#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MACF1	23499	broad.mit.edu	37	1	39900293	39900293	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr1:39900293G>C	ENST00000372915.3	+	67	17548	c.17461G>C	c.(17461-17463)Gag>Cag	p.E5821Q	MACF1_ENST00000539005.1_Missense_Mutation_p.E3733Q|MACF1_ENST00000289893.4_Missense_Mutation_p.E4365Q|MACF1_ENST00000361689.2_Missense_Mutation_p.E3863Q|MACF1_ENST00000545844.1_Missense_Mutation_p.E3863Q|MACF1_ENST00000567887.1_Missense_Mutation_p.E5962Q|MACF1_ENST00000564288.1_Missense_Mutation_p.E5925Q|MACF1_ENST00000317713.7_Missense_Mutation_p.E3863Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5821					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.E3863Q(1)|p.E4365Q(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCAGCAACAAGAGGAAATGAG	0.408																																																2	Substitution - Missense(2)	ovary(2)	1											61.0	61.0	61.0					1																	39900293		2203	4300	6503	39672880	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17461G>C	1.37:g.39900293G>C	ENSP00000362006:p.Glu5821Gln	Unknown		x	x	x	39672880	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.1|23.1	4.369627|4.369627	0.82573|0.82573	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.49720|.	0.77;0.77;0.77;0.77;0.77;0.77|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.000000|.	0.64402|.	D|.	0.000011|.	T|T	0.77054|0.77054	0.4074|0.4074	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.998;1.0;0.998|.	D;D;D|.	0.78314|.	0.965;0.991;0.962|.	T|T	0.74813|0.74813	-0.3537|-0.3537	10|5	0.72032|.	D|.	0.01|.	.|.	20.0706|20.0706	0.97721|0.97721	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5821;3863;3807|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	Q|T	3863;5821;3863;3863;3733;4365|2866	ENSP00000439537:E3863Q;ENSP00000362006:E5821Q;ENSP00000354573:E3863Q;ENSP00000313438:E3863Q;ENSP00000444364:E3733Q;ENSP00000289893:E4365Q|.	ENSP00000289893:E4365Q|.	E|R	+|+	1|2	0|0	MACF1|MACF1	39672880|39672880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.813000|9.813000	0.99286|0.99286	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	GAG|AGA		0.408	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		Missense_Mutation
ADAR	103	broad.mit.edu	37	1	154562394	154562394	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr1:154562394G>A	ENST00000368474.4	-	8	2706	c.2507C>T	c.(2506-2508)aCt>aTt	p.T836I	ADAR_ENST00000368471.3_Missense_Mutation_p.T541I|ADAR_ENST00000292205.5_Missense_Mutation_p.T879I	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	836					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.T836I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GGTGCTGCCAGTGAGAGGGAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	41.0	44.0					1																	154562394		2203	4300	6503	152829018	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2507C>T	1.37:g.154562394G>A	ENSP00000357459:p.Thr836Ile	Unknown		x	x	x	152829018	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	17.79	3.474978	0.63737	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.14516	2.68;2.69;2.5;2.67	5.18	4.25	0.50352	.	0.402431	0.27064	N	0.021105	T	0.06280	0.0162	N	0.14661	0.345	0.29861	N	0.82767	P;D;D	0.55800	0.941;0.973;0.966	P;P;P	0.51385	0.668;0.668;0.518	T	0.16276	-1.0408	10	0.38643	T	0.18	-11.6321	14.007	0.64470	0.0:0.473:0.527:0.0	.	791;810;836	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	I	879;836;541;805	ENSP00000292205:T879I;ENSP00000357459:T836I;ENSP00000357456:T541I;ENSP00000431794:T805I	ENSP00000292205:T879I	T	-	2	0	ADAR	152829018	0.831000	0.29352	0.871000	0.34182	0.978000	0.69477	1.331000	0.33793	1.390000	0.46547	0.563000	0.77884	ACT		0.562	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111		Missense_Mutation
OR5P2	120065	broad.mit.edu	37	11	7818171	7818171	+	Missense_Mutation	SNP	C	C	T	rs569926953|rs147652902	byFrequency	TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr11:7818171C>T	ENST00000329434.2	-	1	349	c.319G>A	c.(319-321)Gaa>Aaa	p.E107K	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E107K(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGGACGCATTCGACTGTTGCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	11						C	LYS/GLU	2,4206		0,2,2102	97.0	113.0	108.0		319	5.5	0.8	11	dbSNP_134	108	0,8584		0,0,4292	no	missense	OR5P2	NM_153444.1	56	0,2,6394	TT,TC,CC		0.0,0.0475,0.0156	probably-damaging	107/323	7818171	2,12790	2104	4292	6396	7774747	SO:0001583	missense	120065			AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.319G>A	11.37:g.7818171C>T	ENSP00000331823:p.Glu107Lys	Unknown		x	x	x	7774747	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724582	0.48833	4.75E-4	0.0	ENSG00000183303	ENST00000329434	T	0.00414	7.52	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.087192	0.49916	D	0.000131	T	0.01835	0.0058	M	0.92219	3.285	0.36026	D	0.8391	D	0.76494	0.999	D	0.73380	0.98	T	0.33085	-0.9882	10	0.87932	D	0	-34.5014	16.9428	0.86222	0.0:1.0:0.0:0.0	.	107	Q8WZ92	OR5P2_HUMAN	K	107	ENSP00000331823:E107K	ENSP00000331823:E107K	E	-	1	0	OR5P2	7774747	0.025000	0.19082	0.822000	0.32727	0.009000	0.06853	1.607000	0.36836	2.868000	0.98415	0.555000	0.69702	GAA		0.493	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444		Missense_Mutation
DYRK2	8445	broad.mit.edu	37	12	68051680	68051680	+	Silent	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr12:68051680G>A	ENST00000344096.3	+	3	1406	c.993G>A	c.(991-993)tcG>tcA	p.S331S	DYRK2_ENST00000393555.3_Silent_p.S258S|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	331	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)	p.S331S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		TTGCCCACTCGATTCTGCAGT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	12											112.0	107.0	109.0					12																	68051680		2203	4300	6503	66337947	SO:0001819	synonymous_variant	8445			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.993G>A	12.37:g.68051680G>A		Unknown		x	x	x	66337947	B2R9V9|Q9BRB5	Silent	SNP	ENST00000344096.3	37	CCDS8978.1	SNP	37	Broad																																																																																				0.448	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402218.1			Silent
RASAL1	8437	broad.mit.edu	37	12	113568721	113568721	+	Silent	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr12:113568721G>A	ENST00000261729.5	-	3	406	c.91C>T	c.(91-93)Cta>Tta	p.L31L	RASAL1_ENST00000446861.3_Silent_p.L31L|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000546530.1_Silent_p.L31L|RASAL1_ENST00000548055.1_Silent_p.L31L			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	31	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.L31L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						ACTTTCACTAGGCAGTAGGGG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	12											62.0	52.0	55.0					12																	113568721		2203	4300	6503	112053104	SO:0001819	synonymous_variant	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.91C>T	12.37:g.113568721G>A		Unknown		x	x	x	112053104	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Silent	SNP	ENST00000261729.5	37	CCDS9165.1	SNP	35	Broad																																																																																				0.617	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		Silent
PXN	5829	broad.mit.edu	37	12	120653416	120653416	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr12:120653416C>T	ENST00000228307.7	-	7	1021	c.880G>A	c.(880-882)Ggc>Agc	p.G294S	PXN_ENST00000538144.1_Intron|PXN-AS1_ENST00000535200.1_RNA|PXN_ENST00000458477.2_Intron|PXN-AS1_ENST00000542265.1_RNA|PXN_ENST00000397506.3_Missense_Mutation_p.G58S|PXN_ENST00000536957.1_Missense_Mutation_p.G292S|PXN_ENST00000267257.7_Intron|PXN_ENST00000424649.2_Intron	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	294					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGAGGCCAGCCGGCCGCCCAG	0.617																																																0			12											32.0	40.0	37.0					12																	120653416		1566	3578	5144	119137799	SO:0001583	missense	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.880G>A	12.37:g.120653416C>T	ENSP00000228307:p.Gly294Ser	Unknown		x	x	x	119137799	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	0.987	-0.695237	0.03303	.	.	ENSG00000089159	ENST00000228307;ENST00000536957;ENST00000397506	T;T;T	0.58060	0.88;0.89;0.36	4.24	0.156	0.14910	.	.	.	.	.	T	0.29061	0.0722	N	0.22421	0.69	0.09310	N	1	B;B	0.17667	0.023;0.001	B;B	0.10450	0.005;0.0	T	0.27706	-1.0066	9	0.02654	T	1	.	6.4322	0.21803	0.0:0.5578:0.0:0.4422	.	58;294	E7EMK8;P49023	.;PAXI_HUMAN	S	294;292;58	ENSP00000228307:G294S;ENSP00000443887:G292S;ENSP00000380643:G58S	ENSP00000228307:G294S	G	-	1	0	PXN	119137799	0.000000	0.05858	0.211000	0.23655	0.046000	0.14306	-1.295000	0.02764	0.125000	0.18397	0.453000	0.30009	GGC		0.617	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859		Missense_Mutation
DYNC1H1	1778	broad.mit.edu	37	14	102446171	102446171	+	Missense_Mutation	SNP	A	A	G	rs138182529		TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr14:102446171A>G	ENST00000360184.4	+	4	798	c.634A>G	c.(634-636)Atg>Gtg	p.M212V		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	212	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.M212V(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GATTCATCCAATGATCACAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	14						A	VAL/MET	1,4405	2.1+/-5.4	0,1,2202	134.0	141.0	138.0		634	2.2	0.0	14	dbSNP_134	138	0,8600		0,0,4300	no	missense	DYNC1H1	NM_001376.4	21	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	212/4647	102446171	1,13005	2203	4300	6503	101515924	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.634A>G	14.37:g.102446171A>G	ENSP00000348965:p.Met212Val	Unknown		x	x	x	101515924	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.089363	0.00367	2.27E-4	0.0	ENSG00000197102	ENST00000360184	T	0.24350	1.86	4.68	2.21	0.28008	.	0.411167	0.28241	N	0.016079	T	0.06600	0.0169	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39643	-0.9604	10	0.07990	T	0.79	.	7.8062	0.29204	0.7862:0.1391:0.0747:0.0	.	212	Q14204	DYHC1_HUMAN	V	212	ENSP00000348965:M212V	ENSP00000348965:M212V	M	+	1	0	DYNC1H1	101515924	0.991000	0.36638	0.003000	0.11579	0.190000	0.23558	5.872000	0.69636	0.329000	0.23460	0.402000	0.26972	ATG		0.408	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		Missense_Mutation
TRPM1	4308	broad.mit.edu	37	15	31318395	31318395	+	Silent	SNP	C	C	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr15:31318395C>T	ENST00000256552.6	-	27	3723	c.3576G>A	c.(3574-3576)aaG>aaA	p.K1192K	RP11-348B17.1_ENST00000558755.1_RNA|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Silent_p.K1170K|TRPM1_ENST00000542188.1_Silent_p.K1209K	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1									p.K1170K(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GCTCATCCTCCTTCTCCCGGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	15											58.0	61.0	60.0					15																	31318395		2127	4242	6369	29105687	SO:0001819	synonymous_variant	4308			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3576G>A	15.37:g.31318395C>T		Unknown		x	x	x	29105687		Silent	SNP	ENST00000256552.6	37	CCDS58346.1	SNP	24	Broad																																																																																				0.602	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		Silent
GDE1	51573	broad.mit.edu	37	16	19533043	19533043	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr16:19533043G>C	ENST00000353258.3	-	1	424	c.244C>G	c.(244-246)Ctg>Gtg	p.L82V	CCP110_ENST00000381396.5_5'Flank|CCP110_ENST00000396212.2_5'Flank|CCP110_ENST00000396208.2_5'Flank	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	82	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)	p.L82V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						ATGGCCGCCAGCGTGTTCTCG	0.682																																																1	Substitution - Missense(1)	ovary(1)	16											14.0	21.0	19.0					16																	19533043		2171	4234	6405	19440544	SO:0001583	missense	51573				CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.244C>G	16.37:g.19533043G>C	ENSP00000261386:p.Leu82Val	Unknown		x	x	x	19440544	O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	ENST00000353258.3	37	CCDS10578.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925139	0.52759	.	.	ENSG00000006007	ENST00000353258	T	0.37235	1.21	4.92	2.95	0.34219	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.166645	0.37809	N	0.001936	T	0.35799	0.0944	M	0.63208	1.945	0.40841	D	0.983676	B	0.25904	0.137	B	0.30716	0.119	T	0.27434	-1.0074	10	0.56958	D	0.05	-12.1227	9.3482	0.38122	0.1688:0.0:0.8312:0.0	.	82	Q9NZC3	GDE1_HUMAN	V	82	ENSP00000261386:L82V	ENSP00000261386:L82V	L	-	1	2	GDE1	19440544	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	1.800000	0.38833	0.778000	0.33520	0.555000	0.69702	CTG		0.682	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578226	7578226	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr17:7578226T>A	ENST00000269305.4	-	6	812	c.623A>T	c.(622-624)gAc>gTc	p.D208V	TP53_ENST00000359597.4_Missense_Mutation_p.D208V|TP53_ENST00000455263.2_Missense_Mutation_p.D208V|TP53_ENST00000445888.2_Missense_Mutation_p.D208V|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.D208V|TP53_ENST00000420246.2_Missense_Mutation_p.D208V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	208	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in a sporadic cancer; somatic mutation).|D -> I (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> N (in sporadic cancers; somatic mutation).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in a sporadic cancer; somatic mutation).|DD -> EY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D208V(14)|p.0?(8)|p.?(5)|p.D208G(3)|p.D207fs*6(2)|p.D208fs*1(1)|p.D207_R213delDDRNTFR(1)|p.D208fs*39(1)|p.D208fs*38(1)|p.D207_V216del10(1)|p.D208I(1)|p.E204_N210delEYLDDRN(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGTGTTTCTGTCATCCAAATA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	40	Substitution - Missense(18)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Deletion - In frame(4)	lung(6)|biliary_tract(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|ovary(3)|stomach(2)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|thyroid(1)|soft_tissue(1)|skin(1)|eye(1)	17											145.0	128.0	134.0					17																	7578226		2203	4300	6503	7518951	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.623A>T	17.37:g.7578226T>A	ENSP00000269305:p.Asp208Val	Unknown		x	x	x	7518951	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846884	0.91277	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.37;-7.37;-7.37;-7.37;-7.37;-7.37;-7.37;-7.37	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.997;0.994;0.999;0.996;0.995;0.996	D	0.96375	0.9277	10	0.87932	D	0	-22.6982	13.709	0.62656	0.0:0.0:0.0:1.0	.	169;208;208;115;208;208;208	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	208;208;208;208;208;208;197;115;76;115;76	ENSP00000410739:D208V;ENSP00000352610:D208V;ENSP00000269305:D208V;ENSP00000398846:D208V;ENSP00000391127:D208V;ENSP00000391478:D208V;ENSP00000425104:D76V;ENSP00000423862:D115V	ENSP00000269305:D208V	D	-	2	0	TP53	7518951	1.000000	0.71417	0.326000	0.25389	0.403000	0.30841	7.996000	0.88334	2.183000	0.69458	0.533000	0.62120	GAC		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
MIF4GD	57409	broad.mit.edu	37	17	73263913	73263913	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr17:73263913G>A	ENST00000325102.8	-	4	386	c.262C>T	c.(262-264)Cag>Tag	p.Q88*	MIF4GD_ENST00000580571.1_Intron|MIF4GD_ENST00000579119.1_Nonsense_Mutation_p.Q88*|MIF4GD_ENST00000577542.1_Nonsense_Mutation_p.Q129*|MIF4GD_ENST00000579297.1_Nonsense_Mutation_p.Q129*|MIF4GD_ENST00000245551.5_Nonsense_Mutation_p.Q122*|MIF4GD_ENST00000578305.1_Intron	NM_001242501.1	NP_001229430.1	A9UHW6	MI4GD_HUMAN	MIF4G domain containing	88	MIF4G.				regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.Q122*(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	10	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TCCCGAGCCTGGTACTCCTGC	0.602																																																1	Substitution - Nonsense(1)	ovary(1)	17											56.0	59.0	58.0					17																	73263913		2203	4300	6503	70775508	SO:0001587	stop_gained	57409			CR605810	CCDS11719.1, CCDS56044.1, CCDS58598.1	17q25.1	2005-12-15		2005-12-15					24030	protein-coding gene	gene with protein product		612072		MIFD			Standard	NM_001242498		Approved	AD023, MGC45027	uc002jnq.3	A9UHW6		ENST00000325102.8:c.262C>T	17.37:g.73263913G>A	ENSP00000321625:p.Gln88*	Unknown		x	x	x	70775508	B4DUM7|Q8N4Q5|Q9HBL5	Nonsense_Mutation	SNP	ENST00000325102.8	37	CCDS56044.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.239694	0.97403	.	.	ENSG00000125457	ENST00000245551;ENST00000325102	.	.	.	5.75	4.77	0.60923	.	0.161466	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-6.8386	9.1374	0.36883	0.0:0.127:0.6003:0.2728	.	.	.	.	X	122;88	.	ENSP00000245551:Q122X	Q	-	1	0	MIF4GD	70775508	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.314000	0.59166	1.401000	0.46761	0.561000	0.74099	CAG		0.602	MIF4GD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446671.1	NM_020679		Nonsense_Mutation
ZBTB14	7541	broad.mit.edu	37	18	5291171	5291171	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr18:5291171G>A	ENST00000357006.4	-	4	1374	c.1036C>T	c.(1036-1038)Cca>Tca	p.P346S	ZBTB14_ENST00000400143.3_Missense_Mutation_p.P346S	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	346					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P346S(1)									TTTAAGTCTGGGGCACGGATA	0.453																																																1	Substitution - Missense(1)	ovary(1)	18											161.0	155.0	157.0					18																	5291171		2203	4300	6503	5281171	SO:0001583	missense	7541			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.1036C>T	18.37:g.5291171G>A	ENSP00000349503:p.Pro346Ser	Unknown		x	x	x	5281171	O00403|Q2TB80	Missense_Mutation	SNP	ENST00000357006.4	37	CCDS11837.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609490	0.28623	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.06768	3.26;3.26	5.8	5.8	0.92144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.08537	0.0212	N	0.01473	-0.845	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.40117	-0.9580	10	0.02654	T	1	-14.9158	20.053	0.97634	0.0:0.0:1.0:0.0	.	346	O43829	ZF161_HUMAN	S	346	ENSP00000349503:P346S;ENSP00000383009:P346S	ENSP00000349503:P346S	P	-	1	0	ZFP161	5281171	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.793000	0.99091	2.733000	0.93635	0.650000	0.86243	CCA		0.453	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409		Missense_Mutation
ANKRD29	147463	broad.mit.edu	37	18	21229074	21229074	+	Silent	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr18:21229074G>A	ENST00000592179.1	-	2	259	c.105C>T	c.(103-105)ggC>ggT	p.G35G	ANKRD29_ENST00000284207.7_Silent_p.G35G|ANKRD29_ENST00000585908.2_Silent_p.G35G|ANKRD29_ENST00000322980.9_Silent_p.G35G	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	35								p.G35G(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CGTCCACCCGGCCGCTGTTCA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	18											66.0	57.0	60.0					18																	21229074		2203	4300	6503	19483072	SO:0001819	synonymous_variant	147463			AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.105C>T	18.37:g.21229074G>A		Unknown		x	x	x	19483072	B2R972|Q6ZWE8|Q96LU9	Silent	SNP	ENST00000592179.1	37	CCDS11879.1	SNP	42	Broad																																																																																				0.567	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505		Silent
MOCOS	55034	broad.mit.edu	37	18	33783136	33783136	+	Silent	SNP	C	C	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr18:33783136C>T	ENST00000261326.5	+	5	1023	c.1002C>T	c.(1000-1002)acC>acT	p.T334T		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GATTTGACACCCTAGAGCGCC	0.493																																																0			18											209.0	171.0	184.0					18																	33783136		2203	4300	6503	32037134	SO:0001819	synonymous_variant	55034			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.1002C>T	18.37:g.33783136C>T		Unknown		x	x	x	32037134		Silent	SNP	ENST00000261326.5	37	CCDS11919.1	SNP	22	Broad																																																																																				0.493	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			Silent
ZNF441	126068	broad.mit.edu	37	19	11892139	11892139	+	Silent	SNP	T	T	C			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr19:11892139T>C	ENST00000357901.4	+	4	1602	c.1500T>C	c.(1498-1500)gaT>gaC	p.D500D	ZNF441_ENST00000454339.2_Silent_p.D433D	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D433D(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACACTGGAGATGGACCTCATA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	19											92.0	92.0	92.0					19																	11892139		2203	4300	6503	11753139	SO:0001819	synonymous_variant	126068			AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1500T>C	19.37:g.11892139T>C		Unknown		x	x	x	11753139		Silent	SNP	ENST00000357901.4	37	CCDS12266.2	SNP	51	Broad																																																																																				0.408	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335273.3	NM_152355		Silent
ZNF30	90075	broad.mit.edu	37	19	35435239	35435239	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr19:35435239G>A	ENST00000601142.1	+	5	1606	c.1369G>A	c.(1369-1371)Gag>Aag	p.E457K	ZNF30_ENST00000426813.2_Missense_Mutation_p.E376K|ZNF30_ENST00000303586.7_Missense_Mutation_p.E458K|ZNF30_ENST00000439785.1_Missense_Mutation_p.E458K|ZNF30_ENST00000601957.1_3'UTR			P17039	ZNF30_HUMAN	zinc finger protein 30	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E458K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		GAAACCCTATGAGTGTAAGGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	19											61.0	63.0	62.0					19																	35435239		2203	4299	6502	40127079	SO:0001583	missense	90075			X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1369G>A	19.37:g.35435239G>A	ENSP00000469954:p.Glu457Lys	Unknown		x	x	x	40127079	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	g	12.28	1.889141	0.33348	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813;ENST00000342559	T;T	0.06608	3.28;3.28	2.2	-0.132	0.13489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02494	0.0076	N	0.02225	-0.63	0.09310	N	1	P;P	0.35551	0.453;0.509	B;B	0.38954	0.286;0.201	T	0.46541	-0.9184	9	0.19590	T	0.45	.	5.023	0.14370	0.4892:0.0:0.5108:0.0	.	458;457	P17039-2;P17039	.;ZNF30_HUMAN	K	458;457;376;166	ENSP00000403441:E458K;ENSP00000416457:E376K	ENSP00000303889:E457K	E	+	1	0	ZNF30	40127079	0.000000	0.05858	0.007000	0.13788	0.569000	0.35902	-1.535000	0.02210	-0.094000	0.12374	-0.357000	0.07601	GAG		0.443	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325		Missense_Mutation
EGLN2	112398	broad.mit.edu	37	19	41312493	41312493	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr19:41312493G>A	ENST00000593726.1	+	2	1905	c.877G>A	c.(877-879)Ggg>Agg	p.G293R	RAB4B-EGLN2_ENST00000594136.1_3'UTR|CTC-490E21.12_ENST00000601627.1_Intron|EGLN2_ENST00000406058.2_Missense_Mutation_p.G293R|EGLN2_ENST00000594140.1_Missense_Mutation_p.G11R|EGLN2_ENST00000303961.4_Missense_Mutation_p.G293R			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	293	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.G293R(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	CAACGGGCTCGGGTACGTAAG	0.572											OREG0025478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											132.0	99.0	110.0					19																	41312493		2203	4300	6503	46004333	SO:0001583	missense	112398			AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.877G>A	19.37:g.41312493G>A	ENSP00000469686:p.Gly293Arg	Unknown	900	x	x	x	46004333	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	CCDS12567.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257603	0.80246	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.59364	0.27;0.27	5.0	5.0	0.66597	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.56615	0.1997	L	0.28649	0.875	0.80722	D	1	D	0.65815	0.995	P	0.53006	0.715	T	0.50651	-0.8803	10	0.22706	T	0.39	-21.7204	17.2313	0.86984	0.0:0.0:1.0:0.0	.	293	Q96KS0	EGLN2_HUMAN	R	293	ENSP00000307080:G293R;ENSP00000385253:G293R	ENSP00000307080:G293R	G	+	1	0	EGLN2	46004333	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.307000	0.78920	2.585000	0.87301	0.655000	0.94253	GGG		0.572	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1			Missense_Mutation
GLTSCR2	29997	broad.mit.edu	37	19	48248863	48248863	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr19:48248863G>C	ENST00000246802.5	+	1	85	c.47G>C	c.(46-48)aGc>aCc	p.S16T	GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	16			S -> R (in dbSNP:rs1042401).			intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.S16T(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		AGCTCGAAAAGCGATGCCGAT	0.637																																					Colon(58;613 1041 9473 10089 15241)											1	Substitution - Missense(1)	ovary(1)	19											89.0	100.0	96.0					19																	48248863		2203	4300	6503	52940675	SO:0001583	missense	29997			AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.47G>C	19.37:g.48248863G>C	ENSP00000246802:p.Ser16Thr	Unknown		x	x	x	52940675	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930500	0.34096	.	.	ENSG00000105373	ENST00000246802;ENST00000325566;ENST00000446535	T	0.33865	1.39	4.69	-1.66	0.08265	.	0.649988	0.16284	N	0.221185	T	0.19765	0.0475	L	0.34521	1.04	0.09310	N	1	B;B;B	0.14438	0.005;0.002;0.01	B;B;B	0.06405	0.001;0.002;0.001	T	0.14282	-1.0478	10	0.59425	D	0.04	-6.0816	1.271	0.02021	0.2649:0.1479:0.4352:0.152	.	16;16;14	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	T	16	ENSP00000246802:S16T	ENSP00000246802:S16T	S	+	2	0	GLTSCR2	52940675	.	.	0.011000	0.14972	0.004000	0.04260	.	.	-0.356000	0.08187	-0.886000	0.02939	AGC		0.637	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710		Missense_Mutation
LILRB5	10990	broad.mit.edu	37	19	54756852	54756852	+	Splice_Site	SNP	T	T	C			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr19:54756852T>C	ENST00000316219.5	-	9	1462		c.e9-2		LILRB5_ENST00000450632.1_Splice_Site|LILRB5_ENST00000449561.2_Splice_Site|LILRB5_ENST00000345866.6_Splice_Site|CTD-2337J16.1_ENST00000595133.1_lincRNA	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.?(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTCCCAGACCTTGAGCGTGAT	0.577																																																1	Unknown(1)	ovary(1)	19											155.0	94.0	115.0					19																	54756852		2203	4299	6502	59448664	SO:0001630	splice_region_variant	10990			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1355-2A>G	19.37:g.54756852T>C		Unknown		x	x	x	59448664	Q8N760	Splice_Site_SNP	SNP	ENST00000316219.5	37	CCDS12885.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	4.664	0.123541	0.08931	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	.	.	.	2.59	1.57	0.23409	.	.	.	.	.	.	.	.	.	.	.	0.21325	N	0.999729	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3575	0.11185	0.0:0.1645:0.0:0.8355	.	.	.	.	.	-1	.	.	.	-	.	.	LILRB5	59448664	0.006000	0.16342	0.023000	0.16930	0.003000	0.03518	0.470000	0.22084	0.411000	0.25702	-0.334000	0.08254	.		0.577	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		Intron	Splice_Site_SNP
DLEC1	9940	broad.mit.edu	37	3	38139095	38139095	+	Silent	SNP	G	G	A	rs201876719		TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr3:38139095G>A	ENST00000308059.6	+	17	2553	c.2532G>A	c.(2530-2532)tcG>tcA	p.S844S	DLEC1_ENST00000346219.3_Silent_p.S844S|DLEC1_ENST00000452631.2_Silent_p.S844S					deleted in lung and esophageal cancer 1									p.S844S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ACTCGCCCTCGCCAGTGGTGT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	3											48.0	53.0	51.0					3																	38139095		2057	4187	6244	38114099	SO:0001819	synonymous_variant	9940			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2532G>A	3.37:g.38139095G>A		Unknown		x	x	x	38114099		Silent	SNP	ENST00000308059.6	37	CCDS2672.2	SNP	38	Broad																																																																																				0.597	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337		Silent
MST1R	4486	broad.mit.edu	37	3	49939840	49939840	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr3:49939840G>T	ENST00000296474.3	-	1	1230	c.1203C>A	c.(1201-1203)ttC>ttA	p.F401L	CTD-2330K9.2_ENST00000435478.1_RNA|CTD-2330K9.3_ENST00000419183.1_5'Flank|MST1R_ENST00000344206.4_Missense_Mutation_p.F401L	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	401	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)	p.F401L(1)		cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TGGGCGACTGGAAGAAGTCGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	94.0	90.0					3																	49939840		2203	4300	6503	49914844	SO:0001583	missense	4486			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1203C>A	3.37:g.49939840G>T	ENSP00000296474:p.Phe401Leu	Unknown		x	x	x	49914844	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	37	CCDS2807.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448974	0.43531	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.10099	2.91;2.91	4.77	2.56	0.30785	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.31734	0.0806	M	0.80746	2.51	0.51482	D	0.999923	B;D;B;B;B	0.71674	0.204;0.998;0.057;0.204;0.014	B;D;B;B;B	0.76071	0.084;0.987;0.084;0.133;0.046	T	0.12426	-1.0548	10	0.72032	D	0.01	-18.543	11.5331	0.50622	0.1808:0.0:0.8192:0.0	.	401;401;401;401;401	Q04912-3;Q04912-4;Q04912-6;Q04912-5;Q04912	.;.;.;.;RON_HUMAN	L	401	ENSP00000296474:F401L;ENSP00000341325:F401L	ENSP00000296474:F401L	F	-	3	2	MST1R	49914844	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	2.900000	0.48687	0.987000	0.38709	0.561000	0.74099	TTC		0.572	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1			Missense_Mutation
PI4K2B	55300	broad.mit.edu	37	4	25258233	25258233	+	Silent	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr4:25258233G>A	ENST00000264864.6	+	4	882	c.693G>A	c.(691-693)aaG>aaA	p.K231K	PI4K2B_ENST00000512921.1_Silent_p.K135K	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	231	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.K231K(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				GAGGCAAAAAGTATGCTTTAG	0.373																																																1	Substitution - coding silent(1)	ovary(1)	4											118.0	119.0	119.0					4																	25258233		2203	4300	6503	24867331	SO:0001819	synonymous_variant	55300			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.693G>A	4.37:g.25258233G>A		Unknown		x	x	x	24867331	Q9NUW2	Silent	SNP	ENST00000264864.6	37	CCDS3433.1	SNP	36	Broad																																																																																				0.373	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1	NM_018323		Silent
PCDHB16	57717	broad.mit.edu	37	5	140562279	140562279	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr5:140562279G>C	ENST00000361016.2	+	1	1300	c.145G>C	c.(145-147)Gga>Cga	p.G49R		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G49R(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCAAATCTAGGAAAAGACCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	5											89.0	103.0	98.0					5																	140562279		2203	4300	6503	140542463	SO:0001583	missense	57717			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.145G>C	5.37:g.140562279G>C	ENSP00000354293:p.Gly49Arg	Unknown		x	x	x	140542463	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265382	0.40095	.	.	ENSG00000196963	ENST00000361016	T	0.15017	2.46	4.84	3.95	0.45737	Cadherin, N-terminal (1);Cadherin (1);	1.525520	0.04654	N	0.407743	T	0.19886	0.0478	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.28784	0.094	T	0.37865	-0.9687	10	0.87932	D	0	.	10.6949	0.45892	0.0:0.1433:0.708:0.1486	.	49	Q9NRJ7	PCDBG_HUMAN	R	49	ENSP00000354293:G49R	ENSP00000354293:G49R	G	+	1	0	PCDHB16	140542463	0.163000	0.22920	0.480000	0.27341	0.555000	0.35460	2.866000	0.48420	0.978000	0.38470	0.655000	0.94253	GGA		0.527	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		Missense_Mutation
PCDHGA11	56105	broad.mit.edu	37	5	140801598	140801598	+	Silent	SNP	G	G	A	rs377701820		TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr5:140801598G>A	ENST00000398587.2	+	1	837	c.804G>A	c.(802-804)acG>acA	p.T268T	PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Silent_p.T268T|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTAATGCAACGGATCCAGACG	0.438													g|||	1	0.000199681	0.0	0.0	5008	,	,		20294	0.001		0.0	False		,,,				2504	0.0															0			5						G	,,,,,,,,,,,,,,,,,,,	0,3800		0,0,1900	135.0	138.0	137.0		,,,804,,,,,,,,,,,,,,,804,804	-8.2	1.0	5	dbSNP_134	137	1,8231		0,1,4115	no	intron,intron,intron,coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous,coding-synonymous	PCDHGB4,PCDHGA8,PCDHGB7,PCDHGB6,PCDHGB5,PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA11,PCDHGA10,PCDHGA9,PCDHGA7,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_003736.2,NM_018912.2,NM_018913.2,NM_018914.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018918.2,NM_018919.2,NM_018920.2,NM_018921.2,NM_018922.2,NM_018923.2,NM_018924.2,NM_018925.2,NM_018926.2,NM_018927.3,NM_032088.1,NM_032091.1,NM_032092.1	,,,,,,,,,,,,,,,,,,,	0,1,6015	AA,AG,GG		0.0121,0.0,0.0083	,,,,,,,,,,,,,,,,,,,	,,,268/936,,,,,,,,,,,,,,,268/838,268/751	140801598	1,12031	1900	4116	6016	140781782	SO:0001819	synonymous_variant	56105			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.804G>A	5.37:g.140801598G>A		Unknown		x	x	x	140781782	B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	ENST00000398587.2	37	CCDS47294.1	SNP	39	Broad																																																																																				0.438	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		Silent
EBF1	1879	broad.mit.edu	37	5	158524048	158524048	+	Silent	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr5:158524048G>A	ENST00000313708.6	-	2	507	c.225C>T	c.(223-225)taC>taT	p.Y75Y	EBF1_ENST00000380654.4_Silent_p.Y75Y|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000517373.1_Silent_p.Y75Y	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	75					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y75Y(1)	HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTGTCTGTCGTAGAGGGCCA	0.622			T	HMGA2	lipoma																																		Dom	yes		5	5q34	1879	early B-cell factor 1		M	1	Substitution - coding silent(1)	ovary(1)	5											53.0	47.0	49.0					5																	158524048		2203	4300	6503	158456626	SO:0001819	synonymous_variant	1879			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.225C>T	5.37:g.158524048G>A		Unknown		x	x	x	158456626	Q8IW11	Silent	SNP	ENST00000313708.6	37	CCDS4343.1	SNP	40	Broad																																																																																				0.622	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007		Silent
MUT	4594	broad.mit.edu	37	6	49427168	49427168	+	Silent	SNP	A	A	G			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr6:49427168A>G	ENST00000274813.3	-	2	139	c.12T>C	c.(10-12)gcT>gcC	p.A4A		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	4					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)	p.A4A(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCTGATTCTTAGCTCTTAACA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	6											65.0	67.0	66.0					6																	49427168		2203	4299	6502	49535127	SO:0001819	synonymous_variant	4594				CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.12T>C	6.37:g.49427168A>G		Unknown		x	x	x	49535127	A8K953|Q5SYZ3|Q96B11|Q9UD64	Silent	SNP	ENST00000274813.3	37	CCDS4924.1	SNP	15	Broad																																																																																				0.408	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1			Silent
GPNMB	10457	broad.mit.edu	37	7	23296642	23296642	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr7:23296642G>A	ENST00000381990.2	+	4	660	c.499G>A	c.(499-501)Gga>Aga	p.G167R	GPNMB_ENST00000258733.4_Missense_Mutation_p.G167R|GPNMB_ENST00000409458.3_Missense_Mutation_p.G167R|GPNMB_ENST00000539136.1_Missense_Mutation_p.G68R|GPNMB_ENST00000453162.2_Intron	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	167					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)	p.G167R(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			TCACCACCCCGGATGGAGAAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											124.0	114.0	118.0					7																	23296642		2203	4300	6503	23263167	SO:0001583	missense	10457			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.499G>A	7.37:g.23296642G>A	ENSP00000371420:p.Gly167Arg	Unknown		x	x	x	23263167	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	CCDS34610.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319264	0.60524	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000409458;ENST00000539136	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	4.68	1.7	0.24286	.	0.254132	0.33515	N	0.004830	T	0.18087	0.0434	M	0.70595	2.14	0.80722	D	1	B;B;B;B	0.28667	0.219;0.14;0.163;0.219	B;B;B;B	0.22880	0.034;0.015;0.042;0.023	T	0.03534	-1.1027	10	0.51188	T	0.08	-0.385	9.9042	0.41366	0.0736:0.2611:0.6653:0.0	.	68;167;167;167	F6SKP1;Q14956;Q14956-2;Q96F58	.;GPNMB_HUMAN;.;.	R	167;202;167;167;68	ENSP00000258733:G167R;ENSP00000371420:G167R;ENSP00000386476:G167R;ENSP00000445266:G68R	ENSP00000258733:G167R	G	+	1	0	GPNMB	23263167	1.000000	0.71417	0.001000	0.08648	0.521000	0.34408	5.237000	0.65360	0.106000	0.17784	0.561000	0.74099	GGA		0.473	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340		Missense_Mutation
PCLO	27445	broad.mit.edu	37	7	82581858	82581858	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr7:82581858G>A	ENST00000333891.9	-	5	8748	c.8411C>T	c.(8410-8412)gCa>gTa	p.A2804V	PCLO_ENST00000423517.2_Missense_Mutation_p.A2804V|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.A2804V(1)|p.A2735V(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGTGTAACTTGCACTAGCTGT	0.463																																																2	Substitution - Missense(2)	ovary(2)	7											199.0	175.0	183.0					7																	82581858		2051	4187	6238	82419794	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8411C>T	7.37:g.82581858G>A	ENSP00000334319:p.Ala2804Val	Unknown		x	x	x	82419794		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	8.019	0.759292	0.15846	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.14022	2.55;2.54	5.69	2.46	0.29980	.	.	.	.	.	T	0.03739	0.0106	N	0.00729	-1.24	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.32824	-0.9892	9	0.87932	D	0	.	3.5996	0.08019	0.3184:0.0:0.4952:0.1864	.	2804;2804	Q9Y6V0-5;Q9Y6V0-6	.;.	V	2735;2804;2804	ENSP00000334319:A2804V;ENSP00000388393:A2804V	ENSP00000334319:A2804V	A	-	2	0	PCLO	82419794	0.001000	0.12720	0.598000	0.28837	0.911000	0.54048	1.188000	0.32102	0.749000	0.32854	0.655000	0.94253	GCA		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		Missense_Mutation
ZSCAN21	7589	broad.mit.edu	37	7	99655002	99655002	+	Missense_Mutation	SNP	C	C	T	rs373816425		TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr7:99655002C>T	ENST00000292450.4	+	2	537	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	ZSCAN21_ENST00000456748.2_Missense_Mutation_p.R125W|ZSCAN21_ENST00000477297.1_3'UTR|ZSCAN21_ENST00000543588.1_Missense_Mutation_p.R125W	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	125	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R125W(1)		breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			AGATCTGGAGCGGGAACTGGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	7											32.0	31.0	32.0					7																	99655002		2203	4298	6501	99492938	SO:0001583	missense	7589			AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.373C>T	7.37:g.99655002C>T	ENSP00000292450:p.Arg125Trp	Unknown		x	x	x	99492938	A4D2A6|D6W5T9|Q9H0B5	Missense_Mutation	SNP	ENST00000292450.4	37	CCDS5681.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606469	0.66445	.	.	ENSG00000166529	ENST00000543588;ENST00000292450;ENST00000456748;ENST00000438937;ENST00000379635	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	4.77	2.8	0.32819	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.330791	0.17202	N	0.183093	T	0.29684	0.0741	H	0.94462	3.54	0.23886	N	0.996562	D;D	0.89917	0.995;1.0	P;D	0.72338	0.765;0.977	T	0.09185	-1.0686	10	0.87932	D	0	.	7.2757	0.26283	0.3375:0.4988:0.1637:0.0	.	125;125	Q9Y5A6;G3V1M0	ZSC21_HUMAN;.	W	125;125;125;125;100	ENSP00000441212:R125W;ENSP00000292450:R125W;ENSP00000390960:R125W;ENSP00000404207:R125W	ENSP00000292450:R125W	R	+	1	2	ZSCAN21	99492938	0.999000	0.42202	0.705000	0.30386	0.989000	0.77384	2.339000	0.43965	1.352000	0.45808	0.655000	0.94253	CGG		0.572	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336166.1	NM_145914		Missense_Mutation
CRB2	286204	broad.mit.edu	37	9	126133040	126133040	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chr9:126133040C>T	ENST00000373631.3	+	7	1709	c.1708C>T	c.(1708-1710)Cag>Tag	p.Q570*	CRB2_ENST00000373629.2_Nonsense_Mutation_p.Q238*|CRB2_ENST00000359999.3_Nonsense_Mutation_p.Q570*	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	570	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)	p.Q570*(1)		NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CTCCTCTGCCCAGCTGGGGGA	0.682																																																1	Substitution - Nonsense(1)	ovary(1)	9											49.0	50.0	50.0					9																	126133040		2203	4300	6503	125172861	SO:0001587	stop_gained	286204			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.1708C>T	9.37:g.126133040C>T	ENSP00000362734:p.Gln570*	Unknown		x	x	x	125172861	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Nonsense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063166	0.36373	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	.	.	.	4.94	1.78	0.24846	.	0.885835	0.09416	N	0.805063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	3.177	0.06572	0.1435:0.5656:0.1388:0.1521	.	.	.	.	X	570;570;238	.	ENSP00000353092:Q570X	Q	+	1	0	CRB2	125172861	0.005000	0.15991	0.014000	0.15608	0.043000	0.13939	0.217000	0.17603	0.459000	0.27016	0.448000	0.29417	CAG		0.682	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689		Nonsense_Mutation
RPGR	6103	broad.mit.edu	37	X	38182664	38182664	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chrX:38182664C>A	ENST00000339363.3	-	2	309	c.142G>T	c.(142-144)Gct>Tct	p.A48S	RPGR_ENST00000378505.2_Missense_Mutation_p.A48S|RPGR_ENST00000342811.3_Missense_Mutation_p.A48S|RPGR_ENST00000309513.3_Missense_Mutation_p.A48S|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000338898.3_Missense_Mutation_p.A48S|RPGR_ENST00000318842.7_Missense_Mutation_p.A48S			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	48					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.A48S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GTAACAACAGCAGAATGTTCA	0.313																																																1	Substitution - Missense(1)	ovary(1)	X											51.0	44.0	46.0					X																	38182664		2202	4299	6501	38067608	SO:0001583	missense	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.142G>T	X.37:g.38182664C>A	ENSP00000343671:p.Ala48Ser	Unknown		x	x	x	38067608	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	18.13	3.556014	0.65425	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	5.6	5.6	0.85130	.	0.000000	0.85682	U	0.000000	D	0.88138	0.6356	M	0.82193	2.58	0.41890	D	0.990364	D;D	0.56035	0.974;0.966	P;P	0.58577	0.841;0.833	D	0.88832	0.3306	10	0.46703	T	0.11	.	13.9031	0.63817	0.1527:0.8472:0.0:0.0	.	48;48	E9PE28;Q92834-2	.;.	S	48	ENSP00000343671:A48S;ENSP00000308783:A48S;ENSP00000340208:A48S;ENSP00000322219:A48S;ENSP00000339531:A48S;ENSP00000367766:A48S	ENSP00000308783:A48S	A	-	1	0	RPGR	38067608	1.000000	0.71417	0.999000	0.59377	0.363000	0.29612	3.620000	0.54203	2.342000	0.79632	0.513000	0.50165	GCT		0.313	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328		Missense_Mutation
CXCR3	2833	broad.mit.edu	37	X	70836822	70836822	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chrX:70836822C>T	ENST00000373693.3	-	2	567	c.500G>A	c.(499-501)cGc>cAc	p.R167H	CXCR3_ENST00000373691.4_Missense_Mutation_p.R214H	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	167					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)	p.R167H(1)		breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					GAGGGTCAcgcgggccggggg	0.652																																																1	Substitution - Missense(1)	ovary(1)	X											22.0	26.0	24.0					X																	70836822		2187	4288	6475	70753547	SO:0001583	missense	2833			U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.500G>A	X.37:g.70836822C>T	ENSP00000362797:p.Arg167His	Unknown		x	x	x	70753547	B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	ENST00000373693.3	37	CCDS14416.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.381749	0.01204	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.39592	1.07;1.07	5.34	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.387744	0.24282	N	0.039881	T	0.23249	0.0562	L	0.31526	0.94	0.09310	N	1	B;P	0.34837	0.232;0.472	B;B	0.25140	0.034;0.058	T	0.11616	-1.0580	10	0.16896	T	0.51	.	7.0622	0.25131	0.0:0.7997:0.0:0.2003	.	214;167	P49682-2;P49682	.;CXCR3_HUMAN	H	214;167;167	ENSP00000362795:R214H;ENSP00000362797:R167H	ENSP00000362791:R167H	R	-	2	0	CXCR3	70753547	0.000000	0.05858	0.009000	0.14445	0.002000	0.02628	-0.306000	0.08178	1.237000	0.43756	-0.276000	0.10085	CGC		0.652	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144141.1			Missense_Mutation
Unknown	0	broad.mit.edu	37	X	0	0	+	IGR	SNP	C	C	A			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chrX:0C>A								None (None upstream) : PLCXD1 (192988 downstream)																							NNNNNNNNNN	0.0																																																0			X																																								148576946	SO:0001628	intergenic_variant	4110																															X.37:g.0C>A		Unknown		x	x	x	148576946		Missense_Mutation	SNP		37		SNP	29	Broad																																																																																			0	0.000									Missense_Mutation
RHOXF1	158800	broad.mit.edu	37	X	119249453	119249453	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2092-01	TCGA-61-2092-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2092-01	TCGA-61-2092-11	g.chrX:119249453C>T	ENST00000217999.2	-	1	394	c.320G>A	c.(319-321)cGc>cAc	p.R107H	RP4-755D9.1_ENST00000553843.1_RNA|GS1-421I3.4_ENST00000422226.1_lincRNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	107					gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R107H(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						GAACTTCGTGCGCCGAGTTCG	0.647																																																1	Substitution - Missense(1)	ovary(1)	X											72.0	62.0	66.0					X																	119249453		2203	4298	6501	119133481	SO:0001583	missense	158800				CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.320G>A	X.37:g.119249453C>T	ENSP00000217999:p.Arg107His	Unknown		x	x	x	119133481	O95030|Q3SYE0	Missense_Mutation	SNP	ENST00000217999.2	37	CCDS14593.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	13.97	2.396933	0.42512	.	.	ENSG00000101883	ENST00000217999	D	0.99167	-5.51	2.73	-2.61	0.06171	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.	.	.	.	D	0.97303	0.9118	M	0.90145	3.09	0.09310	N	1	P	0.44006	0.824	B	0.34346	0.18	D	0.92413	0.5939	9	0.72032	D	0.01	-1.0013	0.2935	0.00262	0.1979:0.2584:0.1937:0.3501	.	107	Q8NHV9	RHXF1_HUMAN	H	107	ENSP00000217999:R107H	ENSP00000217999:R107H	R	-	2	0	RHOXF1	119133481	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.542000	0.06091	-0.841000	0.04200	0.509000	0.49947	CGC		0.647	RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058083.2	NM_139282		Missense_Mutation
