NM_024773		Silent
ANKFY1	51479	broad.mit.edu	37	17	4145675	4145675	+	Silent	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr17:4145675G>A	ENST00000341657.4	-	2	114	c.79C>T	c.(79-81)Ctg>Ttg	p.L27L	ANKFY1_ENST00000570535.1_Silent_p.L69L|ANKFY1_ENST00000433651.1_Silent_p.L27L|ANKFY1_ENST00000574367.1_Silent_p.L27L	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	27					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.L27L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GTCTCCGCCAGCTTCTTCTGC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	17											102.0	105.0	104.0					17																	4145675		2021	4181	6202	4092424	SO:0001819	synonymous_variant	51479			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.79C>T	17.37:g.4145675G>A		Unknown		x	x	x	4092424	A8KA65|Q5RKV4|Q9ULG5	Silent	SNP	ENST00000341657.4	37		SNP	34	Broad																																																																																				0.562	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376		Silent
TP53	7157	broad.mit.edu	37	17	7578239	7578239	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr17:7578239C>A	ENST00000269305.4	-	6	799	c.610G>T	c.(610-612)Gag>Tag	p.E204*	TP53_ENST00000413465.2_Nonsense_Mutation_p.E204*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E204*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E204*|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.E204*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E204*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	204	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|VE -> LV (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E204*(33)|p.0?(8)|p.?(5)|p.E72*(3)|p.E111*(3)|p.E204K(2)|p.E204fs*43(2)|p.E204Q(1)|p.E204fs*4(1)|p.V203_E204>V*(1)|p.V203_E204>LV(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCAAATACTCCACACGCAAA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	63	Substitution - Nonsense(39)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Substitution - Missense(3)|Complex - compound substitution(2)|Deletion - In frame(1)	lung(15)|haematopoietic_and_lymphoid_tissue(7)|large_intestine(6)|upper_aerodigestive_tract(5)|biliary_tract(5)|NS(5)|breast(4)|bone(4)|oesophagus(3)|ovary(3)|central_nervous_system(2)|stomach(1)|liver(1)|urinary_tract(1)|pancreas(1)	17											133.0	118.0	123.0					17																	7578239		2203	4300	6503	7518964	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.610G>T	17.37:g.7578239C>A	ENSP00000269305:p.Glu204*	Unknown		x	x	x	7518964	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489037	0.44249	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	-0.604	0.11626	.	0.445020	0.26082	N	0.026458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-5.2849	1.4244	0.02320	0.133:0.2829:0.3261:0.258	.	.	.	.	X	204;204;204;204;204;204;193;111;72;111;72	.	ENSP00000269305:E204X	E	-	1	0	TP53	7518964	0.600000	0.26899	0.018000	0.16275	0.030000	0.12068	0.945000	0.29056	-0.004000	0.14419	0.655000	0.94253	GAG		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
ADAP2	55803	broad.mit.edu	37	17	29253866	29253866	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr17:29253866C>T	ENST00000330889.3	+	3	582	c.247C>T	c.(247-249)Ctc>Ttc	p.L83F	ADAP2_ENST00000580525.1_Missense_Mutation_p.L89F	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	83	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)|p.L83F(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						CAATGGAAACCTCCGTGTGAA	0.483																																																2	Substitution - Missense(1)|Unknown(1)	ovary(1)|central_nervous_system(1)	17											126.0	105.0	112.0					17																	29253866		2203	4300	6503	26277992	SO:0001583	missense	55803			AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.247C>T	17.37:g.29253866C>T	ENSP00000329468:p.Leu83Phe	Unknown		x	x	x	26277992	Q8N4Q6|Q96SD5	Missense_Mutation	SNP	ENST00000330889.3	37	CCDS11261.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	8.432	0.848847	0.17034	.	.	ENSG00000184060	ENST00000330889	T	0.42900	0.96	5.48	4.45	0.53987	.	0.445605	0.26696	N	0.022979	T	0.57577	0.2063	M	0.64567	1.98	0.31338	N	0.683989	D;D;D	0.76494	0.999;0.964;0.972	D;P;P	0.71184	0.972;0.725;0.82	T	0.61888	-0.6970	10	0.56958	D	0.05	.	10.7397	0.46145	0.1896:0.8104:0.0:0.0	.	89;83;83	Q2V6Q1;Q9NPF8-2;Q9NPF8	.;.;ADAP2_HUMAN	F	83	ENSP00000329468:L83F	ENSP00000329468:L83F	L	+	1	0	ADAP2	26277992	0.020000	0.18652	1.000000	0.80357	0.468000	0.32798	0.541000	0.23207	2.599000	0.87857	0.561000	0.74099	CTC		0.483	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256346.1	NM_018404		Missense_Mutation
PSMD11	5717	broad.mit.edu	37	17	30791556	30791556	+	Silent	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr17:30791556G>A	ENST00000261712.3	+	5	671	c.408G>A	c.(406-408)ttG>ttA	p.L136L	PSMD11_ENST00000457654.2_Silent_p.L136L|Y_RNA_ENST00000365230.1_RNA	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	136					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.L136L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGGTGTCTTTGTACTTTGATA	0.408																																					Ovarian(130;1038 1716 9294 11987 19279)											1	Substitution - coding silent(1)	ovary(1)	17											143.0	127.0	133.0					17																	30791556		2203	4300	6503	27815669	SO:0001819	synonymous_variant	5717			AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.408G>A	17.37:g.30791556G>A		Unknown		x	x	x	27815669	A8K3I7|E1P663|O00495|Q53FT5	Silent	SNP	ENST00000261712.3	37	CCDS11272.1	SNP	48	Broad																																																																																				0.408	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256252.2	NM_002815		Silent
GPR179	440435	broad.mit.edu	37	17	36495366	36495366	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr17:36495366G>C	ENST00000342292.4	-	2	857	c.837C>G	c.(835-837)atC>atG	p.I279M		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	279					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I279M(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CACACTGATTGATGTCCACAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											126.0	127.0	127.0					17																	36495366		2133	4229	6362	33748892	SO:0001583	missense	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.837C>G	17.37:g.36495366G>C	ENSP00000345060:p.Ile279Met	Unknown		x	x	x	33748892		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818750	0.50633	.	.	ENSG00000188888	ENST00000342292	T	0.68331	-0.32	4.32	3.34	0.38264	.	0.239629	0.30920	N	0.008615	T	0.80470	0.4629	M	0.87269	2.87	0.36087	D	0.843175	D	0.89917	1.0	D	0.73708	0.981	D	0.84290	0.0499	10	0.87932	D	0	-17.1579	7.2665	0.26232	0.0925:0.0:0.7391:0.1683	.	279	Q6PRD1	GP179_HUMAN	M	279	ENSP00000345060:I279M	ENSP00000345060:I279M	I	-	3	3	GPR179	33748892	0.999000	0.42202	1.000000	0.80357	0.931000	0.56810	0.532000	0.23067	1.160000	0.42584	0.462000	0.41574	ATC		0.542	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2			Missense_Mutation
CTAGE1	64693	broad.mit.edu	37	18	19997047	19997047	+	5'Flank	SNP	T	T	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr18:19997047T>C	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.K243R			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)		p.K243R(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					ATCTTTCATCTTTAGCAAGCG	0.353																																																1	Substitution - Missense(1)	ovary(1)	18											128.0	127.0	127.0					18																	19997047		2200	4299	6499	18251045	SO:0001631	upstream_gene_variant	64693			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19997047T>C	Exception_encountered	Unknown		x	x	x	18251045	B0YIZ3	Missense_Mutation	SNP	ENST00000525417.1	37		SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	10.98	1.505583	0.26949	.	.	ENSG00000212710	ENST00000391403	T	0.27720	1.65	0.381	0.381	0.16228	.	.	.	.	.	T	0.49525	0.1562	M	0.84511	2.7	0.09310	N	1	D	0.59767	0.986	P	0.58721	0.844	T	0.35126	-0.9801	7	.	.	.	.	.	.	.	.	243	Q96RT6	CTGE2_HUMAN	R	243	ENSP00000375220:K243R	.	K	-	2	0	CTAGE1	18251045	0.998000	0.40836	0.043000	0.18650	0.080000	0.17528	1.397000	0.34543	0.378000	0.24764	0.369000	0.22263	AAG		0.353	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241		Missense_Mutation
GP6	51206	broad.mit.edu	37	19	55525891	55525891	+	3'UTR	SNP	C	C	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr19:55525891C>T	ENST00000417454.1	-	0	1445				GP6_ENST00000310373.3_Silent_p.V474V|CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000333884.2_3'UTR|CTC-550B14.7_ENST00000586845.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.V474V(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CAAAGGGAAGCACGGGAGGAT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	19											71.0	74.0	73.0					19																	55525891		1966	4161	6127	60217703	SO:0001624	3_prime_UTR_variant	51206			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*398G>A	19.37:g.55525891C>T		Unknown		x	x	x	60217703	Q9HCN7|Q9UIF2	Silent	SNP	ENST00000417454.1	37	CCDS46184.1	SNP	25	Broad																																																																																				0.512	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1			Silent
EPAS1	2034	broad.mit.edu	37	2	46605800	46605800	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr2:46605800A>G	ENST00000263734.3	+	11	1958	c.1448A>G	c.(1447-1449)aAt>aGt	p.N483S		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	483					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)	p.N483S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CCCTAGCCCAATAGCCCTGAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	100.0	101.0					2																	46605800		2203	4300	6503	46459304	SO:0001583	missense	2034			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1448A>G	2.37:g.46605800A>G	ENSP00000263734:p.Asn483Ser	Unknown		x	x	x	46459304	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	0.267	-0.995324	0.02145	.	.	ENSG00000116016	ENST00000263734	T	0.39997	1.05	5.55	3.72	0.42706	.	0.216468	0.30630	N	0.009217	T	0.10981	0.0268	N	0.00648	-1.295	0.28458	N	0.916007	B	0.02656	0.0	B	0.01281	0.0	T	0.33292	-0.9874	10	0.02654	T	1	.	7.9286	0.29889	0.1433:0.0:0.7257:0.131	.	483	Q99814	EPAS1_HUMAN	S	483	ENSP00000263734:N483S	ENSP00000263734:N483S	N	+	2	0	EPAS1	46459304	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	3.533000	0.53561	0.685000	0.31468	-1.100000	0.02121	AAT		0.502	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430		Missense_Mutation
IL18R1	8809	broad.mit.edu	37	2	102984374	102984374	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr2:102984374G>A	ENST00000409599.1	+	4	504	c.148G>A	c.(148-150)Gaa>Aaa	p.E50K	IL18R1_ENST00000334376.3_Missense_Mutation_p.E50K|IL18R1_ENST00000233957.1_Missense_Mutation_p.E50K			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	50	Ig-like C2-type 1.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)	p.E50K(1)		breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						ACATGAGATTGAAACAACCAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	119.0	122.0					2																	102984374		2203	4300	6503	102350806	SO:0001583	missense	8809			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.148G>A	2.37:g.102984374G>A	ENSP00000387211:p.Glu50Lys	Unknown		x	x	x	102350806	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	37	CCDS2060.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	6.300	0.423449	0.11928	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957;ENST00000334376	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.23	-2.35	0.06684	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.535540	0.03512	N	0.219759	T	0.24851	0.0603	L	0.36672	1.1	0.09310	N	1	B;B;B	0.17038	0.002;0.02;0.002	B;B;B	0.15484	0.004;0.013;0.004	T	0.08086	-1.0739	10	0.06494	T	0.89	.	1.1998	0.01882	0.4375:0.1533:0.2534:0.1558	.	50;50;50	B7ZKV7;Q86YL8;Q13478	.;.;IL18R_HUMAN	K	50	ENSP00000386663:E50K;ENSP00000387211:E50K;ENSP00000233957:E50K;ENSP00000334030:E50K	ENSP00000233957:E50K	E	+	1	0	IL18R1	102350806	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.520000	0.06252	-0.265000	0.09352	0.563000	0.77884	GAA		0.428	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855		Missense_Mutation
NCKAP5	344148	broad.mit.edu	37	2	133541057	133541057	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr2:133541057C>A	ENST00000409261.1	-	14	3700	c.3327G>T	c.(3325-3327)gaG>gaT	p.E1109D	NCKAP5_ENST00000317721.6_Missense_Mutation_p.E1109D|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1109	Ser-rich.									NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATGATGGTGACTCATTTACCC	0.488																																																0			2											210.0	224.0	219.0					2																	133541057		2084	4216	6300	133257527	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3327G>T	2.37:g.133541057C>A	ENSP00000387128:p.Glu1109Asp	Unknown		x	x	x	133257527	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780553	0.31502	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10382	2.88;2.88	5.41	-1.0	0.10196	.	0.000000	0.38720	U	0.001581	T	0.07143	0.0181	L	0.34521	1.04	0.44024	D	0.996749	B	0.23249	0.082	B	0.25140	0.058	T	0.27468	-1.0073	10	0.36615	T	0.2	.	6.9452	0.24514	0.0:0.5233:0.1158:0.3608	.	1109	O14513	NCKP5_HUMAN	D	1109	ENSP00000387128:E1109D;ENSP00000380603:E1109D	ENSP00000380603:E1109D	E	-	3	2	NCKAP5	133257527	0.755000	0.28372	0.073000	0.20177	0.047000	0.14425	-0.131000	0.10482	-0.078000	0.12730	-0.136000	0.14681	GAG		0.488	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179414890	179414890	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr2:179414890T>A	ENST00000591111.1	-	287	86976	c.86752A>T	c.(86752-86754)Act>Tct	p.T28918S	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T21619S|TTN_ENST00000460472.2_Missense_Mutation_p.T21494S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T30559S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T27991S|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T21686S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28918	Ig-like 133.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T21494S(1)|p.T27989S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGAACCAAGTTACTCGAGGC	0.428																																																2	Substitution - Missense(2)	ovary(2)	2											204.0	200.0	201.0					2																	179414890		1869	4109	5978	179123136	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86752A>T	2.37:g.179414890T>A	ENSP00000465570:p.Thr28918Ser	Unknown		x	x	x	179123136	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	16.80	3.222260	0.58560	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.74	5.74	0.90152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65375	0.2685	L	0.58925	1.835	0.31698	N	0.640984	P;P;P;P	0.51537	0.891;0.891;0.891;0.946	P;P;P;P	0.48952	0.516;0.516;0.516;0.596	T	0.73962	-0.3817	9	0.87932	D	0	.	10.6581	0.45686	0.0:0.0714:0.0:0.9286	.	21494;21619;21686;28918	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	27991;21494;21686;21619;21491	ENSP00000343764:T27991S;ENSP00000434586:T21494S;ENSP00000340554:T21686S;ENSP00000352154:T21619S	ENSP00000340554:T21686S	T	-	1	0	TTN	179123136	0.921000	0.31238	1.000000	0.80357	0.987000	0.75469	1.254000	0.32897	2.317000	0.78254	0.460000	0.39030	ACT		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
TMPRSS2	7113	broad.mit.edu	37	21	42870072	42870072	+	5'UTR	SNP	C	C	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr21:42870072C>G	ENST00000332149.5	-	0	123				TMPRSS2_ENST00000398585.3_Missense_Mutation_p.D34H|TMPRSS2_ENST00000497881.1_5'UTR|TMPRSS2_ENST00000458356.1_5'UTR	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2						positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.?(1)	TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				TTGCTGTTATCAACAGCATCG	0.363			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																		Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	1	Unknown(1)	ovary(1)	21											124.0	107.0	112.0					21																	42870072		2203	4300	6503	41791942	SO:0001623	5_prime_UTR_variant	7113			U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.-12G>C	21.37:g.42870072C>G		Unknown		x	x	x	41791942	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	ENST00000332149.5	37	CCDS33564.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240092	0.58995	.	.	ENSG00000184012	ENST00000398585	D	0.89415	-2.51	4.65	4.65	0.58169	.	.	.	.	.	D	0.87022	0.6074	N	0.08118	0	0.26516	N	0.974511	D	0.71674	0.998	P	0.62740	0.906	T	0.80582	-0.1318	9	0.54805	T	0.06	.	13.4181	0.60980	0.0:1.0:0.0:0.0	.	34	F8WES1	.	H	34	ENSP00000381588:D34H	ENSP00000381588:D34H	D	-	1	0	TMPRSS2	41791942	0.417000	0.25432	0.914000	0.36105	0.700000	0.40528	3.546000	0.53656	2.294000	0.77228	0.655000	0.94253	GAT		0.363	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195189.1			Missense_Mutation
TRPM2	7226	broad.mit.edu	37	21	45798892	45798892	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr21:45798892G>A	ENST00000397928.1	+	8	1472	c.1027G>A	c.(1027-1029)Gcc>Acc	p.A343T	TRPM2_ENST00000397932.2_Missense_Mutation_p.A343T|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Missense_Mutation_p.A343T|TRPM2_ENST00000300481.9_Missense_Mutation_p.A343T	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	343					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.A343T(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CATCGACAACGCCACCACCAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	21											66.0	60.0	62.0					21																	45798892		2203	4300	6503	44623320	SO:0001583	missense	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1027G>A	21.37:g.45798892G>A	ENSP00000381023:p.Ala343Thr	Unknown		x	x	x	44623320	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423393	0.62733	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	3.84	3.84	0.44239	.	0.209859	0.40222	N	0.001150	T	0.33760	0.0874	M	0.76002	2.32	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	P;P	0.60949	0.881;0.844	T	0.23226	-1.0194	10	0.51188	T	0.08	-30.5778	15.9747	0.80054	0.0:0.0:1.0:0.0	.	343;343	E9PGK7;O94759	.;TRPM2_HUMAN	T	343	ENSP00000300482:A343T;ENSP00000381023:A343T;ENSP00000300481:A343T;ENSP00000381026:A343T	ENSP00000300481:A343T	A	+	1	0	TRPM2	44623320	1.000000	0.71417	0.993000	0.49108	0.299000	0.27559	7.018000	0.76406	1.971000	0.57363	0.563000	0.77884	GCC		0.622	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		Missense_Mutation
GRAMD1C	54762	broad.mit.edu	37	3	113623065	113623065	+	Silent	SNP	A	A	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr3:113623065A>G	ENST00000358160.4	+	8	1227	c.735A>G	c.(733-735)gaA>gaG	p.E245E	GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000472026.1_Silent_p.E78E|GRAMD1C_ENST00000440446.2_Silent_p.E40E	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	245						integral component of membrane (GO:0016021)		p.E245E(1)		NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						TTACCAGTGAATCAATTAGTC	0.358																																																1	Substitution - coding silent(1)	ovary(1)	3											86.0	92.0	90.0					3																	113623065		2203	4300	6503	115105755	SO:0001819	synonymous_variant	54762				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.735A>G	3.37:g.113623065A>G		Unknown		x	x	x	115105755	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Silent	SNP	ENST00000358160.4	37	CCDS33826.1	SNP	4	Broad																																																																																				0.358	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577		Silent
STXBP5L	9515	broad.mit.edu	37	3	120764285	120764285	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr3:120764285G>T	ENST00000273666.6	+	5	644	c.373G>T	c.(373-375)Gcc>Tcc	p.A125S	STXBP5L_ENST00000492541.1_Missense_Mutation_p.A125S|STXBP5L_ENST00000497029.1_Missense_Mutation_p.A125S|STXBP5L_ENST00000471454.1_Missense_Mutation_p.A125S|STXBP5L_ENST00000472879.1_Missense_Mutation_p.A125S	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	125					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A125S(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GTTCTAGGGTGCCTTGGTCAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	3											166.0	159.0	161.0					3																	120764285		1844	4087	5931	122246975	SO:0001583	missense	9515			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.373G>T	3.37:g.120764285G>T	ENSP00000273666:p.Ala125Ser	Unknown		x	x	x	122246975	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	CCDS43137.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821322	0.90873	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000495504;ENST00000471262	T;T;T;T;T;T;T	0.54071	0.59;1.63;0.59;0.59;1.63;0.76;1.63	5.43	5.43	0.79202	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.80028	2.48	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	T	0.69745	-0.5062	10	0.22109	T	0.4	-12.0368	18.2281	0.89924	0.0:0.0:1.0:0.0	.	125;125	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	S	125	ENSP00000273666:A125S;ENSP00000420019:A125S;ENSP00000419627:A125S;ENSP00000420287:A125S;ENSP00000420666:A125S;ENSP00000419404:A125S;ENSP00000420167:A125S	ENSP00000273666:A125S	A	+	1	0	STXBP5L	122246975	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.791000	0.91849	2.543000	0.85770	0.655000	0.94253	GCC		0.353	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			Missense_Mutation
MAGEF1	64110	broad.mit.edu	37	3	184429410	184429410	+	Nonsense_Mutation	SNP	A	A	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr3:184429410A>T	ENST00000317897.3	-	1	426	c.200T>A	c.(199-201)tTg>tAg	p.L67*		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	67						extracellular vesicular exosome (GO:0070062)		p.L67*(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			GCGCCTTGCCAAGGCTTTGGC	0.682																																																1	Substitution - Nonsense(1)	ovary(1)	3											53.0	59.0	57.0					3																	184429410		2203	4300	6503	185912104	SO:0001587	stop_gained	64110			AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.200T>A	3.37:g.184429410A>T	ENSP00000315064:p.Leu67*	Unknown		x	x	x	185912104	Q9H215	Nonsense_Mutation	SNP	ENST00000317897.3	37	CCDS3269.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	25.3	4.620488	0.87460	.	.	ENSG00000177383	ENST00000317897	.	.	.	3.18	-2.42	0.06542	.	5.481240	0.00744	N	0.001032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	3.1229	0.06397	0.393:0.0:0.3962:0.2108	.	.	.	.	X	67	.	ENSP00000315064:L67X	L	-	2	0	MAGEF1	185912104	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.271000	0.08572	-0.225000	0.09913	0.533000	0.62120	TTG		0.682	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149		Nonsense_Mutation
LEPREL1	55214	broad.mit.edu	37	3	189838071	189838071	+	Silent	SNP	G	G	C			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr3:189838071G>C	ENST00000319332.5	-	1	647	c.450C>G	c.(448-450)ccC>ccG	p.P150P	LEPREL1_ENST00000427335.2_Intron|LEPREL1-AS1_ENST00000412203.1_RNA	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	150					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)	p.P150P(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GGTAGTTGTAGGGCACTCTGC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	3											27.0	22.0	23.0					3																	189838071		2203	4299	6502	191320765	SO:0001819	synonymous_variant	55214				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.450C>G	3.37:g.189838071G>C		Unknown		x	x	x	191320765	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Silent	SNP	ENST00000319332.5	37	CCDS3294.1	SNP	35	Broad																																																																																				0.662	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192		Silent
UBE3D	90025	broad.mit.edu	37	6	83667113	83667113	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr6:83667113G>A	ENST00000369747.3	-	9	1189	c.1067C>T	c.(1066-1068)gCa>gTa	p.A356V		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	356	HECT-like.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)	p.A356V(1)									CAAGCAGGTTGCAGAGGGCAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											121.0	98.0	106.0					6																	83667113		2203	4300	6503	83723832	SO:0001583	missense	90025			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.1067C>T	6.37:g.83667113G>A	ENSP00000358762:p.Ala356Val	Unknown		x	x	x	83723832	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	CCDS34491.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	14.54	2.567360	0.45694	.	.	ENSG00000118420	ENST00000369747	T	0.30981	1.51	5.57	4.62	0.57501	.	0.622429	0.17964	N	0.156098	T	0.14485	0.0350	L	0.44542	1.39	0.43708	D	0.996178	B	0.30146	0.27	B	0.31812	0.136	T	0.03051	-1.1078	10	0.32370	T	0.25	-4.8493	10.2709	0.43483	0.0:0.0:0.7082:0.2918	.	356	Q7Z6J8	UB2CB_HUMAN	V	356	ENSP00000358762:A356V	ENSP00000358762:A356V	A	-	2	0	UBE2CBP	83723832	0.937000	0.31787	0.893000	0.35052	0.982000	0.71751	3.490000	0.53245	2.628000	0.89032	0.462000	0.41574	GCA		0.463	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920		Missense_Mutation
HEATR2	54919	broad.mit.edu	37	7	825228	825228	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr7:825228C>A	ENST00000297440.6	+	13	2526	c.2506C>A	c.(2506-2508)Cgc>Agc	p.R836S	HEATR2_ENST00000403952.3_Missense_Mutation_p.R261S|HEATR2_ENST00000313147.5_Intron	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	836						cytoplasm (GO:0005737)		p.R836S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CCACAAGCACCGCTCGGCCAC	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	72.0	72.0					7																	825228		2203	4300	6503	791754	SO:0001583	missense	54919			AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.2506C>A	7.37:g.825228C>A	ENSP00000297440:p.Arg836Ser	Unknown		x	x	x	791754	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	37	CCDS34580.1	SNP	23	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.32|19.32	3.805501|3.805501	0.70682|0.70682	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000440747|ENST00000297440;ENST00000537862;ENST00000403952	.|T;T	.|0.66815	.|0.26;-0.23	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80529|0.80529	0.4640|0.4640	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.997;1.0	.|D;D;D	.|0.76071	.|0.987;0.914;0.986	T|T	0.82663|0.82663	-0.0346|-0.0346	5|10	.|0.72032	.|D	.|0.01	-45.2734|-45.2734	10.6484|10.6484	0.45634|0.45634	0.1918:0.8082:0.0:0.0|0.1918:0.8082:0.0:0.0	.|.	.|836;261;582	.|Q86Y56;E9PGY2;F5H8D4	.|HEAT2_HUMAN;.;.	Q|S	637|836;582;261	.|ENSP00000297440:R836S;ENSP00000384884:R261S	.|ENSP00000297440:R836S	P|R	+|+	2|1	0|0	HEATR2|HEATR2	791754|791754	0.997000|0.997000	0.39634|0.39634	0.998000|0.998000	0.56505|0.56505	0.599000|0.599000	0.36880|0.36880	2.728000|2.728000	0.47319|0.47319	2.233000|2.233000	0.73108|0.73108	0.462000|0.462000	0.41574|0.41574	CCG|CGC		0.607	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802		Missense_Mutation
GTF2IRD2	84163	broad.mit.edu	37	7	74211817	74211817	+	Silent	SNP	C	C	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr7:74211817C>T	ENST00000405086.2	-	16	2223	c.2034G>A	c.(2032-2034)gtG>gtA	p.V678V	GTF2IRD2_ENST00000451013.2_Silent_p.V225V	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	678					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V678V(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						atatccagttcacggacttca	0.498																																					NSCLC(40;560 1096 7501 40315 49546)											1	Substitution - coding silent(1)	ovary(1)	7											50.0	45.0	47.0					7																	74211817		2200	4297	6497	73849753	SO:0001819	synonymous_variant	84163			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.2034G>A	7.37:g.74211817C>T		Unknown		x	x	x	73849753	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Silent	SNP	ENST00000405086.2	37	CCDS5576.1	SNP	29	Broad																																																																																				0.498	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252712.3	NM_173537		Silent
MUC17	140453	broad.mit.edu	37	7	100684114	100684114	+	Silent	SNP	T	T	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr7:100684114T>A	ENST00000306151.4	+	3	9481	c.9417T>A	c.(9415-9417)tcT>tcA	p.S3139S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3139	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S3139S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGACCACTTCTACTGAAGCCC	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											299.0	307.0	304.0					7																	100684114		2203	4300	6503	100470834	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9417T>A	7.37:g.100684114T>A		Unknown		x	x	x	100470834	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	53	Broad																																																																																				0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Silent
NRG1	3084	broad.mit.edu	37	8	32621777	32621777	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr8:32621777C>G	ENST00000405005.3	+	12	1780	c.1780C>G	c.(1780-1782)Ccc>Gcc	p.P594A	NRG1_ENST00000338921.4_Missense_Mutation_p.P602A|NRG1_ENST00000287845.5_Missense_Mutation_p.P565A|NRG1_ENST00000519301.1_Missense_Mutation_p.P544A|NRG1_ENST00000356819.4_Missense_Mutation_p.P599A|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000287842.3_Missense_Mutation_p.P591A|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000539990.1_Missense_Mutation_p.P437A			Q02297	NRG1_HUMAN	neuregulin 1	594					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.P599A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CATACAGAACCCCCTGGCAGC	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	70.0	68.0					8																	32621777		2203	4300	6503	32741319	SO:0001583	missense	3084			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1780C>G	8.37:g.32621777C>G	ENSP00000384620:p.Pro594Ala	Unknown		x	x	x	32741319	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.95	2.687808	0.48097	.	.	ENSG00000157168	ENST00000519301;ENST00000523534;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000539990	T;T;T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.95	5.95	0.96441	Neuregulin 1-related, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71467	0.3343	L	0.28694	0.88	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.996;0.999;0.999;0.999	T	0.66984	-0.5785	9	.	.	.	-1.3165	20.3789	0.98926	0.0:1.0:0.0:0.0	.	437;565;599;602;591;594;599	B7Z1E3;F8W9E3;Q7RTW4;Q02297-2;Q02297-7;Q02297;Q02297-6	.;.;.;.;.;NRG1_HUMAN;.	A	544;667;602;599;594;565;591;594;437	ENSP00000429582:P544A;ENSP00000429067:P667A;ENSP00000343395:P602A;ENSP00000349275:P599A;ENSP00000287840:P594A;ENSP00000287845:P565A;ENSP00000287842:P591A;ENSP00000384620:P594A;ENSP00000439276:P437A	.	P	+	1	0	NRG1	32741319	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.615000	0.54167	2.826000	0.97356	0.563000	0.77884	CCC		0.552	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			Missense_Mutation
ANK1	286	broad.mit.edu	37	8	41543690	41543690	+	Missense_Mutation	SNP	C	C	T	rs138642972	byFrequency	TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr8:41543690C>T	ENST00000347528.4	-	36	4453	c.4370G>A	c.(4369-4371)cGt>cAt	p.R1457H	ANK1_ENST00000396942.1_Missense_Mutation_p.R1457H|ANK1_ENST00000396945.1_Missense_Mutation_p.R1457H|ANK1_ENST00000265709.8_Missense_Mutation_p.R1498H|ANK1_ENST00000379758.2_Missense_Mutation_p.R1457H|ANK1_ENST00000352337.4_Missense_Mutation_p.R1457H|ANK1_ENST00000289734.7_Missense_Mutation_p.R1457H	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1457	55 kDa regulatory domain.|Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R1457H(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TTGGCCTTCACGGATGACCCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	8						C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	154.0	110.0	125.0		4370,4493,4370,4370,4370	5.5	0.3	8	dbSNP_134	125	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense	ANK1	NM_000037.3,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2	29,29,29,29,29	0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	1457/1881,1498/1898,1457/1857,1457/1882,1457/1720	41543690	4,13002	2203	4300	6503	41662847	SO:0001583	missense	286			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4370G>A	8.37:g.41543690C>T	ENSP00000339620:p.Arg1457His	Unknown		x	x	x	41662847	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443909	0.83993	4.54E-4	2.33E-4	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	D;D;D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18	5.49	5.49	0.81192	Death (3);DEATH-like (2);	0.059384	0.64402	D	0.000004	D	0.93314	0.7869	M	0.80847	2.515	0.80722	D	1	P;D;D;P;P;D	0.63880	0.917;0.985;0.958;0.933;0.68;0.993	P;P;P;P;P;D	0.63597	0.723;0.849;0.849;0.552;0.723;0.916	D	0.93865	0.7157	10	0.72032	D	0.01	.	18.3408	0.90304	0.0:1.0:0.0:0.0	.	1498;1457;1457;1457;1457;773	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	H	1457;1457;1457;1457;1457;1457;1498;1457	ENSP00000339620:R1457H;ENSP00000289734:R1457H;ENSP00000369082:R1457H;ENSP00000380149:R1457H;ENSP00000380147:R1457H;ENSP00000309131:R1457H;ENSP00000265709:R1498H	ENSP00000265709:R1498H	R	-	2	0	ANK1	41662847	1.000000	0.71417	0.303000	0.25071	0.461000	0.32589	4.440000	0.59975	2.573000	0.86826	0.655000	0.94253	CGT		0.522	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		Missense_Mutation
ZNF16	7564	broad.mit.edu	37	8	146157289	146157289	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr8:146157289C>A	ENST00000276816.4	-	4	1070	c.884G>T	c.(883-885)tGt>tTt	p.C295F	ZNF16_ENST00000394909.2_Missense_Mutation_p.C295F	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	295	Required for nuclear localization.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C295F(2)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		ACATTCATTACACATATAAGG	0.473																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	8											85.0	84.0	84.0					8																	146157289		2203	4300	6503	146128093	SO:0001583	missense	7564			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.884G>T	8.37:g.146157289C>A	ENSP00000276816:p.Cys295Phe	Unknown		x	x	x	146128093	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016725	0.35606	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	D;D	0.85088	-1.94;-1.94	4.02	4.02	0.46733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94981	0.8376	H	0.97291	3.975	0.44587	D	0.997551	D	0.89917	1.0	D	0.97110	1.0	D	0.96778	0.9573	9	0.87932	D	0	.	15.0669	0.72002	0.0:1.0:0.0:0.0	.	295	P17020	ZNF16_HUMAN	F	295	ENSP00000276816:C295F;ENSP00000378369:C295F	ENSP00000276816:C295F	C	-	2	0	ZNF16	146128093	1.000000	0.71417	0.064000	0.19789	0.028000	0.11728	5.060000	0.64312	2.056000	0.61249	0.563000	0.77884	TGT		0.473	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958		Missense_Mutation
ZNF16	7564	broad.mit.edu	37	8	146157361	146157361	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr8:146157361C>G	ENST00000276816.4	-	4	998	c.812G>C	c.(811-813)gGg>gCg	p.G271A	ZNF16_ENST00000394909.2_Missense_Mutation_p.G271A	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	271	Required for nuclear localization.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G271A(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GAAGGCTTTCCCACATTCGCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											127.0	126.0	126.0					8																	146157361		2203	4300	6503	146128165	SO:0001583	missense	7564			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.812G>C	8.37:g.146157361C>G	ENSP00000276816:p.Gly271Ala	Unknown		x	x	x	146128165	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099205	0.37048	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.21361	2.01;2.01	3.76	1.77	0.24775	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28699	0.0711	M	0.85542	2.76	0.24214	N	0.995469	P	0.35242	0.492	B	0.36244	0.22	T	0.23013	-1.0200	9	0.87932	D	0	.	7.6652	0.28426	0.0:0.7345:0.1656:0.0999	.	271	P17020	ZNF16_HUMAN	A	271	ENSP00000276816:G271A;ENSP00000378369:G271A	ENSP00000276816:G271A	G	-	2	0	ZNF16	146128165	0.000000	0.05858	0.003000	0.11579	0.013000	0.08279	0.381000	0.20619	0.707000	0.31934	0.467000	0.42956	GGG		0.463	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958		Missense_Mutation
WNK3	65267	broad.mit.edu	37	X	54259359	54259359	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chrX:54259359G>A	ENST00000375159.2	-	20	4722	c.4723C>T	c.(4723-4725)Caa>Taa	p.Q1575*	WNK3_ENST00000354646.2_Nonsense_Mutation_p.Q1575*|WNK3_ENST00000375169.3_Nonsense_Mutation_p.Q1528*			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1575					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q1575*(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TCAGTAGATTGGGTTTTGCTA	0.468																																																1	Substitution - Nonsense(1)	ovary(1)	X											160.0	143.0	149.0					X																	54259359		2203	4300	6503	54276084	SO:0001587	stop_gained	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4723C>T	X.37:g.54259359G>A	ENSP00000364301:p.Gln1575*	Unknown		x	x	x	54276084	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Nonsense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	41	9.129297	0.99075	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	.	.	.	5.69	1.64	0.23874	.	0.261727	0.26170	N	0.025932	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-1.5687	10.7298	0.46089	0.0865:0.4861:0.4275:0.0	.	.	.	.	X	1528;1575;1575	.	ENSP00000346667:Q1575X	Q	-	1	0	WNK3	54276084	0.141000	0.22595	0.001000	0.08648	0.641000	0.38312	1.507000	0.35758	0.164000	0.19529	0.594000	0.82650	CAA		0.468	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		Nonsense_Mutation
KIAA2022	340533	broad.mit.edu	37	X	73961170	73961170	+	Silent	SNP	C	C	T			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chrX:73961170C>T	ENST00000055682.6	-	3	3833	c.3222G>A	c.(3220-3222)ccG>ccA	p.P1074P		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1074					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.P1074P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TAGGGGTGTCCGGTGGGGACA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	X											86.0	83.0	84.0					X																	73961170		2203	4300	6503	73877895	SO:0001819	synonymous_variant	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3222G>A	X.37:g.73961170C>T		Unknown		x	x	x	73877895	A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	23	Broad																																																																																				0.498	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Silent
COLEC12	81035	broad.mit.edu	37	18	334971	334972	+	Frame_Shift_Ins	INS	-	-	G			TCGA-61-2002-01	TCGA-61-2002-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2002-01	TCGA-61-2002-11	g.chr18:334971_334972insG	ENST00000400256.3	-	6	1793_1794	c.1586_1587insC	c.(1585-1587)ccgfs	p.P529fs		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	529	Collagen-like 2.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.P532fs*66(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CTGGTGGGCCCGGGGGGCCTGG	0.718																																																1	Insertion - Frameshift(1)	ovary(1)	18																																								324972	SO:0001589	frameshift_variant	81035			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1587dupC	18.37:g.334977_334977dupG	ENSP00000383115:p.Pro529fs	Unknown		Capture	Illumina GAIIx	Phase_I	324971	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Frame_Shift_Ins	INS	ENST00000400256.3	37	CCDS32782.1	INS	23	Broad																																																																																				0.718	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1			Frame_Shift_Ins
