#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
KANK4	163782	broad.mit.edu	37	1	62739538	62739538	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr1:62739538A>T	ENST00000371153.4	-	3	1616	c.1238T>A	c.(1237-1239)aTg>aAg	p.M413K	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	413						cytoplasm (GO:0005737)		p.M413K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGTGTTCACCATCACGTCCGT	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											203.0	173.0	184.0					1																	62739538		2203	4300	6503	62512126	SO:0001583	missense	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1238T>A	1.37:g.62739538A>T	ENSP00000360195:p.Met413Lys	Unknown		x	x	x	62512126	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	11.94	1.788485	0.31685	.	.	ENSG00000132854	ENST00000371153	T	0.43688	0.94	5.35	-7.14	0.01527	.	1.416120	0.04617	N	0.401349	T	0.33990	0.0882	L	0.51422	1.61	0.09310	N	1	B	0.24092	0.097	B	0.18871	0.023	T	0.26395	-1.0104	10	0.14656	T	0.56	0.0236	14.7139	0.69254	0.1538:0.1189:0.7273:0.0	.	413	Q5T7N3	KANK4_HUMAN	K	413	ENSP00000360195:M413K	ENSP00000360195:M413K	M	-	2	0	KANK4	62512126	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	0.181000	0.16880	-1.221000	0.02591	-0.379000	0.06801	ATG		0.532	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		Missense_Mutation
MCOLN2	255231	broad.mit.edu	37	1	85397198	85397198	+	Silent	SNP	A	A	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr1:85397198A>G	ENST00000370608.3	-	12	1456	c.1389T>C	c.(1387-1389)gaT>gaC	p.D463D	MCOLN2_ENST00000284027.5_Silent_p.D435D	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	463					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D463D(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		CAAACATGTCATCACCGTTGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	1											71.0	74.0	73.0					1																	85397198		2203	4300	6503	85169786	SO:0001819	synonymous_variant	255231			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1389T>C	1.37:g.85397198A>G		Unknown		x	x	x	85169786	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Silent	SNP	ENST00000370608.3	37	CCDS30762.1	SNP	8	Broad																																																																																				0.378	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259		Silent
RBM15	64783	broad.mit.edu	37	1	110883715	110883715	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr1:110883715G>C	ENST00000369784.3	+	1	2588	c.1688G>C	c.(1687-1689)gGt>gCt	p.G563A	RBM15_ENST00000602849.1_Missense_Mutation_p.G563A|RBM15_ENST00000487146.2_Missense_Mutation_p.G563A|RP5-1074L1.1_ENST00000449169.1_RNA	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	563					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G563R(1)		ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCTTTGAGGGGTGCTCGGGAT	0.547			T	MKL1	acute megakaryocytic leukemia																																		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	1	Substitution - Missense(1)	ovary(1)	1											56.0	50.0	52.0					1																	110883715		2203	4300	6503	110685238	SO:0001583	missense	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1688G>C	1.37:g.110883715G>C	ENSP00000358799:p.Gly563Ala	Unknown		x	x	x	110685238	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	CCDS822.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	4.173	0.030604	0.08101	.	.	ENSG00000162775	ENST00000369784	T	0.18338	2.22	4.44	3.53	0.40419	.	0.316936	0.22740	N	0.056207	T	0.03783	0.0107	L	0.36672	1.1	0.32420	N	0.549463	B;B	0.12013	0.005;0.0	B;B	0.08055	0.003;0.001	T	0.32745	-0.9895	10	0.05959	T	0.93	-1.7109	12.1937	0.54284	0.0827:0.0:0.9173:0.0	.	563;563	Q96T37-3;Q96T37	.;RBM15_HUMAN	A	563	ENSP00000358799:G563A	ENSP00000358799:G563A	G	+	2	0	RBM15	110685238	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.323000	0.52014	1.092000	0.41356	0.655000	0.94253	GGT		0.547	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768		Missense_Mutation
OR10J3	441911	broad.mit.edu	37	1	159284220	159284220	+	Missense_Mutation	SNP	G	G	T	rs562710413		TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr1:159284220G>T	ENST00000332217.5	-	1	229	c.230C>A	c.(229-231)gCc>gAc	p.A77D		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A77D(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GGGAATGATGGCCACAGTGTA	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											162.0	155.0	157.0					1																	159284220		2203	4300	6503	157550844	SO:0001583	missense	441911				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.230C>A	1.37:g.159284220G>T	ENSP00000331789:p.Ala77Asp	Unknown		x	x	x	157550844		Missense_Mutation	SNP	ENST00000332217.5	37	CCDS30909.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054431	0.36277	.	.	ENSG00000196266	ENST00000332217	T	0.00473	7.18	5.4	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32719	U	0.005729	T	0.00271	0.0008	L	0.60455	1.87	0.25979	N	0.982398	P	0.39831	0.69	P	0.47075	0.536	T	0.40289	-0.9571	10	0.87932	D	0	.	6.7243	0.23348	0.0876:0.0:0.7369:0.1755	.	77	Q5JRS4	O10J3_HUMAN	D	77	ENSP00000331789:A77D	ENSP00000331789:A77D	A	-	2	0	OR10J3	157550844	0.000000	0.05858	0.999000	0.59377	0.484000	0.33280	-0.297000	0.08276	1.511000	0.48818	0.561000	0.74099	GCC		0.488	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			Missense_Mutation
TOR1AIP2	163590	broad.mit.edu	37	1	179820119	179820119	+	Silent	SNP	G	G	C	rs143074105	byFrequency	TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr1:179820119G>C	ENST00000367612.3	-	4	801	c.414C>G	c.(412-414)gcC>gcG	p.A138A	TOR1AIP2_ENST00000609928.1_Silent_p.A138A	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0								p.A138A(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						CCTTAGGGAGGGCCACAGAGC	0.547																																																1	Substitution - coding silent(1)	ovary(1)	1											100.0	96.0	97.0					1																	179820119		2203	4300	6503	178086742	SO:0001819	synonymous_variant	163590				CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.414C>G	1.37:g.179820119G>C		Unknown		x	x	x	178086742	Q05BU2	Silent	SNP	ENST00000367612.3	37	CCDS1334.1	SNP	43	Broad																																																																																				0.547	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034		Silent
KIF21B	23046	broad.mit.edu	37	1	200972807	200972807	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr1:200972807C>G	ENST00000422435.2	-	8	1435	c.1119G>C	c.(1117-1119)aaG>aaC	p.K373N	KIF21B_ENST00000461742.2_Missense_Mutation_p.K373N|KIF21B_ENST00000360529.5_Missense_Mutation_p.K373N|KIF21B_ENST00000332129.2_Missense_Mutation_p.K373N	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	373					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K373N(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TCACTACCACCTTGTTCTTGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											193.0	148.0	164.0					1																	200972807		2203	4300	6503	199239430	SO:0001583	missense	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.1119G>C	1.37:g.200972807C>G	ENSP00000411831:p.Lys373Asn	Unknown		x	x	x	199239430	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	c	17.19	3.325635	0.60743	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	5.19	3.29	0.37713	Kinesin, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.81541	0.4844	M	0.86178	2.8	0.58432	D	0.999999	D;D;D;D	0.63880	0.989;0.989;0.969;0.993	P;P;B;P	0.58210	0.688;0.688;0.306;0.835	T	0.79871	-0.1620	10	0.87932	D	0	.	4.6167	0.12430	0.1531:0.6025:0.0:0.2444	.	373;373;373;373	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	N	373	ENSP00000328494:K373N;ENSP00000353724:K373N;ENSP00000433808:K373N;ENSP00000411831:K373N	ENSP00000328494:K373N	K	-	3	2	KIF21B	199239430	0.993000	0.37304	1.000000	0.80357	0.993000	0.82548	0.430000	0.21428	0.555000	0.29079	0.645000	0.84053	AAG		0.537	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		Missense_Mutation
CUL2	8453	broad.mit.edu	37	10	35317783	35317783	+	Silent	SNP	T	T	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr10:35317783T>C	ENST00000374748.1	-	17	1885	c.1572A>G	c.(1570-1572)tcA>tcG	p.S524S	CUL2_ENST00000374749.3_Silent_p.S524S|CUL2_ENST00000374751.3_Silent_p.S524S|CUL2_ENST00000602371.1_Silent_p.S467S|CUL2_ENST00000374742.1_Silent_p.S524S|CUL2_ENST00000374746.1_Silent_p.S524S|CUL2_ENST00000537177.1_Silent_p.S543S			Q13617	CUL2_HUMAN	cullin 2	524					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)	p.S524S(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						CAAACGTAGATGAAGGAGCCT	0.318																																																1	Substitution - coding silent(1)	ovary(1)	10											43.0	45.0	44.0					10																	35317783		2203	4300	6503	35357789	SO:0001819	synonymous_variant	8453			U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.1572A>G	10.37:g.35317783T>C		Unknown		x	x	x	35357789	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Silent	SNP	ENST00000374748.1	37	CCDS7179.1	SNP	51	Broad																																																																																				0.318	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591		Silent
ERCC6	2074	broad.mit.edu	37	10	50738887	50738887	+	Splice_Site	SNP	C	C	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr10:50738887C>A	ENST00000355832.5	-	3	501		c.e3-1		ERCC6-PGBD3_ENST00000515869.1_Splice_Site|PGBD3_ENST00000603152.1_Splice_Site|ERCC6-PGBD3_ENST00000447839.2_Splice_Site	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6						activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CGTACATGACCTGAAAAATAA	0.328								Direct reversal of damage;Nucleotide excision repair (NER)																																								0			10											119.0	112.0	114.0					10																	50738887		2202	4299	6501	50408893	SO:0001630	splice_region_variant	2074			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.423-1G>T	10.37:g.50738887C>A		Unknown		x	x	x	50408893	D3DX94|Q5W0L9	Splice_Site_SNP	SNP	ENST00000355832.5	37	CCDS7229.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964278	0.74131	.	.	ENSG00000225830;ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000462247;ENST00000515869;ENST00000447839	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.241	0.93883	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERCC6;RP11-123B3.6	50408893	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.311000	0.78958	2.556000	0.86216	0.557000	0.71058	.		0.328	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	Intron	Splice_Site_SNP
AGAP4	119016	broad.mit.edu	37	10	51225050	51225050	+	Silent	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr10:51225050G>T	ENST00000425119.2	-	7	2057	c.1932C>A	c.(1930-1932)gcC>gcA	p.A644A	AGAP8_ENST00000602930.1_Silent_p.A628A	NM_001077686.1|NM_001276344.1	NP_001071154.1|NP_001263273.1	Q5SRD3	AGAP8_HUMAN		644					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.A644A(1)		breast(1)|endometrium(1)|lung(2)|ovary(2)	6						CCTGGCTGGAGGCCTGCCGGG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	10											15.0	18.0	17.0					10																	51225050		853	1943	2796	50895056	SO:0001819	synonymous_variant	728404																														ENST00000425119.2:c.1932C>A	10.37:g.51225050G>T		Unknown		x	x	x	50895056		Silent	SNP	ENST00000425119.2	37	CCDS41522.1	SNP	35	Broad																																																																																				0.587	AGAP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048022.2			Silent
ATRNL1	26033	broad.mit.edu	37	10	117026310	117026310	+	Silent	SNP	C	C	T	rs267602377		TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr10:117026310C>T	ENST00000355044.3	+	12	1935	c.1809C>T	c.(1807-1809)ctC>ctT	p.L603L		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	603					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.L603L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CTAGTGTACTCCTTAATGATA	0.333																																																1	Substitution - coding silent(1)	ovary(1)	10											78.0	85.0	83.0					10																	117026310		2203	4300	6503	117016300	SO:0001819	synonymous_variant	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1809C>T	10.37:g.117026310C>T		Unknown		x	x	x	117016300	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	CCDS7592.1	SNP	30	Broad																																																																																				0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		Silent
OS9	10956	broad.mit.edu	37	12	58112052	58112052	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr12:58112052G>C	ENST00000315970.7	+	11	1299	c.1258G>C	c.(1258-1260)Gat>Cat	p.D420H	OS9_ENST00000439210.2_Missense_Mutation_p.D361H|OS9_ENST00000389142.5_Missense_Mutation_p.D420H|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000257966.8_Missense_Mutation_p.D421H|OS9_ENST00000551035.1_Missense_Mutation_p.D388H|OS9_ENST00000413095.2_Missense_Mutation_p.D214H|OS9_ENST00000552285.1_Missense_Mutation_p.D420H|OS9_ENST00000389146.6_Missense_Mutation_p.D420H|OS9_ENST00000435406.2_Missense_Mutation_p.D368H	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	420	Asp/Glu-rich (acidic).				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)	p.D420H(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ggaggatgaggatgaggatga	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											253.0	212.0	226.0					12																	58112052		2203	4300	6503	56398319	SO:0001583	missense	10956			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1258G>C	12.37:g.58112052G>C	ENSP00000318165:p.Asp420His	Unknown		x	x	x	56398319	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	ENST00000315970.7	37	CCDS31843.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304143	0.23736	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	T;T;T;T;T;T;T;T;T	0.32753	1.82;1.73;1.89;1.88;1.44;1.77;1.78;1.76;1.9	3.41	0.823	0.18812	.	0.819619	0.10694	N	0.644857	T	0.33440	0.0863	N	0.24115	0.695	0.09310	N	1	D;P;D;P;B;P;P;P	0.71674	0.966;0.801;0.998;0.771;0.38;0.661;0.661;0.814	P;P;D;P;B;B;B;P	0.68943	0.62;0.742;0.961;0.632;0.332;0.429;0.429;0.534	T	0.14587	-1.0467	10	0.52906	T	0.07	.	4.1068	0.10040	0.2798:0.2051:0.5151:0.0	.	361;388;214;421;420;420;420;420	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	H	420;420;361;420;214;388;421;368;420	ENSP00000450010:D420H;ENSP00000318165:D420H;ENSP00000407360:D361H;ENSP00000373798:D420H;ENSP00000413112:D214H;ENSP00000447866:D388H;ENSP00000257966:D421H;ENSP00000389632:D368H;ENSP00000373794:D420H	ENSP00000257966:D421H	D	+	1	0	OS9	56398319	0.785000	0.28726	0.020000	0.16555	0.305000	0.27757	0.409000	0.21082	0.219000	0.20840	0.467000	0.42956	GAT		0.542	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408344.1	NM_006812		Missense_Mutation
ATP12A	479	broad.mit.edu	37	13	25274938	25274938	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr13:25274938G>T	ENST00000381946.3	+	13	1926	c.1759G>T	c.(1759-1761)Gac>Tac	p.D587Y	ATP12A_ENST00000218548.6_Missense_Mutation_p.D593Y|RNY1P7_ENST00000384743.1_RNA			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	587					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.D587Y(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CTACTCATTTGACATAGACGC	0.463																																					Pancreas(156;1582 1935 18898 22665 26498)											1	Substitution - Missense(1)	ovary(1)	13											134.0	123.0	127.0					13																	25274938		2203	4300	6503	24172938	SO:0001583	missense	479			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1759G>T	13.37:g.25274938G>T	ENSP00000371372:p.Asp587Tyr	Unknown		x	x	x	24172938	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978242	0.53720	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.81499	-1.5;-1.5	6.17	5.32	0.75619	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.063239	0.64402	D	0.000005	D	0.88713	0.6511	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	D	0.89063	0.3464	10	0.87932	D	0	.	12.5938	0.56456	0.0785:0.0:0.9215:0.0	.	593;587	P54707-2;P54707	.;AT12A_HUMAN	Y	593;587	ENSP00000218548:D593Y;ENSP00000371372:D587Y	ENSP00000218548:D593Y	D	+	1	0	ATP12A	24172938	1.000000	0.71417	0.992000	0.48379	0.014000	0.08584	7.908000	0.87438	2.941000	0.99782	0.655000	0.94253	GAC		0.463	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		Missense_Mutation
MYO16	23026	broad.mit.edu	37	13	109793693	109793693	+	Silent	SNP	C	C	T	rs147270616	byFrequency	TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr13:109793693C>T	ENST00000357550.2	+	31	5108	c.5067C>T	c.(5065-5067)tcC>tcT	p.S1689S	MYO16_ENST00000356711.2_Silent_p.S1689S	NM_001198950.1	NP_001185879.1			myosin XVI									p.S1689S(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TTCGGAAATCCGCGGCGGGAA	0.627													C|||	3	0.000599042	0.0023	0.0	5008	,	,		11649	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	13											17.0	16.0	16.0					13																	109793693		2192	4270	6462	108591694	SO:0001819	synonymous_variant	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.5067C>T	13.37:g.109793693C>T		Unknown		x	x	x	108591694		Silent	SNP	ENST00000357550.2	37	CCDS32008.1	SNP	23	Broad																																																																																				0.627	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		Silent
GOLGA5	9950	broad.mit.edu	37	14	93282749	93282749	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr14:93282749C>T	ENST00000163416.2	+	7	1730	c.1474C>T	c.(1474-1476)Ctc>Ttc	p.L492F	GOLGA5_ENST00000355976.2_Missense_Mutation_p.L492F	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	492					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.L492F(1)		large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		GATACATCAGCTCAGATCCGA	0.468			T	RET	papillary thyroid																																		Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	1	Substitution - Missense(1)	ovary(1)	14											107.0	103.0	105.0					14																	93282749		2203	4300	6503	92352502	SO:0001583	missense	9950			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.1474C>T	14.37:g.93282749C>T	ENSP00000163416:p.Leu492Phe	Unknown		x	x	x	92352502	C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	ENST00000163416.2	37	CCDS9905.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577527	0.65878	.	.	ENSG00000066455	ENST00000163416;ENST00000355976;ENST00000439315	T;T	0.48836	0.8;0.8	5.28	4.39	0.52855	.	0.200004	0.24415	N	0.038735	T	0.63674	0.2531	M	0.73217	2.22	0.53688	D	0.999978	D	0.71674	0.998	D	0.70716	0.97	T	0.64127	-0.6480	10	0.51188	T	0.08	-9.2157	9.7576	0.40513	0.1477:0.7768:0.0:0.0755	.	492	Q8TBA6	GOGA5_HUMAN	F	492;492;401	ENSP00000163416:L492F;ENSP00000348252:L492F	ENSP00000163416:L492F	L	+	1	0	GOLGA5	92352502	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	2.243000	0.43115	1.217000	0.43442	0.655000	0.94253	CTC		0.468	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412365.1			Missense_Mutation
UNC79	57578	broad.mit.edu	37	14	94109952	94109952	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr14:94109952G>C	ENST00000393151.2	+	35	6070	c.6070G>C	c.(6070-6072)Ggg>Cgg	p.G2024R	UNC79_ENST00000256339.4_Missense_Mutation_p.G1847R|UNC79_ENST00000555664.1_Missense_Mutation_p.G1985R|UNC79_ENST00000553484.1_Missense_Mutation_p.G2046R			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2024					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1847R(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGAGACACTTGGGCTAGCCAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	14											158.0	133.0	141.0					14																	94109952		2203	4300	6503	93179705	SO:0001583	missense	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6070G>C	14.37:g.94109952G>C	ENSP00000376858:p.Gly2024Arg	Unknown		x	x	x	93179705	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319046	0.81469	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.95	5.95	0.96441	.	0.098865	0.64402	D	0.000001	T	0.50343	0.1610	M	0.62723	1.935	0.50632	D	0.999882	P	0.48162	0.906	P	0.54499	0.754	T	0.45440	-0.9261	10	0.87932	D	0	-17.8019	20.3931	0.98965	0.0:0.0:1.0:0.0	.	2046	C9JQL1	.	R	1847;1985;2046;2024;2046	ENSP00000256339:G1847R;ENSP00000450868:G1985R;ENSP00000451360:G2046R;ENSP00000376858:G2024R	ENSP00000256339:G1847R	G	+	1	0	KIAA1409	93179705	1.000000	0.71417	0.949000	0.38748	0.887000	0.51463	5.401000	0.66326	2.824000	0.97209	0.655000	0.94253	GGG		0.498	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		Missense_Mutation
IQCH	64799	broad.mit.edu	37	15	67786632	67786632	+	Silent	SNP	C	C	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr15:67786632C>T	ENST00000335894.4	+	20	2964	c.2898C>T	c.(2896-2898)acC>acT	p.T966T	IQCH_ENST00000358767.3_Missense_Mutation_p.L682F|IQCH_ENST00000360277.4_Missense_Mutation_p.L607F|IQCH_ENST00000546225.1_Silent_p.T623T|IQCH-AS1_ENST00000559298.1_lincRNA	NM_001031715.2	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H	966								p.T966T(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(2)|pancreas(2)|skin(5)|upper_aerodigestive_tract(1)	33				Colorectal(3;0.0856)		TCCTCATGACCTTTGCTCGCC	0.413																																																1	Substitution - coding silent(1)	ovary(1)	15											101.0	87.0	92.0					15																	67786632		2201	4299	6500	65573686	SO:0001819	synonymous_variant	64799			AY014282	CCDS10223.1, CCDS32273.1, CCDS10223.2, CCDS61680.1, CCDS61681.1	15q23	2005-10-24			ENSG00000103599	ENSG00000103599			25721	protein-coding gene	gene with protein product		612523				12477932	Standard	NM_022784		Approved	FLJ12476	uc002aqo.2	Q86VS3	OTTHUMG00000133231	ENST00000335894.4:c.2898C>T	15.37:g.67786632C>T		Unknown		x	x	x	65573686	A8K8W3|C9JPR6|D6RJ88|Q4G0S6|Q8NEH9|Q9BWX2|Q9H9Y1|Q9UF88	Missense_Mutation	SNP	ENST00000335894.4	37	CCDS32273.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596386	0.86953	.	.	ENSG00000103599	ENST00000358767;ENST00000360277	T;T	0.50277	0.77;0.75	5.62	5.62	0.85841	.	.	.	.	.	T	0.72614	0.3482	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75599	-0.3262	8	0.87932	D	0	-27.8105	19.6702	0.95909	0.0:1.0:0.0:0.0	.	607	Q86VS3-4	.	F	682;607	ENSP00000351617:L682F;ENSP00000353419:L607F	ENSP00000351617:L682F	L	+	1	0	IQCH	65573686	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.398000	0.79919	2.665000	0.90641	0.650000	0.86243	CTT		0.413	IQCH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256969.1	NM_022784		Missense_Mutation
BLM	641	broad.mit.edu	37	15	91352450	91352450	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr15:91352450A>G	ENST00000355112.3	+	20	3953	c.3835A>G	c.(3835-3837)Att>Gtt	p.I1279V	BLM_ENST00000560509.1_Missense_Mutation_p.I1148V|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1279	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.I1279V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TGCGGAAGTGATTTCAGTATT	0.403			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	1	Substitution - Missense(1)	ovary(1)	15											174.0	168.0	170.0					15																	91352450		2198	4298	6496	89153454	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.3835A>G	15.37:g.91352450A>G	ENSP00000347232:p.Ile1279Val	Unknown		x	x	x	89153454	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015444	0.54468	.	.	ENSG00000197299	ENST00000355112;ENST00000536925;ENST00000543977	T	0.50548	0.74	5.88	5.88	0.94601	HRDC-like (1);Helicase/RNase D C-terminal, HRDC domain (3);	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	L	0.53249	1.67	0.27069	N	0.963365	B;B	0.24963	0.025;0.115	B;B	0.44224	0.127;0.444	T	0.59182	-0.7502	10	0.56958	D	0.05	0.0978	14.2535	0.66035	1.0:0.0:0.0:0.0	.	1279;1279	B2RAN0;P54132	.;BLM_HUMAN	V	1279;909;466	ENSP00000347232:I1279V	ENSP00000347232:I1279V	I	+	1	0	BLM	89153454	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.589000	0.67523	2.239000	0.73571	0.533000	0.62120	ATT		0.403	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			Missense_Mutation
CCNF	899	broad.mit.edu	37	16	2503300	2503300	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr16:2503300G>A	ENST00000397066.4	+	14	1665	c.1577G>A	c.(1576-1578)aGc>aAc	p.S526N	RP11-715J22.4_ENST00000566085.1_lincRNA|RP11-715J22.3_ENST00000561653.1_RNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	526					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GGAGAAATCAGCCAGGAAGAG	0.627																																																0			16											69.0	70.0	69.0					16																	2503300		2198	4300	6498	2443301	SO:0001583	missense	899			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1577G>A	16.37:g.2503300G>A	ENSP00000380256:p.Ser526Asn	Unknown		x	x	x	2443301	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.50	2.554823	0.45487	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.28069	1.63	4.29	2.12	0.27331	Cyclin, C-terminal (1);Cyclin-like (2);	0.194148	0.56097	N	0.000024	T	0.33000	0.0848	M	0.79614	2.46	0.44268	D	0.997129	B	0.17852	0.024	B	0.21546	0.035	T	0.30208	-0.9986	10	0.87932	D	0	-14.7116	7.9029	0.29744	0.0941:0.1626:0.7433:0.0	.	526	P41002	CCNF_HUMAN	N	526;441	ENSP00000380256:S526N	ENSP00000293968:S441N	S	+	2	0	CCNF	2443301	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.964000	0.70379	0.904000	0.36572	0.563000	0.77884	AGC		0.627	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761		Missense_Mutation
TEKT5	146279	broad.mit.edu	37	16	10721462	10721462	+	Missense_Mutation	SNP	G	G	A	rs201676909		TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr16:10721462G>A	ENST00000283025.2	-	7	1507	c.1436C>T	c.(1435-1437)cCg>cTg	p.P479L	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	479						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.P479L(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CACCAGGCGCGGGGTGCAGGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	16						G	LEU/PRO	1,4393	2.1+/-5.4	0,1,2196	62.0	61.0	61.0		1436	4.0	0.5	16		61	0,8600		0,0,4300	no	missense	TEKT5	NM_144674.1	98	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	benign	479/486	10721462	1,12993	2197	4300	6497	10628963	SO:0001583	missense	146279				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1436C>T	16.37:g.10721462G>A	ENSP00000283025:p.Pro479Leu	Unknown		x	x	x	10628963	A1L3Z3	Missense_Mutation	SNP	ENST00000283025.2	37	CCDS10542.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	5.777	0.327640	0.10956	2.28E-4	0.0	ENSG00000153060	ENST00000283025	T	0.02737	4.18	4.99	4.03	0.46877	.	0.000000	0.56097	D	0.000034	T	0.02267	0.0070	N	0.17723	0.515	0.80722	D	1	B	0.16802	0.019	B	0.15484	0.013	T	0.54543	-0.8278	10	0.22109	T	0.4	-22.4595	10.3428	0.43889	0.0933:0.0:0.9067:0.0	.	479	Q96M29	TEKT5_HUMAN	L	479	ENSP00000283025:P479L	ENSP00000283025:P479L	P	-	2	0	TEKT5	10628963	1.000000	0.71417	0.529000	0.27951	0.922000	0.55478	5.163000	0.64948	1.098000	0.41479	0.505000	0.49811	CCG		0.572	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674		Missense_Mutation
ITGAL	3683	broad.mit.edu	37	16	30507443	30507443	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr16:30507443T>C	ENST00000356798.6	+	14	1709	c.1529T>C	c.(1528-1530)cTg>cCg	p.L510P	RP11-297C4.1_ENST00000563751.1_RNA|ITGAL_ENST00000358164.5_Missense_Mutation_p.L427P|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000568012.1_3'UTR	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	510					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.L510P(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GTCTCAGAGCTGCAGGGGGAC	0.567																																					NSCLC(110;1462 1641 3311 33990 49495)											1	Substitution - Missense(1)	ovary(1)	16											71.0	75.0	74.0					16																	30507443		2197	4300	6497	30414944	SO:0001583	missense	3683				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1529T>C	16.37:g.30507443T>C	ENSP00000349252:p.Leu510Pro	Unknown		x	x	x	30414944	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	16.20	3.057186	0.55325	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.27557	1.66;1.66	5.94	5.94	0.96194	.	0.000000	0.45867	D	0.000330	T	0.66519	0.2797	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.76416	-0.2967	10	0.87932	D	0	.	13.9183	0.63914	0.0:0.0:0.0:1.0	.	427;510	Q96HB1;P20701	.;ITAL_HUMAN	P	510;427	ENSP00000349252:L510P;ENSP00000350886:L427P	ENSP00000349252:L510P	L	+	2	0	ITGAL	30414944	0.966000	0.33281	0.561000	0.28357	0.485000	0.33311	2.800000	0.47900	2.272000	0.75746	0.460000	0.39030	CTG		0.567	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			Missense_Mutation
IRX6	79190	broad.mit.edu	37	16	55361611	55361611	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr16:55361611A>T	ENST00000290552.7	+	4	1859	c.527A>T	c.(526-528)aAg>aTg	p.K176M	RP11-26L20.3_ENST00000558730.2_RNA|IRX6_ENST00000558315.1_3'UTR	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	176					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.K176M(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TACCCCACTAAGGGTGAGAAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											134.0	103.0	114.0					16																	55361611		2198	4300	6498	53919112	SO:0001583	missense	79190			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.527A>T	16.37:g.55361611A>T	ENSP00000290552:p.Lys176Met	Unknown		x	x	x	53919112	B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	37	CCDS32449.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	34	5.316227	0.95655	.	.	ENSG00000159387	ENST00000290552	D	0.92299	-3.01	6.08	6.08	0.98989	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95999	0.8697	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96351	0.9258	10	0.87932	D	0	-34.4914	16.3053	0.82846	1.0:0.0:0.0:0.0	.	176;75	P78412;Q9BZI2	IRX6_HUMAN;.	M	176	ENSP00000290552:K176M	ENSP00000290552:K176M	K	+	2	0	IRX6	53919112	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.230000	0.95299	2.333000	0.79357	0.533000	0.62120	AAG		0.587	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335		Missense_Mutation
GFOD2	81577	broad.mit.edu	37	16	67719598	67719598	+	Silent	SNP	C	C	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr16:67719598C>A	ENST00000268797.7	-	2	366	c.21G>T	c.(19-21)gtG>gtT	p.V7V	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	7					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)	p.V7V(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		CAAACACGCCCACTCCTGGCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	16											60.0	60.0	60.0					16																	67719598		2198	4300	6498	66277099	SO:0001819	synonymous_variant	81577			AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.21G>T	16.37:g.67719598C>A		Unknown		x	x	x	66277099	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Silent	SNP	ENST00000268797.7	37	CCDS10845.1	SNP	21	Broad																																																																																				0.577	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268868.2	NM_030819		Silent
DHODH	1723	broad.mit.edu	37	16	72046163	72046163	+	Splice_Site	SNP	T	T	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr16:72046163T>A	ENST00000219240.4	+	2	255		c.e2+2		DHODH_ENST00000572887.1_Splice_Site|DHODH_ENST00000573922.1_Splice_Site	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)						'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)	p.?(1)		breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GACATGCTGGTAGTGCTCCCA	0.547																																																1	Unknown(1)	ovary(1)	16											40.0	43.0	42.0					16																	72046163		2123	4249	6372	70603664	SO:0001630	splice_region_variant	1723				CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.234+2T>A	16.37:g.72046163T>A		Unknown		x	x	x	70603664	A8K8C8|Q6P176	Splice_Site_SNP	SNP	ENST00000219240.4	37	CCDS42192.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	15.73	2.919083	0.52546	.	.	ENSG00000102967	ENST00000219240	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5495	0.61723	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DHODH	70603664	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	6.411000	0.73298	1.983000	0.57843	0.379000	0.24179	.		0.547	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361	Intron	Splice_Site_SNP
MYBBP1A	10514	broad.mit.edu	37	17	4443019	4443019	+	Silent	SNP	C	C	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr17:4443019C>T	ENST00000254718.4	-	26	3984	c.3678G>A	c.(3676-3678)ggG>ggA	p.G1226G	MYBBP1A_ENST00000381556.2_Silent_p.G1226G			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1226	Required for nuclear and nucleolar localization. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)	p.G1226G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						TGGTTGGCGTCCCGTTTGCCT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	17											97.0	102.0	100.0					17																	4443019		2203	4300	6503	4389768	SO:0001819	synonymous_variant	10514			AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3678G>A	17.37:g.4443019C>T		Unknown		x	x	x	4389768	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	37	CCDS11046.1	SNP	30	Broad																																																																																				0.647	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520		Silent
ZNF652	22834	broad.mit.edu	37	17	47394440	47394440	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr17:47394440A>T	ENST00000362063.2	-	2	966	c.648T>A	c.(646-648)agT>agA	p.S216R	ZNF652_ENST00000430262.2_Missense_Mutation_p.S216R	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	216					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S216R(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			GTGGCTCTACACTCTTCCTAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	104.0	109.0					17																	47394440		2203	4300	6503	44749439	SO:0001583	missense	22834			AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.648T>A	17.37:g.47394440A>T	ENSP00000354686:p.Ser216Arg	Unknown		x	x	x	44749439	A4QPD9|Q5H9Q0	Missense_Mutation	SNP	ENST00000362063.2	37	CCDS32677.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	10.03	1.237509	0.22711	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	T;T	0.08193	3.12;3.12	4.95	1.56	0.23342	.	0.172122	0.64402	D	0.000004	T	0.04815	0.0130	N	0.22421	0.69	0.31892	N	0.61706	B	0.02656	0.0	B	0.01281	0.0	T	0.39502	-0.9611	10	0.11794	T	0.64	-11.7563	8.7227	0.34449	0.5985:0.0:0.4015:0.0	.	216	Q9Y2D9	ZN652_HUMAN	R	216	ENSP00000354686:S216R;ENSP00000416305:S216R	ENSP00000354686:S216R	S	-	3	2	ZNF652	44749439	0.996000	0.38824	1.000000	0.80357	0.984000	0.73092	1.009000	0.29886	0.076000	0.16826	-0.250000	0.11733	AGT		0.517	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364524.1	NM_014897		Missense_Mutation
MYCBPAP	84073	broad.mit.edu	37	17	48596059	48596059	+	Missense_Mutation	SNP	G	G	C	rs200374790		TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr17:48596059G>C	ENST00000323776.5	+	5	917	c.755G>C	c.(754-756)cGg>cCg	p.R252P	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.R215P	NM_032133.4	NP_115509.4			MYCBP associated protein									p.R215P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			ACAGCCCTGCGGAAGAAGCAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	17											69.0	81.0	77.0					17																	48596059		2203	4300	6503	45951058	SO:0001583	missense	84073			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.755G>C	17.37:g.48596059G>C	ENSP00000323184:p.Arg252Pro	Unknown		x	x	x	45951058		Missense_Mutation	SNP	ENST00000323776.5	37	CCDS32680.2	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	23.8	4.463548	0.84425	.	.	ENSG00000136449	ENST00000323776;ENST00000452039;ENST00000436259	T;T;T	0.67345	-0.26;-0.26;-0.26	5.22	5.22	0.72569	.	0.118793	0.53938	D	0.000048	D	0.82582	0.5068	M	0.77103	2.36	0.49687	D	0.999818	D;D	0.76494	0.999;0.999	D;D	0.72982	0.979;0.979	D	0.84338	0.0525	10	0.66056	D	0.02	-11.4075	19.1305	0.93404	0.0:0.0:1.0:0.0	.	215;252	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	P	252;267;215	ENSP00000323184:R252P;ENSP00000407145:R267P;ENSP00000397209:R215P	ENSP00000323184:R252P	R	+	2	0	MYCBPAP	45951058	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.289000	0.72696	2.594000	0.87642	0.563000	0.77884	CGG		0.587	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133		Missense_Mutation
ICAM2	3384	broad.mit.edu	37	17	62082581	62082581	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr17:62082581G>A	ENST00000412356.1	-	4	568	c.214C>T	c.(214-216)Cag>Tag	p.Q72*	ICAM2_ENST00000418105.1_Nonsense_Mutation_p.Q72*|ICAM2_ENST00000578892.1_Nonsense_Mutation_p.Q48*|ICAM2_ENST00000449662.2_Nonsense_Mutation_p.Q72*|ICAM2_ENST00000579788.1_Nonsense_Mutation_p.Q72*|ICAM2_ENST00000581417.1_5'UTR|ICAM2_ENST00000578379.1_5'UTR|ICAM2_ENST00000579687.1_Nonsense_Mutation_p.Q72*	NM_001099786.1	NP_001093256.1	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2	72	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|uropod (GO:0001931)	integrin binding (GO:0005178)	p.Q72*(1)		large_intestine(1)|lung(2)|ovary(1)|skin(2)	6						CACTGAGCCTGTTCGTCCAGC	0.527																																																1	Substitution - Nonsense(1)	ovary(1)	17											155.0	116.0	129.0					17																	62082581		2203	4300	6503	59436313	SO:0001587	stop_gained	3384				CCDS11657.1	17q23.3	2014-01-30			ENSG00000108622	ENSG00000108622		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5345	protein-coding gene	gene with protein product		146630				1769660	Standard	NM_001099786		Approved	CD102	uc002jdx.4	P13598		ENST00000412356.1:c.214C>T	17.37:g.62082581G>A	ENSP00000415283:p.Gln72*	Unknown		x	x	x	59436313	Q14600	Nonsense_Mutation	SNP	ENST00000412356.1	37	CCDS11657.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444762	0.63178	.	.	ENSG00000108622	ENST00000412356;ENST00000418105;ENST00000449662	.	.	.	5.14	-5.41	0.02648	.	1.324640	0.04951	N	0.460390	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-2.495	9.0555	0.36403	0.0797:0.64:0.1744:0.1059	.	.	.	.	X	72	.	ENSP00000415283:Q72X	Q	-	1	0	ICAM2	59436313	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.291000	0.08343	-0.389000	0.07786	-0.311000	0.09066	CAG		0.527	ICAM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443687.1			Nonsense_Mutation
BPTF	2186	broad.mit.edu	37	17	65907750	65907750	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr17:65907750G>T	ENST00000321892.4	+	13	4189	c.4128G>T	c.(4126-4128)aaG>aaT	p.K1376N	BPTF_ENST00000335221.5_Missense_Mutation_p.K1376N|BPTF_ENST00000424123.3_Missense_Mutation_p.K1237N|BPTF_ENST00000306378.6_Missense_Mutation_p.K1250N			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1376					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K1250N(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTCTTCCAAGAGTGCTTTAC	0.418																																																1	Substitution - Missense(1)	ovary(1)	17											92.0	88.0	89.0					17																	65907750		2203	4300	6503	63338212	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.4128G>T	17.37:g.65907750G>T	ENSP00000315454:p.Lys1376Asn	Unknown		x	x	x	63338212	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	2.363	-0.346192	0.05208	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.62364	0.04;0.04;0.03	5.72	2.26	0.28386	.	.	.	.	.	T	0.39517	0.1081	N	0.19112	0.55	0.09310	N	1	B;B	0.34015	0.157;0.435	B;B	0.24155	0.051;0.037	T	0.29971	-0.9994	9	0.72032	D	0.01	-0.0773	4.7878	0.13234	0.1958:0.0:0.4437:0.3605	.	1250;1376	Q12830-2;Q12830-4	.;.	N	1250;1376;1376	ENSP00000307208:K1250N;ENSP00000334351:K1376N;ENSP00000315454:K1376N	ENSP00000307208:K1250N	K	+	3	2	BPTF	63338212	0.458000	0.25760	0.212000	0.23672	0.696000	0.40369	0.893000	0.28336	0.727000	0.32360	0.650000	0.86243	AAG		0.418	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459		Missense_Mutation
CLUL1	27098	broad.mit.edu	37	18	645002	645002	+	Silent	SNP	C	C	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr18:645002C>G	ENST00000400606.2	+	8	1447	c.1302C>G	c.(1300-1302)ctC>ctG	p.L434L	CLUL1_ENST00000338387.7_Silent_p.L434L|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000581619.1_Silent_p.L459L|CLUL1_ENST00000540035.1_Silent_p.L486L|CLUL1_ENST00000579494.1_Silent_p.L434L	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	434					cell death (GO:0008219)	extracellular region (GO:0005576)		p.L434L(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						ATTTCACACTCAAGATCCCTC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	18											105.0	97.0	100.0					18																	645002		1854	4094	5948	635002	SO:0001819	synonymous_variant	27098			D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1302C>G	18.37:g.645002C>G		Unknown		x	x	x	635002	A0FDN7	Silent	SNP	ENST00000400606.2	37	CCDS42405.1	SNP	29	Broad																																																																																				0.378	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			Silent
INSR	3643	broad.mit.edu	37	19	7143008	7143008	+	Silent	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr19:7143008G>A	ENST00000302850.5	-	12	2503	c.2361C>T	c.(2359-2361)agC>agT	p.S787S	INSR_ENST00000341500.5_Silent_p.S775S	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	787	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.S787S(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCGTGGGCACGCTGGTCGAGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	19											94.0	64.0	74.0					19																	7143008		2203	4300	6503	7094008	SO:0001819	synonymous_variant	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2361C>T	19.37:g.7143008G>A		Unknown		x	x	x	7094008	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	CCDS12176.1	SNP	38	Broad																																																																																				0.612	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			Silent
EPOR	2057	broad.mit.edu	37	19	11488790	11488790	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr19:11488790G>A	ENST00000222139.6	-	8	1501	c.1397C>T	c.(1396-1398)aCt>aTt	p.T466I	EPOR_ENST00000592375.2_3'UTR	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	466					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)	p.T466I(1)		endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	GCTGTAGTCAGTTGAGATGCC	0.587											OREG0025254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											79.0	84.0	83.0					19																	11488790		2203	4300	6503	11349790	SO:0001583	missense	2057			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.1397C>T	19.37:g.11488790G>A	ENSP00000222139:p.Thr466Ile	Unknown	672	x	x	x	11349790	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	ENST00000222139.6	37	CCDS12260.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344614	0.41498	.	.	ENSG00000187266	ENST00000222139	T	0.52983	0.64	4.82	4.82	0.62117	.	0.341069	0.21376	N	0.075554	T	0.32466	0.0830	L	0.27053	0.805	0.19575	N	0.999962	P	0.40476	0.718	B	0.36885	0.235	T	0.14896	-1.0456	10	0.12430	T	0.62	-46.6304	14.8059	0.69956	0.0:0.0:1.0:0.0	.	466	P19235	EPOR_HUMAN	I	466	ENSP00000222139:T466I	ENSP00000222139:T466I	T	-	2	0	EPOR	11349790	0.954000	0.32549	0.194000	0.23346	0.942000	0.58702	4.497000	0.60367	2.210000	0.71456	0.555000	0.69702	ACT		0.587	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1			Missense_Mutation
DHX34	9704	broad.mit.edu	37	19	47856442	47856442	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr19:47856442A>T	ENST00000328771.4	+	2	504	c.155A>T	c.(154-156)cAg>cTg	p.Q52L		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	52					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.Q52L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		TACATCCGTCAGGGTTCTGAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	19											74.0	74.0	74.0					19																	47856442		2203	4300	6503	52548282	SO:0001583	missense	9704			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.155A>T	19.37:g.47856442A>T	ENSP00000331907:p.Gln52Leu	Unknown		x	x	x	52548282	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	14.82	2.648991	0.47362	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.02631	4.22	5.84	0.25	0.15535	.	0.635768	0.14792	N	0.298154	T	0.02230	0.0069	L	0.29908	0.895	0.22858	N	0.998643	B;B	0.26195	0.144;0.049	B;B	0.18561	0.021;0.022	T	0.42699	-0.9436	10	0.66056	D	0.02	-16.2098	5.4474	0.16544	0.4465:0.244:0.3094:0.0	.	52;52	Q14147;B4E3G3	DHX34_HUMAN;.	L	52	ENSP00000331907:Q52L	ENSP00000257252:Q52L	Q	+	2	0	DHX34	52548282	0.936000	0.31750	1.000000	0.80357	0.971000	0.66376	0.331000	0.19733	0.306000	0.22856	0.454000	0.30748	CAG		0.522	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681		Missense_Mutation
FAM179A	165186	broad.mit.edu	37	2	29240042	29240042	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr2:29240042C>A	ENST00000379558.4	+	9	1418	c.1067C>A	c.(1066-1068)tCt>tAt	p.S356Y	FAM179A_ENST00000403861.2_Missense_Mutation_p.S356Y|FAM179A_ENST00000465300.1_Intron	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	356								p.S356Y(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ATCTCCAAGTCTGCCCGGGAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											118.0	122.0	121.0					2																	29240042		2021	4181	6202	29093546	SO:0001583	missense	165186			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.1067C>A	2.37:g.29240042C>A	ENSP00000368876:p.Ser356Tyr	Unknown		x	x	x	29093546	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	37	CCDS1769.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609677	0.66558	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.36340	2.1;1.26	4.75	4.75	0.60458	.	.	.	.	.	T	0.52058	0.1711	L	0.36672	1.1	0.35675	D	0.813599	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.63839	-0.6546	9	0.87932	D	0	.	17.6981	0.88288	0.0:1.0:0.0:0.0	.	356;356	F8W8E4;Q6ZUX3	.;F179A_HUMAN	Y	356	ENSP00000368876:S356Y;ENSP00000384699:S356Y	ENSP00000368876:S356Y	S	+	2	0	FAM179A	29093546	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	2.963000	0.49184	2.334000	0.79466	0.591000	0.81541	TCT		0.502	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280		Missense_Mutation
RIF1	55183	broad.mit.edu	37	2	152293856	152293856	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr2:152293856G>C	ENST00000243326.5	+	12	1957	c.1474G>C	c.(1474-1476)Gat>Cat	p.D492H	RIF1_ENST00000444746.2_Missense_Mutation_p.D492H|RIF1_ENST00000453091.2_Missense_Mutation_p.D492H|RIF1_ENST00000433166.2_3'UTR|RIF1_ENST00000428287.2_Missense_Mutation_p.D492H|RIF1_ENST00000430328.2_Missense_Mutation_p.D492H			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.D492H(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AGTTGGAAAAGATGCCCCCGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											91.0	88.0	89.0					2																	152293856		2203	4300	6503	152002102	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.1474G>C	2.37:g.152293856G>C	ENSP00000243326:p.Asp492His	Unknown		x	x	x	152002102	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.09|10.09	1.254771|1.254771	0.22965|0.22965	.|.	.|.	ENSG00000080345|ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328|ENST00000414861	T;T;T;T;T|.	0.64085|.	-0.08;-0.08;-0.08;-0.08;-0.08|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.095236|.	0.64402|.	D|.	0.000001|.	T|T	0.69522|0.69522	0.3120|0.3120	L|L	0.48362|0.48362	1.52|1.52	0.80722|0.80722	D|D	1|1	P;D|.	0.69078|.	0.892;0.997|.	B;D|.	0.64776|.	0.253;0.929|.	T|T	0.64803|0.64803	-0.6321|-0.6321	10|5	0.37606|.	T|.	0.19|.	-14.2986|-14.2986	19.2552|19.2552	0.93943|0.93943	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	492;492|.	Q5UIP0;Q5UIP0-2|.	RIF1_HUMAN;.|.	H|T	492|483	ENSP00000390181:D492H;ENSP00000414615:D492H;ENSP00000415691:D492H;ENSP00000243326:D492H;ENSP00000416123:D492H|.	ENSP00000243326:D492H|.	D|R	+|+	1|2	0|0	RIF1|RIF1	152002102|152002102	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.022000|0.022000	0.10575|0.10575	7.208000|7.208000	0.77907|0.77907	2.729000|2.729000	0.93468|0.93468	0.460000|0.460000	0.39030|0.39030	GAT|AGA		0.393	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			Missense_Mutation
MARS2	92935	broad.mit.edu	37	2	198571020	198571020	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr2:198571020C>G	ENST00000282276.6	+	1	934	c.891C>G	c.(889-891)ttC>ttG	p.F297L	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	297					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.F297L(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	ATGCTGAGTTCAAATCTTGGT	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											72.0	75.0	74.0					2																	198571020		2203	4300	6503	198279265	SO:0001583	missense	92935			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.891C>G	2.37:g.198571020C>G	ENSP00000282276:p.Phe297Leu	Unknown		x	x	x	198279265	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	CCDS33358.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	7.555	0.663494	0.14710	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.43294	0.95	4.59	1.67	0.24075	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.446016	0.23991	N	0.042562	T	0.21801	0.0525	N	0.12961	0.28	0.09310	N	1	B	0.11235	0.004	B	0.17098	0.017	T	0.12319	-1.0552	10	0.46703	T	0.11	-17.7528	4.8074	0.13326	0.0:0.5051:0.2817:0.2132	.	297	Q96GW9	SYMM_HUMAN	L	297;224	ENSP00000282276:F297L	ENSP00000282276:F297L	F	+	3	2	MARS2	198279265	0.001000	0.12720	0.984000	0.44739	0.998000	0.95712	0.002000	0.13061	0.569000	0.29329	0.655000	0.94253	TTC		0.532	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		Missense_Mutation
UGT1A9	54600	broad.mit.edu	37	2	234580975	234580975	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr2:234580975A>T	ENST00000354728.4	+	1	477	c.395A>T	c.(394-396)aAa>aTa	p.K132I	UGT1A1_ENST00000609637.1_Missense_Mutation_p.K132I|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	132					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)	p.K132I(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	AAAGACAAAAAATTAGTAGAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	102.0	102.0					2																	234580975		2203	4300	6503	234245714	SO:0001583	missense	54600			AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.395A>T	2.37:g.234580975A>T	ENSP00000346768:p.Lys132Ile	Unknown		x	x	x	234245714	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115582	0.37339	.	.	ENSG00000241119	ENST00000354728	T	0.61158	0.13	3.41	3.41	0.39046	.	.	.	.	.	T	0.76407	0.3983	M	0.85197	2.74	0.09310	N	1	D;D	0.63046	0.992;0.992	D;D	0.69142	0.962;0.962	T	0.66408	-0.5931	9	0.72032	D	0.01	.	12.3465	0.55124	1.0:0.0:0.0:0.0	.	132;132	Q5DSZ5;O60656	.;UD19_HUMAN	I	132	ENSP00000346768:K132I	ENSP00000346768:K132I	K	+	2	0	UGT1A9	234245714	0.578000	0.26717	0.024000	0.17045	0.502000	0.33828	3.466000	0.53071	1.552000	0.49463	0.362000	0.22060	AAA		0.323	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027		Missense_Mutation
SCLY	51540	broad.mit.edu	37	2	239003059	239003059	+	Splice_Site	SNP	A	A	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr2:239003059A>C	ENST00000555827.1	+	10	1069		c.e10-1		SCLY_ENST00000429612.2_Splice_Site|SCLY_ENST00000422984.2_Splice_Site|SCLY_ENST00000254663.6_Splice_Site			Q96I15	SCLY_HUMAN	selenocysteine lyase						cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)	p.?(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		TATTTTTTTCAGGCTGAATTC	0.458																																					Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)											1	Unknown(1)	ovary(1)	2											77.0	87.0	83.0					2																	239003059		2203	4300	6503	238667798	SO:0001630	splice_region_variant	51540			AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.1006-1A>C	2.37:g.239003059A>C		Unknown		x	x	x	238667798	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Splice_Site_SNP	SNP	ENST00000555827.1	37		SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	a	8.068	0.769658	0.15983	.	.	ENSG00000132330	ENST00000254663;ENST00000555827;ENST00000422984;ENST00000412508;ENST00000429612;ENST00000437134;ENST00000450965;ENST00000433750	.	.	.	4.83	3.65	0.41850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7423	0.34564	0.8311:0.0:0.0:0.1689	.	.	.	.	.	-1	.	.	.	+	.	.	SCLY	238667798	1.000000	0.71417	0.696000	0.30242	0.067000	0.16453	5.279000	0.65597	0.673000	0.31224	0.492000	0.49549	.		0.458	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510	Intron	Splice_Site_SNP
SYCP2	10388	broad.mit.edu	37	20	58448984	58448984	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr20:58448984G>A	ENST00000357552.3	-	35	3707	c.3482C>T	c.(3481-3483)tCa>tTa	p.S1161L	SYCP2_ENST00000371001.2_Missense_Mutation_p.S1161L			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1161					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.S1161L(1)		NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GTTTTTGGGTGACTTTATTGT	0.343																																																1	Substitution - Missense(1)	ovary(1)	20											160.0	139.0	146.0					20																	58448984		2203	4300	6503	57882379	SO:0001583	missense	10388			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3482C>T	20.37:g.58448984G>A	ENSP00000350162:p.Ser1161Leu	Unknown		x	x	x	57882379	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391983	0.62066	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.18502	2.21;2.21	4.68	3.73	0.42828	.	0.529823	0.17238	N	0.181654	T	0.19967	0.0480	M	0.64997	1.995	0.32197	N	0.578264	B	0.23540	0.087	B	0.25759	0.063	T	0.14980	-1.0453	10	0.87932	D	0	-1.9543	10.2094	0.43132	0.0935:0.0:0.9065:0.0	.	1161	Q9BX26	SYCP2_HUMAN	L	1161	ENSP00000360040:S1161L;ENSP00000350162:S1161L	ENSP00000350162:S1161L	S	-	2	0	SYCP2	57882379	0.738000	0.28186	0.380000	0.26093	0.864000	0.49448	2.397000	0.44477	1.348000	0.45733	-0.251000	0.11542	TCA		0.343	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258		Missense_Mutation
PIWIL3	440822	broad.mit.edu	37	22	25150089	25150089	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr22:25150089C>G	ENST00000332271.5	-	8	1285	c.869G>C	c.(868-870)cGa>cCa	p.R290P	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Missense_Mutation_p.R181P|PIWIL3_ENST00000527701.1_Missense_Mutation_p.R181P	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	290	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.R290P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AGTTTCTATTCGGAGCAGTTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	22											124.0	122.0	123.0					22																	25150089		2203	4300	6503	23480089	SO:0001583	missense	440822			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.869G>C	22.37:g.25150089C>G	ENSP00000330031:p.Arg290Pro	Unknown		x	x	x	23480089		Missense_Mutation	SNP	ENST00000332271.5	37	CCDS33623.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	8.460	0.855106	0.17106	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.15487	2.42;2.42;2.42	2.42	0.293	0.15742	Argonaute/Dicer protein, PAZ (1);	0.000000	0.64402	U	0.000001	T	0.39279	0.1072	M	0.87180	2.865	0.22317	N	0.999202	D;D;D	0.89917	1.0;0.974;1.0	D;D;D	0.97110	1.0;0.909;0.998	T	0.11470	-1.0586	10	0.87932	D	0	-3.4131	6.187	0.20503	0.0:0.7142:0.0:0.2858	.	181;290;290	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	P	290;181;181	ENSP00000330031:R290P;ENSP00000431843:R181P;ENSP00000435718:R181P	ENSP00000330031:R290P	R	-	2	0	PIWIL3	23480089	0.910000	0.30920	0.009000	0.14445	0.073000	0.16967	1.356000	0.34079	0.138000	0.18790	0.462000	0.41574	CGA		0.403	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496		Missense_Mutation
PLXNB1	5364	broad.mit.edu	37	3	48461039	48461039	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr3:48461039T>C	ENST00000358536.4	-	11	2925	c.2656A>G	c.(2656-2658)Atc>Gtc	p.I886V	PLXNB1_ENST00000456774.1_Missense_Mutation_p.I703V|PLXNB1_ENST00000296440.6_Missense_Mutation_p.I886V|PLXNB1_ENST00000358459.4_Missense_Mutation_p.I703V|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	886					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.I886V(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GACGGGAGGATGAGGGGGGCG	0.677																																																1	Substitution - Missense(1)	ovary(1)	3											19.0	23.0	22.0					3																	48461039		2174	4244	6418	48436043	SO:0001583	missense	5364			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2656A>G	3.37:g.48461039T>C	ENSP00000351338:p.Ile886Val	Unknown		x	x	x	48436043	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	14.57	2.575996	0.45902	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.03124	4.04;4.07;4.04;4.07	4.8	4.8	0.61643	.	0.291855	0.28889	N	0.013807	T	0.01940	0.0061	N	0.08118	0	0.80722	D	1	P;B	0.38565	0.637;0.367	B;B	0.31614	0.133;0.076	T	0.65463	-0.6162	10	0.16420	T	0.52	.	12.0888	0.53713	0.0:0.0:0.0:1.0	.	886;703	O43157;O43157-2	PLXB1_HUMAN;.	V	886;703;886;703	ENSP00000296440:I886V;ENSP00000351242:I703V;ENSP00000351338:I886V;ENSP00000414199:I703V	ENSP00000296440:I886V	I	-	1	0	PLXNB1	48436043	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.381000	0.44336	1.781000	0.52344	0.379000	0.24179	ATC		0.677	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673		Missense_Mutation
EPHB1	2047	broad.mit.edu	37	3	134670615	134670615	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr3:134670615G>A	ENST00000398015.3	+	3	896	c.526G>A	c.(526-528)Gct>Act	p.A176T	EPHB1_ENST00000488154.1_Intron	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	176	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.A176T(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TTTTTACCTCGCTTTTCAGGA	0.463																																																2	Substitution - Missense(2)	ovary(2)	3											257.0	246.0	250.0					3																	134670615		1915	4137	6052	136153305	SO:0001583	missense	2047			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.526G>A	3.37:g.134670615G>A	ENSP00000381097:p.Ala176Thr	Unknown		x	x	x	136153305	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.073367	0.94000	.	.	ENSG00000154928	ENST00000398015	T	0.23147	1.92	5.49	5.49	0.81192	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.62282	0.2415	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70350	-0.4896	9	.	.	.	.	19.3897	0.94576	0.0:0.0:1.0:0.0	.	176	P54762	EPHB1_HUMAN	T	176	ENSP00000381097:A176T	.	A	+	1	0	EPHB1	136153305	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	9.869000	0.99810	2.578000	0.87016	0.655000	0.94253	GCT		0.463	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		Missense_Mutation
NLGN1	22871	broad.mit.edu	37	3	173525589	173525589	+	Missense_Mutation	SNP	G	G	C	rs142026432		TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr3:173525589G>C	ENST00000457714.1	+	4	1042	c.613G>C	c.(613-615)Gtc>Ctc	p.V205L	NLGN1_ENST00000361589.4_Missense_Mutation_p.V205L|NLGN1_ENST00000401917.3_Missense_Mutation_p.V245L|NLGN1_ENST00000545397.1_Missense_Mutation_p.V205L	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	222					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.V205L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CAATGTGATCGTCATCACAGT	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											164.0	155.0	158.0					3																	173525589		2203	4300	6503	175008283	SO:0001583	missense	22871			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.613G>C	3.37:g.173525589G>C	ENSP00000392500:p.Val205Leu	Unknown		x	x	x	175008283	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.485214	0.96323	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.71934	-0.29;-0.29;-0.61;-0.29;-0.29	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000003	T	0.82176	0.4980	L	0.58969	1.84	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.70016	0.967;0.873	T	0.82458	-0.0447	10	0.54805	T	0.06	.	19.2403	0.93879	0.0:0.0:1.0:0.0	.	245;205	D2X2H5;Q8N2Q7-2	.;.	L	205;205;245;205;245	ENSP00000392500:V205L;ENSP00000354541:V205L;ENSP00000410374:V245L;ENSP00000441108:V205L;ENSP00000385750:V245L	ENSP00000354541:V205L	V	+	1	0	NLGN1	175008283	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.027000	0.88791	2.555000	0.86185	0.557000	0.71058	GTC		0.398	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932		Missense_Mutation
BDH1	622	broad.mit.edu	37	3	197273238	197273238	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr3:197273238C>A	ENST00000392378.2	-	2	387	c.77G>T	c.(76-78)gGa>gTa	p.G26V	BDH1_ENST00000392379.1_Missense_Mutation_p.G26V|BDH1_ENST00000358186.2_Missense_Mutation_p.G26V|BDH1_ENST00000441275.1_Intron	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	26					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)	p.G26V(1)		endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		TTACCTTGCTCCATTTTCTCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	3											126.0	122.0	124.0					3																	197273238		2203	4300	6503	198757635	SO:0001583	missense	622			M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.77G>T	3.37:g.197273238C>A	ENSP00000376183:p.Gly26Val	Unknown		x	x	x	198757635	D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	ENST00000392378.2	37	CCDS3328.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	11.81	1.750858	0.31046	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000432819;ENST00000431056;ENST00000445160	T;T;T;D;D	0.86230	-1.27;-1.27;-1.27;-2.09;-1.71	4.8	3.92	0.45320	.	0.211052	0.48767	D	0.000162	T	0.76941	0.4058	L	0.29908	0.895	0.45962	D	0.99878	B	0.34103	0.437	B	0.26693	0.072	T	0.76372	-0.2983	10	0.56958	D	0.05	.	9.3334	0.38036	0.0:0.8986:0.0:0.1014	.	26	Q02338	BDH_HUMAN	V	26	ENSP00000376183:G26V;ENSP00000350914:G26V;ENSP00000376184:G26V;ENSP00000409849:G26V;ENSP00000396149:G26V	ENSP00000350914:G26V	G	-	2	0	BDH1	198757635	0.012000	0.17670	0.636000	0.29352	0.515000	0.34225	0.666000	0.25097	1.341000	0.45600	0.645000	0.84053	GGA		0.562	BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340267.1	NM_004051		Missense_Mutation
GPRIN3	285513	broad.mit.edu	37	4	90170082	90170082	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr4:90170082T>C	ENST00000609438.1	-	2	1698	c.1180A>G	c.(1180-1182)Att>Gtt	p.I394V	GPRIN3_ENST00000333209.4_Missense_Mutation_p.I394V	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	394								p.I394V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GCTGCCTGAATGTGCACCTGT	0.552																																																1	Substitution - Missense(1)	ovary(1)	4											79.0	81.0	80.0					4																	90170082		2203	4300	6503	90389105	SO:0001583	missense	285513			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.1180A>G	4.37:g.90170082T>C	ENSP00000476603:p.Ile394Val	Unknown		x	x	x	90389105	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	12.42	1.933071	0.34096	.	.	ENSG00000185477	ENST00000333209	T	0.14266	2.52	5.1	3.92	0.45320	.	0.491185	0.15190	N	0.275600	T	0.09247	0.0228	L	0.29908	0.895	0.09310	N	0.999993	B	0.28419	0.211	B	0.26094	0.066	T	0.34527	-0.9825	10	0.19590	T	0.45	-4.0462	7.4683	0.27334	0.0:0.1804:0.0:0.8196	.	394	Q6ZVF9	GRIN3_HUMAN	V	394	ENSP00000328672:I394V	ENSP00000328672:I394V	I	-	1	0	GPRIN3	90389105	0.088000	0.21588	0.474000	0.27266	0.384000	0.30261	0.101000	0.15251	0.963000	0.38082	0.533000	0.62120	ATT		0.552	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		Missense_Mutation
SEC24B	10427	broad.mit.edu	37	4	110427528	110427528	+	Silent	SNP	G	G	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr4:110427528G>A	ENST00000265175.5	+	7	1588	c.1533G>A	c.(1531-1533)ttG>ttA	p.L511L	SEC24B_ENST00000399100.2_Silent_p.L476L|SEC24B_ENST00000504968.2_Silent_p.L541L	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	511					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.L476L(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TAGGAGGATTGAGTCTTCAGA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	4											109.0	103.0	105.0					4																	110427528		1884	4118	6002	110646977	SO:0001819	synonymous_variant	10427			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1533G>A	4.37:g.110427528G>A		Unknown		x	x	x	110646977	B7ZKM8|B7ZKN4|Q0VG08	Silent	SNP	ENST00000265175.5	37	CCDS47124.1	SNP	45	Broad																																																																																				0.388	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2			Silent
BBS7	55212	broad.mit.edu	37	4	122770081	122770081	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr4:122770081C>G	ENST00000264499.4	-	9	1035	c.852G>C	c.(850-852)atG>atC	p.M284I	BBS7_ENST00000506636.1_Missense_Mutation_p.M284I	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	284					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.M284I(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TTTCAGACAACATCTAAAAAA	0.363									Bardet-Biedl syndrome																																							1	Substitution - Missense(1)	ovary(1)	4											99.0	100.0	100.0					4																	122770081		2203	4300	6503	122989531	SO:0001583	missense	55212	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.852G>C	4.37:g.122770081C>G	ENSP00000264499:p.Met284Ile	Unknown		x	x	x	122989531	Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	37	CCDS3724.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	8.320	0.824053	0.16678	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	D;D	0.91180	-2.8;-2.8	5.45	0.595	0.17490	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.617107	0.17484	N	0.172593	T	0.74397	0.3711	N	0.08118	0	0.27700	N	0.94583	B	0.02656	0.0	B	0.01281	0.0	T	0.62258	-0.6892	10	0.45353	T	0.12	-0.7374	0.5741	0.00701	0.1879:0.2163:0.248:0.3478	.	284	Q8IWZ6	BBS7_HUMAN	I	284	ENSP00000264499:M284I;ENSP00000423626:M284I	ENSP00000264499:M284I	M	-	3	0	BBS7	122989531	0.000000	0.05858	0.879000	0.34478	0.271000	0.26615	-1.904000	0.01593	0.031000	0.15407	0.591000	0.81541	ATG		0.363	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1			Missense_Mutation
NNT	23530	broad.mit.edu	37	5	43656057	43656057	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr5:43656057A>T	ENST00000264663.5	+	15	2396	c.2175A>T	c.(2173-2175)gaA>gaT	p.E725D	NNT_ENST00000512996.2_Missense_Mutation_p.E594D|NNT_ENST00000344920.4_Missense_Mutation_p.E725D	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	725					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.E725D(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					ACATTATAGAATATCCACATT	0.438																																																1	Substitution - Missense(1)	ovary(1)	5											124.0	112.0	116.0					5																	43656057		2203	4300	6503	43691814	SO:0001583	missense	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2175A>T	5.37:g.43656057A>T	ENSP00000264663:p.Glu725Asp	Unknown		x	x	x	43691814	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	CCDS3949.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	8.742	0.919130	0.17982	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.91577	-2.87;-2.87;-2.87	5.91	-2.99	0.05497	.	0.000000	0.85682	D	0.000000	T	0.67730	0.2924	N	0.01048	-1.04	0.54753	D	0.999982	B	0.23316	0.083	B	0.19666	0.026	T	0.62105	-0.6924	10	0.02654	T	1	-23.352	15.2307	0.73386	0.4142:0.0:0.5858:0.0	.	725	Q13423	NNTM_HUMAN	D	240;725;725;594	ENSP00000264663:E725D;ENSP00000343873:E725D;ENSP00000426343:E594D	ENSP00000264663:E725D	E	+	3	2	NNT	43691814	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	0.728000	0.26013	-0.245000	0.09625	0.533000	0.62120	GAA		0.438	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977		Missense_Mutation
GTF2H4	2968	broad.mit.edu	37	6	30880175	30880175	+	Silent	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr6:30880175G>T	ENST00000259895.4	+	11	1252	c.1029G>T	c.(1027-1029)gtG>gtT	p.V343V	VARS2_ENST00000541562.1_5'Flank|VARS2_ENST00000416670.2_5'Flank|VARS2_ENST00000542001.1_5'Flank|VARS2_ENST00000321897.5_5'Flank|GTF2H4_ENST00000376316.2_Silent_p.V343V	NM_001517.4	NP_001508.1	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4, 52kDa	343					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	ATP-dependent DNA helicase activity (GO:0004003)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V343V(1)		breast(1)|endometrium(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						ACATGGTGGTGGCGCAGGTGA	0.587								Nucleotide excision repair (NER)																																								1	Substitution - coding silent(1)	ovary(1)	6											122.0	112.0	115.0					6																	30880175		1511	2709	4220	30988154	SO:0001819	synonymous_variant	2968			Y07595	CCDS34386.1	6p21.3	2012-11-05	2002-08-29		ENSG00000213780	ENSG00000213780		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4658	protein-coding gene	gene with protein product		601760	"""general transcription factor IIH, polypeptide 4 (52kD subunit)"""			9118947	Standard	NM_001517		Approved	TFB2, TFIIH, P52	uc003nsa.1	Q92759	OTTHUMG00000031043	ENST00000259895.4:c.1029G>T	6.37:g.30880175G>T		Unknown		x	x	x	30988154	B4DTJ5|Q76KU4	Silent	SNP	ENST00000259895.4	37	CCDS34386.1	SNP	47	Broad																																																																																				0.587	GTF2H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076044.3	NM_001517		Silent
DOPEY1	23033	broad.mit.edu	37	6	83863932	83863932	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr6:83863932T>A	ENST00000349129.2	+	33	6683	c.6423T>A	c.(6421-6423)caT>caA	p.H2141Q	DOPEY1_ENST00000237163.5_Missense_Mutation_p.H2071Q|DOPEY1_ENST00000369739.3_Missense_Mutation_p.H2132Q|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2141					protein transport (GO:0015031)			p.H2141Q(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TGATGACACATGATAAAACAA	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											140.0	136.0	138.0					6																	83863932		2203	4300	6503	83920651	SO:0001583	missense	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6423T>A	6.37:g.83863932T>A	ENSP00000195654:p.His2141Gln	Unknown		x	x	x	83920651	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	23.5	4.426127	0.83667	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.28069	1.63;1.93	5.37	5.37	0.77165	.	0.113710	0.64402	D	0.000003	T	0.36524	0.0970	L	0.52126	1.63	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.77557	0.99;0.99;0.981	T	0.15694	-1.0428	10	0.42905	T	0.14	.	11.3721	0.49707	0.0:0.0731:0.0:0.9269	.	2032;2132;2141	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	Q	2141;2071;2071	ENSP00000195654:H2141Q;ENSP00000237163:H2071Q	ENSP00000237163:H2071Q	H	+	3	2	DOPEY1	83920651	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.768000	0.62293	2.044000	0.60594	0.455000	0.32223	CAT		0.328	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018		Missense_Mutation
SYNE1	23345	broad.mit.edu	37	6	152558073	152558073	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr6:152558073T>C	ENST00000367255.5	-	109	20679	c.20078A>G	c.(20077-20079)cAt>cGt	p.H6693R	SYNE1_ENST00000356820.4_Missense_Mutation_p.H1217R|SYNE1_ENST00000265368.4_Missense_Mutation_p.H6693R|SYNE1_ENST00000423061.1_Missense_Mutation_p.H6622R|SYNE1_ENST00000448038.1_Missense_Mutation_p.H6622R|SYNE1_ENST00000341594.5_Missense_Mutation_p.H6305R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6693					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.H6693R(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCATCCAGATGGGACCACGT	0.512										HNSCC(10;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	6											82.0	64.0	70.0					6																	152558073		2203	4300	6503	152599766	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20078A>G	6.37:g.152558073T>C	ENSP00000356224:p.His6693Arg	Unknown		x	x	x	152599766	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	2.326	-0.354463	0.05173	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	5.48	1.63	0.23807	.	0.349076	0.25175	N	0.032570	T	0.04543	0.0124	L	0.33137	0.985	0.26863	N	0.967903	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.42189	-0.9466	10	0.05833	T	0.94	.	4.2818	0.10836	0.1357:0.2456:0.0:0.6187	.	6693;6693;6622	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	R	6693;6622;6693;6622;6305;1217	ENSP00000356224:H6693R;ENSP00000396024:H6622R;ENSP00000265368:H6693R;ENSP00000390975:H6622R;ENSP00000341887:H6305R;ENSP00000349276:H1217R	ENSP00000265368:H6693R	H	-	2	0	SYNE1	152599766	0.675000	0.27558	0.192000	0.23308	0.244000	0.25665	0.558000	0.23469	0.034000	0.15491	-0.256000	0.11100	CAT		0.512	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Missense_Mutation
WDR27	253769	broad.mit.edu	37	6	170059616	170059616	+	Splice_Site	SNP	T	T	G			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr6:170059616T>G	ENST00000448612.1	-	11	1239		c.e11-2		WDR27_ENST00000423258.1_Splice_Site|WDR27_ENST00000546525.1_Splice_Site|WDR27_ENST00000333572.6_Splice_Site	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27							nucleus (GO:0005634)		p.?(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		TCTGGAAATCTTCAGTTGAGC	0.597																																																1	Unknown(1)	ovary(1)	6											41.0	51.0	48.0					6																	170059616		2173	4279	6452	169801541	SO:0001630	splice_region_variant	253769			AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1130-2A>C	6.37:g.170059616T>G		Unknown		x	x	x	169801541	A5PLM8|C9JGV0|Q5T066	Splice_Site_SNP	SNP	ENST00000448612.1	37	CCDS47520.2	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	7.656	0.683910	0.14907	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258;ENST00000441385	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.543	0.50677	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR27	169801541	1.000000	0.71417	0.313000	0.25210	0.006000	0.05464	3.640000	0.54350	1.928000	0.55862	0.379000	0.24179	.		0.597	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	Intron	Splice_Site_SNP
HGF	3082	broad.mit.edu	37	7	81358974	81358974	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr7:81358974C>T	ENST00000222390.5	-	8	1213	c.987G>A	c.(985-987)tgG>tgA	p.W329*	HGF_ENST00000457544.2_Nonsense_Mutation_p.W324*	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	329	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.W329*(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						ACTGAGAATCCCAACGCTGAC	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	7											161.0	147.0	151.0					7																	81358974		2203	4300	6503	81196910	SO:0001587	stop_gained	3082				CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.987G>A	7.37:g.81358974C>T	ENSP00000222390:p.Trp329*	Unknown		x	x	x	81196910	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Nonsense_Mutation	SNP	ENST00000222390.5	37	CCDS5597.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	38	6.937741	0.97948	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9767	0.97312	0.0:1.0:0.0:0.0	.	.	.	.	X	329;324	.	ENSP00000222390:W329X	W	-	3	0	HGF	81196910	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.913000	0.75759	2.702000	0.92279	0.655000	0.94253	TGG		0.443	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601		Nonsense_Mutation
CNTNAP2	26047	broad.mit.edu	37	7	147336299	147336299	+	Missense_Mutation	SNP	G	G	A	rs374920791		TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr7:147336299G>A	ENST00000361727.3	+	13	2515	c.1999G>A	c.(1999-2001)Gcc>Acc	p.A667T		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	667	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.A667T(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CGTTTACAGCGCCTCCATGGA	0.502										HNSCC(39;0.1)																																						1	Substitution - Missense(1)	ovary(1)	7						G	THR/ALA	0,4406		0,0,2203	148.0	126.0	133.0		1999	5.7	1.0	7		133	1,8599	1.2+/-3.3	0,1,4299	no	missense	CNTNAP2	NM_014141.5	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	667/1332	147336299	1,13005	2203	4300	6503	146967232	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1999G>A	7.37:g.147336299G>A	ENSP00000354778:p.Ala667Thr	Unknown		x	x	x	146967232	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959480	0.74016	0.0	1.16E-4	ENSG00000174469	ENST00000361727;ENST00000455301	T;T	0.15487	2.42;2.42	5.74	5.74	0.90152	.	0.065352	0.64402	D	0.000013	T	0.24353	0.0590	M	0.78344	2.41	0.80722	D	1	B	0.34226	0.443	B	0.25291	0.059	T	0.03060	-1.1077	10	0.51188	T	0.08	.	18.8598	0.92267	0.0:0.0:1.0:0.0	.	667	Q9UHC6	CNTP2_HUMAN	T	667;58	ENSP00000354778:A667T;ENSP00000392208:A58T	ENSP00000354778:A667T	A	+	1	0	CNTNAP2	146967232	1.000000	0.71417	0.996000	0.52242	0.883000	0.51084	6.803000	0.75180	2.873000	0.98535	0.561000	0.74099	GCC		0.502	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			Missense_Mutation
LONRF1	91694	broad.mit.edu	37	8	12580616	12580616	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr8:12580616G>T	ENST00000398246.3	-	12	2380	c.2311C>A	c.(2311-2313)Caa>Aaa	p.Q771K	LONRF1_ENST00000525024.1_Missense_Mutation_p.Q197K|LONRF1_ENST00000533751.1_Missense_Mutation_p.Q414K	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	771							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.Q771K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		TACTTAGATTGGTCTCTAGAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	8											118.0	120.0	120.0					8																	12580616		1886	4103	5989	12624987	SO:0001583	missense	91694			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.2311C>A	8.37:g.12580616G>T	ENSP00000381298:p.Gln771Lys	Unknown		x	x	x	12624987	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	37	CCDS5987.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431438	0.62844	.	.	ENSG00000154359	ENST00000398246;ENST00000525024;ENST00000533751;ENST00000524526	D;T;T	0.84800	-1.9;-1.3;-1.4	5.06	4.18	0.49190	.	0.198081	0.46442	D	0.000284	T	0.81754	0.4889	L	0.43152	1.355	0.46798	D	0.999208	D;P	0.54772	0.968;0.877	P;B	0.47915	0.561;0.358	T	0.78142	-0.2319	10	0.12766	T	0.61	-14.7447	14.0018	0.64437	0.0743:0.0:0.9257:0.0	.	760;771	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	K	771;197;414;374	ENSP00000381298:Q771K;ENSP00000432130:Q414K;ENSP00000433327:Q374K	ENSP00000381298:Q771K	Q	-	1	0	LONRF1	12624987	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.633000	0.74286	1.428000	0.47296	0.655000	0.94253	CAA		0.438	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271		Missense_Mutation
TOPORS	10210	broad.mit.edu	37	9	32543969	32543969	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr9:32543969G>T	ENST00000360538.2	-	3	670	c.554C>A	c.(553-555)aCa>aAa	p.T185K	TOPORS_ENST00000379858.1_Missense_Mutation_p.T120K	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	185	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T185K(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TCGTTCCCTTGTCAGAGTTGT	0.463																																																1	Substitution - Missense(1)	ovary(1)	9											135.0	116.0	122.0					9																	32543969		2203	4300	6503	32533969	SO:0001583	missense	10210			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.554C>A	9.37:g.32543969G>T	ENSP00000353735:p.Thr185Lys	Unknown		x	x	x	32533969	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930981	0.34096	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.18960	2.18;2.18	5.21	4.26	0.50523	.	0.000000	0.47455	D	0.000234	T	0.35098	0.0920	L	0.55481	1.735	0.39908	D	0.973983	D	0.65815	0.995	P	0.57152	0.814	T	0.15150	-1.0447	10	0.66056	D	0.02	-15.1247	14.3199	0.66479	0.0:0.25:0.75:0.0	.	185	Q9NS56	TOPRS_HUMAN	K	185;120	ENSP00000353735:T185K;ENSP00000369187:T120K	ENSP00000353735:T185K	T	-	2	0	TOPORS	32533969	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	6.113000	0.71553	2.587000	0.87381	0.563000	0.77884	ACA		0.463	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802		Missense_Mutation
COL15A1	1306	broad.mit.edu	37	9	101829309	101829309	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr9:101829309G>T	ENST00000375001.3	+	40	4220	c.3797G>T	c.(3796-3798)aGg>aTg	p.R1266M		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1266	Nonhelical region 10 (NC10).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.R1266M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				ACCATTGTGAGGAAAGCAGAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	9											156.0	130.0	139.0					9																	101829309		2203	4300	6503	100869130	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3797G>T	9.37:g.101829309G>T	ENSP00000364140:p.Arg1266Met	Unknown		x	x	x	100869130	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441011	0.63067	.	.	ENSG00000204291	ENST00000375001	T	0.56941	0.43	5.96	5.96	0.96718	Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	0.187439	0.53938	D	0.000047	T	0.76047	0.3933	M	0.83774	2.66	0.53005	D	0.999966	D	0.89917	1.0	D	0.75020	0.985	T	0.77451	-0.2583	10	0.62326	D	0.03	-22.5878	19.1934	0.93677	0.0:0.0:1.0:0.0	.	1266	P39059	COFA1_HUMAN	M	1266	ENSP00000364140:R1266M	ENSP00000364140:R1266M	R	+	2	0	COL15A1	100869130	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.795000	0.62489	2.832000	0.97577	0.655000	0.94253	AGG		0.483	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		Missense_Mutation
PRRC2B	84726	broad.mit.edu	37	9	134308049	134308049	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr9:134308049C>A	ENST00000357304.4	+	2	216	c.161C>A	c.(160-162)gCc>gAc	p.A54D	PRRC2B_ENST00000458550.1_Missense_Mutation_p.A54D|PRRC2B_ENST00000405995.1_Missense_Mutation_p.A54D	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	54							poly(A) RNA binding (GO:0044822)	p.A54D(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GTTGCTGCAGCCCGGCGCATG	0.527																																																1	Substitution - Missense(1)	ovary(1)	9											62.0	69.0	67.0					9																	134308049		1951	4167	6118	133297870	SO:0001583	missense	84726			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.161C>A	9.37:g.134308049C>A	ENSP00000349856:p.Ala54Asp	Unknown		x	x	x	133297870	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.555034	0.96514	.	.	ENSG00000130723	ENST00000405995;ENST00000541684;ENST00000357304;ENST00000458550	T;T;T	0.28666	1.6;1.6;1.6	6.17	6.17	0.99709	BAT2, N-terminal (1);	0.000000	0.39909	U	0.001225	T	0.59729	0.2215	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58880	-0.7558	10	0.87932	D	0	-8.9632	19.8676	0.96824	0.0:1.0:0.0:0.0	.	54	Q5JSZ5	PRC2B_HUMAN	D	54	ENSP00000384606:A54D;ENSP00000349856:A54D;ENSP00000398853:A54D	ENSP00000349856:A54D	A	+	2	0	PRRC2B	133297870	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GCC		0.527	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
KLHL34	257240	broad.mit.edu	37	X	21674250	21674250	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chrX:21674250G>C	ENST00000379499.2	-	1	2198	c.1657C>G	c.(1657-1659)Cgg>Ggg	p.R553G		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	553						extracellular space (GO:0005615)		p.R553G(1)		cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						GGCCGCAACCGAGTCCACTGG	0.672																																																1	Substitution - Missense(1)	ovary(1)	X											14.0	11.0	12.0					X																	21674250		2171	4241	6412	21584171	SO:0001583	missense	257240			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1657C>G	X.37:g.21674250G>C	ENSP00000368813:p.Arg553Gly	Unknown		x	x	x	21584171		Missense_Mutation	SNP	ENST00000379499.2	37	CCDS14199.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747213	0.69418	.	.	ENSG00000185915	ENST00000379499	T	0.67523	-0.27	5.2	5.2	0.72013	Kelch-type beta propeller (1);	0.070238	0.64402	D	0.000020	T	0.79540	0.4463	M	0.72118	2.19	0.48135	D	0.999591	D	0.89917	1.0	D	0.67548	0.952	T	0.76302	-0.3009	10	0.23891	T	0.37	.	17.84	0.88712	0.0:0.0:1.0:0.0	.	553	Q8N239	KLH34_HUMAN	G	553	ENSP00000368813:R553G	ENSP00000368813:R553G	R	-	1	2	KLHL34	21584171	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	5.799000	0.69101	2.401000	0.81631	0.600000	0.82982	CGG		0.672	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270		Missense_Mutation
SMS	6611	broad.mit.edu	37	X	21995350	21995350	+	Silent	SNP	T	T	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chrX:21995350T>C	ENST00000404933.2	+	5	753	c.501T>C	c.(499-501)gaT>gaC	p.D167D	SMS_ENST00000415881.2_Silent_p.D71D|SMS_ENST00000478094.1_3'UTR|SMS_ENST00000379404.1_Silent_p.D114D	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase	167	PABS. {ECO:0000255|PROSITE- ProRule:PRU00354}.				cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)	p.D167D(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	TTAGTGGGGATGTTAGTAAGT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	X											93.0	94.0	94.0					X																	21995350		2203	4300	6503	21905271	SO:0001819	synonymous_variant	6611			AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.501T>C	X.37:g.21995350T>C		Unknown		x	x	x	21905271	A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Silent	SNP	ENST00000404933.2	37	CCDS14203.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	9.544	1.114228	0.20795	.	.	ENSG00000102172	ENST00000457085	.	.	.	5.73	1.73	0.24493	.	.	.	.	.	T	0.57417	0.2052	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49390	-0.8945	4	.	.	.	-16.7637	8.6985	0.34312	0.0:0.2382:0.0:0.7618	.	.	.	.	R	259	.	.	C	+	1	0	SMS	21905271	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.849000	0.27723	0.201000	0.20466	0.486000	0.48141	TGT		0.378	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056032.1	NM_004595		Silent
OGT	8473	broad.mit.edu	37	X	70777085	70777085	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chrX:70777085C>A	ENST00000373719.3	+	11	1578	c.1361C>A	c.(1360-1362)aCg>aAg	p.T454K	OGT_ENST00000373701.3_Missense_Mutation_p.T444K	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	454					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.T444K(1)|p.T454K(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					TCTTACCGCACGGCTCTGAAA	0.383																																																2	Substitution - Missense(2)	ovary(2)	X											54.0	49.0	50.0					X																	70777085		2203	4300	6503	70693810	SO:0001583	missense	8473			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.1361C>A	X.37:g.70777085C>A	ENSP00000362824:p.Thr454Lys	Unknown		x	x	x	70693810	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527806	0.64860	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.15017	2.46;2.46	5.77	5.77	0.91146	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.13756	0.0333	N	0.00760	-1.21	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.87578	0.985;0.998;0.836	T	0.37820	-0.9689	10	0.02654	T	1	-19.0818	18.9394	0.92600	0.0:1.0:0.0:0.0	.	328;444;454	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	K	454;444	ENSP00000362824:T454K;ENSP00000362805:T444K	ENSP00000362805:T444K	T	+	2	0	OGT	70693810	1.000000	0.71417	0.966000	0.40874	0.847000	0.48162	7.758000	0.85224	2.420000	0.82092	0.594000	0.82650	ACG		0.383	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7579335	7579336	+	Frame_Shift_Ins	INS	-	-	C			TCGA-61-2008-01	TCGA-61-2008-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2008-01	TCGA-61-2008-11	g.chr17:7579335_7579336insC	ENST00000269305.4	-	4	540_541	c.351_352insG	c.(349-354)gggacafs	p.T118fs	TP53_ENST00000420246.2_Frame_Shift_Ins_p.T118fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Ins_p.T118fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.T118fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.T118fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.T118fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	118	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> R (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.T118fs*31(4)|p.G59fs*23(3)|p.T118fs*5(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.T118fs*27(1)|p.H115fs*27(1)|p.T118A(1)|p.Y107fs*44(1)|p.T118fs*6(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.L114fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACTTGGCTGTCCCAGAATGCA	0.574		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Deletion - Frameshift(13)|Whole gene deletion(8)|Insertion - Frameshift(5)|Deletion - In frame(2)|Substitution - Missense(1)	upper_aerodigestive_tract(6)|lung(6)|bone(5)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(2)|urinary_tract(2)|breast(2)|stomach(1)|liver(1)|ovary(1)	17																																								7520061	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.352dupG	17.37:g.7579338_7579338dupC	ENSP00000269305:p.Thr118fs	Unknown		Capture	Illumina GAIIx	Phase_I	7520060	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1	INS	58	Broad																																																																																				0.574	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Ins
