#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MASP2	10747	broad.mit.edu	37	1	11087367	11087367	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:11087367T>A	ENST00000400897.3	-	11	1651	c.1636A>T	c.(1636-1638)Agc>Tgc	p.S546C	RP4-635E18.8_ENST00000607145.1_RNA	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	546	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.S546C(1)		biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		GTGATGTTGCTATTGATTACA	0.393																																					GBM(35;611 746 20780 22741 36496)											1	Substitution - Missense(1)	ovary(1)	1											154.0	151.0	152.0					1																	11087367		2203	4300	6503	11009954	SO:0001583	missense	10747			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.1636A>T	1.37:g.11087367T>A	ENSP00000383690:p.Ser546Cys	Unknown		x	x	x	11009954	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	ENST00000400897.3	37	CCDS123.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	15.40	2.822809	0.50739	.	.	ENSG00000009724	ENST00000400897	D	0.93604	-3.25	5.06	1.39	0.22231	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.592426	0.18683	N	0.134104	D	0.94351	0.8184	M	0.72479	2.2	0.09310	N	0.999999	D	0.65815	0.995	P	0.58820	0.846	D	0.87726	0.2576	10	0.66056	D	0.02	.	8.5111	0.33217	0.0:0.3949:0.0:0.6051	.	546	O00187	MASP2_HUMAN	C	546	ENSP00000383690:S546C	ENSP00000383690:S546C	S	-	1	0	MASP2	11009954	0.000000	0.05858	0.204000	0.23530	0.990000	0.78478	-0.019000	0.12546	0.240000	0.21263	0.460000	0.39030	AGC		0.393	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610		Missense_Mutation
IQCC	55721	broad.mit.edu	37	1	32671810	32671810	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:32671810A>T	ENST00000291358.6	+	2	119	c.98A>T	c.(97-99)tAt>tTt	p.Y33F	IQCC_ENST00000537469.1_Missense_Mutation_p.Y113F|RP4-622L5.7_ENST00000373604.4_RNA|RP4-622L5.7_ENST00000421616.1_RNA|DCDC2B_ENST00000409358.1_5'Flank	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	33	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.							p.Y33F(1)		endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CGAGCTGAGTATGAGGCGATT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											86.0	88.0	87.0					1																	32671810		2203	4300	6503	32444397	SO:0001583	missense	55721			AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.98A>T	1.37:g.32671810A>T	ENSP00000291358:p.Tyr33Phe	Unknown		x	x	x	32444397	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Missense_Mutation	SNP	ENST00000291358.6	37	CCDS355.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450782	0.84101	.	.	ENSG00000160051	ENST00000537469;ENST00000291358	T;T	0.10382	2.88;2.88	5.13	5.13	0.70059	.	0.088052	0.47455	D	0.000230	T	0.29223	0.0727	L	0.57536	1.79	0.43508	D	0.995764	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.00643	-1.1630	10	0.45353	T	0.12	-3.2428	15.0621	0.71964	1.0:0.0:0.0:0.0	.	113;33	F5H7T8;Q4KMZ1	.;IQCC_HUMAN	F	113;33	ENSP00000442291:Y113F;ENSP00000291358:Y33F	ENSP00000291358:Y33F	Y	+	2	0	IQCC	32444397	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.959000	0.56744	2.292000	0.77174	0.533000	0.62120	TAT		0.607	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134		Missense_Mutation
ST3GAL3	6487	broad.mit.edu	37	1	44360113	44360113	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:44360113C>T	ENST00000361392.4	+	6	538	c.361C>T	c.(361-363)Cgg>Tgg	p.R121W	ST3GAL3_ENST00000372365.1_Missense_Mutation_p.R121W|ST3GAL3_ENST00000351035.3_Missense_Mutation_p.R159W|ST3GAL3_ENST00000332628.6_Missense_Mutation_p.R90W|ST3GAL3_ENST00000372369.1_Missense_Mutation_p.R121W|ST3GAL3_ENST00000361400.4_Missense_Mutation_p.R105W|ST3GAL3_ENST00000531451.1_Missense_Mutation_p.R105W|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000353126.3_Missense_Mutation_p.R121W|ST3GAL3_ENST00000347631.2_Missense_Mutation_p.R136W|ST3GAL3_ENST00000372366.1_Missense_Mutation_p.R120W|ST3GAL3_ENST00000372372.2_Missense_Mutation_p.R159W|ST3GAL3_ENST00000528371.1_Missense_Mutation_p.R105W|ST3GAL3_ENST00000372367.1_Missense_Mutation_p.R120W|ST3GAL3_ENST00000361746.4_Missense_Mutation_p.R190W|ST3GAL3_ENST00000533933.1_Missense_Mutation_p.R121W|ST3GAL3_ENST00000361812.4_Missense_Mutation_p.R136W|ST3GAL3_ENST00000531993.1_Missense_Mutation_p.R105W|ST3GAL3_ENST00000372362.2_Missense_Mutation_p.R121W|ST3GAL3_ENST00000372374.2_Missense_Mutation_p.R90W|ST3GAL3_ENST00000461375.1_3'UTR|ST3GAL3_ENST00000330208.2_Missense_Mutation_p.R121W|ST3GAL3_ENST00000372368.2_Missense_Mutation_p.R175W|ST3GAL3_ENST00000372377.4_Missense_Mutation_p.R121W|ST3GAL3_ENST00000335430.6_Missense_Mutation_p.R105W|ST3GAL3_ENST00000262915.3_Missense_Mutation_p.R190W|ST3GAL3_ENST00000545417.1_Missense_Mutation_p.R136W|ST3GAL3_ENST00000372375.2_Missense_Mutation_p.R175W	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	121					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)	p.R190W(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				GGCTAGAATCCGGGAGTTCGT	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											172.0	164.0	167.0					1																	44360113		2203	4300	6503	44132700	SO:0001583	missense	6487			L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.361C>T	1.37:g.44360113C>T	ENSP00000355341:p.Arg121Trp	Unknown		x	x	x	44132700	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	ENST00000361392.4	37	CCDS492.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	19.45	3.829452	0.71258	.	.	ENSG00000126091	ENST00000361392;ENST00000361400;ENST00000262915;ENST00000372375;ENST00000351035;ENST00000372374;ENST00000353126;ENST00000545417;ENST00000330208;ENST00000335430;ENST00000372377;ENST00000347631;ENST00000361812;ENST00000372362;ENST00000531451;ENST00000372369;ENST00000361746;ENST00000372367;ENST00000372366;ENST00000372365;ENST00000372368;ENST00000372372;ENST00000528371;ENST00000531993;ENST00000533933;ENST00000332628	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.78707	1.47;1.47;1.47;1.47;1.47;1.47;1.47;-1.18;-1.19;1.47;-1.2;1.47;-1.18;-1.19;-1.19;1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47	4.99	4.01	0.46588	.	0.573603	0.17375	N	0.176506	T	0.81331	0.4800	L	0.34521	1.04	0.45139	D	0.998152	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.994;0.999;0.999;1.0;0.999;0.999;0.997;1.0;1.0;0.997;0.999;0.997;0.999;0.995;0.999;1.0;0.997	P;P;P;D;P;P;P;D;D;P;P;P;P;P;D;D;P	0.74348	0.799;0.784;0.862;0.983;0.784;0.854;0.707;0.96;0.981;0.827;0.827;0.707;0.827;0.806;0.913;0.96;0.901	T	0.82236	-0.0557	10	0.66056	D	0.02	.	13.0308	0.58840	0.162:0.838:0.0:0.0	.	121;74;105;120;105;120;90;121;136;121;159;105;175;121;190;105;136	Q11203-5;Q11203-21;Q11203-17;Q11203-24;Q11203-16;Q11203-23;Q11203-7;Q11203-12;Q5T4Y1;Q11203-8;Q11203-19;Q11203-15;Q11203-13;Q11203;Q11203-4;Q11203-18;Q5T4W8	.;.;.;.;.;.;.;.;.;.;.;.;.;SIAT6_HUMAN;.;.;.	W	121;105;190;175;159;90;121;136;121;105;121;136;136;121;105;121;190;120;120;121;175;159;105;105;121;90	ENSP00000355341:R121W;ENSP00000354748:R105W;ENSP00000262915:R190W;ENSP00000361450:R175W;ENSP00000316999:R159W;ENSP00000361449:R90W;ENSP00000330463:R121W;ENSP00000439634:R136W;ENSP00000333494:R121W;ENSP00000335633:R105W;ENSP00000361452:R121W;ENSP00000317192:R136W;ENSP00000355201:R136W;ENSP00000361437:R121W;ENSP00000435603:R105W;ENSP00000361444:R121W;ENSP00000354657:R190W;ENSP00000361442:R120W;ENSP00000361441:R120W;ENSP00000361440:R121W;ENSP00000361443:R175W;ENSP00000361447:R159W;ENSP00000434876:R105W;ENSP00000432682:R105W;ENSP00000432965:R121W;ENSP00000329755:R90W	ENSP00000262915:R190W	R	+	1	2	ST3GAL3	44132700	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.056000	0.49923	2.333000	0.79357	0.486000	0.48141	CGG		0.512	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963		Missense_Mutation
SLC5A9	200010	broad.mit.edu	37	1	48690414	48690414	+	Nonsense_Mutation	SNP	C	C	T	rs199760707		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:48690414C>T	ENST00000438567.2	+	2	233	c.181C>T	c.(181-183)Cga>Tga	p.R61*	SLC5A9_ENST00000236495.5_Nonsense_Mutation_p.R61*|SLC5A9_ENST00000420136.2_Nonsense_Mutation_p.R54*|SLC5A9_ENST00000533824.1_Nonsense_Mutation_p.R61*	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	61					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R54*(1)		breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						CCGTGCAAGTCGAGGGACCAT	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	1						C	stop/ARG,stop/ARG	0,4406		0,0,2203	125.0	124.0	124.0		181,181	1.4	0.3	1		124	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained,stop-gained	SLC5A9	NM_001011547.2,NM_001135181.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	61/682,61/707	48690414	1,13005	2203	4300	6503	48463001	SO:0001587	stop_gained	200010			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.181C>T	1.37:g.48690414C>T	ENSP00000401730:p.Arg61*	Unknown		x	x	x	48463001	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Nonsense_Mutation	SNP	ENST00000438567.2	37	CCDS30709.2	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876446	0.91664	0.0	1.16E-4	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495;ENST00000420136	.	.	.	4.48	1.4	0.22301	.	0.114692	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8624	0.29517	0.2851:0.637:0.0:0.0779	.	.	.	.	X	61;61;61;54	.	ENSP00000236495:R61X	R	+	1	2	SLC5A9	48463001	1.000000	0.71417	0.313000	0.25210	0.854000	0.48673	3.169000	0.50809	0.178000	0.19917	0.655000	0.94253	CGA		0.567	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174		Nonsense_Mutation
ORC1	4998	broad.mit.edu	37	1	52859246	52859246	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:52859246G>C	ENST00000371568.3	-	6	1169	c.951C>G	c.(949-951)atC>atG	p.I317M	ORC1_ENST00000371566.1_Missense_Mutation_p.I317M	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	317					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I317M(1)		breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GGGTTCTCAGGATTATGCGAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											211.0	191.0	197.0					1																	52859246		2203	4300	6503	52631834	SO:0001583	missense	4998				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.951C>G	1.37:g.52859246G>C	ENSP00000360623:p.Ile317Met	Unknown		x	x	x	52631834	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430016	0.25726	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.43688	0.94;0.94	4.49	1.06	0.20224	.	1.334900	0.04181	N	0.326448	T	0.36276	0.0961	L	0.60455	1.87	0.09310	N	0.999996	P;P	0.38642	0.641;0.641	B;B	0.34722	0.143;0.188	T	0.25641	-1.0126	10	0.46703	T	0.11	2.4137	2.6718	0.05069	0.292:0.0:0.4917:0.2164	.	317;317	B7Z8H0;Q13415	.;ORC1_HUMAN	M	317	ENSP00000360623:I317M;ENSP00000360621:I317M	ENSP00000360621:I317M	I	-	3	3	ORC1	52631834	0.296000	0.24398	0.271000	0.24616	0.166000	0.22503	0.303000	0.19210	0.217000	0.20800	0.655000	0.94253	ATC		0.483	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153		Missense_Mutation
LRRC7	57554	broad.mit.edu	37	1	70257750	70257750	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:70257750C>G	ENST00000035383.5	+	2	244	c.214C>G	c.(214-216)Cga>Gga	p.R72G	LRRC7_ENST00000370958.1_Missense_Mutation_p.R110G|LRRC7_ENST00000310961.5_Missense_Mutation_p.R77G|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	72						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.R72G(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCAAGCTCTACGAAAACTAAG	0.294																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	103.0	100.0					1																	70257750		2202	4295	6497	70030338	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.214C>G	1.37:g.70257750C>G	ENSP00000035383:p.Arg72Gly	Unknown		x	x	x	70030338	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495794	0.64186	.	.	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	T;T;T	0.28255	1.62;2.79;1.66	5.68	2.7	0.31948	.	0.148908	0.46758	D	0.000280	T	0.19046	0.0457	L	0.51422	1.61	0.80722	D	1	B;B	0.33964	0.4;0.434	B;B	0.39068	0.289;0.239	T	0.04551	-1.0943	10	0.72032	D	0.01	.	13.3006	0.60324	0.4547:0.5453:0.0:0.0	.	72;110	Q96NW7;B1AKT2	LRRC7_HUMAN;.	G	77;110;72;72	ENSP00000309245:R77G;ENSP00000359997:R110G;ENSP00000035383:R72G	ENSP00000035383:R72G	R	+	1	2	LRRC7	70030338	0.999000	0.42202	0.999000	0.59377	0.997000	0.91878	2.305000	0.43664	0.277000	0.22141	0.561000	0.74099	CGA		0.294	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		Missense_Mutation
GDAP2	54834	broad.mit.edu	37	1	118424460	118424460	+	Silent	SNP	G	G	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:118424460G>A	ENST00000369443.5	-	12	1536	c.1287C>T	c.(1285-1287)ccC>ccT	p.P429P	GDAP2_ENST00000369442.3_Silent_p.P429P|GDAP2_ENST00000464026.1_5'Flank	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2	429	CRAL-TRIO.				response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)		p.P429P(1)		kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		AACGAAATGTGGGATGTACAA	0.318																																																1	Substitution - coding silent(1)	ovary(1)	1											95.0	103.0	100.0					1																	118424460		2203	4300	6503	118225983	SO:0001819	synonymous_variant	54834			AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.1287C>T	1.37:g.118424460G>A		Unknown		x	x	x	118225983	Q96DZ0	Silent	SNP	ENST00000369443.5	37	CCDS897.1	SNP	47	Broad																																																																																				0.318	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033732.2	NM_017686		Silent
PRUNE	58497	broad.mit.edu	37	1	151006557	151006557	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:151006557G>C	ENST00000271620.3	+	8	1365	c.1209G>C	c.(1207-1209)gaG>gaC	p.E403D	PRUNE_ENST00000368934.1_Missense_Mutation_p.E168D|BNIPL_ENST00000295294.7_5'Flank|PRUNE_ENST00000271619.8_Missense_Mutation_p.E191D|PRUNE_ENST00000368935.1_Missense_Mutation_p.E118D|BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000368936.1_Missense_Mutation_p.E221D|PRUNE_ENST00000368937.1_Missense_Mutation_p.E168D	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	403	Essential for homodimerization.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)	p.E403D(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AAGATGAGGAGGACCCTCCGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	91.0	95.0					1																	151006557		2203	4300	6503	149273181	SO:0001583	missense	58497			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1209G>C	1.37:g.151006557G>C	ENSP00000271620:p.Glu403Asp	Unknown		x	x	x	149273181	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	ENST00000271620.3	37	CCDS977.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587336	0.28268	.	.	ENSG00000143363	ENST00000271620;ENST00000302413;ENST00000271619;ENST00000368937;ENST00000431193;ENST00000368936;ENST00000368935;ENST00000368934	T;T;T;T;T;T;T	0.34472	1.42;1.41;1.41;1.63;1.36;1.46;1.41	5.35	1.44	0.22558	.	0.134012	0.48767	N	0.000173	T	0.03827	0.0108	N	0.04880	-0.145	0.31363	N	0.681112	B;B	0.12013	0.005;0.003	B;B	0.08055	0.003;0.003	T	0.35724	-0.9777	9	.	.	.	.	1.4134	0.02296	0.17:0.1447:0.4146:0.2708	.	191;403	E9PCU1;Q86TP1	.;PRUNE_HUMAN	D	403;336;191;168;168;221;118;168	ENSP00000271620:E403D;ENSP00000271619:E191D;ENSP00000357933:E168D;ENSP00000392632:E168D;ENSP00000357932:E221D;ENSP00000357931:E118D;ENSP00000357930:E168D	.	E	+	3	2	PRUNE	149273181	0.995000	0.38212	1.000000	0.80357	0.985000	0.73830	0.173000	0.16724	0.179000	0.19938	0.655000	0.94253	GAG		0.572	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1	NM_021222		Missense_Mutation
FLG	2312	broad.mit.edu	37	1	152276888	152276888	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:152276888C>A	ENST00000368799.1	-	3	10509	c.10474G>T	c.(10474-10476)Gac>Tac	p.D3492Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3492	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.D3492Y(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATTGTTCGTCATTACGAGTT	0.572									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											291.0	284.0	286.0					1																	152276888		2203	4297	6500	150543512	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10474G>T	1.37:g.152276888C>A	ENSP00000357789:p.Asp3492Tyr	Unknown		x	x	x	150543512	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	4.561	0.104119	0.08731	.	.	ENSG00000143631	ENST00000368799	T	0.01665	4.7	2.52	-0.769	0.11009	.	.	.	.	.	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	P	0.58331	0.837	T	0.48490	-0.9031	9	0.62326	D	0.03	.	0.9273	0.01327	0.1543:0.2434:0.3671:0.2352	.	3492	P20930	FILA_HUMAN	Y	3492	ENSP00000357789:D3492Y	ENSP00000357789:D3492Y	D	-	1	0	FLG	150543512	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.493000	0.00972	-0.028000	0.13850	-2.046000	0.00415	GAC		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
PPOX	5498	broad.mit.edu	37	1	161140960	161140960	+	Silent	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr1:161140960C>T	ENST00000367999.4	+	13	1694	c.1428C>T	c.(1426-1428)aaC>aaT	p.N476N	PPOX_ENST00000432542.2_Intron|PPOX_ENST00000352210.5_Silent_p.N476N|PPOX_ENST00000544598.1_Silent_p.N184N|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	476					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)	p.N476N(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CAGAACCTAACAGCTGATCCC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	1											80.0	87.0	85.0					1																	161140960		2203	4300	6503	159407584	SO:0001819	synonymous_variant	5498			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1428C>T	1.37:g.161140960C>T		Unknown		x	x	x	159407584	D3DVG0|Q5VTW8	Silent	SNP	ENST00000367999.4	37	CCDS1221.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.984253	0.00443	.	.	ENSG00000143224	ENST00000537523	.	.	.	4.71	-0.611	0.11601	.	.	.	.	.	T	0.07413	0.0187	.	.	.	0.24347	N	0.994937	.	.	.	.	.	.	T	0.36089	-0.9762	4	.	.	.	-15.712	1.8241	0.03117	0.153:0.3749:0.2976:0.1745	.	.	.	.	I	229	.	.	T	+	2	0	PPOX	159407584	0.007000	0.16637	0.159000	0.22649	0.233000	0.25261	-0.049000	0.11924	-0.280000	0.09154	-0.832000	0.03076	ACA		0.507	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309		Silent
C10orf55	414236	broad.mit.edu	37	10	75672760	75672760	+	Intron	SNP	G	G	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr10:75672760G>T	ENST00000409178.1	-	3	301				PLAU_ENST00000372762.4_Missense_Mutation_p.C55F|PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372764.3_Missense_Mutation_p.C91F|C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000446342.1_Missense_Mutation_p.C74F	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55									p.C91F(1)		endometrium(1)	1	Prostate(51;0.0112)					GGCCGGCCCTGCCTGCCCTGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	10											69.0	63.0	65.0					10																	75672760		2203	4300	6503	75342766	SO:0001627	intron_variant	5328				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.39+40C>A	10.37:g.75672760G>T		Unknown		x	x	x	75342766	Q3KRG4|Q8NAK4	Missense_Mutation	SNP	ENST00000409178.1	37	CCDS53541.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737920	0.69304	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	D;D;D	0.92911	-3.13;-3.13;-3.13	5.78	4.84	0.62591	Kringle (5);Kringle-like fold (1);	0.098719	0.64402	D	0.000001	D	0.97666	0.9235	H	0.99143	4.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.81914	0.991;0.995;0.988;0.981	D	0.97919	1.0313	10	0.87932	D	0	.	12.2698	0.54700	0.0:0.0:0.8316:0.1684	.	74;55;91;91	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	F	74;91;55;55	ENSP00000388474:C74F;ENSP00000361850:C91F;ENSP00000361848:C55F	ENSP00000361847:C55F	C	+	2	0	PLAU	75342766	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	5.849000	0.69465	2.731000	0.93534	0.650000	0.86243	TGC		0.537	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048746.1	NM_001001791		Missense_Mutation
BUB3	9184	broad.mit.edu	37	10	124921870	124921870	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr10:124921870A>G	ENST00000368865.4	+	6	904	c.695A>G	c.(694-696)gAg>gGg	p.E232G	BUB3_ENST00000368859.2_Intron|BUB3_ENST00000538238.1_Missense_Mutation_p.E152G|BUB3_ENST00000368858.5_Missense_Mutation_p.E232G|BUB3_ENST00000481952.1_3'UTR	NM_004725.3	NP_004716.1	O43684	BUB3_HUMAN	BUB3 mitotic checkpoint protein	232					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|regulation of chromosome segregation (GO:0051983)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly checkpoint (GO:0071173)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)		p.E232G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				AATAATATTGAGCAGATTTAC	0.373																																					GBM(161;1111 1985 17553 20049 26037)											1	Substitution - Missense(1)	ovary(1)	10											106.0	112.0	110.0					10																	124921870		2203	4300	6503	124911860	SO:0001583	missense	9184			AF053304	CCDS7635.1, CCDS31306.1	10q24	2013-01-17	2013-01-17		ENSG00000154473	ENSG00000154473		"""WD repeat domain containing"""	1151	protein-coding gene	gene with protein product		603719	"""BUB3 (budding uninhibited by benzimidazoles 3, yeast) homolog"", ""budding uninhibited by benzimidazoles 3 homolog (yeast)"""			9660858	Standard	NM_004725		Approved	BUB3L	uc001lhe.2	O43684	OTTHUMG00000019197	ENST00000368865.4:c.695A>G	10.37:g.124921870A>G	ENSP00000357858:p.Glu232Gly	Unknown		x	x	x	124911860	A6NJ42|B2R6E7|D3DRE9|O43685	Missense_Mutation	SNP	ENST00000368865.4	37	CCDS7635.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450972	0.84209	.	.	ENSG00000154473	ENST00000368865;ENST00000538238;ENST00000368858;ENST00000407911	T;T;T;T	0.70045	-0.45;-0.44;-0.45;-0.45	5.62	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77003	0.4067	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.76410	-0.2969	10	0.48119	T	0.1	-12.8147	11.5023	0.50446	0.9298:0.0:0.0702:0.0	.	232;232	O43684;O43684-2	BUB3_HUMAN;.	G	232;152;232;232	ENSP00000357858:E232G;ENSP00000444354:E152G;ENSP00000357851:E232G;ENSP00000383941:E232G	ENSP00000357851:E232G	E	+	2	0	BUB3	124911860	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.255000	0.95524	1.068000	0.40764	0.528000	0.53228	GAG		0.373	BUB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050835.1			Missense_Mutation
LUZP2	338645	broad.mit.edu	37	11	24998138	24998138	+	Splice_Site	SNP	C	C	G	rs572470818		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr11:24998138C>G	ENST00000336930.6	+	8	590	c.524C>G	c.(523-525)gCg>gGg	p.A175G	LUZP2_ENST00000533227.1_Splice_Site_p.A89G			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	175	Leucine-zipper.					extracellular region (GO:0005576)		p.A175G(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						ATTTTACAGGCGCAGCAGCTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	11											55.0	61.0	59.0					11																	24998138		2202	4299	6501	24954714	SO:0001630	splice_region_variant	338645			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.523-1C>G	11.37:g.24998138C>G		Unknown		x	x	x	24954714	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	CCDS31446.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.84	3.232739	0.58777	.	.	ENSG00000187398	ENST00000336930;ENST00000529015;ENST00000533227	T;T;T	0.25250	1.81;1.99;1.81	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000002	T	0.36608	0.0973	N	0.20986	0.625	0.36880	D	0.889337	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.25433	-1.0132	10	0.28530	T	0.3	-7.9555	16.4555	0.84011	0.0:1.0:0.0:0.0	.	89;175	E9PN53;Q86TE4	.;LUZP2_HUMAN	G	175;133;89	ENSP00000336817:A175G;ENSP00000437032:A133G;ENSP00000432952:A89G	ENSP00000336817:A175G	A	+	2	0	LUZP2	24954714	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	4.066000	0.57520	2.540000	0.85666	0.650000	0.86243	GCG		0.358	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	Missense_Mutation	Missense_Mutation
SLCO2B1	11309	broad.mit.edu	37	11	74911328	74911328	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr11:74911328C>A	ENST00000289575.5	+	11	2054	c.1659C>A	c.(1657-1659)tgC>tgA	p.C553*	SLCO2B1_ENST00000531756.1_Nonsense_Mutation_p.C298*|SLCO2B1_ENST00000341411.4_Nonsense_Mutation_p.C326*|SLCO2B1_ENST00000532236.1_Nonsense_Mutation_p.C437*|SLCO2B1_ENST00000454962.2_Nonsense_Mutation_p.C326*|SLCO2B1_ENST00000525650.1_Nonsense_Mutation_p.C409*|SLCO2B1_ENST00000428359.2_Nonsense_Mutation_p.C531*	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	553					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.C553*(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CAGGATCCTGCGACTCAACGT	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	11											120.0	109.0	113.0					11																	74911328		2200	4293	6493	74588976	SO:0001587	stop_gained	11309			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1659C>A	11.37:g.74911328C>A	ENSP00000289575:p.Cys553*	Unknown		x	x	x	74588976	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Nonsense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353929	0.61293	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000531756;ENST00000525650;ENST00000454962;ENST00000428359	.	.	.	5.37	-8.49	0.00931	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1462	0.89656	0.0:0.2034:0.0:0.7966	.	.	.	.	X	553;326;437;298;409;326;531	.	ENSP00000289575:C553X	C	+	3	2	SLCO2B1	74588976	0.011000	0.17503	0.407000	0.26434	0.055000	0.15305	-1.736000	0.01845	-1.753000	0.01323	-0.379000	0.06801	TGC		0.612	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256		Nonsense_Mutation
KCTD14	65987	broad.mit.edu	37	11	77728292	77728292	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr11:77728292C>T	ENST00000353172.5	-	2	159	c.115G>A	c.(115-117)Gtc>Atc	p.V39I	RP11-7I15.3_ENST00000533697.1_RNA|NDUFC2-KCTD14_ENST00000528251.1_Missense_Mutation_p.R64H|KCTD14_ENST00000533144.1_Missense_Mutation_p.V9I|NDUFC2-KCTD14_ENST00000530054.1_Missense_Mutation_p.R112H	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	39	BTB.				protein homooligomerization (GO:0051260)			p.V39I(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			TCACCCCCGACGTTCAGCTCC	0.532																																					NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)											1	Substitution - Missense(1)	ovary(1)	11											54.0	53.0	53.0					11																	77728292		2200	4292	6492	77405940	SO:0001583	missense	65987			BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.115G>A	11.37:g.77728292C>T	ENSP00000316482:p.Val39Ile	Unknown		x	x	x	77405940	B2R9R8	Missense_Mutation	SNP	ENST00000353172.5	37	CCDS8255.2	SNP	19	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.43|15.43	2.832518|2.832518	0.50845|0.50845	.|.	.|.	ENSG00000259112|ENSG00000151364	ENST00000528251;ENST00000530054|ENST00000353172;ENST00000533144	T;T|T;T	0.58506|0.62232	0.33;0.72|0.04;0.04	4.89|4.89	3.99|3.99	0.46301|0.46301	.|BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.|0.136566	.|0.49916	.|D	.|0.000139	T|T	0.57021|0.57021	0.2025|0.2025	L|L	0.38692|0.38692	1.165|1.165	0.26865|0.26865	N|N	0.967877|0.967877	.|D	.|0.58268	.|0.982	.|P	.|0.50270	.|0.636	T|T	0.51140|0.51140	-0.8743|-0.8743	7|10	0.87932|0.44086	D|T	0|0.13	.|.	8.7995|8.7995	0.34901|0.34901	0.0:0.8311:0.0:0.1689|0.0:0.8311:0.0:0.1689	.|.	.|39	.|Q9BQ13	.|KCD14_HUMAN	H|I	64;112|39;9	ENSP00000435967:R64H;ENSP00000432614:R112H|ENSP00000316482:V39I;ENSP00000431155:V9I	ENSP00000435967:R64H|ENSP00000316482:V39I	R|V	-|-	2|1	0|0	RP11-7I15.5|KCTD14	77405940|77405940	0.985000|0.985000	0.35326|0.35326	0.764000|0.764000	0.31436|0.31436	0.959000|0.959000	0.62525|0.62525	2.657000|2.657000	0.46724|0.46724	1.281000|1.281000	0.44480|0.44480	0.561000|0.561000	0.74099|0.74099	CGT|GTC		0.532	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316888.1	NM_023930		Missense_Mutation
FAT3	120114	broad.mit.edu	37	11	92087551	92087551	+	Missense_Mutation	SNP	A	A	G	rs375393993		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr11:92087551A>G	ENST00000298047.6	+	1	2290	c.2273A>G	c.(2272-2274)aAt>aGt	p.N758S	FAT3_ENST00000525166.1_Missense_Mutation_p.N608S|FAT3_ENST00000409404.2_Missense_Mutation_p.N758S|FAT3_ENST00000541502.1_Missense_Mutation_p.N758S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	758	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T764A(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCTGGCTTCAATGGAAAAGTG	0.408										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11						A	SER/ASN	1,3827		0,1,1913	125.0	126.0	125.0		2273	5.8	1.0	11		125	0,8274		0,0,4137	no	missense	FAT3	NM_001008781.2	46	0,1,6050	GG,GA,AA		0.0,0.0261,0.0083	possibly-damaging	758/4558	92087551	1,12101	1914	4137	6051	91727199	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2273A>G	11.37:g.92087551A>G	ENSP00000298047:p.Asn758Ser	Unknown		x	x	x	91727199	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	14.99	2.699522	0.48307	2.61E-4	0.0	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.77	5.77	0.91146	.	.	.	.	.	T	0.75250	0.3824	M	0.83603	2.65	0.44595	D	0.997567	D	0.76494	0.999	D	0.83275	0.996	T	0.77400	-0.2602	9	0.49607	T	0.09	.	9.721	0.40302	0.9233:0.0:0.0766:0.0	.	758	Q8TDW7-3	.	S	758;758;758;608	ENSP00000298047:N758S;ENSP00000387040:N758S;ENSP00000443786:N758S;ENSP00000432586:N608S	ENSP00000298047:N758S	N	+	2	0	FAT3	91727199	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.500000	0.81588	2.204000	0.70986	0.383000	0.25322	AAT		0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
ETV6	2120	broad.mit.edu	37	12	12037492	12037492	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr12:12037492G>C	ENST00000396373.4	+	6	1397	c.1123G>C	c.(1123-1125)Gga>Cga	p.G375R		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	375					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G375R(1)	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GGATCCCAACGGACTGGCTCG	0.463			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	1	Substitution - Missense(1)	ovary(1)	12											92.0	87.0	89.0					12																	12037492		2203	4300	6503	11928759	SO:0001583	missense	2120			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1123G>C	12.37:g.12037492G>C	ENSP00000379658:p.Gly375Arg	Unknown		x	x	x	11928759	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	ENST00000396373.4	37	CCDS8643.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.085985	0.94100	.	.	ENSG00000139083	ENST00000396373	T	0.13420	2.59	5.63	5.63	0.86233	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.053475	0.85682	D	0.000000	T	0.28001	0.0690	N	0.25647	0.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01734	-1.1285	10	0.54805	T	0.06	.	19.2738	0.94021	0.0:0.0:1.0:0.0	.	375	P41212	ETV6_HUMAN	R	375	ENSP00000379658:G375R	ENSP00000379658:G375R	G	+	1	0	ETV6	11928759	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.869000	0.99810	2.636000	0.89361	0.655000	0.94253	GGA		0.463	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987		Missense_Mutation
OVCH1	341350	broad.mit.edu	37	12	29629180	29629180	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr12:29629180G>A	ENST00000318184.5	-	13	1429	c.1430C>T	c.(1429-1431)gCt>gTt	p.A477V	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	477	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.A477V(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AATCACAACAGCATCATAAAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											191.0	181.0	184.0					12																	29629180		1871	4111	5982	29520447	SO:0001583	missense	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1430C>T	12.37:g.29629180G>A	ENSP00000326708:p.Ala477Val	Unknown		x	x	x	29520447		Missense_Mutation	SNP	ENST00000318184.5	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818224	0.32145	.	.	ENSG00000187950	ENST00000318184	T	0.57752	0.38	2.49	1.56	0.23342	CUB (5);	.	.	.	.	T	0.50360	0.1611	N	0.24115	0.695	0.09310	N	1	D	0.59767	0.986	P	0.61328	0.887	T	0.42378	-0.9455	9	0.17832	T	0.49	.	10.4034	0.44243	0.0:0.2023:0.7977:0.0	.	477	Q7RTY7	OVCH1_HUMAN	V	477	ENSP00000326708:A477V	ENSP00000326708:A477V	A	-	2	0	OVCH1	29520447	0.005000	0.15991	0.046000	0.18839	0.070000	0.16714	0.563000	0.23547	0.585000	0.29608	0.650000	0.86243	GCT		0.378	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		Missense_Mutation
SLC38A4	55089	broad.mit.edu	37	12	47181808	47181808	+	Missense_Mutation	SNP	C	C	T	rs562561657		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr12:47181808C>T	ENST00000447411.1	-	4	423	c.217G>A	c.(217-219)Gga>Aga	p.G73R	SLC38A4_ENST00000266579.4_Missense_Mutation_p.G73R	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	73					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)	p.G73R(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					GAAGTGGTTCCGGGATGCTTG	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20728	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12											83.0	78.0	80.0					12																	47181808		2203	4300	6503	45468075	SO:0001583	missense	55089			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.217G>A	12.37:g.47181808C>T	ENSP00000389843:p.Gly73Arg	Unknown		x	x	x	45468075	A8K553	Missense_Mutation	SNP	ENST00000447411.1	37	CCDS8750.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.288411	0.95517	.	.	ENSG00000139209	ENST00000395426;ENST00000447411;ENST00000266579;ENST00000547477;ENST00000546940	T;T;T;T	0.29917	3.31;3.31;1.79;1.55	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.55226	0.1907	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.52487	-0.8569	10	0.51188	T	0.08	-14.5934	19.5612	0.95373	0.0:1.0:0.0:0.0	.	73	Q969I6	S38A4_HUMAN	R	73	ENSP00000389843:G73R;ENSP00000266579:G73R;ENSP00000450071:G73R;ENSP00000448543:G73R	ENSP00000266579:G73R	G	-	1	0	SLC38A4	45468075	1.000000	0.71417	0.996000	0.52242	0.953000	0.61014	7.776000	0.85560	2.687000	0.91594	0.655000	0.94253	GGA		0.438	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404574.1			Missense_Mutation
ACTR6	64431	broad.mit.edu	37	12	100612251	100612251	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr12:100612251T>G	ENST00000188312.2	+	9	1574	c.809T>G	c.(808-810)tTg>tGg	p.L270W	ACTR6_ENST00000546902.1_Missense_Mutation_p.L188W|ACTR6_ENST00000552376.1_Missense_Mutation_p.L270W|ACTR6_ENST00000551617.1_Missense_Mutation_p.L188W	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	270						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.L270W(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						ATTCTTCGTTTGGCCAATGAG	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											88.0	85.0	86.0					12																	100612251		2203	4300	6503	99136382	SO:0001583	missense	64431			AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.809T>G	12.37:g.100612251T>G	ENSP00000188312:p.Leu270Trp	Unknown		x	x	x	99136382	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	CCDS9074.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	27.7	4.856431	0.91355	.	.	ENSG00000075089	ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	D;D;D;D	0.95342	-3.68;-3.68;-3.68;-3.68	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.97788	0.9274	M	0.91406	3.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77557	0.985;0.985;0.984;0.99	D	0.98737	1.0715	10	0.87932	D	0	.	16.1839	0.81934	0.0:0.0:0.0:1.0	.	188;188;270;270	G3V1Y1;F8VSD1;F8W057;Q9GZN1	.;.;.;ARP6_HUMAN	W	270;188;270;188	ENSP00000188312:L270W;ENSP00000448669:L188W;ENSP00000447237:L270W;ENSP00000448356:L188W	ENSP00000188312:L270W	L	+	2	0	ACTR6	99136382	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	7.403000	0.79983	2.222000	0.72286	0.533000	0.62120	TTG		0.343	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496		Missense_Mutation
B3GNT4	79369	broad.mit.edu	37	12	122691196	122691196	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr12:122691196G>A	ENST00000324189.4	+	3	754	c.398G>A	c.(397-399)cGa>cAa	p.R133Q	B3GNT4_ENST00000545141.1_Intron|B3GNT4_ENST00000535274.1_Missense_Mutation_p.R108Q|B3GNT4_ENST00000546192.1_Missense_Mutation_p.R108Q	NM_030765.2	NP_110392.1	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4	133					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.R133Q(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		CACGTGGAGCGACGTGCGGCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											102.0	105.0	104.0					12																	122691196		2203	4300	6503	121257149	SO:0001583	missense	79369			AB049586	CCDS9227.1	12q24	2013-02-19						"""Beta 3-glycosyltransferases"""	15683	protein-coding gene	gene with protein product		605864				11042166	Standard	NM_030765		Approved	B3GN-T4, beta3Gn-T4	uc001ubx.3	Q9C0J1		ENST00000324189.4:c.398G>A	12.37:g.122691196G>A	ENSP00000319636:p.Arg133Gln	Unknown		x	x	x	121257149	Q8N5W4|Q8N934|Q8ND21|Q8WWR5|Q8WY02|Q96QH5	Missense_Mutation	SNP	ENST00000324189.4	37	CCDS9227.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	9.980	1.228003	0.22542	.	.	ENSG00000176383	ENST00000324189;ENST00000546192;ENST00000535274	T;T;T	0.51817	0.69;0.69;0.69	5.0	-1.27	0.09347	.	0.600069	0.13961	N	0.350819	T	0.26304	0.0642	N	0.16016	0.355	0.19300	N	0.99998	B	0.24882	0.113	B	0.20384	0.029	T	0.14868	-1.0457	10	0.31617	T	0.26	.	9.9671	0.41732	0.4297:0.0:0.5703:0.0	.	133	Q9C0J1	B3GN4_HUMAN	Q	133;108;108	ENSP00000319636:R133Q;ENSP00000438840:R108Q;ENSP00000444534:R108Q	ENSP00000319636:R133Q	R	+	2	0	B3GNT4	121257149	0.779000	0.28652	0.002000	0.10522	0.123000	0.20343	1.690000	0.37711	-0.229000	0.09854	-0.126000	0.14955	CGA		0.622	B3GNT4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401595.1	NM_030765		Missense_Mutation
UTP14C	9724	broad.mit.edu	37	13	52604325	52604325	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr13:52604325C>T	ENST00000521776.2	+	2	2118	c.1385C>T	c.(1384-1386)tCt>tTt	p.S462F		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	462					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.S462F(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AGGGCACTATCTCAGAAATTG	0.493																																																1	Substitution - Missense(1)	ovary(1)	13											92.0	97.0	96.0					13																	52604325		2203	4300	6503	51502326	SO:0001583	missense	9724			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.1385C>T	13.37:g.52604325C>T	ENSP00000428619:p.Ser462Phe	Unknown		x	x	x	51502326	Q5FWG3|Q92555	Missense_Mutation	SNP	ENST00000521776.2	37	CCDS31978.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	6.091	0.385021	0.11524	.	.	ENSG00000253797	ENST00000521776	T	0.19806	2.12	2.91	2.91	0.33838	.	0.852655	0.11048	N	0.605351	T	0.21387	0.0515	L	0.58925	1.835	0.09310	N	1	B	0.12630	0.006	B	0.16722	0.016	T	0.13415	-1.0510	9	.	.	.	-1.7969	9.3827	0.38325	0.0:1.0:0.0:0.0	.	462	Q5TAP6	UT14C_HUMAN	F	462	ENSP00000428619:S462F	.	S	+	2	0	UTP14C	51502326	0.002000	0.14202	0.081000	0.20488	0.038000	0.13279	0.213000	0.17521	1.636000	0.50526	0.462000	0.41574	TCT		0.493	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045049.2	NM_021645		Missense_Mutation
DCT	1638	broad.mit.edu	37	13	95121160	95121160	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr13:95121160T>G	ENST00000377028.5	-	2	848	c.435A>C	c.(433-435)ttA>ttC	p.L145F	DCT_ENST00000446125.1_Missense_Mutation_p.L145F|DCT_ENST00000490854.1_5'Flank	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	145					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)	p.L145F(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TCGCGAGATCTAAGGCGCCCA	0.567																																																1	Substitution - Missense(1)	ovary(1)	13											225.0	223.0	224.0					13																	95121160		2203	4300	6503	93919161	SO:0001583	missense	1638			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.435A>C	13.37:g.95121160T>G	ENSP00000366227:p.Leu145Phe	Unknown		x	x	x	93919161	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183623	0.38609	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.99113	-5.44;-5.44	5.79	1.37	0.22104	Uncharacterised domain, di-copper centre (2);	0.067025	0.64402	D	0.000011	D	0.98785	0.9591	M	0.87097	2.86	0.58432	D	0.999998	D;P	0.58268	0.982;0.941	P;P	0.54140	0.743;0.536	D	0.97864	1.0282	9	.	.	.	-7.3318	10.3188	0.43753	0.0:0.5362:0.0:0.4638	.	145;145	Q09GT4;P40126	.;TYRP2_HUMAN	F	145	ENSP00000366227:L145F;ENSP00000392762:L145F	.	L	-	3	2	DCT	93919161	1.000000	0.71417	0.642000	0.29436	0.023000	0.10783	0.838000	0.27572	-0.076000	0.12775	-0.250000	0.11733	TTA		0.567	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3			Missense_Mutation
CHD8	57680	broad.mit.edu	37	14	21896413	21896413	+	Splice_Site	SNP	C	C	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr14:21896413C>G	ENST00000557364.1	-	4	1479	c.1216G>C	c.(1216-1218)Gct>Cct	p.A406P	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Splice_Site_p.A127P|CHD8_ENST00000399982.2_Splice_Site_p.A406P|RN7SL650P_ENST00000583681.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	406	Gln-rich.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.A406P(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GAAGAGCCAGCCTATAGAAAC	0.448																																																1	Substitution - Missense(1)	ovary(1)	14											52.0	50.0	50.0					14																	21896413		1818	4072	5890	20966253	SO:0001630	splice_region_variant	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1216-1G>C	14.37:g.21896413C>G		Unknown		x	x	x	20966253	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.29	2.492492	0.44352	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.90197	-2.63;-2.61;-2.61	5.7	5.7	0.88788	.	0.059107	0.64402	D	0.000002	D	0.88284	0.6395	N	0.19112	0.55	0.42485	D	0.992877	D	0.62365	0.991	P	0.56514	0.8	D	0.83729	0.0197	10	0.02654	T	1	-11.8709	18.6031	0.91256	0.0:1.0:0.0:0.0	.	127	Q9HCK8-2	.	P	127;406;126;406	ENSP00000406288:A127P;ENSP00000382863:A406P;ENSP00000451601:A406P	ENSP00000262707:A126P	A	-	1	0	CHD8	20966253	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.969000	0.49232	2.687000	0.91594	0.563000	0.77884	GCT		0.448	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	Missense_Mutation	Missense_Mutation
DDX24	57062	broad.mit.edu	37	14	94521519	94521519	+	Silent	SNP	G	G	A	rs369246793		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr14:94521519G>A	ENST00000330836.5	-	7	2132	c.2001C>T	c.(1999-2001)acC>acT	p.T667T	DDX24_ENST00000544005.1_Silent_p.T417T|DDX24_ENST00000555054.1_Silent_p.T624T	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	667	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.T667T(1)		cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		AAATCTCCGAGGTACGTGGGA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	14						G		0,4406		0,0,2203	72.0	67.0	69.0		2001	-0.6	0.9	14		69	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DDX24	NM_020414.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		667/860	94521519	1,13005	2203	4300	6503	93591272	SO:0001819	synonymous_variant	57062			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.2001C>T	14.37:g.94521519G>A		Unknown		x	x	x	93591272	E7EMJ4|Q4V9L5	Silent	SNP	ENST00000330836.5	37	CCDS9918.1	SNP	35	Broad																																																																																				0.537	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414		Silent
CILP	8483	broad.mit.edu	37	15	65499326	65499326	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr15:65499326C>T	ENST00000261883.4	-	4	384	c.218G>A	c.(217-219)cGg>cAg	p.R73Q		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	73					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.R73Q(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GGCGTCCAGCCGCTCATAGTC	0.612																																																1	Substitution - Missense(1)	ovary(1)	15											53.0	43.0	46.0					15																	65499326		2201	4299	6500	63286379	SO:0001583	missense	8483			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.218G>A	15.37:g.65499326C>T	ENSP00000261883:p.Arg73Gln	Unknown		x	x	x	63286379	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118610	0.56505	.	.	ENSG00000138615	ENST00000261883	T	0.16743	2.32	5.58	4.64	0.57946	.	0.162448	0.56097	D	0.000028	T	0.13200	0.0320	L	0.40543	1.245	0.38915	D	0.957603	P	0.35684	0.515	B	0.25405	0.06	T	0.07616	-1.0763	10	0.37606	T	0.19	-20.8633	13.4491	0.61161	0.1579:0.8421:0.0:0.0	.	73	O75339	CILP1_HUMAN	Q	73	ENSP00000261883:R73Q	ENSP00000261883:R73Q	R	-	2	0	CILP	63286379	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	4.454000	0.60068	1.300000	0.44818	0.561000	0.74099	CGG		0.612	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		Missense_Mutation
CDH11	1009	broad.mit.edu	37	16	65005940	65005940	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr16:65005940G>C	ENST00000268603.4	-	10	2033	c.1418C>G	c.(1417-1419)cCa>cGa	p.P473R	CDH11_ENST00000566827.1_Missense_Mutation_p.P347R|CDH11_ENST00000394156.3_Missense_Mutation_p.P473R	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	473	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P473R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		AATGGCCACTGGGACTTTGGC	0.478			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																													Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	1	Substitution - Missense(1)	ovary(1)	16											101.0	87.0	92.0					16																	65005940		2203	4300	6503	63563441	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1418C>G	16.37:g.65005940G>C	ENSP00000268603:p.Pro473Arg	Unknown		x	x	x	63563441	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	12.98	2.100018	0.37048	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.01685	4.69;4.69	5.91	5.91	0.95273	Cadherin (5);Cadherin-like (1);	0.161528	0.56097	D	0.000027	T	0.02767	0.0083	L	0.37561	1.115	0.50039	D	0.999847	B;B	0.21606	0.058;0.009	B;B	0.18561	0.022;0.012	T	0.58352	-0.7651	10	0.44086	T	0.13	.	19.2845	0.94065	0.0:0.0:1.0:0.0	.	473;473	P55287-2;P55287	.;CAD11_HUMAN	R	473;473;456	ENSP00000268603:P473R;ENSP00000377711:P473R	ENSP00000268603:P473R	P	-	2	0	CDH11	63563441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.456000	0.53000	2.813000	0.96785	0.655000	0.94253	CCA		0.478	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664		Missense_Mutation
TAT	6898	broad.mit.edu	37	16	71610312	71610312	+	Missense_Mutation	SNP	G	G	A	rs548790465		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr16:71610312G>A	ENST00000355962.4	-	2	140	c.7C>T	c.(7-9)Cca>Tca	p.P3S	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	3					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)	p.P3S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	ATCATGTATGGGTCCATCACT	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19154	0.0		0.0	False		,,,				2504	0.0				Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)											1	Substitution - Missense(1)	ovary(1)	16											89.0	90.0	90.0					16																	71610312		2198	4300	6498	70167813	SO:0001583	missense	6898				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.7C>T	16.37:g.71610312G>A	ENSP00000348234:p.Pro3Ser	Unknown		x	x	x	70167813	B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	37	CCDS10903.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934256	0.34096	.	.	ENSG00000198650	ENST00000355962	T	0.78364	-1.17	6.06	-2.14	0.07123	Tyrosine aminotransferase ubiquitination region (1);	1.556390	0.03537	N	0.223376	T	0.52256	0.1723	N	0.04508	-0.205	0.23095	N	0.998309	B;B;B	0.13145	0.007;0.001;0.001	B;B;B	0.12837	0.008;0.001;0.001	T	0.46400	-0.9194	10	0.08837	T	0.75	0.0418	6.149	0.20301	0.43:0.3283:0.2417:0.0	.	3;3;3	Q8WW92;A1L4G7;P17735	.;.;ATTY_HUMAN	S	3	ENSP00000348234:P3S	ENSP00000348234:P3S	P	-	1	0	TAT	70167813	0.990000	0.36364	0.896000	0.35187	0.849000	0.48306	0.261000	0.18442	-0.276000	0.09206	-0.136000	0.14681	CCA		0.507	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	17											50.0	52.0	51.0					17																	7578461		2202	4300	6502	7519186	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Unknown		x	x	x	7519186	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
OMG	4974	broad.mit.edu	37	17	29622592	29622592	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:29622592G>A	ENST00000247271.4	-	2	1019	c.758C>T	c.(757-759)cCa>cTa	p.P253L	NF1_ENST00000356175.3_Intron|NF1_ENST00000358273.4_Intron	NM_002544.4	NP_002535.3	P23515	OMGP_HUMAN	oligodendrocyte myelin glycoprotein	253					cell adhesion (GO:0007155)|negative regulation of axonogenesis (GO:0050771)|neuron projection regeneration (GO:0031102)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|regulation of collateral sprouting of intact axon in response to injury (GO:0048683)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.0?(8)|p.?(3)|p.P253L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|stomach(1)	13		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)		GGTAGAACATGGAGTCCCTAT	0.393																																																12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17											168.0	143.0	151.0					17																	29622592		2203	4300	6503	26646718	SO:0001583	missense	4974				CCDS11265.1	17q11-q12	2008-07-18			ENSG00000126861	ENSG00000126861			8135	protein-coding gene	gene with protein product		164345				1899288, 2277079	Standard	NM_002544		Approved	OMGP	uc002hgj.3	P23515	OTTHUMG00000132870	ENST00000247271.4:c.758C>T	17.37:g.29622592G>A	ENSP00000247271:p.Pro253Leu	Unknown		x	x	x	26646718	E1P659	Missense_Mutation	SNP	ENST00000247271.4	37	CCDS11265.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078855	0.36662	.	.	ENSG00000126861	ENST00000247271	T	0.51325	0.71	5.54	4.57	0.56435	.	0.101722	0.43747	D	0.000522	T	0.35856	0.0946	N	0.24115	0.695	0.80722	D	1	B	0.13145	0.007	B	0.15052	0.012	T	0.13361	-1.0512	10	0.48119	T	0.1	-3.2877	14.6299	0.68647	0.0702:0.0:0.9298:0.0	.	253	P23515	OMGP_HUMAN	L	253	ENSP00000247271:P253L	ENSP00000247271:P253L	P	-	2	0	OMG	26646718	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.496000	0.90485	1.479000	0.48272	0.650000	0.86243	CCA		0.393	OMG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256350.2	NM_002544		Missense_Mutation
EVI2A	2123	broad.mit.edu	37	17	29645986	29645986	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:29645986A>G	ENST00000462804.2	-	2	445	c.46T>C	c.(46-48)Ttt>Ctt	p.F16L	NF1_ENST00000356175.3_Intron|CTD-2370N5.3_ENST00000578584.1_5'Flank|NF1_ENST00000581113.2_Intron|EVI2A_ENST00000247270.3_Missense_Mutation_p.F39L|EVI2A_ENST00000461237.1_Missense_Mutation_p.F16L|NF1_ENST00000358273.4_Intron	NM_014210.3	NP_055025.2	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A	16					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.0?(8)|p.?(3)|p.F39L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		GTCATCAGAAAGGCAAGATGT	0.398																																																12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17											211.0	201.0	204.0					17																	29645986		2203	4300	6503	26670112	SO:0001583	missense	2123			M55267	CCDS32608.1, CCDS42293.1	17q11.2	2008-07-18			ENSG00000126860	ENSG00000126860			3499	protein-coding gene	gene with protein product		158380		EVI2		2117566	Standard	NM_014210		Approved	EVDA	uc002hgm.3	P22794	OTTHUMG00000159306	ENST00000462804.2:c.46T>C	17.37:g.29645986A>G	ENSP00000420557:p.Phe16Leu	Unknown		x	x	x	26670112	B2R5X2|B4DHX8	Missense_Mutation	SNP	ENST00000462804.2	37	CCDS42293.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	13.80	2.343801	0.41498	.	.	ENSG00000126860	ENST00000394755;ENST00000462804;ENST00000461237;ENST00000247270	.	.	.	5.31	2.75	0.32379	.	0.279448	0.31335	N	0.007838	T	0.47637	0.1456	L	0.50333	1.59	0.80722	D	1	B;B	0.20887	0.049;0.04	B;B	0.23150	0.044;0.043	T	0.38564	-0.9655	9	0.33940	T	0.23	.	8.4811	0.33043	0.8163:0.0:0.1837:0.0	.	16;39	P22794;P22794-2	EVI2A_HUMAN;.	L	16;12;16;39	.	ENSP00000247270:F39L	F	-	1	0	EVI2A	26670112	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	1.623000	0.37008	0.862000	0.35528	0.533000	0.62120	TTT		0.398	EVI2A-001	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354491.3	NM_014210		Missense_Mutation
KRTAP9-8	83901	broad.mit.edu	37	17	39394650	39394650	+	Missense_Mutation	SNP	G	G	C	rs556439657	byFrequency	TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:39394650G>C	ENST00000254072.6	+	1	354	c.347G>C	c.(346-348)tGc>tCc	p.C116S		NM_031963.2	NP_114169.2	Q9BYQ0	KRA98_HUMAN	keratin associated protein 9-8	116	15 X 5 AA repeats of C-C-[RQVSGE]- [SPSNQ]-[TASPI].					keratin filament (GO:0045095)		p.C116S(1)		lung(8)|ovary(1)|prostate(1)	10		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CTGCCTGGTTGCCTAAACCAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											92.0	112.0	106.0					17																	39394650		2105	4300	6405	36648176	SO:0001583	missense	83901			AJ406950	CCDS42334.1	17q21.2	2013-06-25			ENSG00000187272	ENSG00000187272		"""Keratin associated proteins"""	17231	protein-coding gene	gene with protein product						11279113	Standard	NM_031963		Approved	KAP9.8	uc002hwh.4	Q9BYQ0	OTTHUMG00000133604	ENST00000254072.6:c.347G>C	17.37:g.39394650G>C	ENSP00000254072:p.Cys116Ser	Unknown		x	x	x	36648176		Missense_Mutation	SNP	ENST00000254072.6	37	CCDS42334.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	.	11.71	1.720638	0.30503	.	.	ENSG00000187272	ENST00000254072	T	0.01221	5.15	2.1	1.09	0.20402	.	.	.	.	.	T	0.04907	0.0132	M	0.68317	2.08	0.09310	N	1	D	0.54772	0.968	D	0.69824	0.966	T	0.37384	-0.9708	9	0.56958	D	0.05	.	3.4405	0.07461	0.399:0.0:0.601:0.0	.	116	Q9BYQ0	KRA98_HUMAN	S	116	ENSP00000254072:C116S	ENSP00000254072:C116S	C	+	2	0	KRTAP9-8	36648176	0.107000	0.21998	0.009000	0.14445	0.164000	0.22412	0.315000	0.19451	1.105000	0.41606	0.508000	0.49915	TGC		0.617	KRTAP9-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257712.1			Missense_Mutation
ITGA3	3675	broad.mit.edu	37	17	48149481	48149481	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:48149481C>G	ENST00000320031.8	+	7	1421	c.1091C>G	c.(1090-1092)cCc>cGc	p.P364R	ITGA3_ENST00000007722.7_Missense_Mutation_p.P364R|ITGA3_ENST00000544892.1_Missense_Mutation_p.P139R	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	364					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)	p.P364R(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						CTTCATGGCCCCAGTGGCTCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	17											146.0	117.0	127.0					17																	48149481		2203	4300	6503	45504480	SO:0001583	missense	3675			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.1091C>G	17.37:g.48149481C>G	ENSP00000315190:p.Pro364Arg	Unknown		x	x	x	45504480	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006669	0.74932	.	.	ENSG00000005884	ENST00000544892;ENST00000007722;ENST00000538917;ENST00000320031	T;T;T	0.71698	-0.59;2.81;2.81	5.55	5.55	0.83447	.	0.157867	0.56097	D	0.000024	T	0.78046	0.4222	L	0.51853	1.615	0.47123	D	0.999327	D;D	0.76494	0.999;0.999	D;D	0.76071	0.983;0.987	T	0.72343	-0.4322	10	0.17369	T	0.5	.	13.9626	0.64191	0.0:0.8478:0.1522:0.0	.	364;364	P26006-1;P26006	.;ITA3_HUMAN	R	139;364;350;364	ENSP00000446133:P139R;ENSP00000007722:P364R;ENSP00000315190:P364R	ENSP00000007722:P364R	P	+	2	0	ITGA3	45504480	0.975000	0.34042	1.000000	0.80357	0.898000	0.52572	3.704000	0.54815	2.620000	0.88729	0.563000	0.77884	CCC		0.557	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501		Missense_Mutation
EPX	8288	broad.mit.edu	37	17	56281620	56281620	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:56281620C>A	ENST00000225371.5	+	12	2094	c.1984C>A	c.(1984-1986)Cag>Aag	p.Q662K		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	662					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.Q662K(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CACCAAAAGACAGCGCAAGGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											105.0	92.0	97.0					17																	56281620		2203	4300	6503	53636619	SO:0001583	missense	8288			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1984C>A	17.37:g.56281620C>A	ENSP00000225371:p.Gln662Lys	Unknown		x	x	x	53636619	Q4TVP3	Missense_Mutation	SNP	ENST00000225371.5	37	CCDS11602.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985801	0.93044	.	.	ENSG00000121053	ENST00000225371	T	0.70986	-0.53	5.65	5.65	0.86999	.	0.102568	0.64402	D	0.000002	D	0.89760	0.6808	H	0.96604	3.85	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.92799	0.6255	10	0.87932	D	0	-10.2799	17.2336	0.86991	0.0:1.0:0.0:0.0	.	662	P11678	PERE_HUMAN	K	662	ENSP00000225371:Q662K	ENSP00000225371:Q662K	Q	+	1	0	EPX	53636619	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	5.673000	0.68109	2.660000	0.90430	0.655000	0.94253	CAG		0.493	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502		Missense_Mutation
TEX14	56155	broad.mit.edu	37	17	56661918	56661918	+	Silent	SNP	A	A	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:56661918A>G	ENST00000240361.8	-	19	3217	c.3132T>C	c.(3130-3132)caT>caC	p.H1044H	TEX14_ENST00000389934.3_Silent_p.H1038H|TEX14_ENST00000349033.5_Silent_p.H1038H			Q8IWB6	TEX14_HUMAN	testis expressed 14	1044					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.H1038H(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGCTTCACTATGCTCTGGTT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	17											207.0	174.0	185.0					17																	56661918		2203	4300	6503	54016917	SO:0001819	synonymous_variant	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.3132T>C	17.37:g.56661918A>G		Unknown		x	x	x	54016917	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Silent	SNP	ENST00000240361.8	37	CCDS56042.1	SNP	16	Broad																																																																																				0.438	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			Silent
HELZ	9931	broad.mit.edu	37	17	65199441	65199441	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:65199441C>A	ENST00000358691.5	-	6	532	c.366G>T	c.(364-366)gaG>gaT	p.E122D	HELZ_ENST00000580662.1_5'UTR|HELZ_ENST00000580168.1_Missense_Mutation_p.E122D	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	122						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E122D(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATACCAGGGACTCTCCTGTGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	17											104.0	103.0	103.0					17																	65199441		1912	4130	6042	62629903	SO:0001583	missense	9931			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.366G>T	17.37:g.65199441C>A	ENSP00000351524:p.Glu122Asp	Unknown		x	x	x	62629903	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184094	0.38609	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	D;T	0.86956	-2.19;0.96	6.06	4.1	0.47936	.	0.000000	0.85682	D	0.000000	D	0.87269	0.6135	L	0.29908	0.895	0.48395	D	0.999646	D;D;D	0.71674	0.984;0.998;0.983	D;D;P	0.77557	0.956;0.99;0.829	D	0.84630	0.0689	10	0.38643	T	0.18	-20.3853	7.7691	0.28997	0.0:0.7189:0.0:0.2811	.	122;122;122	B7ZLW2;F8WBX6;P42694	.;.;HELZ_HUMAN	D	122	ENSP00000351524:E122D;ENSP00000411144:E122D	ENSP00000351524:E122D	E	-	3	2	HELZ	62629903	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.506000	0.35747	0.901000	0.36495	0.650000	0.86243	GAG		0.413	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		Missense_Mutation
ABCA8	10351	broad.mit.edu	37	17	66902287	66902287	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr17:66902287C>A	ENST00000269080.2	-	17	2313	c.2176G>T	c.(2176-2178)Gat>Tat	p.D726Y	ABCA8_ENST00000586539.1_Missense_Mutation_p.D766Y|ABCA8_ENST00000430352.2_Missense_Mutation_p.D766Y	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	726					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.D726Y(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GGATAGCTATCAAGATCCTTG	0.313																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	99.0	99.0					17																	66902287		2203	4298	6501	64413882	SO:0001583	missense	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.2176G>T	17.37:g.66902287C>A	ENSP00000269080:p.Asp726Tyr	Unknown		x	x	x	64413882	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521375	0.64747	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	D;D	0.84223	-1.82;-1.82	5.38	5.38	0.77491	.	0.000000	0.56097	D	0.000029	D	0.94889	0.8348	H	0.95187	3.635	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.986;0.971;0.997;0.986	D	0.95906	0.8919	10	0.87932	D	0	.	17.8699	0.88808	0.0:1.0:0.0:0.0	.	705;766;766;766;726	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	Y	726;766;705	ENSP00000269080:D726Y;ENSP00000402814:D766Y	ENSP00000269080:D726Y	D	-	1	0	ABCA8	64413882	1.000000	0.71417	0.852000	0.33557	0.616000	0.37450	3.842000	0.55858	2.801000	0.96364	0.655000	0.94253	GAT		0.313	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168		Missense_Mutation
MYO5B	4645	broad.mit.edu	37	18	47463665	47463665	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr18:47463665G>T	ENST00000285039.7	-	15	2154	c.1855C>A	c.(1855-1857)Ccc>Acc	p.P619T		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	619	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.P619T(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TTCATGGGGGGTCTGGCAGAA	0.577																																																1	Substitution - Missense(1)	ovary(1)	18											109.0	107.0	108.0					18																	47463665		1971	4165	6136	45717663	SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1855C>A	18.37:g.47463665G>T	ENSP00000285039:p.Pro619Thr	Unknown		x	x	x	45717663	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	6.182	0.401683	0.11696	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.86694	-2.16	5.26	4.38	0.52667	Myosin head, motor domain (2);	0.135917	0.51477	D	0.000091	T	0.81659	0.4869	L	0.37507	1.11	0.80722	D	1	B;B	0.18013	0.018;0.025	B;B	0.22753	0.021;0.041	T	0.75453	-0.3312	10	0.25106	T	0.35	.	14.7746	0.69713	0.0:0.1456:0.8544:0.0	.	618;619	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	T	619;618	ENSP00000285039:P619T	ENSP00000285039:P619T	P	-	1	0	MYO5B	45717663	0.986000	0.35501	0.993000	0.49108	0.314000	0.28054	1.501000	0.35693	1.207000	0.43291	-0.315000	0.08773	CCC		0.577	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			Missense_Mutation
MAST3	23031	broad.mit.edu	37	19	18235582	18235582	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr19:18235582A>C	ENST00000262811.6	+	10	989	c.989A>C	c.(988-990)gAg>gCg	p.E330A	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	330							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.E352A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GACCCCCTGGAGGGTAAGCCG	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											29.0	32.0	31.0					19																	18235582		1924	4143	6067	18096582	SO:0001583	missense	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.989A>C	19.37:g.18235582A>C	ENSP00000262811:p.Glu330Ala	Unknown		x	x	x	18096582	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.20	2.167298	0.38315	.	.	ENSG00000099308	ENST00000262811	T	0.30448	1.53	4.42	4.42	0.53409	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.046737	0.85682	D	0.000000	T	0.29976	0.0750	L	0.54323	1.7	0.47698	D	0.999495	B	0.12630	0.006	B	0.19666	0.026	T	0.07177	-1.0786	10	0.30078	T	0.28	-18.8959	13.1412	0.59436	1.0:0.0:0.0:0.0	.	330	O60307	MAST3_HUMAN	A	330	ENSP00000262811:E330A	ENSP00000262811:E330A	E	+	2	0	MAST3	18096582	1.000000	0.71417	0.853000	0.33588	0.855000	0.48748	7.263000	0.78421	1.760000	0.52011	0.379000	0.24179	GAG		0.612	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150		Missense_Mutation
CAPN13	92291	broad.mit.edu	37	2	30993313	30993313	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr2:30993313G>C	ENST00000295055.8	-	5	566	c.390C>G	c.(388-390)ttC>ttG	p.F130L	CAPN13_ENST00000534090.2_Missense_Mutation_p.F130L|CAPN13_ENST00000465960.2_5'UTR	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	130	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.F130L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CACATTGCCAGAACTGGAAGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											128.0	130.0	130.0					2																	30993313		2024	4196	6220	30846817	SO:0001583	missense	92291				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.390C>G	2.37:g.30993313G>C	ENSP00000295055:p.Phe130Leu	Unknown		x	x	x	30846817	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	37	CCDS46252.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	6.803	0.517156	0.13005	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.12569	2.67;2.67	5.46	3.67	0.42095	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.28267	0.0698	L	0.47016	1.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00605	-1.1648	10	0.56958	D	0.05	.	11.2047	0.48762	0.1526:0.0:0.8474:0.0	.	130	Q6MZZ7	CAN13_HUMAN	L	130	ENSP00000295055:F130L;ENSP00000431298:F130L	ENSP00000295055:F130L	F	-	3	2	CAPN13	30846817	1.000000	0.71417	1.000000	0.80357	0.210000	0.24377	4.558000	0.60789	0.689000	0.31550	-0.258000	0.10820	TTC		0.522	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575		Missense_Mutation
PLA2R1	22925	broad.mit.edu	37	2	160833794	160833794	+	Splice_Site	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr2:160833794C>T	ENST00000283243.7	-	15	2608		c.e15+1		PLA2R1_ENST00000392771.1_Splice_Site	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa						cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.?(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ACTATTTTTACCTCTTGGGAT	0.353																																																1	Unknown(1)	ovary(1)	2											112.0	107.0	109.0					2																	160833794		2203	4300	6503	160542040	SO:0001630	splice_region_variant	22925			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2401+1G>A	2.37:g.160833794C>T		Unknown		x	x	x	160542040	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Splice_Site_SNP	SNP	ENST00000283243.7	37	CCDS33309.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240837	0.79912	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.261	0.87069	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLA2R1	160542040	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.393000	0.73217	2.364000	0.80123	0.561000	0.74099	.		0.353	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		Intron	Splice_Site_SNP
ZDBF2	57683	broad.mit.edu	37	2	207169948	207169948	+	Silent	SNP	T	T	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr2:207169948T>C	ENST00000374423.3	+	5	1082	c.696T>C	c.(694-696)gaT>gaC	p.D232D		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	232							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.D232D(1)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AACAGCCAGATGGGGCCTCTA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	2											38.0	38.0	38.0					2																	207169948		1859	4094	5953	206878193	SO:0001819	synonymous_variant	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.696T>C	2.37:g.207169948T>C		Unknown		x	x	x	206878193	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	CCDS46501.1	SNP	51	Broad																																																																																				0.378	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		Silent
FASTKD2	22868	broad.mit.edu	37	2	207636734	207636734	+	Silent	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr2:207636734G>C	ENST00000236980.6	+	5	1455	c.1107G>C	c.(1105-1107)gtG>gtC	p.V369V	FASTKD2_ENST00000402774.3_Silent_p.V369V|FASTKD2_ENST00000403094.3_Silent_p.V369V	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	369					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.V369V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		GCAGTAAGGTGGTCCTAGGTA	0.333																																																1	Substitution - coding silent(1)	ovary(1)	2											138.0	142.0	141.0					2																	207636734		2203	4300	6503	207344979	SO:0001819	synonymous_variant	22868			BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1107G>C	2.37:g.207636734G>C		Unknown		x	x	x	207344979	Q9NVX6|Q9Y2H7	Silent	SNP	ENST00000236980.6	37	CCDS2371.1	SNP	47	Broad																																																																																				0.333	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929		Silent
KIF3B	9371	broad.mit.edu	37	20	30914650	30914650	+	Nonsense_Mutation	SNP	G	G	T	rs200067481		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr20:30914650G>T	ENST00000375712.3	+	6	1992	c.1825G>T	c.(1825-1827)Gaa>Taa	p.E609*	KIF3B_ENST00000418717.2_Nonsense_Mutation_p.E235*	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	609	Globular.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)	p.E609*(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TGATGAAGAGGAAGATCATTG	0.338																																																1	Substitution - Nonsense(1)	ovary(1)	20											100.0	110.0	107.0					20																	30914650		2203	4300	6503	30378311	SO:0001587	stop_gained	9371			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1825G>T	20.37:g.30914650G>T	ENSP00000364864:p.Glu609*	Unknown		x	x	x	30378311	B2RMP4|B4DSR5|E1P5M5	Nonsense_Mutation	SNP	ENST00000375712.3	37	CCDS13200.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.842805	0.98519	.	.	ENSG00000101350	ENST00000375712;ENST00000418717	.	.	.	5.74	5.74	0.90152	.	0.145332	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	20.2825	0.98528	0.0:0.0:1.0:0.0	.	.	.	.	X	609;235	.	ENSP00000364864:E609X	E	+	1	0	KIF3B	30378311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.458000	0.80787	2.873000	0.98535	0.561000	0.74099	GAA		0.338	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1	NM_004798		Nonsense_Mutation
EPB41L1	2036	broad.mit.edu	37	20	34797484	34797484	+	Silent	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr20:34797484C>T	ENST00000338074.2	+	15	1904	c.1743C>T	c.(1741-1743)ggC>ggT	p.G581G	EPB41L1_ENST00000373950.2_Silent_p.G472G|EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000373941.1_Silent_p.G581G|EPB41L1_ENST00000441639.1_Silent_p.G507G|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000202028.5_Silent_p.G507G	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	581					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.G581G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GTGACACAGGCGATGAGGACC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	20											86.0	80.0	82.0					20																	34797484		2203	4300	6503	34260898	SO:0001819	synonymous_variant	2036			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1743C>T	20.37:g.34797484C>T		Unknown		x	x	x	34260898	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1	SNP	27	Broad																																																																																				0.572	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156		Silent
ZNF70	7621	broad.mit.edu	37	22	24086108	24086108	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr22:24086108A>G	ENST00000341976.3	-	2	1680	c.1220T>C	c.(1219-1221)aTt>aCt	p.I407T		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I407T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						ATAGTGCTCAATGAGGGCTGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	22											123.0	119.0	120.0					22																	24086108		2203	4300	6503	22416108	SO:0001583	missense	7621			X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.1220T>C	22.37:g.24086108A>G	ENSP00000339314:p.Ile407Thr	Unknown		x	x	x	22416108		Missense_Mutation	SNP	ENST00000341976.3	37	CCDS13812.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	4.449	0.083105	0.08533	.	.	ENSG00000187792	ENST00000341976	T	0.07114	3.22	3.27	3.27	0.37495	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04048	0.0113	N	0.13003	0.285	0.24495	N	0.994286	B	0.21905	0.062	B	0.21708	0.036	T	0.42224	-0.9464	9	0.02654	T	1	.	6.7521	0.23493	0.7583:0.2416:0.0:0.0	.	407	Q9UC06	ZNF70_HUMAN	T	407	ENSP00000339314:I407T	ENSP00000339314:I407T	I	-	2	0	ZNF70	22416108	0.000000	0.05858	0.470000	0.27216	0.592000	0.36648	0.445000	0.21677	1.756000	0.51951	0.454000	0.30748	ATT		0.577	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	NM_021916		Missense_Mutation
SEC13	6396	broad.mit.edu	37	3	10357041	10357041	+	Missense_Mutation	SNP	C	C	T	rs201150723		TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr3:10357041C>T	ENST00000350697.3	-	3	253	c.128G>A	c.(127-129)cGc>cAc	p.R43H	SEC13_ENST00000383801.2_Missense_Mutation_p.R89H|SEC13_ENST00000337354.4_Missense_Mutation_p.R46H|SEC13_ENST00000397117.1_Missense_Mutation_p.R29H|SEC13_ENST00000397109.3_Missense_Mutation_p.R29H	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	43					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.R43H(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						CCCTCCATTGCGCACATCAAA	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											79.0	70.0	73.0					3																	10357041		2203	4300	6503	10332041	SO:0001583	missense	6396				CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.128G>A	3.37:g.10357041C>T	ENSP00000312122:p.Arg43His	Unknown		x	x	x	10332041	A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Missense_Mutation	SNP	ENST00000350697.3	37	CCDS2599.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	17.97	3.517390	0.64634	.	.	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000397117;ENST00000383801;ENST00000397105;ENST00000431352;ENST00000397102;ENST00000397101;ENST00000397099	T;T;T;T;T;T	0.81415	-0.18;-0.18;-0.18;-1.49;-1.49;-1.49	5.56	5.56	0.83823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.155329	0.53938	D	0.000044	T	0.64316	0.2587	L	0.35341	1.055	0.58432	D	0.999999	D;P;P;D;P	0.56968	0.963;0.853;0.76;0.978;0.695	B;B;B;B;B	0.30316	0.114;0.111;0.111;0.08;0.045	T	0.70633	-0.4818	10	0.56958	D	0.05	.	10.4748	0.44659	0.0:0.9127:0.0:0.0873	.	43;43;29;89;43	A8MWR8;E9PHR5;A8MXL6;B4DXJ1;P55735	.;.;.;.;SEC13_HUMAN	H	29;46;43;29;89;43;46;43;43;89	ENSP00000380298:R29H;ENSP00000336566:R46H;ENSP00000312122:R43H;ENSP00000380306:R29H;ENSP00000373312:R89H;ENSP00000401368:R46H	ENSP00000336566:R46H	R	-	2	0	SEC13	10332041	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.572000	0.53849	2.617000	0.88574	0.655000	0.94253	CGC		0.592	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250563.3			Missense_Mutation
NUP210	23225	broad.mit.edu	37	3	13417904	13417904	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr3:13417904C>A	ENST00000254508.5	-	10	1262	c.1180G>T	c.(1180-1182)Gct>Tct	p.A394S		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	394					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.A394S(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					AAGAACTCAGCAGGAAGCACA	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											120.0	99.0	106.0					3																	13417904		2203	4300	6503	13392904	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1180G>T	3.37:g.13417904C>A	ENSP00000254508:p.Ala394Ser	Unknown		x	x	x	13392904	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	5.709	0.315261	0.10789	.	.	ENSG00000132182	ENST00000254508	T	0.05139	3.49	5.31	-3.23	0.05109	.	1.500550	0.03263	N	0.183579	T	0.02929	0.0087	N	0.04508	-0.205	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.43147	-0.9409	10	0.09084	T	0.74	0.2376	8.7022	0.34332	0.0635:0.5675:0.1586:0.2105	.	394;394	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	S	394	ENSP00000254508:A394S	ENSP00000254508:A394S	A	-	1	0	NUP210	13392904	0.000000	0.05858	0.024000	0.17045	0.686000	0.39977	-3.081000	0.00613	-0.644000	0.05465	-0.479000	0.04858	GCT		0.557	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923		Missense_Mutation
TGFBR2	7048	broad.mit.edu	37	3	30729915	30729915	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr3:30729915G>A	ENST00000295754.5	+	6	1818	c.1436G>A	c.(1435-1437)cGg>cAg	p.R479Q	TGFBR2_ENST00000359013.4_Missense_Mutation_p.R504Q	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	479	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.R479Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						TCCAAGGTGCGGGAGCACCCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											123.0	116.0	119.0					3																	30729915		2203	4300	6503	30704919	SO:0001583	missense	7048				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1436G>A	3.37:g.30729915G>A	ENSP00000295754:p.Arg479Gln	Unknown		x	x	x	30704919	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605972	0.87157	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.93307	-3.2;-3.2	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.061520	0.64402	D	0.000002	D	0.89918	0.6854	N	0.13327	0.33	0.52501	D	0.999958	D;D	0.53312	0.959;0.959	P;P	0.48552	0.581;0.581	D	0.88700	0.3215	10	0.25751	T	0.34	.	19.4941	0.95064	0.0:0.0:1.0:0.0	.	479;504	P37173;D2JYI1	TGFR2_HUMAN;.	Q	479;504;309	ENSP00000295754:R479Q;ENSP00000351905:R504Q	ENSP00000295754:R479Q	R	+	2	0	TGFBR2	30704919	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.728000	0.74769	2.682000	0.91365	0.591000	0.81541	CGG		0.507	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2			Missense_Mutation
C3orf30	152405	broad.mit.edu	37	3	118865298	118865298	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr3:118865298G>T	ENST00000295622.1	+	1	302	c.262G>T	c.(262-264)Ggc>Tgc	p.G88C	IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000425327.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	88								p.G88C(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TGGTCAGGCTGGCCGCAGAGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											54.0	47.0	50.0					3																	118865298		2203	4300	6503	120347988	SO:0001583	missense	152405			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.262G>T	3.37:g.118865298G>T	ENSP00000295622:p.Gly88Cys	Unknown		x	x	x	120347988	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	CCDS2984.1	SNP	47	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.35|12.35	1.910266|1.910266	0.33721|0.33721	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150	T|.	0.26518|.	1.73|.	2.91|2.91	0.93|0.93	0.19454|0.19454	.|.	.|.	.|.	.|.	.|.	T|T	0.22003|0.22003	0.0530|0.0530	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	D;D|.	0.76494|.	0.992;0.999|.	P;D|.	0.71870|.	0.555;0.975|.	T|T	0.26430|0.26430	-1.0103|-1.0103	9|5	0.56958|.	D|.	0.05|.	.|.	6.5632|6.5632	0.22497|0.22497	0.0:0.2082:0.5956:0.1962|0.0:0.2082:0.5956:0.1962	.|.	88;88|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	C|L	88|51	ENSP00000295622:G88C|.	ENSP00000295622:G88C|.	G|W	+|+	1|2	0|0	C3orf30|C3orf30	120347988|120347988	0.008000|0.008000	0.16893|0.16893	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	1.700000|1.700000	0.37815|0.37815	0.237000|0.237000	0.21200|0.21200	-0.311000|-0.311000	0.09066|0.09066	GGC|TGG		0.502	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		Missense_Mutation
COL6A5	256076	broad.mit.edu	37	3	130159295	130159295	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr3:130159295A>G	ENST00000432398.2	+	35	6607	c.6113A>G	c.(6112-6114)cAa>cGa	p.Q2038R	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q2038R	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2038	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.Q77R(1)		endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TATGACAACCAACTCCTAATG	0.413																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	90.0	92.0					3																	130159295		1890	4116	6006	131641985	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6113A>G	3.37:g.130159295A>G	ENSP00000390895:p.Gln2038Arg	Unknown		x	x	x	131641985	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	0.220	-1.029200	0.02045	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.83075	-1.68;-1.68	5.76	-1.0	0.10196	von Willebrand factor, type A (3);	0.688385	0.12694	N	0.446991	T	0.61825	0.2378	N	0.13098	0.295	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.09377	0.004;0.004	T	0.44221	-0.9342	10	0.30854	T	0.27	.	1.7022	0.02875	0.3923:0.2138:0.2809:0.1129	.	2038;2038	A8TX70;A8TX70-2	CO6A5_HUMAN;.	R	2038	ENSP00000390895:Q2038R;ENSP00000265379:Q2038R	ENSP00000265379:Q2038R	Q	+	2	0	COL6A5	131641985	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.366000	0.20365	-0.397000	0.07691	-0.912000	0.02778	CAA		0.413	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264		Missense_Mutation
COL6A6	131873	broad.mit.edu	37	3	130290055	130290055	+	Missense_Mutation	SNP	C	C	T	rs377667400	byFrequency	TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr3:130290055C>T	ENST00000358511.6	+	6	2826	c.2795C>T	c.(2794-2796)aCg>aTg	p.T932M	COL6A6_ENST00000453409.2_Missense_Mutation_p.T932M	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	932	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.T932M(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTCAATGCCACGGCAAAGGCC	0.567													C|||	3	0.000599042	0.0008	0.0	5008	,	,		18998	0.001		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3						C	MET/THR	0,3938		0,0,1969	64.0	64.0	64.0		2795	4.8	0.7	3		64	1,8305		0,1,4152	no	missense	COL6A6	NM_001102608.1	81	0,1,6121	TT,TC,CC		0.012,0.0,0.0082	probably-damaging	932/2264	130290055	1,12243	1969	4153	6122	131772745	SO:0001583	missense	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2795C>T	3.37:g.130290055C>T	ENSP00000351310:p.Thr932Met	Unknown		x	x	x	131772745	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790138	0.50102	0.0	1.2E-4	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.77877	-1.13;-1.13	4.82	4.82	0.62117	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000016	D	0.82788	0.5113	L	0.50333	1.59	0.09310	N	1	D	0.89917	1.0	D	0.71414	0.973	T	0.73675	-0.3908	10	0.35671	T	0.21	.	12.3866	0.55335	0.0:0.9166:0.0:0.0834	.	932	A6NMZ7	CO6A6_HUMAN	M	932	ENSP00000351310:T932M;ENSP00000399236:T932M	ENSP00000351310:T932M	T	+	2	0	COL6A6	131772745	0.069000	0.21087	0.698000	0.30274	0.972000	0.66771	1.814000	0.38972	2.403000	0.81681	0.561000	0.74099	ACG		0.567	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		Missense_Mutation
UGT2B7	7364	broad.mit.edu	37	4	69974041	69974041	+	Splice_Site	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr4:69974041G>C	ENST00000305231.7	+	5	1356		c.e5+1		UGT2B7_ENST00000508661.1_Intron|UGT2B7_ENST00000509763.1_Intron	NM_001074.2	NP_001065.2	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7						androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)	p.?(1)		autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ATGATCCTTCGTGAGTAGAAC	0.383																																																1	Unknown(1)	ovary(1)	4											143.0	140.0	141.0					4																	69974041		2203	4300	6503	70008630	SO:0001630	splice_region_variant	7364			BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000305231.7:c.1310+1G>C	4.37:g.69974041G>C		Unknown		x	x	x	70008630	B2R810|Q6GTW0	Splice_Site_SNP	SNP	ENST00000305231.7	37	CCDS3526.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	9.022	0.985144	0.18889	.	.	ENSG00000171234	ENST00000305231	.	.	.	2.49	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7717	0.34735	0.0:0.2361:0.7638:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UGT2B7	70008630	1.000000	0.71417	0.058000	0.19502	0.010000	0.07245	5.863000	0.69568	0.342000	0.23796	0.491000	0.48974	.		0.383	UGT2B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251560.1	NM_001074	Intron	Splice_Site_SNP
WDFY3	23001	broad.mit.edu	37	4	85742596	85742596	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr4:85742596T>G	ENST00000295888.4	-	11	1639	c.1232A>C	c.(1231-1233)tAc>tCc	p.Y411S	WDFY3_ENST00000322366.6_Missense_Mutation_p.Y411S	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	411					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.Y411S(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GTCAGCCATGTAAATATTTGT	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											114.0	115.0	114.0					4																	85742596		2203	4300	6503	85961620	SO:0001583	missense	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.1232A>C	4.37:g.85742596T>G	ENSP00000295888:p.Tyr411Ser	Unknown		x	x	x	85961620	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	22.0	4.231528	0.79688	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.17528	2.27;2.27	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.44008	0.1273	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.41770	-0.9490	10	0.87932	D	0	.	16.0204	0.80478	0.0:0.0:0.0:1.0	.	411;411	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	S	411	ENSP00000318466:Y411S;ENSP00000295888:Y411S	ENSP00000295888:Y411S	Y	-	2	0	WDFY3	85961620	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	7.642000	0.83385	2.174000	0.68829	0.533000	0.62120	TAC		0.393	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		Missense_Mutation
CARTPT	9607	broad.mit.edu	37	5	71015245	71015245	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr5:71015245C>T	ENST00000296777.4	+	1	256	c.125C>T	c.(124-126)tCt>tTt	p.S42F		NM_004291.3	NP_004282.1	Q16568	CART_HUMAN	CART prepropeptide	42					activation of MAPKK activity (GO:0000186)|adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|circadian regulation of gene expression (GO:0032922)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of appetite (GO:0032099)|negative regulation of bone resorption (GO:0045779)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of osteoclast differentiation (GO:0045671)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of epinephrine secretion (GO:0032812)|positive regulation of transmission of nerve impulse (GO:0051971)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|somatostatin secretion (GO:0070253)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|secretory granule (GO:0030141)		p.S42F(1)		large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	GACATCTACTCTGCCGTGGAT	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											74.0	71.0	72.0					5																	71015245		2203	4300	6503	71051001	SO:0001583	missense	9607			U16826	CCDS4011.1	5q13.2	2008-02-05			ENSG00000164326	ENSG00000164326			24323	protein-coding gene	gene with protein product	"""cocaine and amphetamine regulated transcript"""	602606				9590691, 8647455	Standard	NM_004291		Approved	CART	uc003kbv.2	Q16568	OTTHUMG00000131261	ENST00000296777.4:c.125C>T	5.37:g.71015245C>T	ENSP00000296777:p.Ser42Phe	Unknown		x	x	x	71051001	Q6FG92	Missense_Mutation	SNP	ENST00000296777.4	37	CCDS4011.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919247	0.52546	.	.	ENSG00000164326	ENST00000296777	T	0.57907	0.37	4.24	3.38	0.38709	.	0.327462	0.28161	N	0.016365	T	0.46889	0.1416	L	0.54323	1.7	0.45747	D	0.998642	B	0.15719	0.014	B	0.12156	0.007	T	0.47209	-0.9135	10	0.59425	D	0.04	.	10.8856	0.46965	0.0:0.9055:0.0:0.0945	.	42	Q16568	CART_HUMAN	F	42	ENSP00000296777:S42F	ENSP00000296777:S42F	S	+	2	0	CARTPT	71051001	0.996000	0.38824	0.998000	0.56505	0.990000	0.78478	4.557000	0.60782	1.006000	0.39211	0.561000	0.74099	TCT		0.657	CARTPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254029.2	NM_004291		Missense_Mutation
FBN2	2201	broad.mit.edu	37	5	127712497	127712497	+	Silent	SNP	G	G	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr5:127712497G>A	ENST00000508053.1	-	20	2873	c.1899C>T	c.(1897-1899)atC>atT	p.I633I	FBN2_ENST00000508989.1_Silent_p.I600I|FBN2_ENST00000511489.1_5'UTR|FBN2_ENST00000262464.4_Silent_p.I633I			P35556	FBN2_HUMAN	fibrillin 2	633	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.I633I(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CATCTTCATTGATGCACATTC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	5											260.0	214.0	230.0					5																	127712497		2203	4300	6503	127740396	SO:0001819	synonymous_variant	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1899C>T	5.37:g.127712497G>A		Unknown		x	x	x	127740396	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1	SNP	45	Broad																																																																																				0.433	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		Silent
PCDHGC5	56097	broad.mit.edu	37	5	140870891	140870891	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr5:140870891T>A	ENST00000252087.1	+	1	2084	c.2084T>A	c.(2083-2085)aTt>aAt	p.I695N	PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	695					homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I695N(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTACCTCATTGTGGCTCTA	0.557																																																2	Substitution - Missense(2)	ovary(2)	5											195.0	185.0	188.0					5																	140870891		2203	4300	6503	140851075	SO:0001583	missense	56097			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.2084T>A	5.37:g.140870891T>A	ENSP00000252087:p.Ile695Asn	Unknown		x	x	x	140851075	Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	21.5	4.151736	0.78001	.	.	ENSG00000240764	ENST00000252087	T	0.63255	-0.03	4.7	4.7	0.59300	.	0.000000	0.47852	D	0.000209	T	0.77974	0.4211	M	0.75615	2.305	0.50313	D	0.999864	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.972	T	0.81351	-0.0972	10	0.87932	D	0	.	14.3219	0.66491	0.0:0.0:0.0:1.0	.	695;695	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	N	695	ENSP00000252087:I695N	ENSP00000252087:I695N	I	+	2	0	PCDHGC5	140851075	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.290000	0.78711	1.965000	0.57142	0.459000	0.35465	ATT		0.557	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		Missense_Mutation
CDK19	23097	broad.mit.edu	37	6	110991680	110991680	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr6:110991680T>C	ENST00000368911.3	-	3	448	c.269A>G	c.(268-270)gAc>gGc	p.D90G	CDK19_ENST00000323817.3_Missense_Mutation_p.D30G	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.D90G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						TACCTTCCTGTCACTGTGAGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											92.0	78.0	83.0					6																	110991680		2203	4300	6503	111098373	SO:0001583	missense	23097			AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.269A>G	6.37:g.110991680T>C	ENSP00000357907:p.Asp90Gly	Unknown		x	x	x	111098373	Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Missense_Mutation	SNP	ENST00000368911.3	37	CCDS5085.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	23.0	4.361461	0.82353	.	.	ENSG00000155111	ENST00000368911;ENST00000323817;ENST00000392576;ENST00000457688	T;T;T	0.65732	-0.17;-0.17;-0.17	4.84	4.84	0.62591	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.048184	0.85682	D	0.000000	T	0.45796	0.1360	L	0.28115	0.83	0.80722	D	1	P	0.42337	0.776	P	0.45913	0.497	T	0.56607	-0.7951	10	0.72032	D	0.01	-34.2092	14.6245	0.68611	0.0:0.0:0.0:1.0	.	90	Q9BWU1	CDK19_HUMAN	G	90;30;29;30	ENSP00000357907:D90G;ENSP00000317665:D30G;ENSP00000415621:D30G	ENSP00000317665:D30G	D	-	2	0	CDK19	111098373	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.493000	0.81493	2.036000	0.60181	0.524000	0.50904	GAC		0.408	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041804.1	NM_015076		Missense_Mutation
RAPGEF5	9771	broad.mit.edu	37	7	22184701	22184701	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr7:22184701C>T	ENST00000401957.2	-	10	1485	c.1238G>A	c.(1237-1239)cGa>cAa	p.R413Q	RAPGEF5_ENST00000344041.6_Missense_Mutation_p.R563Q			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	413	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.R277Q(1)|p.R565Q(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						CAGCTGCACTCGCTTGCCCAG	0.493																																																2	Substitution - Missense(2)	ovary(2)	7											71.0	69.0	69.0					7																	22184701		1943	4148	6091	22151226	SO:0001583	missense	9771			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.1238G>A	7.37:g.22184701C>T	ENSP00000384044:p.Arg413Gln	Unknown		x	x	x	22151226	A4D140|Q8IXU5	Missense_Mutation	SNP	ENST00000401957.2	37		SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.921712	0.97105	.	.	ENSG00000136237	ENST00000344041;ENST00000425852;ENST00000258735;ENST00000401957	T;T	0.70631	-0.5;-0.5	6.17	6.17	0.99709	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	D	0.89622	0.6768	H	0.94698	3.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91005	0.4845	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	413;563	Q92565;A8MQ07	RPGF5_HUMAN;.	Q	563;415;277;413	ENSP00000343656:R563Q;ENSP00000384044:R413Q	ENSP00000258735:R277Q	R	-	2	0	RAPGEF5	22151226	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.437000	0.80417	2.941000	0.99782	0.655000	0.94253	CGA		0.493	RAPGEF5-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000326590.2	NM_012294		Missense_Mutation
EPDR1	54749	broad.mit.edu	37	7	37960503	37960503	+	5'UTR	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr7:37960503G>C	ENST00000199448.4	+	0	341				EPDR1_ENST00000423717.1_5'UTR|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000559325.1_Missense_Mutation_p.G108R|EPDR1_ENST00000476620.1_Intron	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.G108R(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						CGCCCCCTTGGGCTTGGGCTT	0.721																																																1	Substitution - Missense(1)	ovary(1)	7											14.0	20.0	18.0					7																	37960503		2188	4284	6472	37927028	SO:0001623	5_prime_UTR_variant	54749			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-39G>C	7.37:g.37960503G>C		Unknown		x	x	x	37927028	A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	ENST00000199448.4	37	CCDS5454.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738023	0.49045	.	.	ENSG00000086289	ENST00000199448;ENST00000423717	.	.	.	3.59	0.367	0.16140	.	0.870115	0.09559	N	0.785766	T	0.13586	0.0329	N	0.08118	0	0.09310	N	0.999994	P	0.44578	0.838	B	0.39258	0.295	T	0.13072	-1.0523	9	0.87932	D	0	-1.2373	3.5316	0.07778	0.2525:0.2131:0.5344:0.0	.	108	A4D1W8	.	R	108;82	.	ENSP00000199448:G108R	G	+	1	0	EPDR1	37927028	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.004000	0.13106	0.298000	0.22638	0.467000	0.42956	GGC		0.721	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549		Missense_Mutation
FIGNL1	63979	broad.mit.edu	37	7	50513667	50513667	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr7:50513667A>C	ENST00000419119.1	-	2	2872	c.1319T>G	c.(1318-1320)tTt>tGt	p.F440C	FIGNL1_ENST00000395556.2_Missense_Mutation_p.F440C|FIGNL1_ENST00000356889.4_Missense_Mutation_p.F440C|FIGNL1_ENST00000433017.1_Missense_Mutation_p.F440C			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	440					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)	p.F440C(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				AGGAGGACCAAAGAGCAAAAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	7											50.0	54.0	53.0					7																	50513667		2203	4300	6503	50481161	SO:0001583	missense	63979			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.1319T>G	7.37:g.50513667A>C	ENSP00000410811:p.Phe440Cys	Unknown		x	x	x	50481161	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	37	CCDS5510.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091291	0.76756	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119	D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17	5.99	5.99	0.97316	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96002	0.8698	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96374	0.9276	10	0.87932	D	0	-19.5814	15.6754	0.77316	1.0:0.0:0.0:0.0	.	440	Q6PIW4	FIGL1_HUMAN	C	440	ENSP00000349356:F440C;ENSP00000378924:F440C;ENSP00000399997:F440C;ENSP00000410811:F440C	ENSP00000349356:F440C	F	-	2	0	FIGNL1	50481161	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	TTT		0.438	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762		Missense_Mutation
KIAA1324L	222223	broad.mit.edu	37	7	86556230	86556230	+	Silent	SNP	T	T	G			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr7:86556230T>G	ENST00000450689.2	-	9	1277	c.1092A>C	c.(1090-1092)acA>acC	p.T364T	KIAA1324L_ENST00000416314.1_Silent_p.T197T|KIAA1324L_ENST00000444627.1_Silent_p.T364T|KIAA1324L_ENST00000297222.6_Silent_p.T124T	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	364						integral component of membrane (GO:0016021)		p.T124T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ACATTATCTGTGTCTACaaaa	0.373																																																1	Substitution - coding silent(1)	ovary(1)	7											51.0	51.0	51.0					7																	86556230		2203	4300	6503	86394166	SO:0001819	synonymous_variant	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1092A>C	7.37:g.86556230T>G		Unknown		x	x	x	86394166	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Silent	SNP	ENST00000450689.2	37	CCDS47632.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	3.926	-0.017057	0.07681	.	.	ENSG00000164659	ENST00000423294	T	0.31510	1.49	5.23	-2.11	0.07187	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.09509	-1.0671	7	0.40728	T	0.16	.	0.8648	0.01201	0.4106:0.1587:0.1132:0.3174	.	.	.	.	P	325	ENSP00000406961:T325P	ENSP00000406961:T325P	T	-	1	0	KIAA1324L	86394166	0.272000	0.24172	0.997000	0.53966	0.414000	0.31173	-0.390000	0.07332	-0.165000	0.10908	-0.490000	0.04691	ACA		0.373	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748		Silent
TNC	3371	broad.mit.edu	37	9	117844119	117844119	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr9:117844119T>A	ENST00000350763.4	-	6	2747	c.2336A>T	c.(2335-2337)tAt>tTt	p.Y779F	TNC_ENST00000423613.2_Missense_Mutation_p.Y779F|TNC_ENST00000542877.1_Missense_Mutation_p.Y779F|TNC_ENST00000535648.1_Missense_Mutation_p.Y779F|TNC_ENST00000537320.1_Missense_Mutation_p.Y779F|TNC_ENST00000341037.4_Missense_Mutation_p.Y779F|TNC_ENST00000346706.3_Missense_Mutation_p.Y779F|TNC_ENST00000345230.3_Missense_Mutation_p.Y779F|TNC_ENST00000340094.3_Missense_Mutation_p.Y779F	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	779	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.Y779F(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AGATATCTCATACTCTTGCCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	9											112.0	110.0	111.0					9																	117844119		2203	4300	6503	116883940	SO:0001583	missense	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.2336A>T	9.37:g.117844119T>A	ENSP00000265131:p.Tyr779Phe	Unknown		x	x	x	116883940	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	33	5.258876	0.95368	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	D;D;D;D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	6.08	6.08	0.98989	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94866	0.8341	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95337	0.8435	10	0.87932	D	0	.	16.643	0.85134	0.0:0.0:0.0:1.0	.	779;779	E9PC84;P24821	.;TENA_HUMAN	F	779	ENSP00000344400:Y779F;ENSP00000438152:Y779F;ENSP00000344555:Y779F;ENSP00000345861:Y779F;ENSP00000265131:Y779F;ENSP00000339553:Y779F;ENSP00000411406:Y779F;ENSP00000443478:Y779F;ENSP00000442242:Y779F	ENSP00000344400:Y779F	Y	-	2	0	TNC	116883940	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.677000	0.84024	2.330000	0.79161	0.533000	0.62120	TAT		0.473	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160		Missense_Mutation
OR1L8	138881	broad.mit.edu	37	9	125330591	125330591	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2009-01	TCGA-61-2009-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2009-01	TCGA-61-2009-10	g.chr9:125330591G>C	ENST00000304865.2	-	1	247	c.166C>G	c.(166-168)Ctt>Gtt	p.L56V		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L56V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GGGGTCTGAAGATGGGGGTTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	9											101.0	107.0	105.0					9																	125330591		2203	4300	6503	124370412	SO:0001583	missense	138881				CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.166C>G	9.37:g.125330591G>C	ENSP00000306607:p.Leu56Val	Unknown		x	x	x	124370412	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	CCDS35124.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579845	0.46006	.	.	ENSG00000171496	ENST00000304865	T	0.14022	2.54	4.39	4.39	0.52855	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37393	N	0.002112	T	0.48223	0.1488	H	0.98027	4.13	0.33515	D	0.591627	D	0.67145	0.996	P	0.62649	0.905	T	0.72609	-0.4241	10	0.87932	D	0	-27.6523	10.6842	0.45833	0.0945:0.0:0.9055:0.0	.	56	Q8NGR8	OR1L8_HUMAN	V	56	ENSP00000306607:L56V	ENSP00000306607:L56V	L	-	1	0	OR1L8	124370412	1.000000	0.71417	0.793000	0.32043	0.358000	0.29455	3.336000	0.52113	2.485000	0.83878	0.449000	0.29647	CTT		0.458	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1			Missense_Mutation
