#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
VPS13D	55187	broad.mit.edu	37	1	12475241	12475241	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:12475241C>T	ENST00000358136.3	+	64	12262	c.12132C>T	c.(12130-12132)ttC>ttT	p.F4044F	VPS13D_ENST00000496628.1_3'UTR|VPS13D_ENST00000356315.4_Silent_p.F4019F|VPS13D_ENST00000543766.1_Silent_p.F42F	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.F4044F(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCAAGGAGTTCATCATCAATG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	1											138.0	122.0	127.0					1																	12475241		2203	4300	6503	12397828	SO:0001819	synonymous_variant	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.12132C>T	1.37:g.12475241C>T		Unknown		x	x	x	12397828		Silent	SNP	ENST00000358136.3	37	CCDS30588.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291938	0.23564	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.58	2.3	0.28687	.	.	.	.	.	T	0.59797	0.2220	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55604	-0.8115	4	.	.	.	.	10.7744	0.46342	0.0:0.6637:0.0:0.3363	.	.	.	.	L	2866	.	.	S	+	2	0	VPS13D	12397828	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	0.528000	0.23002	0.685000	0.31468	0.650000	0.86243	TCA		0.423	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		Silent
ATP13A2	23400	broad.mit.edu	37	1	17326929	17326930	+	Missense_Mutation	DNP	AT	AT	GA			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:17326929_17326930AT>GA	ENST00000326735.8	-	9	838_839	c.805_806AT>TC	c.(805-807)ATc>TCc	p.I269S	ATP13A2_ENST00000502860.1_5'Flank|ATP13A2_ENST00000341676.5_Missense_Mutation_p.I264S|ATP13A2_ENST00000452699.1_Missense_Mutation_p.I264S|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	269					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.I269S(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		GCAGATGGAGATGGAGGAAATG	0.609																																																1	Substitution - Missense(1)	ovary(1)	1																																								17199517	SO:0001583	missense	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.805_806delinsGA	1.37:g.17326929_17326930delinsGA	ENSP00000327214:p.Ile269Ser	Unknown		x	x	x	17199516	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	DNP	ENST00000326735.8	37	CCDS175.1	DNP	12	Broad																																																																																				0.609	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089		Missense_Mutation
GRHL3	57822	broad.mit.edu	37	1	24664220	24664220	+	Missense_Mutation	SNP	G	G	A	rs145470039	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:24664220G>A	ENST00000350501.5	+	6	908	c.781G>A	c.(781-783)Gtc>Atc	p.V261I	GRHL3_ENST00000356046.2_Missense_Mutation_p.V215I|GRHL3_ENST00000361548.4_Missense_Mutation_p.V261I|GRHL3_ENST00000342072.4_Missense_Mutation_p.V168I|GRHL3_ENST00000236255.4_Missense_Mutation_p.V266I	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	261					central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.V266I(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		GTTCTACCCCGTCACCCTGCG	0.587													G|||	9	0.00179712	0.0061	0.0014	5008	,	,		20270	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	16,4390	23.3+/-48.9	0,16,2187	98.0	84.0	89.0		781,781,796,643	4.1	0.8	1	dbSNP_134	89	0,8600		0,0,4300	yes	missense,missense,missense,missense	GRHL3	NM_198174.2,NM_198173.2,NM_021180.3,NM_001195010.1	29,29,29,29	0,16,6487	AA,AG,GG		0.0,0.3631,0.123	benign,benign,benign,benign	261/627,261/603,266/608,215/557	24664220	16,12990	2203	4300	6503	24536807	SO:0001583	missense	57822			AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.781G>A	1.37:g.24664220G>A	ENSP00000288955:p.Val261Ile	Unknown		x	x	x	24536807	A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Missense_Mutation	SNP	ENST00000350501.5	37	CCDS252.2	SNP	40	Broad	7	0.003205128205128205	7	0.014227642276422764	0	0.0	0	0.0	0	0.0	G	4.028	0.002793	0.07866	0.003631	0.0	ENSG00000158055	ENST00000361548;ENST00000342072;ENST00000350501;ENST00000356046;ENST00000236255	T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46	5.97	4.12	0.48240	.	0.237878	0.42964	N	0.000623	T	0.03390	0.0098	N	0.02103	-0.685	0.32683	N	0.515251	B;B;B	0.18310	0.013;0.003;0.027	B;B;B	0.14578	0.008;0.006;0.011	T	0.30937	-0.9961	10	0.02654	T	1	-28.162	9.5371	0.39229	0.2343:0.0:0.7657:0.0	.	215;266;261	A2A297;Q8TE85-2;G3XAF0	.;.;.	I	261;168;261;215;266	ENSP00000354943:V261I;ENSP00000340543:V168I;ENSP00000288955:V261I;ENSP00000348333:V215I;ENSP00000236255:V266I	ENSP00000236255:V266I	V	+	1	0	GRHL3	24536807	0.796000	0.28864	0.822000	0.32727	0.992000	0.81027	1.375000	0.34295	0.868000	0.35678	0.655000	0.94253	GTC		0.587	GRHL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000009047.2	NM_021180		Missense_Mutation
RLF	6018	broad.mit.edu	37	1	40705034	40705034	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:40705034C>A	ENST00000372771.4	+	8	4687	c.4660C>A	c.(4660-4662)Caa>Aaa	p.Q1554K		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1554					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CTGCATGGTTCAAGGATGCTT	0.453																																																0			1											96.0	100.0	99.0					1																	40705034		2203	4300	6503	40477621	SO:0001583	missense	6018				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.4660C>A	1.37:g.40705034C>A	ENSP00000361857:p.Gln1554Lys	Unknown		x	x	x	40477621	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	CCDS448.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	0.492	-0.874832	0.02550	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.10573	2.86	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.211342	0.49916	D	0.000123	T	0.07503	0.0189	N	0.12182	0.205	0.39481	D	0.96788	B;B	0.29988	0.264;0.085	B;B	0.24701	0.055;0.025	T	0.43507	-0.9387	10	0.26408	T	0.33	-13.4773	17.4736	0.87653	0.0:0.8763:0.1237:0.0	.	1247;1554	F5H2M5;Q13129	.;RLF_HUMAN	K	1554;1247	ENSP00000361857:Q1554K	ENSP00000361857:Q1554K	Q	+	1	0	RLF	40477621	0.835000	0.29415	1.000000	0.80357	0.998000	0.95712	1.803000	0.38863	2.864000	0.98301	0.551000	0.68910	CAA		0.453	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		Missense_Mutation
SCP2	6342	broad.mit.edu	37	1	53453793	53453793	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:53453793C>T	ENST00000528311.1	+	10	1119	c.823C>T	c.(823-825)Cca>Tca	p.P275S	SCP2_ENST00000407246.2_Missense_Mutation_p.P332S|SCP2_ENST00000371509.4_Missense_Mutation_p.P312S|SCP2_ENST00000371514.3_Missense_Mutation_p.P356S|SCP2_ENST00000371513.5_Missense_Mutation_p.P312S	NM_001193617.1	NP_001180546.1	Q9BX26	SYCP2_HUMAN	sterol carrier protein 2	0					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.P356S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	15						AAAGGGACACCCACTAGGCGC	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	80.0	78.0					1																	53453793		2203	4300	6503	53226381	SO:0001583	missense	6342			M75884	CCDS572.1, CCDS30719.1, CCDS41338.1, CCDS44149.1, CCDS44150.1, CCDS53317.1, CCDS53318.1, CCDS53319.1	1p32	2010-08-20			ENSG00000116171	ENSG00000116171			10606	protein-coding gene	gene with protein product		184755				1703300, 1718316	Standard	NM_001007098		Approved		uc001cur.2	P22307	OTTHUMG00000008936	ENST00000528311.1:c.823C>T	1.37:g.53453793C>T	ENSP00000434132:p.Pro275Ser	Unknown		x	x	x	53226381	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000528311.1	37	CCDS53319.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	29.8	5.036676	0.93630	.	.	ENSG00000116171	ENST00000371514;ENST00000528311;ENST00000371509;ENST00000407246;ENST00000371513	D;D;D;D;D	0.97924	-3.58;-4.61;-3.58;-3.58;-4.61	5.8	5.8	0.92144	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, conserved site (1);Thiolase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99242	0.9736	H	0.96333	3.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.998	D	0.98968	1.0800	10	0.87932	D	0	-11.1646	19.669	0.95903	0.0:1.0:0.0:0.0	.	332;312;356;312	C9JC79;A6NM69;P22307;Q6NXF4	.;.;NLTP_HUMAN;.	S	356;275;312;332;312	ENSP00000360569:P356S;ENSP00000434132:P275S;ENSP00000360564:P312S;ENSP00000384569:P332S;ENSP00000360568:P312S	ENSP00000360564:P312S	P	+	1	0	SCP2	53226381	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.996000	0.76263	2.741000	0.93983	0.650000	0.86243	CCA		0.373	SCP2-010	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387558.1	NM_002979		Missense_Mutation
PCSK9	255738	broad.mit.edu	37	1	55527134	55527135	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:55527134_55527135GG>AA	ENST00000302118.5	+	11	2058_2059	c.1768_1769GG>AA	c.(1768-1770)GGc>AAc	p.G590N	PCSK9_ENST00000490692.1_3'UTR|PCSK9_ENST00000543384.1_3'UTR	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	590	C-terminal domain.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.G590N(1)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						CCAGTGCGTGGGCCACAGGGAG	0.649																																					Pancreas(137;1454 1827 5886 22361 42375)											1	Substitution - Missense(1)	ovary(1)	1																																								55299723	SO:0001583	missense	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	Exception_encountered	1.37:g.55527134_55527135delinsAA	ENSP00000303208:p.Gly590Asn	Unknown		x	x	x	55299722	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	DNP	ENST00000302118.5	37	CCDS603.1	DNP	43	Broad																																																																																				0.649	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1	NM_174936		Missense_Mutation
ALG14	199857	broad.mit.edu	37	1	95492697	95492697	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:95492697C>T	ENST00000370205.5	-	3	454	c.408G>A	c.(406-408)gtG>gtA	p.V136V		NM_144988.3	NP_659425.1	Q96F25	ALG14_HUMAN	ALG14, UDP-N-acetylglucosaminyltransferase subunit	136					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	6		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		AATCTGGCTTCACCCTGTGAA	0.473																																																0			1											80.0	74.0	76.0					1																	95492697		2203	4300	6503	95265285	SO:0001819	synonymous_variant	199857				CCDS752.1	1p21.3	2013-02-21	2013-02-21		ENSG00000172339	ENSG00000172339			28287	protein-coding gene	gene with protein product		612866	"""asparagine-linked glycosylation 14 homolog (yeast)"", ""asparagine-linked glycosylation 14 homolog (S. cerevisiae)"""			15615718	Standard	NM_144988		Approved	MGC19780	uc001dra.2	Q96F25	OTTHUMG00000010781	ENST00000370205.5:c.408G>A	1.37:g.95492697C>T		Unknown		x	x	x	95265285	A8K030	Silent	SNP	ENST00000370205.5	37	CCDS752.1	SNP	29	Broad																																																																																				0.473	ALG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029699.2	NM_144988		Silent
NRAS	4893	broad.mit.edu	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	C	rs11554290	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:115256529T>C	ENST00000369535.4	-	3	435	c.182A>G	c.(181-183)cAa>cGa	p.Q61R		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																													Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	1											180.0	156.0	164.0					1																	115256529		2203	4300	6503	115058052	SO:0001583	missense	4893	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>G	1.37:g.115256529T>C	ENSP00000358548:p.Gln61Arg	Unknown		x	x	x	115058052	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004139	0.74932	.	.	ENSG00000213281	ENST00000369535	D	0.83673	-1.75	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.86489	0.5945	M	0.92604	3.325	0.80722	D	1	B	0.28512	0.214	B	0.39590	0.304	D	0.88255	0.2919	10	0.66056	D	0.02	.	15.0132	0.71565	0.0:0.0:0.0:1.0	rs11554290;rs11554290	61	P01111	RASN_HUMAN	R	61	ENSP00000358548:Q61R	ENSP00000358548:Q61R	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524		Missense_Mutation
NOTCH2	4853	broad.mit.edu	37	1	120458689	120458689	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:120458689G>A	ENST00000256646.2	-	34	6875	c.6656C>T	c.(6655-6657)cCc>cTc	p.P2219L		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2219					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTCACTGAGGGAAGCACAGT	0.567			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0			1											59.0	56.0	57.0					1																	120458689		2203	4300	6503	120260212	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6656C>T	1.37:g.120458689G>A	ENSP00000256646:p.Pro2219Leu	Unknown		x	x	x	120260212	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	13.44	2.239077	0.39598	.	.	ENSG00000134250	ENST00000256646	D	0.82081	-1.57	5.5	5.5	0.81552	.	0.000000	0.37530	U	0.002041	T	0.79482	0.4453	L	0.41824	1.3	0.80722	D	1	D	0.59357	0.985	P	0.50970	0.655	T	0.79105	-0.1940	10	0.40728	T	0.16	.	18.3882	0.90473	0.0:0.0:1.0:0.0	.	2219	Q04721	NOTC2_HUMAN	L	2219	ENSP00000256646:P2219L	ENSP00000256646:P2219L	P	-	2	0	NOTCH2	120260212	0.995000	0.38212	0.999000	0.59377	0.906000	0.53458	2.217000	0.42880	2.588000	0.87417	0.561000	0.74099	CCC		0.567	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		Missense_Mutation
RFX5	5993	broad.mit.edu	37	1	151314767	151314767	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:151314767C>T	ENST00000290524.4	-	11	1924	c.1746G>A	c.(1744-1746)aaG>aaA	p.K582K	RFX5_ENST00000368870.2_Silent_p.K582K|RFX5_ENST00000452513.2_Silent_p.K542K|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452671.2_Silent_p.K582K|RP11-126K1.8_ENST00000422153.1_RNA	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	582					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K582K(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTACCTCTCCCTTTGCCAAAG	0.463																																																1	Substitution - coding silent(1)	lung(1)	1											137.0	126.0	130.0					1																	151314767		2203	4300	6503	149581391	SO:0001819	synonymous_variant	5993				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1746G>A	1.37:g.151314767C>T		Unknown		x	x	x	149581391	B7Z848|D3DV19|E9PFU4|Q5VWC3	Silent	SNP	ENST00000290524.4	37	CCDS994.1	SNP	24	Broad																																																																																				0.463	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449		Silent
ATP8B2	57198	broad.mit.edu	37	1	154303355	154303356	+	Missense_Mutation	DNP	AG	AG	GC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:154303355_154303356AG>GC	ENST00000368489.3	+	4	254_255	c.254_255AG>GC	c.(253-255)cAG>cGC	p.Q85R	ATP8B2_ENST00000368487.3_Missense_Mutation_p.Q52R|ATP8B2_ENST00000341822.2_Missense_Mutation_p.Q71R|ATP8B2_ENST00000426445.1_3'UTR	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	71					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.Q85R(1)	IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTCTTTGAGCAGTTCCAGGAAG	0.455																																																1	Substitution - Missense(1)	ovary(1)	1																																								152569980	SO:0001583	missense	57198			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	Exception_encountered	1.37:g.154303355_154303356delinsGC	ENSP00000357475:p.Gln85Arg	Unknown		x	x	x	152569979	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	DNP	ENST00000368489.3	37	CCDS1066.1	DNP	7	Broad																																																																																				0.455	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452		Missense_Mutation
GBA	2629	broad.mit.edu	37	1	155208380	155208380	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:155208380G>T	ENST00000327247.5	-	6	748	c.516C>A	c.(514-516)taC>taA	p.Y172*	AL713999.1_ENST00000401290.1_RNA|GBA_ENST00000536770.1_Nonsense_Mutation_p.Y59*|GBA_ENST00000493842.1_5'UTR|GBA_ENST00000427500.3_Nonsense_Mutation_p.Y123*|GBA_ENST00000368373.3_Nonsense_Mutation_p.Y172*|GBA_ENST00000428024.3_Nonsense_Mutation_p.Y85*	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	172					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	CTGCATAGGTGTAGGTGCGGA	0.493									Gaucher disease type I																																							0			1											60.0	59.0	59.0					1																	155208380		2201	4298	6499	153475004	SO:0001587	stop_gained	2629	Familial Cancer Database	glucocerebrosidase insufficiency	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.516C>A	1.37:g.155208380G>T	ENSP00000314508:p.Tyr172*	Unknown		x	x	x	153475004	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Nonsense_Mutation	SNP	ENST00000327247.5	37	CCDS1102.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926494	0.18056	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	.	.	.	3.55	-2.82	0.05787	.	0.090758	0.45867	D	0.000321	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4975	0.33136	0.6936:0.0:0.3064:0.0	.	.	.	.	X	123;85;172;172;59;129;157	.	ENSP00000314508:Y172X	Y	-	3	2	GBA	153475004	1.000000	0.71417	0.086000	0.20670	0.300000	0.27592	1.152000	0.31663	-0.452000	0.07087	-0.704000	0.03662	TAC		0.493	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157		Nonsense_Mutation
TNN	63923	broad.mit.edu	37	1	175054549	175054550	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:175054549_175054550CC>AG	ENST00000239462.4	+	6	1356_1357	c.1243_1244CC>AG	c.(1243-1245)CCg>AGg	p.P415R		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	415	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.P415R(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGGTCTGCACCCGGGGACTGAG	0.599																																																1	Substitution - Missense(1)	ovary(1)	1																																								173321173	SO:0001583	missense	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	Exception_encountered	1.37:g.175054549_175054550delinsAG	ENSP00000239462:p.Pro415Arg	Unknown		x	x	x	173321172	B9EGP3|Q5R360	Missense_Mutation	DNP	ENST00000239462.4	37	CCDS30943.1	DNP	22	Broad																																																																																				0.599	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		Missense_Mutation
SOX13	9580	broad.mit.edu	37	1	204083544	204083544	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:204083544C>G	ENST00000367204.1	+	3	424	c.315C>G	c.(313-315)aaC>aaG	p.N105K	SOX13_ENST00000367203.4_3'UTR	NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	105					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N105K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGACTTCAACCGAAATTTGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	51.0	52.0					1																	204083544		1949	4153	6102	202350167	SO:0001583	missense	9580				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.315C>G	1.37:g.204083544C>G	ENSP00000356172:p.Asn105Lys	Unknown		x	x	x	202350167	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	11.57	1.678246	0.29783	.	.	ENSG00000143842	ENST00000367204;ENST00000528591	D	0.97505	-4.41	4.65	2.74	0.32292	.	0.221487	0.45867	D	0.000321	D	0.93239	0.7846	L	0.41236	1.265	0.25538	N	0.987204	B;B	0.24258	0.1;0.075	B;B	0.21546	0.022;0.035	D	0.87724	0.2575	10	0.59425	D	0.04	.	7.3553	0.26714	0.0:0.7182:0.0:0.2818	.	105;87	Q9UN79;Q5SXX2	SOX13_HUMAN;.	K	105	ENSP00000356172:N105K	ENSP00000356172:N105K	N	+	3	2	SOX13	202350167	0.994000	0.37717	0.982000	0.44146	0.924000	0.55760	0.351000	0.20096	0.943000	0.37553	0.563000	0.77884	AAC		0.542	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686		Missense_Mutation
MCM10	55388	broad.mit.edu	37	10	13228183	13228183	+	Missense_Mutation	SNP	A	A	T	rs200097291		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:13228183A>T	ENST00000484800.2	+	9	1224	c.1121A>T	c.(1120-1122)cAt>cTt	p.H374L	MCM10_ENST00000378714.3_Missense_Mutation_p.H373L|MCM10_ENST00000378694.1_Missense_Mutation_p.H373L			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	374	OB-fold domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.H374L(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TCTATCGATCATCCTCAGAAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	10											189.0	178.0	182.0					10																	13228183		2203	4300	6503	13268189	SO:0001583	missense	55388			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1121A>T	10.37:g.13228183A>T	ENSP00000418268:p.His374Leu	Unknown		x	x	x	13268189	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	29.0	4.972596	0.92919	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.15372	2.43;2.43;2.43	5.78	5.78	0.91487	.	0.089542	0.85682	D	0.000000	T	0.40815	0.1132	M	0.76574	2.34	0.58432	D	0.99999	D;P;P	0.76494	0.999;0.877;0.804	D;P;B	0.65987	0.94;0.548;0.346	T	0.13926	-1.0491	10	0.33141	T	0.24	-17.9507	16.1067	0.81230	1.0:0.0:0.0:0.0	.	373;373;374	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	L	373;374;374;373	ENSP00000367986:H373L;ENSP00000418268:H374L;ENSP00000367966:H373L	ENSP00000354945:H374L	H	+	2	0	MCM10	13268189	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.050000	0.93843	2.201000	0.70794	0.459000	0.35465	CAT		0.428	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751		Missense_Mutation
KAT6B	23522	broad.mit.edu	37	10	76790646	76790646	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:76790646C>T	ENST00000287239.4	+	18	6553	c.6064C>T	c.(6064-6066)Cag>Tag	p.Q2022*	KAT6B_ENST00000372724.1_Nonsense_Mutation_p.Q1730*|KAT6B_ENST00000372714.1_Nonsense_Mutation_p.Q1730*|KAT6B_ENST00000372711.1_Nonsense_Mutation_p.Q1839*|KAT6B_ENST00000372725.1_Nonsense_Mutation_p.Q1730*	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	2022	Interaction with RUNX1 and RUNX2.|Met-rich.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q2022*(1)									ATACCCTATGCAGATGCAGAT	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	10											95.0	90.0	91.0					10																	76790646		2203	4300	6503	76460652	SO:0001587	stop_gained	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.6064C>T	10.37:g.76790646C>T	ENSP00000287239:p.Gln2022*	Unknown		x	x	x	76460652	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Nonsense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	45	11.434457	0.99560	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	.	.	.	5.82	5.82	0.92795	.	0.000000	0.47455	D	0.000224	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.8145	20.0836	0.97793	0.0:1.0:0.0:0.0	.	.	.	.	X	1730;1730;2022;1730;1839	.	ENSP00000287239:Q2022X	Q	+	1	0	KAT6B	76460652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.336000	0.79245	2.751000	0.94390	0.655000	0.94253	CAG		0.547	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		Nonsense_Mutation
ANKRD2	26287	broad.mit.edu	37	10	99343396	99343396	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:99343396C>A	ENST00000307518.5	+	9	1264	c.997C>A	c.(997-999)Cat>Aat	p.H333N	HOGA1_ENST00000370647.4_5'Flank|ANKRD2_ENST00000370655.1_Missense_Mutation_p.H306N|HOGA1_ENST00000370646.4_5'Flank|ANKRD2_ENST00000298808.5_Missense_Mutation_p.H300N|ANKRD2_ENST00000455090.1_Missense_Mutation_p.H273N|PI4K2A_ENST00000555577.1_5'Flank|PI4K2A_ENST00000370649.3_5'Flank			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	333					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)	p.H333N(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		CGCCCTGGAGCATCCTGAGCC	0.682																																																1	Substitution - Missense(1)	ovary(1)	10											20.0	19.0	19.0					10																	99343396		2200	4298	6498	99333386	SO:0001583	missense	26287			AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.997C>A	10.37:g.99343396C>A	ENSP00000306163:p.His333Asn	Unknown		x	x	x	99333386	Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Missense_Mutation	SNP	ENST00000307518.5	37	CCDS7466.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	12.38	1.921133	0.33908	.	.	ENSG00000165887	ENST00000307518;ENST00000298808;ENST00000370655;ENST00000455090	T;T;T;T	0.50548	0.97;0.76;0.92;0.74	5.6	3.62	0.41486	.	0.484315	0.21167	N	0.079054	T	0.32315	0.0825	L	0.27053	0.805	0.29001	N	0.88745	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.16100	-1.0414	10	0.22706	T	0.39	-14.6895	11.1306	0.48345	0.4399:0.5601:0.0:0.0	.	300;333	Q9GZV1-2;Q9GZV1	.;ANKR2_HUMAN	N	333;300;306;273	ENSP00000306163:H333N;ENSP00000298808:H300N;ENSP00000359689:H306N;ENSP00000403114:H273N	ENSP00000298808:H300N	H	+	1	0	ANKRD2	99333386	0.725000	0.28048	0.997000	0.53966	0.807000	0.45602	0.759000	0.26461	1.363000	0.46019	0.561000	0.74099	CAT		0.682	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
KAZALD1	81621	broad.mit.edu	37	10	102822665	102822665	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:102822665C>G	ENST00000370200.5	+	2	642	c.316C>G	c.(316-318)Ctt>Gtt	p.L106V	RP11-108L7.15_ENST00000609242.1_lincRNA	NM_030929.4	NP_112191.2	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	106	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|regulation of cell growth (GO:0001558)	interstitial matrix (GO:0005614)		p.L106V(1)		endometrium(1)|ovary(1)|prostate(2)	4				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		CGGCGAGCAGCTTGAGTGCCG	0.697																																																1	Substitution - Missense(1)	ovary(1)	10											16.0	16.0	16.0					10																	102822665		2179	4258	6437	102812655	SO:0001583	missense	81621			AF333487	CCDS7509.1	10q24.32	2013-01-11	2005-08-17		ENSG00000107821	ENSG00000107821		"""Immunoglobulin superfamily / I-set domain containing"""	25460	protein-coding gene	gene with protein product		609208	"""Kazal-type serine protease inhibitor domain 1"""			12975309	Standard	NM_030929		Approved	FKSG40, FKSG28	uc001ksr.3	Q96I82	OTTHUMG00000018918	ENST00000370200.5:c.316C>G	10.37:g.102822665C>G	ENSP00000359219:p.Leu106Val	Unknown		x	x	x	102812655	D3DR74|Q6ZMB1|Q9BQ73	Missense_Mutation	SNP	ENST00000370200.5	37	CCDS7509.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.384390	0.82792	.	.	ENSG00000107821	ENST00000313664;ENST00000370200	T	0.77877	-1.13	5.14	5.14	0.70334	Insulin-like growth factor-binding protein, IGFBP (2);	0.134854	0.52532	D	0.000063	D	0.89389	0.6701	M	0.93854	3.465	0.50632	D	0.99988	D	0.69078	0.997	D	0.71184	0.972	D	0.90899	0.4767	10	0.87932	D	0	-8.9899	9.4002	0.38428	0.0:0.8409:0.0:0.1591	.	106	Q96I82	KAZD1_HUMAN	V	106	ENSP00000359219:L106V	ENSP00000313288:L106V	L	+	1	0	KAZALD1	102812655	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.280000	0.51677	2.408000	0.81797	0.555000	0.69702	CTT		0.697	KAZALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049891.2	NM_030929		Missense_Mutation
JAKMIP3	282973	broad.mit.edu	37	10	133967308	133967308	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:133967308A>G	ENST00000298622.4	+	17	2251	c.2113A>G	c.(2113-2115)Atg>Gtg	p.M705V	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	705						Golgi apparatus (GO:0005794)		p.M705V(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GCAGCGGAAGATGGTGGATCT	0.632																																																1	Substitution - Missense(1)	ovary(1)	10											126.0	131.0	130.0					10																	133967308		2203	4300	6503	133817298	SO:0001583	missense	282973			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.2113A>G	10.37:g.133967308A>G	ENSP00000298622:p.Met705Val	Unknown		x	x	x	133817298	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	18.20	3.572033	0.65765	.	.	ENSG00000188385	ENST00000298622	T	0.25414	1.8	4.76	4.76	0.60689	.	.	.	.	.	T	0.45418	0.1341	M	0.65975	2.015	0.46437	D	0.999048	D;P	0.61697	0.99;0.954	D;D	0.72982	0.979;0.943	T	0.35500	-0.9786	9	0.14656	T	0.56	.	14.2913	0.66281	1.0:0.0:0.0:0.0	.	142;705	Q5VZ66-2;Q5VZ66	.;JKIP3_HUMAN	V	705	ENSP00000298622:M705V	ENSP00000298622:M705V	M	+	1	0	JAKMIP3	133817298	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.759000	0.91667	1.772000	0.52199	0.477000	0.44152	ATG		0.632	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303		Missense_Mutation
SLC22A18	5002	broad.mit.edu	37	11	2946407	2946407	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:2946407A>T	ENST00000380574.1	+	11	1686	c.1255A>T	c.(1255-1257)Agg>Tgg	p.R419W	SLC22A18_ENST00000441077.1_3'UTR|SLC22A18_ENST00000449793.2_Missense_Mutation_p.R321W|SLC22A18_ENST00000347936.2_Missense_Mutation_p.R419W|SLC22A18_ENST00000312221.5_Missense_Mutation_p.R419W			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	419					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)	p.R419W(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		TATGCCCCAGAGGAAGGACAA	0.582																																																1	Substitution - Missense(1)	ovary(1)	11											73.0	63.0	66.0					11																	2946407		2202	4299	6501	2902983	SO:0001583	missense	5002			AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.1255A>T	11.37:g.2946407A>T	ENSP00000369948:p.Arg419Trp	Unknown		x	x	x	2902983	O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Missense_Mutation	SNP	ENST00000380574.1	37	CCDS7740.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	16.81	3.225576	0.58668	.	.	ENSG00000110628	ENST00000347936;ENST00000312221;ENST00000449793;ENST00000380574	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	4.65	-0.429	0.12303	Major facilitator superfamily domain, general substrate transporter (1);	0.927475	0.09025	N	0.859547	D	0.82277	0.5002	L	0.29908	0.895	0.09310	N	1	D;D	0.63880	0.993;0.993	D;P	0.65573	0.936;0.75	T	0.69339	-0.5171	10	0.87932	D	0	-11.6071	4.8757	0.13655	0.6114:0.1478:0.2408:0.0	.	321;419	E9PRM7;Q96BI1	.;S22AI_HUMAN	W	419;419;321;419	ENSP00000307859:R419W;ENSP00000311139:R419W;ENSP00000392072:R321W;ENSP00000369948:R419W	ENSP00000311139:R419W	R	+	1	2	SLC22A18	2902983	0.000000	0.05858	0.001000	0.08648	0.092000	0.18411	1.040000	0.30278	-0.104000	0.12154	-0.375000	0.07067	AGG		0.582	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027770.1	NM_183233		Missense_Mutation
RRP8	23378	broad.mit.edu	37	11	6624670	6624670	+	Silent	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:6624670G>T	ENST00000254605.6	-	1	180	c.63C>A	c.(61-63)atC>atA	p.I21I	ILK_ENST00000299421.4_5'Flank|RRP8_ENST00000534343.1_Silent_p.I21I|ILK_ENST00000537806.1_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000396751.2_5'Flank|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000420936.2_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	21					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.I21I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						GAGGTCGTGAGATTACGGGCC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	11											17.0	19.0	18.0					11																	6624670		2196	4288	6484	6581246	SO:0001819	synonymous_variant	23378			AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.63C>A	11.37:g.6624670G>T		Unknown		x	x	x	6581246	Q7KZ78|Q9BVM6	Silent	SNP	ENST00000254605.6	37	CCDS31411.1	SNP	33	Broad																																																																																				0.662	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324		Silent
GAL3ST3	89792	broad.mit.edu	37	11	65811060	65811060	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:65811060G>A	ENST00000312006.4	-	3	495	c.214C>T	c.(214-216)Cac>Tac	p.H72Y	GAL3ST3_ENST00000527878.1_Missense_Mutation_p.H72Y	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	72					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.H72Y(1)		kidney(1)|lung(9)|ovary(2)|skin(2)	14						GCCGTCTTGTGAGTCTTCAGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	11											34.0	28.0	30.0					11																	65811060		2197	4294	6491	65567636	SO:0001583	missense	89792			AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.214C>T	11.37:g.65811060G>A	ENSP00000308591:p.His72Tyr	Unknown		x	x	x	65567636	Q14D05	Missense_Mutation	SNP	ENST00000312006.4	37	CCDS8128.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965584	0.74131	.	.	ENSG00000175229	ENST00000312006;ENST00000527878	T;T	0.24151	1.87;1.87	3.97	3.97	0.46021	.	0.000000	0.64402	D	0.000001	T	0.54806	0.1881	M	0.86343	2.81	0.53688	D	0.999975	D	0.76494	0.999	D	0.83275	0.996	T	0.62886	-0.6759	10	0.56958	D	0.05	-48.6667	13.9368	0.64029	0.0:0.0:1.0:0.0	.	72	Q96A11	G3ST3_HUMAN	Y	72	ENSP00000308591:H72Y;ENSP00000434829:H72Y	ENSP00000308591:H72Y	H	-	1	0	GAL3ST3	65567636	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.601000	0.98297	2.213000	0.71641	0.462000	0.41574	CAC		0.647	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036		Missense_Mutation
TCIRG1	10312	broad.mit.edu	37	11	67816658	67816658	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:67816658T>C	ENST00000265686.3	+	15	1892	c.1784T>C	c.(1783-1785)gTc>gCc	p.V595A	RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000532635.1_Missense_Mutation_p.V379A|RP11-802E16.3_ENST00000526897.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	595					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.V595A(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TGGCTGTGTGTCTGGGCTGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	94.0	97.0					11																	67816658		2200	4294	6494	67573234	SO:0001583	missense	10312			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1784T>C	11.37:g.67816658T>C	ENSP00000265686:p.Val595Ala	Unknown		x	x	x	67573234	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	6.795	0.515615	0.12944	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.85556	-2.0;-2.0	4.53	2.13	0.27403	.	1.017750	0.07831	N	0.961389	T	0.70780	0.3263	N	0.03930	-0.32	0.09310	N	1	B	0.20368	0.044	B	0.25987	0.065	T	0.60454	-0.7260	10	0.54805	T	0.06	-6.36	9.0026	0.36092	0.2783:0.0:0.0:0.7217	.	595	Q13488	VPP3_HUMAN	A	595;379	ENSP00000265686:V595A;ENSP00000434407:V379A	ENSP00000265686:V595A	V	+	2	0	TCIRG1	67573234	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.350000	0.20079	0.243000	0.21327	0.454000	0.30748	GTC		0.622	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019		Missense_Mutation
CCDC90B	60492	broad.mit.edu	37	11	82997014	82997014	+	Start_Codon_SNP	SNP	A	A	G	rs567031875		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:82997014A>G	ENST00000529689.1	-	1	436	c.2T>C	c.(1-3)aTg>aCg	p.M1T	CCDC90B_ENST00000529073.1_Start_Codon_SNP_p.M1T|CCDC90B_ENST00000455220.2_Intron|CCDC90B_ENST00000529611.1_5'UTR|CCDC90B_ENST00000525503.1_5'UTR|RP11-727A23.10_ENST00000530045.1_RNA|RP11-727A23.10_ENST00000534572.1_RNA			Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B	1						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.M1T(1)		kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Acute lymphoblastic leukemia(157;0.103)				GCGACTATTCATGTCCTCAGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											19.0	20.0	20.0					11																	82997014		2203	4300	6503	82674662	SO:0001582	initiator_codon_variant	60492			BC048795	CCDS8266.1, CCDS66190.1, CCDS66191.1	11q14.1	2006-10-23			ENSG00000137500	ENSG00000137500			28108	protein-coding gene	gene with protein product						11230166	Standard	XM_005274154		Approved	MDS025, MDS011	uc001pae.3	Q9GZT6	OTTHUMG00000167078	ENST00000529689.1:c.2T>C	11.37:g.82997014A>G	ENSP00000434724:p.Met1Thr	Unknown		x	x	x	82674662	A8K8I4|B3KP87|B4E3L2|Q3B781|Q9GZU6	Missense_Mutation	SNP	ENST00000529689.1	37	CCDS8266.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181077	0.57800	.	.	ENSG00000137500	ENST00000529689;ENST00000529073	T;T	0.35789	1.45;1.29	5.47	4.31	0.51392	.	0.220531	0.42821	N	0.000657	T	0.21881	0.0527	.	.	.	0.80722	D	1	B	0.33694	0.421	B	0.26770	0.073	T	0.04946	-1.0916	8	.	.	.	-8.8812	8.7623	0.34683	0.8316:0.0:0.0:0.1684	.	1	Q9GZT6	CC90B_HUMAN	T	1	ENSP00000434724:M1T;ENSP00000431523:M1T	.	M	-	2	0	CCDC90B	82674662	0.967000	0.33354	0.089000	0.20774	0.036000	0.12997	2.415000	0.44635	0.970000	0.38263	0.455000	0.32223	ATG		0.597	CCDC90B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392940.2	NM_021825	Missense_Mutation	Missense_Mutation
FOLH1B	219595	broad.mit.edu	37	11	89424196	89424197	+	RNA	DNP	CA	CA	TT			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:89424196_89424197CA>TT	ENST00000532352.1	+	0	1659_1660							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.I283L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TAGCCAATTCCATAGTGCTCCC	0.381																																																1	Substitution - Missense(1)	ovary(1)	11																																								89063845			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376	Exception_encountered	11.37:g.89424196_89424197delinsTT		Unknown		x	x	x	89063844		Missense_Mutation	DNP	ENST00000532352.1	37		DNP	21	Broad																																																																																				0.381	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		Missense_Mutation
PHLDB1	23187	broad.mit.edu	37	11	118531350	118531350	+	IGR	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:118531350T>G	ENST00000361417.2	+	0	5753				TREH_ENST00000397925.1_Missense_Mutation_p.N303H|TREH_ENST00000525958.1_Missense_Mutation_p.N303H|TREH_ENST00000264029.4_Missense_Mutation_p.N334H|TREH_ENST00000530256.1_Missense_Mutation_p.N211H|TREH_ENST00000529101.1_Missense_Mutation_p.N334H	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1									p.N334H(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CTAAGCGAGTTGGGGTTTGGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	11											49.0	54.0	53.0					11																	118531350		2075	4212	6287	118036560	SO:0001628	intergenic_variant	11181				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341		11.37:g.118531350T>G		Unknown		x	x	x	118036560	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	7.265	0.606037	0.14002	.	.	ENSG00000118094	ENST00000529101;ENST00000530256;ENST00000264029;ENST00000450700;ENST00000525958;ENST00000397925	T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93	4.42	0.65	0.17812	Six-hairpin glycosidase-like (1);	0.581631	0.19931	N	0.102859	T	0.14614	0.0353	.	.	.	0.09310	N	1	B;B;B	0.15473	0.013;0.001;0.0	B;B;B	0.12156	0.007;0.001;0.001	T	0.15723	-1.0427	9	0.45353	T	0.12	-9.7217	3.839	0.08906	0.1877:0.4575:0.0:0.3548	.	303;211;334	E9PNA2;E9PPK1;O43280	.;.;TREA_HUMAN	H	334;211;334;211;303;303	ENSP00000435095:N334H;ENSP00000432640:N211H;ENSP00000264029:N334H;ENSP00000432853:N303H;ENSP00000381020:N303H	ENSP00000264029:N334H	N	-	1	0	TREH	118036560	0.000000	0.05858	0.002000	0.10522	0.076000	0.17211	-0.054000	0.11826	0.007000	0.14760	0.533000	0.62120	AAC		0.577	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157		Missense_Mutation
SORL1	6653	broad.mit.edu	37	11	121391494	121391494	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:121391494G>C	ENST00000260197.7	+	9	1469	c.1340G>C	c.(1339-1341)gGg>gCg	p.G447A	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	447					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TTTGACAAAGGGGGAACCTGG	0.418																																																0			11											68.0	70.0	69.0					11																	121391494		2203	4299	6502	120896704	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1340G>C	11.37:g.121391494G>C	ENSP00000260197:p.Gly447Ala	Unknown		x	x	x	120896704	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019555	0.93462	.	.	ENSG00000137642	ENST00000260197	T	0.45276	0.9	5.55	5.55	0.83447	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.73682	0.3618	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79864	-0.1623	10	0.87932	D	0	.	19.5142	0.95155	0.0:0.0:1.0:0.0	.	447	Q92673	SORL_HUMAN	A	447	ENSP00000260197:G447A	ENSP00000260197:G447A	G	+	2	0	SORL1	120896704	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.555000	0.98123	2.604000	0.88044	0.467000	0.42956	GGG		0.418	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		Missense_Mutation
GPRC5D	55507	broad.mit.edu	37	12	13103173	13103173	+	Missense_Mutation	SNP	C	C	A	rs374734710		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:13103173C>A	ENST00000228887.1	-	1	145	c.146G>T	c.(145-147)cGa>cTa	p.R49L	RP11-392P7.6_ENST00000545914.1_RNA|RP11-392P7.6_ENST00000543515.2_RNA|GPRC5D_ENST00000396333.3_Missense_Mutation_p.R49L|RP11-392P7.6_ENST00000540198.1_RNA|RP11-392P7.6_ENST00000394742.3_RNA|RP11-392P7.6_ENST00000538231.1_RNA|RP11-392P7.6_ENST00000536029.1_RNA|RP11-392P7.6_ENST00000542078.1_RNA	NM_018654.1	NP_061124.1	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, class C, group 5, member D	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R49Q(1)|p.R49L(1)		kidney(2)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		TTGGATCTTTCGCATGAGGAA	0.552																																																2	Substitution - Missense(2)	urinary_tract(1)|ovary(1)	12											82.0	76.0	78.0					12																	13103173		2203	4300	6503	12994440	SO:0001583	missense	55507			AF209923	CCDS8658.1	12p13.3	2014-01-30	2014-01-30		ENSG00000111291	ENSG00000111291		"""GPCR / Class C : Orphans"""	13310	protein-coding gene	gene with protein product		607437	"""G protein-coupled receptor, family C, group 5, member D"""				Standard	XM_005253421		Approved		uc010shp.2	Q9NZD1	OTTHUMG00000168711	ENST00000228887.1:c.146G>T	12.37:g.13103173C>A	ENSP00000228887:p.Arg49Leu	Unknown		x	x	x	12994440	Q3KNV3|Q7Z5J9|Q8TDS6	Missense_Mutation	SNP	ENST00000228887.1	37	CCDS8658.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927170	0.52759	.	.	ENSG00000111291	ENST00000228887;ENST00000396333;ENST00000541128	D;D;D	0.89939	-2.59;-2.59;-2.59	6.17	5.11	0.69529	GPCR, family 3, C-terminal (1);	0.397760	0.23652	N	0.045910	D	0.83450	0.5257	L	0.50333	1.59	0.25729	N	0.985282	P	0.39920	0.695	B	0.36504	0.226	T	0.73767	-0.3879	10	0.15952	T	0.53	.	11.8554	0.52435	0.0:0.8012:0.126:0.0728	.	49	Q9NZD1	GPC5D_HUMAN	L	49	ENSP00000228887:R49L;ENSP00000379624:R49L;ENSP00000440530:R49L	ENSP00000228887:R49L	R	-	2	0	GPRC5D	12994440	0.062000	0.20869	1.000000	0.80357	0.981000	0.71138	1.509000	0.35780	2.941000	0.99782	0.655000	0.94253	CGA		0.552	GPRC5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400687.1			Missense_Mutation
ENDOU	8909	broad.mit.edu	37	12	48111941	48111941	+	Missense_Mutation	SNP	T	T	C	rs6505	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:48111941T>C	ENST00000422538.3	-	3	337	c.215A>G	c.(214-216)gAg>gGg	p.E72G	RP1-197B17.3_ENST00000547799.1_lincRNA|ENDOU_ENST00000542202.1_5'Flank|ENDOU_ENST00000229003.3_Missense_Mutation_p.E31G|ENDOU_ENST00000545824.2_Intron	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	72			E -> Q (in dbSNP:rs6504).|E -> V (in dbSNP:rs6505).		female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						TGTCTCTTCCTCCAGCTGTGG	0.552											OREG0021752	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			12											80.0	70.0	73.0					12																	48111941		2202	4298	6500	46398208	SO:0001583	missense	8909			M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.215A>G	12.37:g.48111941T>C	ENSP00000397679:p.Glu72Gly	Unknown	952	x	x	x	46398208	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Missense_Mutation	SNP	ENST00000422538.3	37	CCDS53785.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	29.0	4.966661	0.92855	.	.	ENSG00000111405	ENST00000229003;ENST00000422538	T;T	0.33216	1.42;1.46	4.93	3.77	0.43336	.	0.257807	0.33875	N	0.004465	T	0.26629	0.0651	L	0.53249	1.67	0.80722	D	1	B;B	0.12630	0.004;0.006	B;B	0.16722	0.007;0.016	T	0.06373	-1.0830	10	0.36615	T	0.2	-18.1495	7.3694	0.26792	0.0:0.0988:0.0:0.9012	.	72;31	P21128;P21128-2	ENDOU_HUMAN;.	G	31;72	ENSP00000229003:E31G;ENSP00000397679:E72G	ENSP00000229003:E31G	E	-	2	0	ENDOU	46398208	0.990000	0.36364	0.998000	0.56505	0.929000	0.56500	2.547000	0.45786	1.009000	0.39289	0.533000	0.62120	GAG		0.552	ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000405352.1	NM_006025.2		Missense_Mutation
ATF1	466	broad.mit.edu	37	12	51208193	51208193	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:51208193G>C	ENST00000262053.3	+	6	664	c.642G>C	c.(640-642)ttG>ttC	p.L214F	ATF1_ENST00000539132.1_Missense_Mutation_p.L79F	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	214	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	ACCCCCAATTGAAAAGAGAAA	0.398			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																		Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	0			12											73.0	67.0	69.0					12																	51208193		2203	4300	6503	49494460	SO:0001583	missense	466			BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.642G>C	12.37:g.51208193G>C	ENSP00000262053:p.Leu214Phe	Unknown		x	x	x	49494460	B4DRF9|P25168|Q9H4A8	Missense_Mutation	SNP	ENST00000262053.3	37	CCDS8803.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468026	0.63625	.	.	ENSG00000123268	ENST00000262053;ENST00000539132	T;T	0.60299	0.2;0.2	5.07	-0.381	0.12485	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.252110	0.38959	N	0.001510	T	0.52041	0.1710	M	0.73372	2.23	0.49483	D	0.999792	P	0.47841	0.901	P	0.45276	0.475	T	0.49698	-0.8912	10	0.66056	D	0.02	-32.9828	3.8561	0.08976	0.1909:0.1131:0.5796:0.1164	.	214	P18846	ATF1_HUMAN	F	214;79	ENSP00000262053:L214F;ENSP00000438403:L79F	ENSP00000262053:L214F	L	+	3	2	ATF1	49494460	1.000000	0.71417	0.792000	0.32020	0.975000	0.68041	2.053000	0.41326	0.013000	0.14918	0.655000	0.94253	TTG		0.398	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404285.1	NM_005171		Missense_Mutation
ERBB3	2065	broad.mit.edu	37	12	56477599	56477599	+	Silent	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:56477599G>T	ENST00000267101.3	+	2	587	c.147G>T	c.(145-147)ctG>ctT	p.L49L	ERBB3_ENST00000411731.2_Silent_p.L49L|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_5'UTR	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	49					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.L49L(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ACCAGACACTGTACAAGCTCT	0.557																																																1	Substitution - coding silent(1)	ovary(1)	12											306.0	247.0	267.0					12																	56477599		2203	4300	6503	54763866	SO:0001819	synonymous_variant	2065			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.147G>T	12.37:g.56477599G>T		Unknown		x	x	x	54763866	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	37	CCDS31833.1	SNP	48	Broad																																																																																				0.557	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3			Silent
UHRF1BP1L	23074	broad.mit.edu	37	12	100497705	100497705	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:100497705G>A	ENST00000279907.7	-	3	444	c.232C>T	c.(232-234)Cat>Tat	p.H78Y	UHRF1BP1L_ENST00000356828.3_Missense_Mutation_p.H78Y	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	78								p.H78Y(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						CAGATGGGATGTGTTTTCAGT	0.279																																																2	Substitution - Missense(2)	ovary(2)	12											77.0	82.0	80.0					12																	100497705		2203	4294	6497	99021836	SO:0001583	missense	23074				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.232C>T	12.37:g.100497705G>A	ENSP00000279907:p.His78Tyr	Unknown		x	x	x	99021836	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	CCDS31882.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	28.2	4.895339	0.91962	.	.	ENSG00000111647	ENST00000279907;ENST00000356828	D;D	0.82344	-1.6;-1.6	5.52	5.52	0.82312	.	0.103647	0.64402	D	0.000003	D	0.90521	0.7030	M	0.73598	2.24	0.80722	D	1	B;D	0.54601	0.435;0.967	B;P	0.62382	0.248;0.901	D	0.91227	0.5011	10	0.87932	D	0	-6.1829	19.437	0.94799	0.0:0.0:1.0:0.0	.	78;78	A0JNW5-2;A0JNW5	.;UH1BL_HUMAN	Y	78	ENSP00000279907:H78Y;ENSP00000349285:H78Y	ENSP00000279907:H78Y	H	-	1	0	UHRF1BP1L	99021836	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.681000	0.84073	2.587000	0.87381	0.591000	0.81541	CAT		0.279	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947		Missense_Mutation
TCHP	84260	broad.mit.edu	37	12	110352317	110352317	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:110352317T>C	ENST00000312777.5	+	11	1419	c.1205T>C	c.(1204-1206)cTg>cCg	p.L402P	TCHP_ENST00000405876.4_Missense_Mutation_p.L402P	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding									p.L402P(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						GAGGAATCCCTGAAACACAGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	96.0	96.0					12																	110352317		2203	4300	6503	108836700	SO:0001583	missense	84260			AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.1205T>C	12.37:g.110352317T>C	ENSP00000324404:p.Leu402Pro	Unknown		x	x	x	108836700		Missense_Mutation	SNP	ENST00000312777.5	37	CCDS9137.1	SNP	55	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.3|23.3	4.398974|4.398974	0.83120|0.83120	.|.	.|.	ENSG00000139437|ENSG00000139437	ENST00000405876;ENST00000312777;ENST00000551627|ENST00000536868	T;T|.	0.09723|.	2.95;2.95|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.178796|.	0.37761|.	N|.	0.001954|.	T|.	0.72447|.	0.3461|.	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.76071|.	0.987|.	T|.	0.72874|.	-0.4160|.	10|.	0.30078|.	T|.	0.28|.	-6.0648|-6.0648	13.4414|13.4414	0.61114|0.61114	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	402|.	Q9BT92|.	TCHP_HUMAN|.	P|R	402;402;46|221	ENSP00000384520:L402P;ENSP00000324404:L402P|.	ENSP00000324404:L402P|.	L|X	+|+	2|1	0|0	TCHP|TCHP	108836700|108836700	0.911000|0.911000	0.30947|0.30947	0.913000|0.913000	0.36048|0.36048	0.977000|0.977000	0.68977|0.68977	6.527000|6.527000	0.73803|0.73803	2.070000|2.070000	0.61991|0.61991	0.533000|0.533000	0.62120|0.62120	CTG|TGA		0.493	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403289.1	NM_032300		Missense_Mutation
DHX37	57647	broad.mit.edu	37	12	125451341	125451341	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr12:125451341C>T	ENST00000308736.2	-	12	1686	c.1588G>A	c.(1588-1590)Gag>Aag	p.E530K	DHX37_ENST00000544745.1_Missense_Mutation_p.E317K	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	530	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.E530K(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CCACGTACCTCAGCCCGCGCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	12											87.0	83.0	85.0					12																	125451341		2203	4300	6503	124017294	SO:0001583	missense	57647			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1588G>A	12.37:g.125451341C>T	ENSP00000311135:p.Glu530Lys	Unknown		x	x	x	124017294	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	1.990	-0.431914	0.04669	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.03301	4.05;3.98	4.3	0.229	0.15368	Helicase, C-terminal (1);	1.727270	0.02914	N	0.137056	T	0.01800	0.0057	N	0.02960	-0.455	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41016	-0.9532	10	0.06625	T	0.88	-19.5053	6.7383	0.23421	0.0:0.5513:0.0:0.4487	.	530	Q8IY37	DHX37_HUMAN	K	530;317	ENSP00000311135:E530K;ENSP00000439009:E317K	ENSP00000311135:E530K	E	-	1	0	DHX37	124017294	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.355000	0.07671	-0.056000	0.13221	0.651000	0.88453	GAG		0.572	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656		Missense_Mutation
ATP8A2	51761	broad.mit.edu	37	13	26153012	26153012	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr13:26153012C>T	ENST00000381655.2	+	21	1984	c.1842C>T	c.(1840-1842)tgC>tgT	p.C614C	ATP8A2_ENST00000491840.1_3'UTR|ATP8A2_ENST00000255283.8_Silent_p.C574C	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	574					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AAACATTATGCCATCTGGAAT	0.388																																																0			13											136.0	131.0	133.0					13																	26153012		1880	4116	5996	25051012	SO:0001819	synonymous_variant	51761			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1842C>T	13.37:g.26153012C>T		Unknown		x	x	x	25051012	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	37	CCDS41873.1	SNP	26	Broad																																																																																				0.388	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		Silent
RNASE1	6035	broad.mit.edu	37	14	21269805	21269805	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr14:21269805G>T	ENST00000397967.4	-	2	929	c.423C>A	c.(421-423)agC>agA	p.S141R	RNASE1_ENST00000412779.2_Missense_Mutation_p.S141R|RNASE1_ENST00000555698.1_Missense_Mutation_p.S101R|RNASE1_ENST00000340900.3_Missense_Mutation_p.S141R|RNASE1_ENST00000397970.4_Missense_Mutation_p.S141R	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	141					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)	p.S141R(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	GCACATATGGGCTCCCTTCAC	0.562																																																1	Substitution - Missense(1)	ovary(1)	14											149.0	130.0	136.0					14																	21269805		2203	4300	6503	20339645	SO:0001583	missense	6035			BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.423C>A	14.37:g.21269805G>T	ENSP00000381057:p.Ser141Arg	Unknown		x	x	x	20339645	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Missense_Mutation	SNP	ENST00000397967.4	37	CCDS9559.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913948	0.33815	.	.	ENSG00000129538	ENST00000397967;ENST00000340900;ENST00000412779;ENST00000555698;ENST00000397970	T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6	5.21	-1.64	0.08318	Ribonuclease A, domain (4);	0.695263	0.13587	N	0.376899	T	0.64681	0.2620	L	0.50919	1.6	0.09310	N	1	B	0.32604	0.377	B	0.41764	0.366	T	0.61053	-0.7140	10	0.72032	D	0.01	-16.624	5.4588	0.16606	0.1584:0.0:0.3455:0.4962	.	141	P07998	RNAS1_HUMAN	R	141;141;141;101;141	ENSP00000381057:S141R;ENSP00000344193:S141R;ENSP00000399493:S141R;ENSP00000451058:S101R;ENSP00000381060:S141R	ENSP00000344193:S141R	S	-	3	2	RNASE1	20339645	0.000000	0.05858	0.000000	0.03702	0.195000	0.23768	-0.150000	0.10189	-0.152000	0.11156	0.650000	0.86243	AGC		0.562	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3			Missense_Mutation
RAB2B	84932	broad.mit.edu	37	14	21936873	21936873	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr14:21936873G>T	ENST00000397762.1	-	4	325	c.225C>A	c.(223-225)taC>taA	p.Y75*	RAB2B_ENST00000461909.1_5'UTR	NM_001163380.1|NM_032846.3	NP_001156852.1|NP_116235.2	Q8WUD1	RAB2B_HUMAN	RAB2B, member RAS oncogene family	75					positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			NS(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6	all_cancers(95;0.000858)		Epithelial(56;1.53e-06)|all cancers(55;1.44e-05)	GBM - Glioblastoma multiforme(265;0.00391)		CTCCCCTGTAGTAGGAACGGG	0.493																																					Melanoma(131;1007 1750 28652 34486 42672)											0			14											97.0	89.0	92.0					14																	21936873		2203	4300	6503	21006713	SO:0001587	stop_gained	84932			AK027730	CCDS9570.1	14q11.1	2006-12-18			ENSG00000129472	ENSG00000129472		"""RAB, member RAS oncogene"""	20246	protein-coding gene	gene with protein product		607466				12376746	Standard	NM_032846		Approved	FLJ14824	uc010tlt.2	Q8WUD1	OTTHUMG00000029693	ENST00000397762.1:c.225C>A	14.37:g.21936873G>T	ENSP00000380869:p.Tyr75*	Unknown		x	x	x	21006713	B2RD03|D3DS24|Q6NZ33	Nonsense_Mutation	SNP	ENST00000397762.1	37	CCDS9570.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.382509	0.95967	.	.	ENSG00000129472	ENST00000397762;ENST00000304034	.	.	.	5.81	4.92	0.64577	.	0.000000	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.861	0.41114	0.157:0.0:0.843:0.0	.	.	.	.	X	75	.	ENSP00000302005:Y75X	Y	-	3	2	RAB2B	21006713	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.328000	0.59253	1.462000	0.47948	0.655000	0.94253	TAC		0.493	RAB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074053.4			Nonsense_Mutation
MYH6	4624	broad.mit.edu	37	14	23865927	23865927	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr14:23865927G>A	ENST00000356287.3	-	18	2297	c.2268C>T	c.(2266-2268)aaC>aaT	p.N756N	MYH6_ENST00000405093.3_Silent_p.N756N			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	756	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ACTTGTACTGGTTGTGATCAA	0.552																																																0			14											131.0	111.0	118.0					14																	23865927		2203	4300	6503	22935767	SO:0001819	synonymous_variant	4624			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2268C>T	14.37:g.23865927G>A		Unknown		x	x	x	22935767	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	37	CCDS9600.1	SNP	44	Broad																																																																																				0.552	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			Silent
BRF1	2972	broad.mit.edu	37	14	105685549	105685549	+	Silent	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr14:105685549T>C	ENST00000546474.1	-	13	16357	c.1398A>G	c.(1396-1398)gaA>gaG	p.E466E	BRF1_ENST00000551787.1_Intron|BRF1_ENST00000446501.2_Silent_p.E228E|BRF1_ENST00000440513.3_Silent_p.E373E|BRF1_ENST00000379937.2_Silent_p.E439E|BRF1_ENST00000547530.1_5'UTR|BRF1_ENST00000327359.3_Silent_p.E351E|BRF1_ENST00000392557.4_Silent_p.E262E|BRF1_ENST00000549044.1_5'UTR|BRF1_ENST00000379932.4_Intron	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	466					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)	p.E466E(1)		NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TCACGCGGGCTTCCGACTCAT	0.642																																																1	Substitution - coding silent(1)	ovary(1)	14											101.0	91.0	95.0					14																	105685549		2203	4300	6503	104756594	SO:0001819	synonymous_variant	2972			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1398A>G	14.37:g.105685549T>C		Unknown		x	x	x	104756594	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Silent	SNP	ENST00000546474.1	37	CCDS10001.1	SNP	56	Broad																																																																																				0.642	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519		Silent
NPAP1	23742	broad.mit.edu	37	15	24921252	24921252	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr15:24921252G>A	ENST00000329468.2	+	1	712	c.238G>A	c.(238-240)Gcc>Acc	p.A80T		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	80					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A80T(1)									GGCTGCGGCCGCCCCTCTGGG	0.692																																																1	Substitution - Missense(1)	ovary(1)	15																																								22472345	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.238G>A	15.37:g.24921252G>A	ENSP00000333735:p.Ala80Thr	Unknown		x	x	x	22472345		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	.	8.211	0.800259	0.16397	.	.	ENSG00000185823	ENST00000329468	T	0.05580	3.42	2.39	-3.68	0.04463	.	2.447710	0.01778	N	0.031590	T	0.03053	0.0090	N	0.22421	0.69	0.09310	N	1	P	0.40476	0.718	B	0.26969	0.075	T	0.39663	-0.9603	10	0.18710	T	0.47	.	4.0075	0.09608	0.0:0.2837:0.4146:0.3017	.	80	Q9NZP6	CO002_HUMAN	T	80	ENSP00000333735:A80T	ENSP00000333735:A80T	A	+	1	0	C15orf2	22472345	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.119000	0.03276	-0.876000	0.04017	-0.719000	0.03609	GCC		0.692	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		Missense_Mutation
HERC2	8924	broad.mit.edu	37	15	28478853	28478853	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr15:28478853G>A	ENST00000261609.7	-	28	4416	c.4308C>T	c.(4306-4308)gtC>gtT	p.V1436V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.V1436V(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACAAGCGACCGACCTCTTCCA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	15											59.0	54.0	56.0					15																	28478853		2203	4297	6500	26152448	SO:0001819	synonymous_variant	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4308C>T	15.37:g.28478853G>A		Unknown		x	x	x	26152448		Silent	SNP	ENST00000261609.7	37	CCDS10021.1	SNP	37	Broad																																																																																				0.458	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		Silent
PIGB	9488	broad.mit.edu	37	15	55632898	55632899	+	Nonsense_Mutation	DNP	TC	TC	GA			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr15:55632898_55632899TC>GA	ENST00000164305.5	+	8	1226_1227	c.935_936TC>GA	c.(934-936)tTC>tGA	p.F312*	PIGB_ENST00000539642.1_Nonsense_Mutation_p.F117*|CCPG1_ENST00000563294.1_Intron	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	312					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)	p.F312*(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		CACTGGTACTTCAGTCAAGGAT	0.426																																																1	Substitution - Nonsense(1)	ovary(1)	15																																								53420191	SO:0001587	stop_gained	9488			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	Exception_encountered	15.37:g.55632898_55632899delinsGA	ENSP00000164305:p.Phe312*	Unknown		x	x	x	53420190	Q53FF9|Q8WVN7	Nonsense_Mutation	DNP	ENST00000164305.5	37		DNP	62	Broad																																																																																				0.426	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855		Nonsense_Mutation
IGDCC3	9543	broad.mit.edu	37	15	65621480	65621480	+	Missense_Mutation	SNP	G	G	T	rs139839494	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr15:65621480G>T	ENST00000327987.4	-	14	2463	c.2212C>A	c.(2212-2214)Cct>Act	p.P738T	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	738					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.P738T(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGGGCTGCAGGATCCTGCTGG	0.662																																																1	Substitution - Missense(1)	ovary(1)	15											14.0	18.0	16.0					15																	65621480		2201	4296	6497	63408533	SO:0001583	missense	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2212C>A	15.37:g.65621480G>T	ENSP00000332773:p.Pro738Thr	Unknown		x	x	x	63408533	O95215	Missense_Mutation	SNP	ENST00000327987.4	37	CCDS10205.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613886	0.28712	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.65916	-0.18	5.58	2.7	0.31948	.	0.239128	0.33895	N	0.004445	T	0.42200	0.1192	N	0.24115	0.695	0.09310	N	1	P	0.44734	0.842	B	0.35114	0.196	T	0.30592	-0.9973	10	0.62326	D	0.03	-10.3763	10.1258	0.42649	0.0:0.2767:0.5787:0.1446	.	738	Q8IVU1	IGDC3_HUMAN	T	738;561	ENSP00000332773:P738T	ENSP00000332773:P738T	P	-	1	0	IGDCC3	63408533	0.017000	0.18338	0.031000	0.17742	0.001000	0.01503	0.555000	0.23422	0.311000	0.23014	-1.983000	0.00453	CCT		0.662	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884		Missense_Mutation
CYP1A1	1543	broad.mit.edu	37	15	75015355	75015356	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr15:75015355_75015356GG>CC	ENST00000379727.3	-	2	281_282	c.83_84CC>GG	c.(82-84)gCC>gGG	p.A28G	CYP1A1_ENST00000395048.2_Missense_Mutation_p.A28G|CYP1A1_ENST00000567032.1_Missense_Mutation_p.A28G|CYP1A1_ENST00000395049.4_Missense_Mutation_p.A28G|CYP1A1_ENST00000564596.1_Intron			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	28					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)	p.A28G(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	GAGGTCTTGAGGCCCTGATTAC	0.554									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																																							1	Substitution - Missense(1)	ovary(1)	15																																								72802409	SO:0001583	missense	1543	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.83_84delinsCC	15.37:g.75015355_75015356delinsCC	ENSP00000369050:p.Ala28Gly	Unknown		x	x	x	72802408	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	DNP	ENST00000379727.3	37	CCDS10268.1	DNP	35	Broad																																																																																				0.554	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	NM_000499		Missense_Mutation
POLR2C	5432	broad.mit.edu	37	16	57503161	57503161	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr16:57503161G>A	ENST00000219252.5	+	5	681	c.343G>A	c.(343-345)Gtc>Atc	p.V115I	POLR2C_ENST00000564651.1_3'UTR	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	115					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						GACGCGACATGTCACGTCTCG	0.582																																																0			16											138.0	115.0	123.0					16																	57503161		2198	4300	6498	56060662	SO:0001583	missense	5432				CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	ENST00000219252.5:c.343G>A	16.37:g.57503161G>A	ENSP00000219252:p.Val115Ile	Unknown		x	x	x	56060662	O15161	Missense_Mutation	SNP	ENST00000219252.5	37	CCDS10782.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162231	0.78226	.	.	ENSG00000102978	ENST00000219252	.	.	.	5.77	5.77	0.91146	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, insert domain (3);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.055577	0.64402	D	0.000001	T	0.79405	0.4440	M	0.75447	2.3	0.80722	D	1	D;B	0.71674	0.998;0.127	D;B	0.91635	0.999;0.2	T	0.79495	-0.1780	9	0.52906	T	0.07	.	17.2149	0.86940	0.0:0.0:1.0:0.0	.	115;115	B7Z377;P19387	.;RPB3_HUMAN	I	115	.	ENSP00000219252:V115I	V	+	1	0	POLR2C	56060662	1.000000	0.71417	0.967000	0.41034	0.476000	0.33039	7.937000	0.87672	2.732000	0.93576	0.650000	0.86243	GTC		0.582	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257340.3	NM_032940		Missense_Mutation
GPR114	221188	broad.mit.edu	37	16	57598948	57598948	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr16:57598948T>G	ENST00000340339.4	+	6	955	c.432T>G	c.(430-432)gaT>gaG	p.D144E	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.D144E	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	144					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D144E(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						CCTTCCAGGATGAAAACAACT	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											99.0	83.0	89.0					16																	57598948		2198	4300	6498	56156449	SO:0001583	missense	221188			AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.432T>G	16.37:g.57598948T>G	ENSP00000342981:p.Asp144Glu	Unknown		x	x	x	56156449	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	37	CCDS10785.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803876	0.50315	.	.	ENSG00000159618	ENST00000394361;ENST00000340339;ENST00000349457	T;T	0.30448	1.53;1.53	4.9	2.59	0.31030	.	0.678925	0.13126	N	0.411836	T	0.22437	0.0541	L	0.50333	1.59	0.28285	N	0.923795	B;P	0.39282	0.224;0.666	B;B	0.31869	0.035;0.137	T	0.19095	-1.0316	10	0.66056	D	0.02	.	4.6593	0.12634	0.176:0.0929:0.0:0.7311	.	144;144	B4E148;Q8IZF4	.;GP114_HUMAN	E	144	ENSP00000342981:D144E;ENSP00000290823:D144E	ENSP00000342981:D144E	D	+	3	2	GPR114	56156449	0.194000	0.23325	0.155000	0.22561	0.892000	0.51952	0.153000	0.16323	0.219000	0.20840	0.397000	0.26171	GAT		0.562	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837		Missense_Mutation
WDR59	79726	broad.mit.edu	37	16	74919598	74919598	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr16:74919598T>C	ENST00000262144.6	-	25	2772	c.2642A>G	c.(2641-2643)gAa>gGa	p.E881G		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	881										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CTTCAACACTTCAGCTCGCTT	0.473																																																0			16											121.0	109.0	113.0					16																	74919598		2198	4300	6498	73477099	SO:0001583	missense	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.2642A>G	16.37:g.74919598T>C	ENSP00000262144:p.Glu881Gly	Unknown		x	x	x	73477099	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	ENST00000262144.6	37	CCDS32488.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	16.39	3.108971	0.56398	.	.	ENSG00000103091	ENST00000262144	T	0.73152	-0.72	5.36	5.36	0.76844	.	0.046742	0.85682	D	0.000000	T	0.78155	0.4239	M	0.77313	2.365	0.80722	D	1	P;P	0.46987	0.888;0.827	P;P	0.49192	0.537;0.602	T	0.81302	-0.0994	10	0.59425	D	0.04	-22.2106	15.3552	0.74421	0.0:0.0:0.0:1.0	.	881;326	Q6PJI9;Q6PJI9-4	WDR59_HUMAN;.	G	881	ENSP00000262144:E881G	ENSP00000262144:E881G	E	-	2	0	WDR59	73477099	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	8.021000	0.88750	2.023000	0.59567	0.459000	0.35465	GAA		0.473	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581		Missense_Mutation
SCARF1	8578	broad.mit.edu	37	17	1551681	1551682	+	5'Flank	DNP	CT	CT	TC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:1551681_1551682CT>TC	ENST00000263071.4	-	0	0				RILP_ENST00000301336.6_Missense_Mutation_p.V262M|SCARF1_ENST00000571272.1_5'Flank|SCARF1_ENST00000348987.3_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.V262M(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGCAGGAACACTTTGGCTTTGA	0.619																																																1	Substitution - Missense(1)	ovary(1)	17																																								1498432	SO:0001631	upstream_gene_variant	83547			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.1_1delinsTC	17.37:g.1551681_1551682delinsTC	Exception_encountered	Unknown		x	x	x	1498431	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	DNP	ENST00000263071.4	37	CCDS11007.1	DNP	20	Broad																																																																																				0.619	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		Missense_Mutation
SCARF1	8578	broad.mit.edu	37	17	1551688	1551688	+	5'Flank	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:1551688T>C	ENST00000263071.4	-	0	0				RILP_ENST00000301336.6_Silent_p.K259K|SCARF1_ENST00000571272.1_5'Flank|SCARF1_ENST00000348987.3_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.K259K(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		ACACTTTGGCTTTGAGTTCAT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	17											58.0	53.0	55.0					17																	1551688		2203	4300	6503	1498438	SO:0001631	upstream_gene_variant	83547			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1551688T>C	Exception_encountered	Unknown		x	x	x	1498438	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Silent	SNP	ENST00000263071.4	37	CCDS11007.1	SNP	56	Broad																																																																																				0.637	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		Silent
KSR1	8844	broad.mit.edu	37	17	25935037	25935037	+	Splice_Site	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:25935037G>T	ENST00000319524.6	+	16	2157		c.e16+1		KSR1_ENST00000509603.2_Splice_Site|KSR1_ENST00000268763.6_Splice_Site|KSR1_ENST00000582410.1_5'Flank|KSR1_ENST00000398988.3_Splice_Site			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1						Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GATCATCAAGGTGAGGGGGTG	0.602																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)											1	Unknown(1)	ovary(1)	17											23.0	24.0	24.0					17																	25935037		2003	4165	6168	22959164	SO:0001630	splice_region_variant	8844			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.2157+1G>T	17.37:g.25935037G>T		Unknown		x	x	x	22959164	F8WEA9|H7BYU0|Q13476	Splice_Site_SNP	SNP	ENST00000319524.6	37		SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079899	0.76528	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982;ENST00000398988	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5915	0.91214	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KSR1	22959164	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	9.699000	0.98703	2.637000	0.89404	0.561000	0.74099	.		0.602	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_014238	Intron	Splice_Site_SNP
GIT1	28964	broad.mit.edu	37	17	27904254	27904254	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:27904254C>T	ENST00000225394.3	-	11	1241	c.993G>A	c.(991-993)aaG>aaA	p.K331K	GIT1_ENST00000581348.1_Silent_p.K340K|GIT1_ENST00000394869.3_Silent_p.K340K|GIT1_ENST00000579937.1_Silent_p.K331K|RP11-68I3.2_ENST00000581474.1_RNA	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	331	ARHGEF6-binding. {ECO:0000250}.|PTK2/FAK1-binding. {ECO:0000250}.				regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.K331K(1)		large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		AGCGGGCCAGCTTTTGTCGCC	0.602																																					Colon(81;41 1719 20078 35068)											1	Substitution - coding silent(1)	ovary(1)	17											69.0	75.0	73.0					17																	27904254		2203	4300	6503	24928380	SO:0001819	synonymous_variant	28964			AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.993G>A	17.37:g.27904254C>T		Unknown		x	x	x	24928380	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Silent	SNP	ENST00000225394.3	37	CCDS11250.1	SNP	28	Broad																																																																																				0.602	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	NM_014030		Silent
SSH2	85464	broad.mit.edu	37	17	27999047	27999047	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:27999047G>C	ENST00000269033.3	-	8	785	c.634C>G	c.(634-636)Cat>Gat	p.H212D	SSH2_ENST00000324677.7_5'Flank|SSH2_ENST00000540801.1_Missense_Mutation_p.H239D|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	212					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.H212D(1)	SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGTTGATATGGCTCTCATAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	17											204.0	174.0	184.0					17																	27999047		2203	4300	6503	25023173	SO:0001583	missense	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.634C>G	17.37:g.27999047G>C	ENSP00000269033:p.His212Asp	Unknown		x	x	x	25023173	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456728	0.63401	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	T;T	0.40476	1.03;1.03	5.67	5.67	0.87782	.	0.053328	0.64402	D	0.000001	T	0.40145	0.1105	L	0.39898	1.24	0.80722	D	1	B;B;B	0.26876	0.162;0.074;0.07	B;B;B	0.28553	0.091;0.062;0.042	T	0.12016	-1.0564	10	0.34782	T	0.22	-11.0918	19.7592	0.96308	0.0:0.0:1.0:0.0	.	239;212;212	F5H527;Q76I76-4;Q76I76	.;.;SSH2_HUMAN	D	212;239;212	ENSP00000269033:H212D;ENSP00000444743:H239D	ENSP00000269033:H212D	H	-	1	0	SSH2	25023173	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.422000	0.66453	2.664000	0.90586	0.514000	0.50259	CAT		0.483	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389		Missense_Mutation
PTRF	284119	broad.mit.edu	37	17	40574886	40574886	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:40574886T>A	ENST00000357037.5	-	1	649	c.230A>T	c.(229-231)gAg>gTg	p.E77V		NM_012232.5	NP_036364.2			polymerase I and transcript release factor									p.E77V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CGCCTGCCGCTCCTCCAGCTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	17											50.0	37.0	41.0					17																	40574886		2202	4300	6502	37828412	SO:0001583	missense	284119			AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.230A>T	17.37:g.40574886T>A	ENSP00000349541:p.Glu77Val	Unknown		x	x	x	37828412		Missense_Mutation	SNP	ENST00000357037.5	37	CCDS11425.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660568	0.67586	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.61040	0.14	5.12	5.12	0.69794	.	0.246105	0.39834	N	0.001242	T	0.53158	0.1779	L	0.48877	1.53	0.54753	D	0.999989	B;P	0.35542	0.355;0.508	B;B	0.36504	0.226;0.171	T	0.56183	-0.8021	10	0.48119	T	0.1	-27.8541	14.9125	0.70770	0.0:0.0:0.0:1.0	.	77;77	B4DNU9;Q6NZI2	.;PTRF_HUMAN	V	77;32	ENSP00000349541:E77V	ENSP00000349541:E77V	E	-	2	0	PTRF	37828412	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.351000	0.59398	1.917000	0.55516	0.454000	0.30748	GAG		0.627	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232		Missense_Mutation
EVPL	2125	broad.mit.edu	37	17	74005992	74005992	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:74005992C>A	ENST00000301607.3	-	22	3547	c.3294G>T	c.(3292-3294)caG>caT	p.Q1098H	EVPL_ENST00000586740.1_Missense_Mutation_p.Q1120H	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1098	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.Q1098H(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCTCCTCCATCTGCAGCCTCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											102.0	96.0	98.0					17																	74005992		2203	4300	6503	71517587	SO:0001583	missense	2125			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3294G>T	17.37:g.74005992C>A	ENSP00000301607:p.Gln1098His	Unknown		x	x	x	71517587	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	8.272	0.813589	0.16537	.	.	ENSG00000167880	ENST00000301607	T	0.52754	0.65	5.17	5.17	0.71159	.	0.309778	0.35466	N	0.003195	T	0.51160	0.1658	M	0.79258	2.445	0.30226	N	0.796356	P;P	0.43287	0.802;0.8	B;B	0.41723	0.346;0.365	T	0.63695	-0.6579	10	0.72032	D	0.01	-24.9479	11.6829	0.51468	0.0:0.8701:0.0:0.1299	.	1120;1098	B7ZLH8;Q92817	.;EVPL_HUMAN	H	1098	ENSP00000301607:Q1098H	ENSP00000301607:Q1098H	Q	-	3	2	EVPL	71517587	0.889000	0.30405	0.372000	0.25991	0.089000	0.18198	0.924000	0.28777	2.419000	0.82065	0.491000	0.48974	CAG		0.602	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988		Missense_Mutation
QRICH2	84074	broad.mit.edu	37	17	74289720	74289720	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:74289720T>C	ENST00000262765.5	-	4	769	c.590A>G	c.(589-591)cAa>cGa	p.Q197R		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	197								p.Q197R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TAAGTCCTGTTGAACTGGACC	0.512																																																1	Substitution - Missense(1)	ovary(1)	17											138.0	105.0	116.0					17																	74289720		2203	4300	6503	71801315	SO:0001583	missense	84074			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.590A>G	17.37:g.74289720T>C	ENSP00000262765:p.Gln197Arg	Unknown		x	x	x	71801315	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	4.259	0.047045	0.08243	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.09538	2.97	3.53	1.25	0.21368	.	.	.	.	.	T	0.09335	0.0230	M	0.66939	2.045	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.15484	0.013;0.007	T	0.47222	-0.9134	9	0.06757	T	0.87	3.3526	3.6931	0.08354	0.0:0.1201:0.2254:0.6545	.	197;197	B5MD94;Q9H0J4	.;QRIC2_HUMAN	R	197	ENSP00000262765:Q197R	ENSP00000262765:Q197R	Q	-	2	0	QRICH2	71801315	0.000000	0.05858	0.004000	0.12327	0.006000	0.05464	-0.741000	0.04855	0.229000	0.21039	-0.460000	0.05396	CAA		0.512	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		Missense_Mutation
UBE2O	63893	broad.mit.edu	37	17	74387129	74387129	+	Silent	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:74387129G>C	ENST00000319380.7	-	18	3838	c.3774C>G	c.(3772-3774)ctC>ctG	p.L1258L		NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	1258					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.L1258L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						AAAGTGGGAAGAGGGGGAAGC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	17											93.0	98.0	96.0					17																	74387129		2203	4300	6503	71898724	SO:0001819	synonymous_variant	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.3774C>G	17.37:g.74387129G>C		Unknown		x	x	x	71898724	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Silent	SNP	ENST00000319380.7	37	CCDS32742.1	SNP	33	Broad																																																																																				0.582	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066		Silent
DNAH17	8632	broad.mit.edu	37	17	76457761	76457761	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:76457761A>C	ENST00000585328.1	-	58	9313	c.9189T>G	c.(9187-9189)atT>atG	p.I3063M	DNAH17_ENST00000389840.5_Missense_Mutation_p.I3054M|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3054	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CAGCCTCCTGAATCGCCAACT	0.577																																																0			17											55.0	45.0	48.0					17																	76457761		2203	4300	6503	73969356	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9189T>G	17.37:g.76457761A>C	ENSP00000465516:p.Ile3063Met	Unknown		x	x	x	73969356	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	6.452	0.451579	0.12223	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.75477	-0.94	4.14	-3.12	0.05282	.	1.158180	0.06537	N	0.742504	T	0.61578	0.2358	L	0.38175	1.15	0.09310	N	1	B	0.19817	0.039	B	0.22386	0.039	T	0.49744	-0.8907	10	0.49607	T	0.09	.	5.9151	0.19050	0.3094:0.398:0.2926:0.0	.	3063	E7EUM8	.	M	3063;3054	ENSP00000374490:I3054M	ENSP00000300671:I3063M	I	-	3	3	DNAH17	73969356	0.000000	0.05858	0.309000	0.25155	0.383000	0.30230	-1.523000	0.02235	-0.776000	0.04578	-0.376000	0.06991	ATT		0.577	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		Missense_Mutation
DNAH17	8632	broad.mit.edu	37	17	76457763	76457764	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:76457763_76457764TC>AG	ENST00000585328.1	-	58	9310_9311	c.9186_9187GA>CT	c.(9184-9189)gcGAtt>gcCTtt	p.I3063F	DNAH17_ENST00000389840.5_Missense_Mutation_p.I3054F|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3054	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I3063F(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCCTCCTGAATCGCCAACTTGG	0.579																																																1	Substitution - Missense(1)	ovary(1)	17																																								73969359	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9186_9187delinsAG	17.37:g.76457763_76457764delinsAG	ENSP00000465516:p.Ile3063Phe	Unknown		x	x	x	73969358	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	DNP	ENST00000585328.1	37		DNP	50	Broad																																																																																				0.579	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		Missense_Mutation
TBC1D16	125058	broad.mit.edu	37	17	77923572	77923573	+	Missense_Mutation	DNP	CT	CT	GC	rs145878577		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:77923572_77923573CT>GC	ENST00000310924.2	-	7	1464_1465	c.1349_1350AG>GC	c.(1348-1350)gAG>gGC	p.E450G	TBC1D16_ENST00000572862.1_Missense_Mutation_p.E88G|TBC1D16_ENST00000340848.7_Missense_Mutation_p.E88G|TBC1D16_ENST00000570373.1_Missense_Mutation_p.E89G|TBC1D16_ENST00000576768.1_Missense_Mutation_p.E75G	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	450	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.E450G(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GCGCCTCCCGCTCCTCCGACGT	0.639																																					Ovarian(14;397 562 4850 31922 49378)											1	Substitution - Missense(1)	ovary(1)	17																																								75538168	SO:0001583	missense	125058			AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1349_1350delinsGC	17.37:g.77923572_77923573delinsGC	ENSP00000309794:p.Glu450Gly	Unknown		x	x	x	75538167	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	DNP	ENST00000310924.2	37	CCDS11766.1	DNP	28	Broad																																																																																				0.639	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020		Missense_Mutation
RNF213	57674	broad.mit.edu	37	17	78337469	78337469	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:78337469C>A	ENST00000582970.1	+	41	11772	c.11629C>A	c.(11629-11631)Ccc>Acc	p.P3877T	RNF213_ENST00000336301.6_Missense_Mutation_p.P1950T|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.P3926T	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3877					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P1950T(1)|p.P3926T(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CACCCTGAAGCCCAGTCCCCA	0.627																																																2	Substitution - Missense(2)	ovary(2)	17											91.0	62.0	72.0					17																	78337469		2203	4300	6503	75952064	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.11629C>A	17.37:g.78337469C>A	ENSP00000464087:p.Pro3877Thr	Unknown		x	x	x	75952064	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695499	0.30052	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.21361	2.01	4.89	4.89	0.63831	.	0.208616	0.44902	D	0.000411	T	0.28830	0.0715	M	0.76838	2.35	0.28849	N	0.896161	P;B	0.51537	0.946;0.209	P;B	0.47162	0.54;0.031	T	0.21655	-1.0239	10	0.22109	T	0.4	.	9.4849	0.38924	0.0:0.8659:0.0:0.1341	.	3926;1950	C9JCP4;Q63HN8	.;RN213_HUMAN	T	3877;3926;1950	ENSP00000338218:P1950T	ENSP00000338218:P1950T	P	+	1	0	RNF213	75952064	1.000000	0.71417	0.991000	0.47740	0.693000	0.40251	2.688000	0.46984	2.257000	0.74773	0.561000	0.74099	CCC		0.627	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		Missense_Mutation
TRAPPC8	22878	broad.mit.edu	37	18	29493393	29493393	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr18:29493393G>A	ENST00000283351.4	-	5	1045	c.710C>T	c.(709-711)tCa>tTa	p.S237L	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.S183L|TRAPPC8_ENST00000582513.1_Missense_Mutation_p.S237L	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	237					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.S237L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CTGTTCATCTGATGCTCGATT	0.318																																																1	Substitution - Missense(1)	ovary(1)	18											91.0	92.0	92.0					18																	29493393		2203	4300	6503	27747391	SO:0001583	missense	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.710C>T	18.37:g.29493393G>A	ENSP00000283351:p.Ser237Leu	Unknown		x	x	x	27747391	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408947	0.42715	.	.	ENSG00000153339	ENST00000283351	T	0.18338	2.22	5.65	5.65	0.86999	.	0.425407	0.24200	N	0.040622	T	0.19248	0.0462	L	0.31926	0.97	0.32250	N	0.571507	B;B	0.26318	0.093;0.146	B;B	0.33121	0.077;0.158	T	0.06862	-1.0803	10	0.28530	T	0.3	.	20.0845	0.97795	0.0:0.0:1.0:0.0	.	237;237	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	L	237	ENSP00000283351:S237L	ENSP00000283351:S237L	S	-	2	0	TRAPPC8	27747391	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.183000	0.58317	2.821000	0.97095	0.650000	0.86243	TCA		0.318	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939		Missense_Mutation
KLHL14	57565	broad.mit.edu	37	18	30257208	30257208	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr18:30257208C>A	ENST00000359358.4	-	8	2112	c.1674G>T	c.(1672-1674)gaG>gaT	p.E558D		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	558						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.E558D(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						CACTTCGACCCTCCAAAATGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	18											155.0	130.0	139.0					18																	30257208		2203	4300	6503	28511206	SO:0001583	missense	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1674G>T	18.37:g.30257208C>A	ENSP00000352314:p.Glu558Asp	Unknown		x	x	x	28511206	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912685	0.52439	.	.	ENSG00000197705	ENST00000359358	T	0.67171	-0.25	5.73	1.21	0.21127	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	L	0.39633	1.23	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.63488	-0.6626	10	0.35671	T	0.21	.	9.2912	0.37789	0.0:0.567:0.0:0.433	.	558	Q9P2G3	KLH14_HUMAN	D	558	ENSP00000352314:E558D	ENSP00000352314:E558D	E	-	3	2	KLHL14	28511206	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.578000	0.23773	0.382000	0.24878	0.655000	0.94253	GAG		0.483	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1			Missense_Mutation
SERPINB4	6318	broad.mit.edu	37	18	61309035	61309035	+	Missense_Mutation	SNP	C	C	T	rs201045585		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr18:61309035C>T	ENST00000341074.5	-	4	425	c.310G>A	c.(310-312)Gcc>Acc	p.A104T	SERPINB4_ENST00000356424.6_Missense_Mutation_p.A104T	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	104					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A104T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						AGCTTGTTGGCGATCTTCAGC	0.408																																																1	Substitution - Missense(1)	ovary(1)	18						C	THR/ALA	0,4406		0,0,2203	213.0	196.0	202.0		310	2.0	0.4	18		202	2,8598	2.2+/-6.3	0,2,4298	no	missense	SERPINB4	NM_002974.2	58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		104/391	61309035	2,13004	2203	4300	6503	59460015	SO:0001583	missense	6318			X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.310G>A	18.37:g.61309035C>T	ENSP00000343445:p.Ala104Thr	Unknown		x	x	x	59460015	A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	CCDS11986.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	13.53	2.263904	0.39995	0.0	2.33E-4	ENSG00000206073	ENST00000341074;ENST00000356424	D;D	0.87179	-2.22;-2.22	3.76	1.97	0.26223	Serpin domain (3);	0.519560	0.16085	N	0.230317	D	0.87613	0.6221	M	0.88775	2.98	0.34048	D	0.655763	B;B	0.29531	0.183;0.247	B;B	0.30251	0.101;0.113	D	0.86997	0.2114	10	0.54805	T	0.06	.	8.955	0.35812	0.0:0.8113:0.0:0.1887	.	104;104	P48594;Q9BYF7	SPB4_HUMAN;.	T	104	ENSP00000343445:A104T;ENSP00000348795:A104T	ENSP00000343445:A104T	A	-	1	0	SERPINB4	59460015	0.984000	0.35163	0.425000	0.26659	0.060000	0.15804	2.658000	0.46733	0.390000	0.25115	-0.894000	0.02916	GCC		0.408	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041		Missense_Mutation
CTDP1	9150	broad.mit.edu	37	18	77457981	77457982	+	Missense_Mutation	DNP	CG	CG	GT			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr18:77457981_77457982CG>GT	ENST00000299543.7	+	4	761_762	c.614_615CG>GT	c.(613-615)tCG>tGT	p.S205C	CTDP1_ENST00000075430.7_Missense_Mutation_p.S205C	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	205	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)	p.S205C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CAGCAGATGTCGAATAAAGTGA	0.49																																																1	Substitution - Missense(1)	ovary(1)	18																																								75558970	SO:0001583	missense	9150			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	Exception_encountered	18.37:g.77457981_77457982delinsGT	ENSP00000299543:p.Ser205Cys	Unknown		x	x	x	75558969	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	DNP	ENST00000299543.7	37	CCDS12017.1	DNP	31	Broad																																																																																				0.490	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715		Missense_Mutation
ADNP2	22850	broad.mit.edu	37	18	77895160	77895160	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr18:77895160G>T	ENST00000262198.4	+	4	2319	c.1864G>T	c.(1864-1866)Gtc>Ttc	p.V622F		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	622					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V622F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CCCCGTGTCTGTCACTCTGCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	18											86.0	84.0	85.0					18																	77895160		2203	4300	6503	75996151	SO:0001583	missense	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1864G>T	18.37:g.77895160G>T	ENSP00000262198:p.Val622Phe	Unknown		x	x	x	75996151	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191202	0.58017	.	.	ENSG00000101544	ENST00000262198	.	.	.	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000018	T	0.76147	0.3947	L	0.59436	1.845	0.48185	D	0.999602	D	0.76494	0.999	D	0.79108	0.992	T	0.75291	-0.3369	8	.	.	.	-25.4685	18.19	0.89804	0.0:0.0:1.0:0.0	.	622	Q6IQ32	ADNP2_HUMAN	F	622	.	.	V	+	1	0	ADNP2	75996151	1.000000	0.71417	0.993000	0.49108	0.630000	0.37929	6.171000	0.71926	2.537000	0.85549	0.650000	0.86243	GTC		0.602	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		Missense_Mutation
ATP8B3	148229	broad.mit.edu	37	19	1789034	1789035	+	Missense_Mutation	DNP	GA	GA	CC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:1789034_1789035GA>CC	ENST00000310127.6	-	24	3168_3169	c.2930_2931TC>GG	c.(2929-2931)tTC>tGG	p.F977W	ATP8B3_ENST00000539485.1_Missense_Mutation_p.F987W|ATP8B3_ENST00000525591.1_Missense_Mutation_p.F940W	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	977					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.F987W(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGCTGCAGGAAGCAGAACTG	0.644																																																1	Substitution - Missense(1)	ovary(1)	19																																								1740035	SO:0001583	missense	148229			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.2930_2931delinsCC	19.37:g.1789034_1789035delinsCC	ENSP00000311336:p.Phe977Trp	Unknown		x	x	x	1740034	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	DNP	ENST00000310127.6	37	CCDS45901.1	DNP	41	Broad																																																																																				0.644	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813		Missense_Mutation
RANBP3	8498	broad.mit.edu	37	19	5933475	5933475	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:5933475C>A	ENST00000340578.6	-	6	479	c.422G>T	c.(421-423)gGc>gTc	p.G141V	RANBP3_ENST00000439268.2_Missense_Mutation_p.G141V|RANBP3_ENST00000591092.1_Missense_Mutation_p.G73V|RANBP3_ENST00000034275.8_Missense_Mutation_p.G73V|RANBP3_ENST00000541471.1_Missense_Mutation_p.G13V|RANBP3_ENST00000591124.1_5'UTR	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	141					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)	p.G141V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CAACCGGAAGCCACTGCTCCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											37.0	41.0	40.0					19																	5933475		1963	4161	6124	5884475	SO:0001583	missense	8498			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.422G>T	19.37:g.5933475C>A	ENSP00000341483:p.Gly141Val	Unknown		x	x	x	5884475	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372600	0.82573	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807;ENST00000541471	T;T;T;T	0.39229	1.65;1.58;2.37;1.09	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;1.0;1.0;0.999	T	0.38845	-0.9642	10	0.23302	T	0.38	-31.7046	16.9253	0.86174	0.0:1.0:0.0:0.0	.	13;141;13;73;73;141;141	F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;.;RANB3_HUMAN	V	141;141;73;72;13	ENSP00000341483:G141V;ENSP00000404837:G141V;ENSP00000034275:G73V;ENSP00000445071:G13V	ENSP00000034275:G73V	G	-	2	0	RANBP3	5884475	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.221000	0.72243	2.663000	0.90544	0.655000	0.94253	GGC		0.612	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322		Missense_Mutation
C19orf57	79173	broad.mit.edu	37	19	14001229	14001229	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:14001229A>G	ENST00000586783.1	-	5	439	c.440T>C	c.(439-441)cTa>cCa	p.L147P	C19orf57_ENST00000454313.1_Missense_Mutation_p.L147P|C19orf57_ENST00000346736.2_Missense_Mutation_p.L147P|C19orf57_ENST00000591586.1_Intron			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	147					multicellular organismal development (GO:0007275)			p.L147P(1)		breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			GGTCTCCACTAGCAGCTGGCA	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											27.0	33.0	31.0					19																	14001229		2196	4291	6487	13862229	SO:0001583	missense	79173			BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.440T>C	19.37:g.14001229A>G	ENSP00000465822:p.Leu147Pro	Unknown		x	x	x	13862229	Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	37		SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	12.54	1.967908	0.34754	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.37411	1.2;1.2	3.12	-3.83	0.04269	.	1.513210	0.04999	N	0.468741	T	0.30634	0.0771	N	0.19112	0.55	0.09310	N	1	D;D	0.64830	0.986;0.994	P;P	0.53912	0.649;0.737	T	0.23583	-1.0184	10	0.42905	T	0.14	-2.0E-4	4.6027	0.12361	0.2216:0.2127:0.0:0.5657	.	147;147	Q0VDD7-2;Q0VDD7	.;CS057_HUMAN	P	147	ENSP00000404382:L147P;ENSP00000254336:L147P	ENSP00000254336:L147P	L	-	2	0	C19orf57	13862229	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.613000	0.00883	-0.858000	0.04110	0.397000	0.26171	CTA		0.632	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323		Missense_Mutation
UPF1	5976	broad.mit.edu	37	19	18974390	18974390	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:18974390A>T	ENST00000599848.1	+	19	2986	c.2777A>T	c.(2776-2778)aAg>aTg	p.K926M	UPF1_ENST00000262803.5_Missense_Mutation_p.K915M			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	926					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CAGTTCAGCAAGCCACGGAAG	0.602																																																0			19											61.0	52.0	55.0					19																	18974390		2203	4300	6503	18835390	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2777A>T	19.37:g.18974390A>T	ENSP00000470142:p.Lys926Met	Unknown		x	x	x	18835390	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.156747	0.78114	.	.	ENSG00000005007	ENST00000262803	D	0.91521	-2.86	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.93452	0.7911	M	0.72479	2.2	0.80722	D	1	P;D	0.55800	0.954;0.973	P;P	0.61201	0.77;0.885	D	0.93841	0.7136	10	0.87932	D	0	-45.1049	11.4935	0.50394	1.0:0.0:0.0:0.0	.	926;915	Q92900;Q92900-2	RENT1_HUMAN;.	M	915	ENSP00000262803:K915M	ENSP00000262803:K915M	K	+	2	0	UPF1	18835390	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	8.921000	0.92784	1.650000	0.50662	0.459000	0.35465	AAG		0.602	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911		Missense_Mutation
UPF1	5976	broad.mit.edu	37	19	18974392	18974392	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:18974392C>T	ENST00000599848.1	+	19	2988	c.2779C>T	c.(2779-2781)Cca>Tca	p.P927S	UPF1_ENST00000262803.5_Missense_Mutation_p.P916S			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	927					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GTTCAGCAAGCCACGGAAGCT	0.602																																																0			19											60.0	51.0	54.0					19																	18974392		2203	4300	6503	18835392	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2779C>T	19.37:g.18974392C>T	ENSP00000470142:p.Pro927Ser	Unknown		x	x	x	18835392	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118460	0.77323	.	.	ENSG00000005007	ENST00000262803	D	0.91351	-2.83	4.47	4.47	0.54385	.	0.053495	0.85682	D	0.000000	D	0.90338	0.6977	L	0.42245	1.32	0.80722	D	1	B;P	0.35575	0.376;0.51	B;P	0.46299	0.314;0.511	D	0.91130	0.4937	10	0.66056	D	0.02	-32.4121	14.2851	0.66240	0.0:1.0:0.0:0.0	.	927;916	Q92900;Q92900-2	RENT1_HUMAN;.	S	916	ENSP00000262803:P916S	ENSP00000262803:P916S	P	+	1	0	UPF1	18835392	1.000000	0.71417	0.991000	0.47740	0.745000	0.42441	7.472000	0.80996	2.028000	0.59812	0.561000	0.74099	CCA		0.602	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911		Missense_Mutation
SLC7A10	56301	broad.mit.edu	37	19	33701443	33701443	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:33701443C>T	ENST00000253188.4	-	9	1339	c.1193G>A	c.(1192-1194)tGc>tAc	p.C398Y	CTD-2540B15.13_ENST00000609744.1_RNA	NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	398					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.C398Y(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GACGCCGTAGCAGAGGTAGTT	0.647																																																1	Substitution - Missense(1)	ovary(1)	19											108.0	63.0	78.0					19																	33701443		2203	4300	6503	38393283	SO:0001583	missense	56301			AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.1193G>A	19.37:g.33701443C>T	ENSP00000253188:p.Cys398Tyr	Unknown		x	x	x	38393283	B2RE84	Missense_Mutation	SNP	ENST00000253188.4	37	CCDS12431.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923788	0.34002	.	.	ENSG00000130876	ENST00000253188	D	0.88818	-2.43	5.38	5.38	0.77491	Amino acid permease domain (1);	0.162901	0.56097	D	0.000029	D	0.89632	0.6771	L	0.39147	1.195	0.48696	D	0.999692	B;P	0.43169	0.257;0.8	B;P	0.50270	0.216;0.636	D	0.89864	0.4018	10	0.52906	T	0.07	.	18.1015	0.89507	0.0:1.0:0.0:0.0	.	398;245	Q9NS82;Q9NWI3	AAA1_HUMAN;.	Y	398	ENSP00000253188:C398Y	ENSP00000253188:C398Y	C	-	2	0	SLC7A10	38393283	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.563000	0.36364	2.536000	0.85505	0.491000	0.48974	TGC		0.647	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849		Missense_Mutation
ZNF546	339327	broad.mit.edu	37	19	40520961	40520961	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:40520961A>T	ENST00000347077.4	+	7	2000	c.1784A>T	c.(1783-1785)aAt>aTt	p.N595I	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.N569I	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	595					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N595I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CGTCGCTATAATCTTACTCAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	19											47.0	49.0	48.0					19																	40520961		2203	4300	6503	45212801	SO:0001583	missense	339327			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1784A>T	19.37:g.40520961A>T	ENSP00000339823:p.Asn595Ile	Unknown		x	x	x	45212801	A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	a	11.03	1.518607	0.27211	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.22539	1.95	2.91	1.85	0.25348	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19685	0.0473	L	0.53671	1.685	0.09310	N	1	P	0.43857	0.819	B	0.42343	0.384	T	0.11690	-1.0577	9	0.22109	T	0.4	.	7.7337	0.28802	0.7878:0.2122:0.0:0.0	.	595	Q86UE3	ZN546_HUMAN	I	595;204	ENSP00000339823:N595I	ENSP00000339823:N595I	N	+	2	0	ZNF546	45212801	0.000000	0.05858	0.036000	0.18154	0.995000	0.86356	-0.980000	0.03770	0.471000	0.27319	0.482000	0.46254	AAT		0.348	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544		Missense_Mutation
CYP2A6	1548	broad.mit.edu	37	19	41350620	41350620	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:41350620T>G	ENST00000301141.5	-	8	1239	c.1219A>C	c.(1219-1221)Aac>Cac	p.N407H	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	407					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.N407H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TCCTGGGGGTTGGAGAAGAAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											112.0	107.0	109.0					19																	41350620		2203	4300	6503	46042460	SO:0001583	missense	1548			AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.1219A>C	19.37:g.41350620T>G	ENSP00000301141:p.Asn407His	Unknown		x	x	x	46042460	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	-	12.81	2.049415	0.36181	.	.	ENSG00000255974	ENST00000301141	T	0.01438	4.89	3.16	2.01	0.26516	.	0.730148	0.12898	U	0.430056	T	0.03739	0.0106	L	0.39898	1.24	0.21290	N	0.999733	P	0.37330	0.59	P	0.55161	0.77	T	0.41502	-0.9505	10	0.62326	D	0.03	.	8.07	0.30682	0.1801:0.0:0.0:0.8199	.	407	P11509	CP2A6_HUMAN	H	407	ENSP00000301141:N407H	ENSP00000301141:N407H	N	-	1	0	CYP2A6	46042460	0.000000	0.05858	0.977000	0.42913	0.406000	0.30931	0.457000	0.21875	1.219000	0.43474	0.312000	0.20444	AAC		0.537	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762		Missense_Mutation
SIGLEC12	89858	broad.mit.edu	37	19	52002862	52002862	+	Missense_Mutation	SNP	G	G	A	rs569989918		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:52002862G>A	ENST00000291707.3	-	3	972	c.917C>T	c.(916-918)aCg>aTg	p.T306M	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.T188M	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	306	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.T306M(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCAGGTGATCGTGGGGGGCGT	0.667													g|||	1	0.000199681	0.0008	0.0	5008	,	,		9447	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											55.0	56.0	56.0					19																	52002862		2203	4300	6503	56694674	SO:0001583	missense	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.917C>T	19.37:g.52002862G>A	ENSP00000291707:p.Thr306Met	Unknown		x	x	x	56694674	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	.	4.129	0.022255	0.08006	.	.	ENSG00000254521	ENST00000291707	T	0.03386	3.95	2.07	0.989	0.19802	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.615220	0.04364	N	0.357951	T	0.03390	0.0098	N	0.16656	0.425	0.09310	N	1	D;P	0.56287	0.975;0.539	P;B	0.45474	0.482;0.089	T	0.34527	-0.9825	10	0.33940	T	0.23	.	3.757	0.08589	0.7829:0.0:0.2171:0.0	.	306;188	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	M	306	ENSP00000291707:T306M	ENSP00000291707:T306M	T	-	2	0	SIGLEC12	56694674	0.000000	0.05858	0.020000	0.16555	0.000000	0.00434	-2.385000	0.01062	0.084000	0.17077	-0.518000	0.04402	ACG		0.667	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003		Missense_Mutation
ZNF324B	388569	broad.mit.edu	37	19	58967129	58967130	+	Missense_Mutation	DNP	TC	TC	GT			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:58967129_58967130TC>GT	ENST00000336614.4	+	4	925_926	c.818_819TC>GT	c.(817-819)cTC>cGT	p.L273R	ZNF324B_ENST00000391696.1_Missense_Mutation_p.L263R|ZNF324B_ENST00000545523.1_Missense_Mutation_p.L273R	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	273					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L273R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TCCGACCTCCTCAAGCACCTAC	0.649																																																1	Substitution - Missense(1)	ovary(1)	19																																								63658942	SO:0001583	missense	388569			AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		Exception_encountered	19.37:g.58967129_58967130delinsGT	ENSP00000337473:p.Leu273Arg	Unknown		x	x	x	63658941	B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	DNP	ENST00000336614.4	37	CCDS33138.1	DNP	54	Broad																																																																																				0.649	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467038.1	NM_207395		Missense_Mutation
DHX57	90957	broad.mit.edu	37	2	39065007	39065007	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:39065007C>G	ENST00000295373.6	-	13	2634	c.2508G>C	c.(2506-2508)gaG>gaC	p.E836D		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	836	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				CCACAATCCACTCTAATAAGG	0.393																																					Melanoma(191;1090 2095 4375 23729 47341)											0			2											155.0	139.0	145.0					2																	39065007		2203	4300	6503	38918511	SO:0001583	missense	90957			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.2508G>C	2.37:g.39065007C>G	ENSP00000295373:p.Glu836Asp	Unknown		x	x	x	38918511	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	CCDS1800.1	SNP	20	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.85|12.85	2.061773|2.061773	0.36373|0.36373	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|.	0.02606|.	4.23|.	5.15|5.15	0.862|0.862	0.19056|0.19056	Helicase, C-terminal (1);|.	0.116585|.	0.38272|.	N|.	0.001752|.	T|T	0.44685|0.44685	0.1305|0.1305	L|L	0.41710|0.41710	1.295|1.295	0.48830|0.48830	D|D	0.999711|0.999711	B;B;B|.	0.14438|.	0.005;0.01;0.003|.	B;B;B|.	0.17722|.	0.019;0.013;0.005|.	T|T	0.23226|0.23226	-1.0194|-1.0194	10|5	0.23891|.	T|.	0.37|.	.|.	5.6161|5.6161	0.17432|0.17432	0.0:0.5336:0.1349:0.3315|0.0:0.5336:0.1349:0.3315	.|.	836;836;228|.	Q6P158;B4DKW2;Q59G60|.	DHX57_HUMAN;.;.|.	D|L	836|160	ENSP00000295373:E836D|.	ENSP00000295373:E836D|.	E|V	-|-	3|1	2|0	DHX57|DHX57	38918511|38918511	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	0.368000|0.368000	0.20399|0.20399	0.574000|0.574000	0.29417|0.29417	-0.254000|-0.254000	0.11334|0.11334	GAG|GTG		0.393	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646		Missense_Mutation
THADA	63892	broad.mit.edu	37	2	43520110	43520110	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:43520110G>A	ENST00000405006.4	-	32	5032	c.4681C>T	c.(4681-4683)Ctg>Ttg	p.L1561L	THADA_ENST00000405975.2_Silent_p.L1561L|THADA_ENST00000415080.2_Silent_p.L1242L|THADA_ENST00000330266.7_Intron	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1561										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AGGGCTTCCAGTGTTAGTGAG	0.542																																																0			2											38.0	38.0	38.0					2																	43520110		1925	4134	6059	43373614	SO:0001819	synonymous_variant	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4681C>T	2.37:g.43520110G>A		Unknown		x	x	x	43373614	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Silent	SNP	ENST00000405006.4	37	CCDS46268.1	SNP	36	Broad																																																																																				0.542	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		Silent
SOCS5	9655	broad.mit.edu	37	2	46986254	46986254	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:46986254C>T	ENST00000306503.5	+	2	757	c.585C>T	c.(583-585)agC>agT	p.S195S	SOCS5_ENST00000394861.2_Silent_p.S195S	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	195					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)	p.S195S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			GAACTTACAGCAAGCAGTCAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	2											54.0	54.0	54.0					2																	46986254		2199	4294	6493	46839758	SO:0001819	synonymous_variant	9655			AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.585C>T	2.37:g.46986254C>T		Unknown		x	x	x	46839758	Q53SD4|Q8IYZ4	Silent	SNP	ENST00000306503.5	37	CCDS1830.1	SNP	25	Broad																																																																																				0.438	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2			Silent
FAM161A	84140	broad.mit.edu	37	2	62081132	62081132	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:62081132G>A	ENST00000405894.3	-	1	146	c.45C>T	c.(43-45)ctC>ctT	p.L15L	FAM161A_ENST00000404929.1_Silent_p.L15L	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	15					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)		p.L15L(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CCGGGGTCTGGAGACTGGAGG	0.692																																																1	Substitution - coding silent(1)	ovary(1)	2											21.0	22.0	21.0					2																	62081132		1568	3582	5150	61934636	SO:0001819	synonymous_variant	84140				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.45C>T	2.37:g.62081132G>A		Unknown		x	x	x	61934636	B4DJV7|Q9H8R2	Silent	SNP	ENST00000405894.3	37	CCDS42687.2	SNP	41	Broad																																																																																				0.692	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180		Silent
CYP26B1	56603	broad.mit.edu	37	2	72359702	72359703	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:72359702_72359703TC>AA	ENST00000001146.2	-	6	1395_1396	c.1192_1193GA>TT	c.(1192-1194)GAc>TTc	p.D398F	CYP26B1_ENST00000546307.1_Missense_Mutation_p.D323F|CYP26B1_ENST00000412253.1_Missense_Mutation_p.D207F	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	398					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.D398F(1)		breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						GTCATGGGTGTCCCGGATGCTA	0.604																																																1	Substitution - Missense(1)	ovary(1)	2																																								72213211	SO:0001583	missense	56603				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1192_1193delinsAA	2.37:g.72359702_72359703delinsAA	ENSP00000001146:p.Asp398Phe	Unknown		x	x	x	72213210	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	DNP	ENST00000001146.2	37	CCDS1919.1	DNP	58	Broad																																																																																				0.604	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		Missense_Mutation
WBP1	23559	broad.mit.edu	37	2	74687689	74687690	+	Missense_Mutation	DNP	GT	GT	CC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:74687689_74687690GT>CC	ENST00000233615.2	+	4	965_966	c.691_692GT>CC	c.(691-693)GTg>CCg	p.V231P	WBP1_ENST00000494741.1_3'UTR|MOGS_ENST00000462443.1_5'Flank|WBP1_ENST00000393972.3_Missense_Mutation_p.V265P|WBP1_ENST00000409737.1_Missense_Mutation_p.V228P	NM_012477.3	NP_036609.1	Q96G27	WBP1_HUMAN	WW domain binding protein 1	231							WW domain binding (GO:0050699)	p.V231P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	8						AGTCAAGGAGGTGAGGGTTAGT	0.609																																																1	Substitution - Missense(1)	ovary(1)	2																																								74541198	SO:0001583	missense	23559			U79457	CCDS1943.1	2p12	2012-04-20			ENSG00000239779	ENSG00000239779			12737	protein-coding gene	gene with protein product		606961				7644498	Standard	NM_012477		Approved	WBP-1	uc002slj.2	Q96G27	OTTHUMG00000129958	Exception_encountered	2.37:g.74687689_74687690delinsCC	ENSP00000233615:p.Val231Pro	Unknown		x	x	x	74541197	B2RE02|O95637	Missense_Mutation	DNP	ENST00000233615.2	37	CCDS1943.1	DNP	44	Broad																																																																																				0.609	WBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252221.2	NM_012477		Missense_Mutation
FAM178B	51252	broad.mit.edu	37	2	97543677	97543677	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:97543677T>C	ENST00000417561.3	-	20	2400	c.2401A>G	c.(2401-2403)Acc>Gcc	p.T801A	FAM178B_ENST00000327896.3_Missense_Mutation_p.T621A|FAM178B_ENST00000490605.2_Missense_Mutation_p.T653A|FAM178B_ENST00000393526.2_Missense_Mutation_p.T93A|FAM178B_ENST00000470789.1_5'UTR			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	801								p.T93A(1)		large_intestine(1)|ovary(1)	2						TAGGTCTGGGTAGCCAGGTCC	0.667																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	60.0	65.0					2																	97543677		2203	4300	6503	96907404	SO:0001583	missense	51252			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.2401A>G	2.37:g.97543677T>C	ENSP00000413245:p.Thr801Ala	Unknown		x	x	x	96907404	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	ENST00000417561.3	37		SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	5.676	0.309305	0.10733	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000393526;ENST00000490605	T;T;T;T	0.36699	1.25;1.36;1.24;1.34	5.2	1.69	0.24217	.	.	.	.	.	T	0.12263	0.0298	N	0.02751	-0.505	0.24093	N	0.995907	B	0.20887	0.049	B	0.22152	0.038	T	0.34527	-0.9825	9	0.02654	T	1	-1.8013	6.2862	0.21035	0.0:0.4374:0.0:0.5626	.	801	Q8IXR5	F178B_HUMAN	A	801;621;93;653	ENSP00000413245:T801A;ENSP00000333553:T621A;ENSP00000377160:T93A;ENSP00000429896:T653A	ENSP00000333553:T621A	T	-	1	0	FAM178B	96907404	0.002000	0.14202	0.987000	0.45799	0.906000	0.53458	-0.502000	0.06390	0.388000	0.25054	-0.475000	0.04921	ACC		0.667	FAM178B-202	KNOWN	basic	protein_coding	protein_coding		NM_016490		Missense_Mutation
CNGA3	1261	broad.mit.edu	37	2	99012779	99012779	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:99012779C>T	ENST00000272602.2	+	7	1185	c.1146C>T	c.(1144-1146)gtC>gtT	p.V382V	CNGA3_ENST00000436404.2_Silent_p.V364V|CNGA3_ENST00000409937.1_Silent_p.V386V|CNGA3_ENST00000393504.1_Silent_p.V382V			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	382					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.V382V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TCTTTGTGGTCGTAGACTTCT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	2											77.0	78.0	78.0					2																	99012779		2203	4300	6503	98379211	SO:0001819	synonymous_variant	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1146C>T	2.37:g.99012779C>T		Unknown		x	x	x	98379211	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	37	CCDS2034.1	SNP	31	Broad																																																																																				0.512	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		Silent
NCKAP5	344148	broad.mit.edu	37	2	133540467	133540467	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:133540467G>T	ENST00000409261.1	-	14	4290	c.3917C>A	c.(3916-3918)gCc>gAc	p.A1306D	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.A1306D|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1306										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GCCTCTCTCGGCGGTATTGGT	0.572																																																0			2											77.0	76.0	77.0					2																	133540467		1941	4141	6082	133256937	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3917C>A	2.37:g.133540467G>T	ENSP00000387128:p.Ala1306Asp	Unknown		x	x	x	133256937	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288907	0.59976	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12255	2.7;2.7	5.5	4.59	0.56863	.	0.747675	0.10821	U	0.630520	T	0.21550	0.0519	L	0.29908	0.895	0.46396	D	0.999025	D	0.63880	0.993	P	0.55391	0.775	T	0.01252	-1.1405	10	0.41790	T	0.15	.	14.9076	0.70733	0.0:0.1418:0.8582:0.0	.	1306	O14513	NCKP5_HUMAN	D	1306	ENSP00000387128:A1306D;ENSP00000380603:A1306D	ENSP00000380603:A1306D	A	-	2	0	NCKAP5	133256937	0.984000	0.35163	0.933000	0.37362	0.769000	0.43574	3.828000	0.55753	2.854000	0.98071	0.655000	0.94253	GCC		0.572	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		Missense_Mutation
WIPF1	7456	broad.mit.edu	37	2	175436420	175436420	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:175436420G>T	ENST00000392547.2	-	5	1212	c.1113C>A	c.(1111-1113)gaC>gaA	p.D371E	AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000359761.3_Missense_Mutation_p.D371E|WIPF1_ENST00000392546.2_Missense_Mutation_p.D371E|WIPF1_ENST00000272746.5_Missense_Mutation_p.D371E|WIPF1_ENST00000467149.1_5'Flank|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000409891.1_Missense_Mutation_p.D371E|WIPF1_ENST00000409415.3_Missense_Mutation_p.D371E	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	371	Pro-rich.				actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.D371E(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GGCCTGGCGGGTCCCTCACTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											64.0	70.0	68.0					2																	175436420		2197	4292	6489	175144666	SO:0001583	missense	7456			AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.1113C>A	2.37:g.175436420G>T	ENSP00000376330:p.Asp371Glu	Unknown		x	x	x	175144666	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	ENST00000392547.2	37	CCDS2260.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	0.870	-0.732208	0.03135	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415	T;T;T;T;T;T	0.54071	1.54;1.52;1.54;1.54;0.97;0.59	4.85	0.173	0.15036	.	0.164293	0.52532	N	0.000074	T	0.28433	0.0703	L	0.28740	0.885	0.80722	D	1	B;B;B;B	0.12013	0.004;0.005;0.004;0.002	B;B;B;B	0.11329	0.004;0.004;0.006;0.002	T	0.04565	-1.0942	10	0.15066	T	0.55	.	1.0558	0.01590	0.2765:0.1697:0.3825:0.1714	.	371;371;371;371	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	E	371;227;371;371;371;371;371	ENSP00000376330:D371E;ENSP00000272746:D371E;ENSP00000352802:D371E;ENSP00000376329:D371E;ENSP00000386431:D371E;ENSP00000387150:D371E	ENSP00000272746:D371E	D	-	3	2	WIPF1	175144666	1.000000	0.71417	0.993000	0.49108	0.113000	0.19764	0.627000	0.24506	0.417000	0.25871	0.536000	0.68110	GAC		0.572	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179400239	179400239	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:179400239G>A	ENST00000591111.1	-	308	96404	c.96180C>T	c.(96178-96180)gtC>gtT	p.V32060V	TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.V24636V|TTN-AS1_ENST00000589842.1_RNA|TTN_ENST00000359218.5_Silent_p.V24761V|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Silent_p.V31133V|TTN_ENST00000342175.6_Silent_p.V24828V|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Silent_p.V33701V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32060	Fibronectin type-III 132. {ECO:0000255|PROSITE-ProRule:PRU00316}.			V -> A (in Ref. 1; CAA62188 and 14; CAA45938/CAA49245). {ECO:0000305}.	adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCTCGTGAGACATCACTAA	0.438																																																0			2											86.0	92.0	90.0					2																	179400239		2055	4211	6266	179108485	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96180C>T	2.37:g.179400239G>A		Unknown		x	x	x	179108485	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	33	Broad																																																																																				0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
TTN	7273	broad.mit.edu	37	2	179432535	179432535	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:179432535C>T	ENST00000591111.1	-	276	73625	c.73401G>A	c.(73399-73401)caG>caA	p.Q24467Q	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Silent_p.Q17043Q|TTN_ENST00000359218.5_Silent_p.Q17168Q|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Silent_p.Q23540Q|TTN_ENST00000342175.6_Silent_p.Q17235Q|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Silent_p.Q26108Q|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24467	Fibronectin type-III 78. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Q23538Q(1)|p.Q17043Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTGGTCCACTGTAAAGTGA	0.418																																																2	Substitution - coding silent(2)	ovary(2)	2											141.0	133.0	135.0					2																	179432535		1895	4111	6006	179140781	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.73401G>A	2.37:g.179432535C>T		Unknown		x	x	x	179140781	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	20	Broad																																																																																				0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
SGPP2	130367	broad.mit.edu	37	2	223339308	223339308	+	Missense_Mutation	SNP	G	G	A	rs138702204		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:223339308G>A	ENST00000321276.7	+	2	327	c.241G>A	c.(241-243)Gtg>Atg	p.V81M		NM_152386.2	NP_689599.2	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphatase 2	81					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.V81M(2)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	18		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		GAAGTACGTCGTGAAGAATTA	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		18637	0.0		0.001	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	2						G	MET/VAL	1,4403	2.1+/-5.4	0,1,2201	140.0	142.0	141.0		241	5.5	1.0	2	dbSNP_134	141	1,8599	1.2+/-3.3	0,1,4299	no	missense	SGPP2	NM_152386.2	21	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	81/400	223339308	2,13002	2202	4300	6502	223047552	SO:0001583	missense	130367			AF542512	CCDS2453.1	2q36.3	2010-05-26	2010-05-26		ENSG00000163082	ENSG00000163082			19953	protein-coding gene	gene with protein product		612827				12411432	Standard	NM_152386		Approved	SPP2, FLJ39004	uc010zlo.2	Q8IWX5	OTTHUMG00000133156	ENST00000321276.7:c.241G>A	2.37:g.223339308G>A	ENSP00000315137:p.Val81Met	Unknown		x	x	x	223047552	A3KPB4|Q8N8Q6	Missense_Mutation	SNP	ENST00000321276.7	37	CCDS2453.1	SNP	40	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.0	4.366997	0.82463	2.27E-4	1.16E-4	ENSG00000163082	ENST00000321276	.	.	.	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000004	T	0.79592	0.4472	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.80999	-0.1131	9	0.72032	D	0.01	-19.3372	19.4318	0.94772	0.0:0.0:1.0:0.0	.	81	Q8IWX5	SGPP2_HUMAN	M	81	.	ENSP00000315137:V81M	V	+	1	0	SGPP2	223047552	1.000000	0.71417	0.958000	0.39756	0.916000	0.54674	7.558000	0.82253	2.582000	0.87167	0.561000	0.74099	GTG		0.363	SGPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256856.2			Missense_Mutation
KCNE4	23704	broad.mit.edu	37	2	223917651	223917651	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr2:223917651G>A	ENST00000281830.3	+	2	587	c.256G>A	c.(256-258)Gag>Aag	p.E86K	KCNE4_ENST00000604125.1_Missense_Mutation_p.E35K|KCNE4_ENST00000488477.2_Intron			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	86						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)	p.E35K(2)		large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		CAATGGCAACGAGTACTTCTA	0.592																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2											87.0	70.0	76.0					2																	223917651		2203	4300	6503	223625895	SO:0001583	missense	23704			AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.256G>A	2.37:g.223917651G>A	ENSP00000281830:p.Glu86Lys	Unknown		x	x	x	223625895	B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	ENST00000281830.3	37		SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.320453	0.95682	.	.	ENSG00000152049	ENST00000281830	.	.	.	5.91	5.91	0.95273	.	0.052677	0.85682	D	0.000000	T	0.78723	0.4328	M	0.75264	2.295	0.53688	D	0.999973	D	0.71674	0.998	P	0.62184	0.899	T	0.77978	-0.2384	9	0.51188	T	0.08	0.2868	20.2985	0.98592	0.0:0.0:1.0:0.0	.	35	Q8WWG9	KCNE4_HUMAN	K	35	.	ENSP00000281830:E35K	E	+	1	0	KCNE4	223625895	1.000000	0.71417	0.948000	0.38648	0.754000	0.42855	9.434000	0.97515	2.793000	0.96121	0.655000	0.94253	GAG		0.592	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671		Missense_Mutation
DNTTIP1	116092	broad.mit.edu	37	20	44424081	44424081	+	Splice_Site	SNP	A	A	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr20:44424081A>G	ENST00000372622.3	+	4	439	c.371A>G	c.(370-372)cAg>cGg	p.Q124R		NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	124						nucleolus (GO:0005730)|nucleus (GO:0005634)		p.Q124R(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				TGCCTGGAGCAGGTGAGACCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	20											38.0	26.0	30.0					20																	44424081		2202	4300	6502	43857488	SO:0001630	splice_region_variant	116092			AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.372+1A>G	20.37:g.44424081A>G		Unknown		x	x	x	43857488	B2RA18|Q96DE3|Q9BQP2|Q9H148	Missense_Mutation	SNP	ENST00000372622.3	37	CCDS13369.1	SNP	7	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	23.6|23.6	4.437355|4.437355	0.83885|0.83885	.|.	.|.	ENSG00000101457|ENSG00000101457	ENST00000372622;ENST00000449078;ENST00000415790|ENST00000435014	T;T|.	0.46451|.	0.89;0.87|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.047802|.	0.85682|.	D|.	0.000000|.	T|T	0.60612|0.60612	0.2282|0.2282	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	P|.	0.38078|.	0.617|.	B|.	0.37144|.	0.242|.	T|T	0.57447|0.57447	-0.7810|-0.7810	10|5	0.56958|.	D|.	0.05|.	-23.4154|-23.4154	14.5366|14.5366	0.67966|0.67966	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	124|.	Q9H147|.	TDIF1_HUMAN|.	R|G	124;119;84|51	ENSP00000361705:Q124R;ENSP00000392509:Q84R|.	ENSP00000361705:Q124R|.	Q|R	+|+	2|1	0|2	DNTTIP1|DNTTIP1	43857488|43857488	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	7.376000|7.376000	0.79658|0.79658	2.304000|2.304000	0.77564|0.77564	0.524000|0.524000	0.50904|0.50904	CAG|AGG		0.552	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	Missense_Mutation	Missense_Mutation
NKAIN4	128414	broad.mit.edu	37	20	61881327	61881328	+	Missense_Mutation	DNP	AG	AG	GC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr20:61881327_61881328AG>GC	ENST00000370316.3	-	2	240_241	c.151_152CT>GC	c.(151-153)CTc>GCc	p.L51A	NKAIN4_ENST00000466885.1_5'Flank|NKAIN4_ENST00000370307.2_5'UTR|NKAIN4_ENST00000370313.1_5'UTR	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L51A(1)		endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					GGTGCCGAAGAGTCCCAGGATG	0.619																																																1	Substitution - Missense(1)	ovary(1)	20																																								61351773	SO:0001583	missense	128414			BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.151_152delinsGC	20.37:g.61881327_61881328delinsGC	ENSP00000359340:p.Leu51Ala	Unknown		x	x	x	61351772	Q4VXQ6|Q9BQU8|Q9BQU9	Missense_Mutation	DNP	ENST00000370316.3	37	CCDS13514.1	DNP	11	Broad																																																																																				0.619	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080117.3	NM_152864		Missense_Mutation
IFNAR2	3455	broad.mit.edu	37	21	34635017	34635017	+	Intron	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr21:34635017A>T	ENST00000342136.4	+	9	1166				IFNAR2_ENST00000382264.3_Missense_Mutation_p.D331V|IFNAR2_ENST00000404220.3_Missense_Mutation_p.D331V|IFNAR2_ENST00000413881.1_Intron|AP000295.9_ENST00000433395.2_Intron|IFNAR2_ENST00000382241.3_Intron|IL10RB-AS1_ENST00000411998.1_RNA|IFNAR2_ENST00000342101.3_Intron			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2						cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	tgcccCAGTGATTAAGTTTTA	0.393																																																0			21											27.0	32.0	30.0					21																	34635017		1257	2473	3730	33556887	SO:0001627	intron_variant	3455				CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.841-81A>T	21.37:g.34635017A>T		Unknown		x	x	x	33556887	A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Missense_Mutation	SNP	ENST00000342136.4	37	CCDS13621.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007019	0.35415	.	.	ENSG00000159110	ENST00000382264;ENST00000404220	T;T	0.25912	1.77;1.77	1.62	1.62	0.23740	.	.	.	.	.	T	0.17789	0.0427	L	0.49778	1.585	0.09310	N	0.999998	P	0.40302	0.712	B	0.29862	0.108	T	0.20438	-1.0275	9	0.87932	D	0	.	5.3324	0.15940	1.0:0.0:0.0:0.0	.	331	P48551-2	.	V	331	ENSP00000371699:D331V;ENSP00000384309:D331V	ENSP00000371699:D331V	D	+	2	0	IFNAR2	33556887	0.000000	0.05858	0.001000	0.08648	0.085000	0.17905	0.425000	0.21346	0.989000	0.38761	0.460000	0.39030	GAT		0.393	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139825.1			Missense_Mutation
PKNOX1	5316	broad.mit.edu	37	21	44450198	44450198	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr21:44450198A>G	ENST00000291547.5	+	11	1509	c.1298A>G	c.(1297-1299)gAc>gGc	p.D433G	PKNOX1_ENST00000432907.2_Missense_Mutation_p.D316G	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	433					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D433G(1)		cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						GAGAACAGTGACTCCCTGCAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	21											42.0	39.0	40.0					21																	44450198		2203	4300	6503	43323267	SO:0001583	missense	5316				CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.1298A>G	21.37:g.44450198A>G	ENSP00000291547:p.Asp433Gly	Unknown		x	x	x	43323267	O00528|Q8IWT7	Missense_Mutation	SNP	ENST00000291547.5	37	CCDS13692.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	12.09	1.833141	0.32421	.	.	ENSG00000160199	ENST00000291547;ENST00000432907	D;D	0.88975	-2.19;-2.45	5.43	0.418	0.16429	.	0.669254	0.15828	N	0.242674	T	0.79811	0.4510	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.68202	-0.5471	10	0.87932	D	0	-12.5641	9.1382	0.36888	0.642:0.0:0.358:0.0	.	433	P55347	PKNX1_HUMAN	G	433;316	ENSP00000291547:D433G;ENSP00000402243:D316G	ENSP00000291547:D433G	D	+	2	0	PKNOX1	43323267	1.000000	0.71417	0.994000	0.49952	0.311000	0.27955	4.688000	0.61715	-0.152000	0.11156	0.482000	0.46254	GAC		0.522	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3			Missense_Mutation
MTFP1	51537	broad.mit.edu	37	22	30824620	30824621	+	3'UTR	DNP	GA	GA	AG	rs114347202	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr22:30824620_30824621GA>AG	ENST00000266263.5	+	0	950_951				MTFP1_ENST00000407550.3_3'UTR|RP4-539M6.19_ENST00000439838.1_3'UTR|MTFP1_ENST00000355143.4_Missense_Mutation_p.D123S	NM_016498.4	NP_057582.2	Q9UDX5	MTFP1_HUMAN	mitochondrial fission process 1						apoptotic process (GO:0006915)|mitochondrial fission (GO:0000266)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTGTCCAAAGACCCTGGCACC	0.574																																																0			22																																								29154621	SO:0001624	3_prime_UTR_variant	51537			AF151076	CCDS33634.1, CCDS33635.1	22q	2010-09-02			ENSG00000242114	ENSG00000242114			26945	protein-coding gene	gene with protein product		610235				15155745, 15985469	Standard	NM_016498		Approved	MTP18, HSPC242		Q9UDX5	OTTHUMG00000151057	Exception_encountered	22.37:g.30824620_30824621delinsAG		Unknown		x	x	x	29154620	A6NFQ5|Q9H3K1|Q9P0N6	Missense_Mutation	DNP	ENST00000266263.5	37	CCDS33635.1	DNP	33	Broad																																																																																				0.574	MTFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321126.3	NM_016498		Missense_Mutation
TOM1	10043	broad.mit.edu	37	22	35743161	35743161	+	Nonsense_Mutation	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr22:35743161A>T	ENST00000449058.2	+	15	1563	c.1438A>T	c.(1438-1440)Aag>Tag	p.K480*	TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000447733.1_Nonsense_Mutation_p.K448*|TOM1_ENST00000436462.2_Nonsense_Mutation_p.K442*|TOM1_ENST00000425375.1_Nonsense_Mutation_p.K435*|TOM1_ENST00000411850.1_Nonsense_Mutation_p.K481*	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	480					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)	p.K480*(1)		NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GCCCCGGAAGAAGACCCAGGA	0.647																																																1	Substitution - Nonsense(1)	ovary(1)	22											66.0	75.0	72.0					22																	35743161		2203	4300	6503	34073161	SO:0001587	stop_gained	10043			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1438A>T	22.37:g.35743161A>T	ENSP00000394466:p.Lys480*	Unknown		x	x	x	34073161	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Nonsense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	37	6.367587	0.97511	.	.	ENSG00000100284	ENST00000447733;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000412456;ENST00000451197;ENST00000436462	.	.	.	4.68	4.68	0.58851	.	0.773571	0.11293	N	0.579023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.3801	11.9315	0.52849	1.0:0.0:0.0:0.0	.	.	.	.	X	448;480;481;435;217;489;442	.	ENSP00000413697:K481X	K	+	1	0	TOM1	34073161	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	4.693000	0.61753	1.853000	0.53794	0.459000	0.35465	AAG		0.647	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488		Nonsense_Mutation
TBC1D22A	25771	broad.mit.edu	37	22	47507495	47507496	+	Missense_Mutation	DNP	TT	TT	GC			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr22:47507495_47507496TT>GC	ENST00000337137.4	+	12	1587_1588	c.1421_1422TT>GC	c.(1420-1422)tTT>tGC	p.F474C	TBC1D22A_ENST00000407381.3_Missense_Mutation_p.F415C|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.F427C|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.F396C	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	474							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)	p.F474C(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GAAAAAGATTTTCAAGTAAGTA	0.371																																																1	Substitution - Missense(1)	ovary(1)	22																																								45886160	SO:0001583	missense	25771			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	Exception_encountered	22.37:g.47507495_47507496delinsGC	ENSP00000336724:p.Phe474Cys	Unknown		x	x	x	45886159	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	DNP	ENST00000337137.4	37	CCDS14078.1	DNP	64	Broad																																																																																				0.371	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346		Missense_Mutation
BHLHE40	8553	broad.mit.edu	37	3	5025042	5025042	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:5025042A>C	ENST00000256495.3	+	5	1507	c.904A>C	c.(904-906)Act>Cct	p.T302P		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	302					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						AGGCCATTTCACTAGCAGTGA	0.552																																																0			3											132.0	111.0	118.0					3																	5025042		2203	4300	6503	5000042	SO:0001583	missense	8553			AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.904A>C	3.37:g.5025042A>C	ENSP00000256495:p.Thr302Pro	Unknown		x	x	x	5000042	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	37	CCDS2565.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	1.754	-0.488474	0.04352	.	.	ENSG00000134107	ENST00000256495	T	0.50001	0.76	4.23	-8.46	0.00942	.	2.567670	0.01377	N	0.012773	T	0.25754	0.0627	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11542	-1.0583	10	0.23302	T	0.38	-11.4724	7.0991	0.25327	0.1114:0.5429:0.2521:0.0936	.	302	O14503	BHE40_HUMAN	P	302	ENSP00000256495:T302P	ENSP00000256495:T302P	T	+	1	0	BHLHE40	5000042	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-2.230000	0.01207	-2.389000	0.00587	-0.331000	0.08364	ACT		0.552	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670		Missense_Mutation
PFKFB4	5210	broad.mit.edu	37	3	48576054	48576054	+	Splice_Site	SNP	T	T	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:48576054T>A	ENST00000232375.3	-	7	623		c.e7-2		PFKFB4_ENST00000545984.1_Splice_Site|PFKFB4_ENST00000383734.2_Splice_Site|PFKFB4_ENST00000490115.1_Splice_Site|PFKFB4_ENST00000536104.1_Splice_Site|PFKFB4_ENST00000541519.1_Splice_Site|PFKFB4_ENST00000416568.1_Splice_Site	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.?(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TTTCACTTGCTGCCGGAGCCA	0.597																																																1	Unknown(1)	ovary(1)	3											55.0	48.0	50.0					3																	48576054		2203	4300	6503	48551058	SO:0001630	splice_region_variant	5210			BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.511-2A>T	3.37:g.48576054T>A		Unknown		x	x	x	48551058	Q5S3G5|Q5XLC2|Q64EX5	Splice_Site_SNP	SNP	ENST00000232375.3	37	CCDS2771.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	18.97	3.734900	0.69189	.	.	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519;ENST00000452531;ENST00000412035	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4361	0.50068	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PFKFB4	48551058	1.000000	0.71417	0.973000	0.42090	0.747000	0.42532	7.778000	0.85637	1.794000	0.52575	0.482000	0.46254	.		0.597	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257503.2	NM_004567	Intron	Splice_Site_SNP
MAPKAPK3	7867	broad.mit.edu	37	3	50655112	50655112	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:50655112T>G	ENST00000446044.1	+	4	712	c.116T>G	c.(115-117)gTg>gGg	p.V39G	MAPKAPK3_ENST00000357955.2_Missense_Mutation_p.V39G	NM_001243926.1	NP_001230855.1	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated protein kinase 3	39					activation of MAPK activity (GO:0000187)|innate immune response (GO:0045087)|macropinocytosis (GO:0044351)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|Ras protein signal transduction (GO:0007265)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein serine/threonine kinase activity (GO:0004674)	p.V39G(1)		central_nervous_system(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		AAGTACGCAGTGACCGACGAC	0.687																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	97.0	92.0					3																	50655112		2203	4300	6503	50630116	SO:0001583	missense	7867			U43784	CCDS2832.1	3p21.3	2004-03-10			ENSG00000114738	ENSG00000114738			6888	protein-coding gene	gene with protein product		602130				8626550, 8622688	Standard	NM_004635		Approved	3pK, MAPKAP3, 3PK	uc003dba.2	Q16644	OTTHUMG00000156850	ENST00000446044.1:c.116T>G	3.37:g.50655112T>G	ENSP00000396467:p.Val39Gly	Unknown		x	x	x	50630116	B5BU67	Missense_Mutation	SNP	ENST00000446044.1	37	CCDS2832.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	23.1	4.378096	0.82682	.	.	ENSG00000114738	ENST00000446044;ENST00000430409;ENST00000357955;ENST00000457064	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.57	5.57	0.84162	Protein kinase-like domain (1);	0.063543	0.64402	D	0.000006	T	0.31040	0.0784	N	0.08118	0	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.12734	-1.0536	10	0.72032	D	0.01	-13.9046	14.7141	0.69254	0.0:0.0:0.0:1.0	.	39	Q16644	MAPK3_HUMAN	G	39	ENSP00000396467:V39G;ENSP00000410970:V39G;ENSP00000350639:V39G;ENSP00000402045:V39G	ENSP00000350639:V39G	V	+	2	0	MAPKAPK3	50630116	1.000000	0.71417	0.834000	0.33040	0.987000	0.75469	7.672000	0.83956	2.125000	0.65367	0.459000	0.35465	GTG		0.687	MAPKAPK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346237.1	NM_004635		Missense_Mutation
SUCLG2	8801	broad.mit.edu	37	3	67579524	67579524	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:67579524G>T	ENST00000307227.5	-	3	340	c.313C>A	c.(313-315)Cat>Aat	p.H105N	SUCLG2_ENST00000493112.1_Missense_Mutation_p.H105N|SUCLG2_ENST00000492795.1_Missense_Mutation_p.H105N	NM_003848.3	NP_003839.2	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	105	ATP-grasp.				cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	TTTGTTAAATGAACACCTCCT	0.383																																																0			3											155.0	147.0	149.0					3																	67579524		1849	4084	5933	67662214	SO:0001583	missense	8801			AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000307227.5:c.313C>A	3.37:g.67579524G>T	ENSP00000307432:p.His105Asn	Unknown		x	x	x	67662214	C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	ENST00000307227.5	37	CCDS43104.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517858	0.85495	.	.	ENSG00000172340	ENST00000493112;ENST00000307227;ENST00000541608;ENST00000492795	T;T;T	0.62941	-0.01;-0.01;-0.01	4.92	4.92	0.64577	ATP-grasp fold, subdomain 1 (1);ATP-grasp fold, succinyl-CoA synthetase-type (1);	0.098554	0.64402	D	0.000001	D	0.82563	0.5064	M	0.91510	3.215	0.80722	D	1	D	0.53462	0.96	P	0.62435	0.902	D	0.87240	0.2266	10	0.87932	D	0	.	18.129	0.89595	0.0:0.0:1.0:0.0	.	105	Q96I99	SUCB2_HUMAN	N	105;105;57;105	ENSP00000419325:H105N;ENSP00000307432:H105N;ENSP00000417589:H105N	ENSP00000307432:H105N	H	-	1	0	SUCLG2	67662214	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.715000	0.98748	2.270000	0.75569	0.460000	0.39030	CAT		0.383	SUCLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351993.1	NM_003848		Missense_Mutation
EPHA6	285220	broad.mit.edu	37	3	97311539	97311539	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:97311539C>T	ENST00000514100.1	+	9	888	c.646C>T	c.(646-648)Cca>Tca	p.P216S	EPHA6_ENST00000389672.5_Missense_Mutation_p.P824S|EPHA6_ENST00000442602.2_Missense_Mutation_p.P190S|EPHA6_ENST00000502694.1_Missense_Mutation_p.P216S	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	730						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.P730S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						GGCCCCGCATCCAGTGCCAGG	0.517																																																1	Substitution - Missense(1)	ovary(1)	3											44.0	46.0	45.0					3																	97311539		1841	4082	5923	98794229	SO:0001583	missense	285220			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.646C>T	3.37:g.97311539C>T	ENSP00000421711:p.Pro216Ser	Unknown		x	x	x	98794229	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125712	0.56721	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	T;D;T;T	0.81821	-0.81;-1.54;-1.29;0.34	6.16	6.16	0.99307	Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.86552	0.5960	L	0.41710	1.295	0.40034	D	0.97556	D;D;D;D	0.89917	0.993;0.993;0.998;1.0	D;D;D;D	0.83275	0.968;0.968;0.994;0.996	D	0.85792	0.1368	9	0.49607	T	0.09	.	19.0404	0.92997	0.0:1.0:0.0:0.0	.	190;729;216;216	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	S	824;216;216;190	ENSP00000374323:P824S;ENSP00000421711:P216S;ENSP00000423950:P216S;ENSP00000403100:P190S	ENSP00000374323:P824S	P	+	1	0	EPHA6	98794229	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.744000	0.62118	2.937000	0.99478	0.650000	0.86243	CCA		0.517	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448		Missense_Mutation
KIAA2018	205717	broad.mit.edu	37	3	113376755	113376755	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:113376755C>T	ENST00000478658.1	-	5	3791	c.3774G>A	c.(3772-3774)gcG>gcA	p.A1258A	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.A1258A			Q68DE3	K2018_HUMAN	KIAA2018	1258						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.A1258A(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GGGATAAACCCGCACAGCTGG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	3											80.0	81.0	81.0					3																	113376755		2020	4186	6206	114859445	SO:0001819	synonymous_variant	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3774G>A	3.37:g.113376755C>T		Unknown		x	x	x	114859445	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1	SNP	23	Broad																																																																																				0.483	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		Silent
GP5	2814	broad.mit.edu	37	3	194118094	194118095	+	Missense_Mutation	DNP	GG	GG	CA			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:194118094_194118095GG>CA	ENST00000401815.1	-	1	988_989	c.917_918CC>TG	c.(916-918)cCC>cTG	p.P306L	GP5_ENST00000323007.3_Missense_Mutation_p.P306L			P40197	GPV_HUMAN	glycoprotein V (platelet)	306					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P306L(2)		breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		AGGCGGCGGCGGGCAGGGTGCG	0.718																																																2	Substitution - Missense(2)	ovary(2)	3																																								195599384	SO:0001583	missense	2814			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.917_918delinsCA	3.37:g.194118094_194118095delinsCA	ENSP00000383931:p.Pro306Leu	Unknown		x	x	x	195599383	D1MER9	Missense_Mutation	DNP	ENST00000401815.1	37	CCDS3307.1	DNP	39	Broad																																																																																				0.718	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317710.1	NM_004488		Missense_Mutation
MUC4	4585	broad.mit.edu	37	3	195475824	195475824	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:195475824T>G	ENST00000346145.4	-	23	3314	c.3275A>C	c.(3274-3276)tAc>tCc	p.Y1092S	MUC4_ENST00000475231.1_Missense_Mutation_p.Y5276S|MUC4_ENST00000349607.4_Missense_Mutation_p.Y1041S|MUC4_ENST00000463781.3_Missense_Mutation_p.Y5328S	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	2085					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.Y1092S(1)|p.Y5200S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATGGTCACAGTAGCCCCTACT	0.637																																																2	Substitution - Missense(2)	ovary(2)	3											67.0	60.0	62.0					3																	195475824		2203	4300	6503	196961495	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.3275A>C	3.37:g.195475824T>G	ENSP00000304207:p.Tyr1092Ser	Unknown		x	x	x	196961495	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	37	CCDS3310.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	t	10.84	1.463225	0.26248	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.54279	0.85;1.21;0.58;0.74	5.17	1.18	0.20946	.	0.145669	0.31648	N	0.007285	T	0.62048	0.2396	M	0.65498	2.005	0.25468	N	0.987856	D;D;D;P;P;D	0.89917	0.997;0.994;0.994;0.89;0.89;1.0	D;D;D;B;B;D	0.76575	0.915;0.92;0.92;0.425;0.425;0.988	T	0.50955	-0.8766	10	0.39692	T	0.17	-14.9352	4.9669	0.14094	0.3815:0.0:0.1575:0.461	.	5200;1041;1092;5328;5276;2033	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	S	1041;1092;5328;5276;1828	ENSP00000338109:Y1041S;ENSP00000304207:Y1092S;ENSP00000417498:Y5328S;ENSP00000420243:Y5276S	ENSP00000304207:Y1092S	Y	-	2	0	MUC4	196961495	1.000000	0.71417	0.932000	0.37286	0.877000	0.50540	0.856000	0.27818	0.047000	0.15862	-0.466000	0.05196	TAC		0.637	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406		Missense_Mutation
WDR53	348793	broad.mit.edu	37	3	196287989	196287989	+	Missense_Mutation	SNP	T	T	C	rs370933008		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:196287989T>C	ENST00000332629.5	-	3	925	c.358A>G	c.(358-360)Atc>Gtc	p.I120V	WDR53_ENST00000433160.1_Intron|WDR53_ENST00000429115.1_Intron	NM_182627.1	NP_872433.1	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	120										breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	13	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AAGTCTAGGATTTTGATTGCC	0.438																																																0			3						T	VAL/ILE	0,4406		0,0,2203	138.0	137.0	138.0		358	4.2	1.0	3		138	1,8599	1.2+/-3.3	0,1,4299	no	missense	WDR53	NM_182627.1	29	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	120/359	196287989	1,13005	2203	4300	6503	197772386	SO:0001583	missense	348793			BC054030	CCDS3318.1	3q29	2013-01-09			ENSG00000185798	ENSG00000185798		"""WD repeat domain containing"""	28786	protein-coding gene	gene with protein product		615110				12477932	Standard	NM_182627		Approved	MGC64882, MGC12928	uc003fwt.3	Q7Z5U6	OTTHUMG00000155572	ENST00000332629.5:c.358A>G	3.37:g.196287989T>C	ENSP00000328079:p.Ile120Val	Unknown		x	x	x	197772386	A0MNP1	Missense_Mutation	SNP	ENST00000332629.5	37	CCDS3318.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	9.315	1.056516	0.19907	0.0	1.16E-4	ENSG00000185798	ENST00000332629;ENST00000456677;ENST00000425888	T;T;T	0.51071	1.63;0.72;0.72	5.38	4.24	0.50183	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.120124	0.56097	N	0.000034	T	0.27697	0.0681	N	0.13272	0.32	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.06092	-1.0846	10	0.38643	T	0.18	-15.9644	7.2171	0.25965	0.0:0.2458:0.0:0.7542	.	120	Q7Z5U6	WDR53_HUMAN	V	120	ENSP00000328079:I120V;ENSP00000408087:I120V;ENSP00000396248:I120V	ENSP00000328079:I120V	I	-	1	0	WDR53	197772386	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.287000	0.33284	1.074000	0.40909	0.533000	0.62120	ATC		0.438	WDR53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340689.1	NM_182627		Missense_Mutation
CHRNA9	55584	broad.mit.edu	37	4	40355996	40355996	+	Splice_Site	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:40355996G>A	ENST00000310169.2	+	5	1038	c.899G>A	c.(898-900)gGt>gAt	p.G300D		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	300					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)	p.G300D(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	TTAATTCCAGGTAAATACTAC	0.463																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)											1	Substitution - Missense(1)	ovary(1)	4											83.0	89.0	87.0					4																	40355996		2203	4300	6503	40050753	SO:0001630	splice_region_variant	55584			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.899-1G>A	4.37:g.40355996G>A		Unknown		x	x	x	40050753	Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	CCDS3459.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930541	0.92389	.	.	ENSG00000174343	ENST00000310169	D	0.85013	-1.93	5.72	5.72	0.89469	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.097562	0.64402	D	0.000001	D	0.94801	0.8321	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95478	0.8558	9	.	.	.	.	19.877	0.96880	0.0:0.0:1.0:0.0	.	300	Q9UGM1	ACHA9_HUMAN	D	300	ENSP00000312663:G300D	.	G	+	2	0	CHRNA9	40050753	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.476000	0.97823	2.709000	0.92574	0.561000	0.74099	GGT		0.463	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1		Missense_Mutation	Missense_Mutation
RASL11B	65997	broad.mit.edu	37	4	53731857	53731857	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:53731857C>T	ENST00000248706.3	+	4	850	c.632C>T	c.(631-633)cCc>cTc	p.P211L	RASL11B_ENST00000505041.1_3'UTR	NM_023940.2	NP_076429.1			RAS-like, family 11, member B									p.P211L(1)		autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			AGCAGTACACCCGAGAAGCGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	4											112.0	109.0	110.0					4																	53731857		2203	4300	6503	53426614	SO:0001583	missense	65997			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.632C>T	4.37:g.53731857C>T	ENSP00000248706:p.Pro211Leu	Unknown		x	x	x	53426614		Missense_Mutation	SNP	ENST00000248706.3	37	CCDS3490.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469384	0.26423	.	.	ENSG00000128045	ENST00000248706	T	0.78924	-1.22	5.57	4.73	0.59995	.	0.140194	0.64402	N	0.000003	T	0.67116	0.2859	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.61840	-0.6980	10	0.37606	T	0.19	.	13.2755	0.60184	0.0:0.9242:0.0:0.0758	.	211	Q9BPW5	RSLBB_HUMAN	L	211	ENSP00000248706:P211L	ENSP00000248706:P211L	P	+	2	0	RASL11B	53426614	0.967000	0.33354	0.229000	0.23960	0.116000	0.19942	5.746000	0.68681	1.336000	0.45506	0.655000	0.94253	CCC		0.498	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219931.2	NM_023940		Missense_Mutation
TRAM1L1	133022	broad.mit.edu	37	4	118005903	118005903	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:118005903T>G	ENST00000310754.4	-	1	833	c.647A>C	c.(646-648)aAt>aCt	p.N216T		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	216	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.N216T(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						TCCCAAATGATTCAAGTACAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											125.0	119.0	121.0					4																	118005903		2203	4300	6503	118225351	SO:0001583	missense	133022			AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.647A>C	4.37:g.118005903T>G	ENSP00000309402:p.Asn216Thr	Unknown		x	x	x	118225351	Q8N2L7	Missense_Mutation	SNP	ENST00000310754.4	37	CCDS3707.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	0.027	-1.364338	0.01235	.	.	ENSG00000174599	ENST00000310754	D	0.84070	-1.8	3.88	3.88	0.44766	TRAM/LAG1/CLN8 homology domain (3);	0.132495	0.64402	D	0.000003	T	0.64023	0.2561	N	0.11756	0.17	0.50039	D	0.999842	B	0.12630	0.006	B	0.18871	0.023	T	0.58736	-0.7584	10	0.02654	T	1	-20.8912	11.3167	0.49396	0.0:0.0:0.0:1.0	.	216	Q8N609	TR1L1_HUMAN	T	216	ENSP00000309402:N216T	ENSP00000309402:N216T	N	-	2	0	TRAM1L1	118225351	1.000000	0.71417	0.347000	0.25668	0.008000	0.06430	3.905000	0.56333	1.982000	0.57802	0.533000	0.62120	AAT		0.393	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402		Missense_Mutation
DCTD	1635	broad.mit.edu	37	4	183815687	183815687	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:183815687C>G	ENST00000438320.2	-	4	606	c.316G>C	c.(316-318)Gcc>Ccc	p.A106P	DCTD_ENST00000357067.3_Missense_Mutation_p.A117P|DCTD_ENST00000510370.1_Missense_Mutation_p.A106P	NM_001921.2	NP_001912.2	P32321	DCTD_HUMAN	dCMP deaminase	106					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	dCMP deaminase activity (GO:0004132)|zinc ion binding (GO:0008270)	p.A106P(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|urinary_tract(1)	18		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)	Cytarabine(DB00987)	GGGAACAAGGCAACATACATA	0.458																																																1	Substitution - Missense(1)	ovary(1)	4											199.0	159.0	172.0					4																	183815687		2203	4300	6503	184052681	SO:0001583	missense	1635			L12136	CCDS3831.1, CCDS34108.1	4q35.1	2008-08-01			ENSG00000129187	ENSG00000129187	3.5.4.12		2710	protein-coding gene	gene with protein product		607638					Standard	XM_005262778		Approved		uc003ivg.3	P32321	OTTHUMG00000160685	ENST00000438320.2:c.316G>C	4.37:g.183815687C>G	ENSP00000398194:p.Ala106Pro	Unknown		x	x	x	184052681	B2R836|D3DP49|D3DP50|Q5M7Z8|Q9BVD8	Missense_Mutation	SNP	ENST00000438320.2	37	CCDS3831.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.167071	0.94768	.	.	ENSG00000129187	ENST00000357067;ENST00000438320;ENST00000510370;ENST00000503182;ENST00000510307;ENST00000512766	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.53	5.53	0.82687	APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.89917	0.994;1.0;0.997;0.994	D;D;D;D	0.97110	0.992;1.0;0.99;0.992	T	0.62364	-0.6870	10	0.87932	D	0	-10.3075	19.4604	0.94915	0.0:1.0:0.0:0.0	.	106;47;117;106	D6RBJ9;B4DDC2;P32321-2;P32321	.;.;.;DCTD_HUMAN	P	117;106;106;106;106;106	ENSP00000349576:A117P;ENSP00000398194:A106P;ENSP00000424017:A106P;ENSP00000422662:A106P;ENSP00000424050:A106P;ENSP00000423182:A106P	ENSP00000349576:A117P	A	-	1	0	DCTD	184052681	1.000000	0.71417	0.972000	0.41901	0.940000	0.58332	7.776000	0.85560	2.602000	0.87976	0.650000	0.86243	GCC		0.458	DCTD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361743.2			Missense_Mutation
FRG2	448831	broad.mit.edu	37	4	190946952	190946952	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:190946952G>T	ENST00000378763.1	-	4	653	c.601C>A	c.(601-603)Cca>Aca	p.P201T	FRG2_ENST00000504750.1_Missense_Mutation_p.P202T	NM_001005217.1|NM_001199232.1	NP_001005217.1|NP_001186161.1	Q64ET8	FRG2_HUMAN	FSHD region gene 2	201						nucleus (GO:0005634)		p.P201T(1)		large_intestine(1)|lung(3)|ovary(2)|skin(1)	7		all_cancers(14;1.01e-50)|all_epithelial(14;6.7e-35)|all_lung(41;2.17e-14)|Lung NSC(41;4.95e-14)|Breast(6;3.4e-05)|Melanoma(20;0.000539)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|all_hematologic(60;0.0489)|Prostate(90;0.0513)		all cancers(3;3.83e-31)|Epithelial(3;1.36e-30)|OV - Ovarian serous cystadenocarcinoma(60;1.99e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00831)|READ - Rectum adenocarcinoma(43;0.155)		CAGGTAAGTGGAGAATGGATC	0.547																																																1	Substitution - Missense(1)	ovary(1)	4											0.0	1.0	1.0					4																	190946952		0	1	1	191183946	SO:0001583	missense	448831				CCDS34123.1, CCDS68834.1	4q35.2	2014-09-04			ENSG00000205097	ENSG00000205097			19136	protein-coding gene	gene with protein product		609032				12176321, 15520407	Standard	NM_001005217		Approved	FRG2A		Q64ET8	OTTHUMG00000160339	ENST00000378763.1:c.601C>A	4.37:g.190946952G>T	ENSP00000368039:p.Pro201Thr	Unknown		x	x	x	191183946	B7ZMJ1|E7EN36	Missense_Mutation	SNP	ENST00000378763.1	37	CCDS34123.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	.	8.396	0.840940	0.16891	.	.	ENSG00000205097	ENST00000504750;ENST00000378763	T;T	0.48522	0.81;0.81	0.352	0.352	0.16051	.	0.419100	0.17741	N	0.163577	T	0.48502	0.1503	L	0.27053	0.805	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.31530	-0.9940	9	0.41790	T	0.15	-5.3249	.	.	.	.	202;201	E7EN36;Q64ET8	.;FRG2_HUMAN	T	202;201	ENSP00000424015:P202T;ENSP00000368039:P201T	ENSP00000368039:P201T	P	-	1	0	FRG2	191183946	0.020000	0.18652	0.002000	0.10522	0.002000	0.02628	0.320000	0.19540	0.423000	0.26033	0.423000	0.28283	CCA		0.547	FRG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360294.1	NM_001005217		Missense_Mutation
SDHA	6389	broad.mit.edu	37	5	226126	226126	+	Silent	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr5:226126G>T	ENST00000264932.6	+	5	700	c.585G>T	c.(583-585)cgG>cgT	p.R195R	SDHA_ENST00000510361.1_Silent_p.R147R|SDHA_ENST00000504309.1_Silent_p.R195R	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	195					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)	p.R195R(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TGGCTGATCGGACTGGCCACT	0.572									Familial Paragangliomas																																							1	Substitution - coding silent(1)	ovary(1)	5											63.0	59.0	60.0					5																	226126		2203	4300	6503	279126	SO:0001819	synonymous_variant	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.585G>T	5.37:g.226126G>T		Unknown		x	x	x	279126	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Silent	SNP	ENST00000264932.6	37	CCDS3853.1	SNP	41	Broad																																																																																				0.572	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168		Silent
ZFR	51663	broad.mit.edu	37	5	32415192	32415192	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr5:32415192G>A	ENST00000265069.8	-	5	768	c.666C>T	c.(664-666)acC>acT	p.T222T		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	222	Ala-rich.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AGAAAGTAGTGGTAGCTGGAC	0.512																																																0			5											216.0	189.0	198.0					5																	32415192		2203	4300	6503	32450949	SO:0001819	synonymous_variant	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.666C>T	5.37:g.32415192G>A		Unknown		x	x	x	32450949	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	ENST00000265069.8	37	CCDS34139.1	SNP	47	Broad																																																																																				0.512	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1			Silent
DDX46	9879	broad.mit.edu	37	5	134121240	134121240	+	Silent	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr5:134121240G>A	ENST00000354283.4	+	11	1563	c.1428G>A	c.(1426-1428)gtG>gtA	p.V476V	DDX46_ENST00000452510.2_Silent_p.V476V|DDX46_ENST00000509178.1_3'UTR			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	476	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GACTTAGAGTGGTCTGTGTTT	0.368																																					Colon(13;391 453 4901 21675 24897)											0			5											165.0	167.0	167.0					5																	134121240		2203	4300	6503	134149139	SO:0001819	synonymous_variant	9879				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.1428G>A	5.37:g.134121240G>A		Unknown		x	x	x	134149139	O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	37	CCDS34240.1	SNP	47	Broad																																																																																				0.368	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829		Silent
PCDHB16	57717	broad.mit.edu	37	5	140567813	140567813	+	IGR	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr5:140567813T>G	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAATTGCTTGATTATGAGT	0.328																																																0			5											28.0	29.0	29.0					5																	140567813		2023	4227	6250	140547997	SO:0001628	intergenic_variant	56127			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140567813T>G		Unknown		x	x	x	140547997	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	CCDS4251.1	SNP	63	Broad																																																																																				0.328	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		Silent
DPYSL3	1809	broad.mit.edu	37	5	146780347	146780347	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr5:146780347G>C	ENST00000398514.3	-	10	1389	c.1018C>G	c.(1018-1020)Cag>Gag	p.Q340E	CTB-108O6.2_ENST00000607270.1_RNA|DPYSL3_ENST00000343218.5_Missense_Mutation_p.Q454E|DPYSL3_ENST00000534907.1_Intron	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	340					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)	p.Q340E(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTGCTTTCTGGGCAGTGCTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	5											110.0	115.0	114.0					5																	146780347		2196	4299	6495	146760540	SO:0001583	missense	1809			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1018C>G	5.37:g.146780347G>C	ENSP00000381526:p.Gln340Glu	Unknown		x	x	x	146760540	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	CCDS43381.1	SNP	47	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.184897|5.184897	0.94885|0.94885	.|.	.|.	ENSG00000113657|ENSG00000113657	ENST00000520473|ENST00000398514;ENST00000343218	.|D;D	.|0.90004	.|-2.6;-2.6	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93959|0.93959	0.8066|0.8066	M|M	0.71206|0.71206	2.165|2.165	0.80722|0.80722	D|D	1|1	.|P;D	.|0.76494	.|0.956;0.999	.|P;D	.|0.66196	.|0.86;0.942	D|D	0.94079|0.94079	0.7342|0.7342	5|10	.|0.87932	.|D	.|0	-23.6366|-23.6366	19.8183|19.8183	0.96579|0.96579	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|454;340	.|B3SXQ8;Q14195	.|.;DPYL3_HUMAN	R|E	38|340;454	.|ENSP00000381526:Q340E;ENSP00000343690:Q454E	.|ENSP00000343690:Q454E	P|Q	-|-	2|1	0|0	DPYSL3|DPYSL3	146760540|146760540	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.706000|9.706000	0.98722|0.98722	2.761000|2.761000	0.94854|0.94854	0.650000|0.650000	0.86243|0.86243	CCA|CAG		0.562	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387		Missense_Mutation
STK10	6793	broad.mit.edu	37	5	171533644	171533645	+	Missense_Mutation	DNP	CG	CG	AA			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr5:171533644_171533645CG>AA	ENST00000176763.5	-	6	1110_1111	c.767_768CG>TT	c.(766-768)aCG>aTT	p.T256I		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	256	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.T256I(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCGTGAGCAGCGTGGGAGGGTC	0.663											OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	5																																								171466250	SO:0001583	missense	6793			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.767_768delinsAA	5.37:g.171533644_171533645delinsAA	ENSP00000176763:p.Thr256Ile	Unknown	1893	x	x	x	171466249	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	DNP	ENST00000176763.5	37	CCDS34290.1	DNP	27	Broad																																																																																				0.663	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990		Missense_Mutation
RREB1	6239	broad.mit.edu	37	6	7182297	7182297	+	Silent	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr6:7182297G>C	ENST00000349384.6	+	4	467	c.153G>C	c.(151-153)cgG>cgC	p.R51R	RREB1_ENST00000379933.3_Silent_p.R51R|RREB1_ENST00000334984.6_Silent_p.R51R|RP11-405O10.2_ENST00000451355.2_RNA|RREB1_ENST00000379938.2_Silent_p.R51R	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	51					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R51R(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GACCAAATCGGATTGGCAGAA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	6											48.0	47.0	47.0					6																	7182297		2203	4300	6503	7127296	SO:0001819	synonymous_variant	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.153G>C	6.37:g.7182297G>C		Unknown		x	x	x	7127296	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Silent	SNP	ENST00000349384.6	37	CCDS34336.1	SNP	41	Broad																																																																																				0.532	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			Silent
RIMS1	22999	broad.mit.edu	37	6	72892194	72892194	+	Silent	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr6:72892194G>T	ENST00000521978.1	+	6	1020	c.1020G>T	c.(1018-1020)gcG>gcT	p.A340A	RIMS1_ENST00000522291.1_Silent_p.A340A|RIMS1_ENST00000348717.5_Silent_p.A340A|RIMS1_ENST00000264839.7_Silent_p.A340A|RIMS1_ENST00000517960.1_Silent_p.A340A|RIMS1_ENST00000518273.1_Silent_p.A340A|RIMS1_ENST00000520567.1_Silent_p.A340A|RIMS1_ENST00000491071.2_Silent_p.A340A	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	340					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.A340A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GCAAAGCGGCGGATGAGGAAA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	6											31.0	41.0	38.0					6																	72892194		1983	4157	6140	72948915	SO:0001819	synonymous_variant	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.1020G>T	6.37:g.72892194G>T		Unknown		x	x	x	72948915	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	37	CCDS47449.1	SNP	39	Broad																																																																																				0.577	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			Silent
TPBG	7162	broad.mit.edu	37	6	83075084	83075084	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr6:83075084G>T	ENST00000369750.3	+	2	1023	c.406G>T	c.(406-408)Ggc>Tgc	p.G136C	TPBG_ENST00000543496.1_Missense_Mutation_p.G136C|TPBG_ENST00000535040.1_Missense_Mutation_p.G136C			Q13641	TPBG_HUMAN	trophoblast glycoprotein	136					cell adhesion (GO:0007155)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)		p.G136C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		GGTGCGCGCGGGCGCCTTCGA	0.736																																																1	Substitution - Missense(1)	ovary(1)	6											20.0	23.0	22.0					6																	83075084		2183	4279	6462	83131803	SO:0001583	missense	7162			AJ012159	CCDS4995.1	6q14-q15	2008-07-29			ENSG00000146242	ENSG00000146242			12004	protein-coding gene	gene with protein product		190920				8132670	Standard	NM_006670		Approved	5T4-AG, 5T4	uc003pjo.3	Q13641	OTTHUMG00000015103	ENST00000369750.3:c.406G>T	6.37:g.83075084G>T	ENSP00000358765:p.Gly136Cys	Unknown		x	x	x	83131803	A8K555	Missense_Mutation	SNP	ENST00000369750.3	37	CCDS4995.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	14.70	2.615102	0.46631	.	.	ENSG00000146242	ENST00000535040;ENST00000369750;ENST00000543496	T;T;T	0.59224	0.28;0.28;0.28	4.41	4.41	0.53225	.	0.712700	0.13161	N	0.409041	T	0.64494	0.2603	M	0.85299	2.745	0.09310	N	1	D	0.71674	0.998	P	0.57776	0.827	T	0.58411	-0.7641	10	0.66056	D	0.02	-15.3167	10.792	0.46438	0.0877:0.0:0.9123:0.0	.	136	Q13641	TPBG_HUMAN	C	136	ENSP00000441219:G136C;ENSP00000358765:G136C;ENSP00000440049:G136C	ENSP00000358765:G136C	G	+	1	0	TPBG	83131803	0.546000	0.26457	0.873000	0.34254	0.928000	0.56348	3.559000	0.53756	2.265000	0.75225	0.462000	0.41574	GGC		0.736	TPBG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041340.1			Missense_Mutation
SYNE1	23345	broad.mit.edu	37	6	152560819	152560819	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr6:152560819G>A	ENST00000367255.5	-	108	20517	c.19916C>T	c.(19915-19917)tCt>tTt	p.S6639F	SYNE1_ENST00000341594.5_Missense_Mutation_p.S6251F|SYNE1_ENST00000265368.4_Missense_Mutation_p.S6639F|SYNE1_ENST00000448038.1_Missense_Mutation_p.S6568F|SYNE1_ENST00000423061.1_Missense_Mutation_p.S6568F|SYNE1_ENST00000356820.4_Missense_Mutation_p.S1163F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6639					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATCATATGAGATTCCAGGCC	0.408										HNSCC(10;0.0054)																																						0			6											70.0	67.0	68.0					6																	152560819		2203	4300	6503	152602512	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19916C>T	6.37:g.152560819G>A	ENSP00000356224:p.Ser6639Phe	Unknown		x	x	x	152602512	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296093	0.40594	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000011	T	0.21674	0.0522	L	0.53249	1.67	0.46564	D	0.999109	B;B;P	0.34909	0.344;0.344;0.475	B;B;B	0.30251	0.053;0.053;0.113	T	0.05273	-1.0895	10	0.18276	T	0.48	.	19.8351	0.96655	0.0:0.0:1.0:0.0	.	6639;6639;6568	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	F	6639;6568;6639;6568;6251;1163	ENSP00000356224:S6639F;ENSP00000396024:S6568F;ENSP00000265368:S6639F;ENSP00000390975:S6568F;ENSP00000341887:S6251F;ENSP00000349276:S1163F	ENSP00000265368:S6639F	S	-	2	0	SYNE1	152602512	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.986000	0.63851	2.687000	0.91594	0.655000	0.94253	TCT		0.408	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Missense_Mutation
SYNE1	23345	broad.mit.edu	37	6	152658125	152658126	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr6:152658125_152658126TC>AT	ENST00000367255.5	-	76	12979_12980	c.12378_12379GA>AT	c.(12376-12381)caGAac>caATac	p.N4127Y	SYNE1_ENST00000341594.5_Missense_Mutation_p.N3992Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.N4127Y|SYNE1_ENST00000448038.1_Missense_Mutation_p.N4056Y|SYNE1_ENST00000423061.1_Missense_Mutation_p.N4056Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4127					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.N4127Y(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGAGTTAAGTTCTGGGCCTGGA	0.431										HNSCC(10;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	6																																								152699819	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12378_12379delinsAT	6.37:g.152658125_152658126delinsAT	ENSP00000356224:p.Asn4127Tyr	Unknown		x	x	x	152699818	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	DNP	ENST00000367255.5	37	CCDS5236.2	DNP	62	Broad																																																																																				0.431	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Missense_Mutation
ARL4A	10124	broad.mit.edu	37	7	12728205	12728205	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:12728205A>T	ENST00000396663.1	+	2	808	c.326A>T	c.(325-327)gAa>gTa	p.E109V	ARL4A_ENST00000396662.1_Missense_Mutation_p.E109V|ARL4A_ENST00000396664.2_Missense_Mutation_p.E109V|ARL4A_ENST00000356797.3_Missense_Mutation_p.E109V|ARL4A_ENST00000404894.1_Missense_Mutation_p.E109V	NM_001037164.2|NM_001195396.1|NM_005738.4|NM_212460.3	NP_001032241.1|NP_001182325.1|NP_005729.1|NP_997625.1	P40617	ARL4A_HUMAN	ADP-ribosylation factor-like 4A	109					brown fat cell differentiation (GO:0050873)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.E109V(1)		NS(2)|lung(3)|ovary(1)	6				UCEC - Uterine corpus endometrioid carcinoma (126;0.176)		GAAAGGATGGAAGAAGCCAAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	7											35.0	34.0	34.0					7																	12728205		2202	4297	6499	12694730	SO:0001583	missense	10124			U73960	CCDS5359.1	7p21.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000122644	ENSG00000122644		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	695	protein-coding gene	gene with protein product		604786	"""ADP-ribosylation factor-like 4"""	ARL4			Standard	NM_212460		Approved		uc003ssq.3	P40617	OTTHUMG00000023374	ENST00000396663.1:c.326A>T	7.37:g.12728205A>T	ENSP00000379898:p.Glu109Val	Unknown		x	x	x	12694730	A4D119|P80418|Q49AF5	Missense_Mutation	SNP	ENST00000396663.1	37	CCDS5359.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	17.91	3.504950	0.64410	.	.	ENSG00000122644	ENST00000396662;ENST00000356797;ENST00000396664;ENST00000396663;ENST00000404894	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	4.39	4.39	0.52855	Small GTP-binding protein domain (1);	0.061993	0.64402	D	0.000007	T	0.71863	0.3390	L	0.58925	1.835	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.68172	-0.5479	10	0.19590	T	0.45	.	14.13	0.65247	1.0:0.0:0.0:0.0	.	109	P40617	ARL4A_HUMAN	V	109	ENSP00000379897:E109V;ENSP00000349250:E109V;ENSP00000379899:E109V;ENSP00000379898:E109V;ENSP00000385236:E109V	ENSP00000349250:E109V	E	+	2	0	ARL4A	12694730	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.127000	0.77210	1.995000	0.58328	0.449000	0.29647	GAA		0.403	ARL4A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326036.1	NM_005738		Missense_Mutation
GRB10	2887	broad.mit.edu	37	7	50742237	50742237	+	Silent	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:50742237G>C	ENST00000401949.1	-	6	727	c.258C>G	c.(256-258)gcC>gcG	p.A86A	GRB10_ENST00000406641.1_Silent_p.A28A|GRB10_ENST00000403097.1_Silent_p.A80A|GRB10_ENST00000402497.1_Silent_p.A28A|GRB10_ENST00000439599.1_Silent_p.A80A|GRB10_ENST00000398812.2_Silent_p.A86A|GRB10_ENST00000398810.2_Silent_p.A28A|GRB10_ENST00000357271.5_Silent_p.A86A|GRB10_ENST00000407526.1_Silent_p.A28A|GRB10_ENST00000402578.1_Silent_p.A28A|GRB10_ENST00000335866.3_Silent_p.A28A			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	86					insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)	p.A86A(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					GCTGGCTGCGGGCATGCTGGC	0.647									Russell-Silver syndrome																																							1	Substitution - coding silent(1)	ovary(1)	7											45.0	52.0	50.0					7																	50742237		2089	4211	6300	50709731	SO:0001819	synonymous_variant	2887	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.258C>G	7.37:g.50742237G>C		Unknown		x	x	x	50709731	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Silent	SNP	ENST00000401949.1	37	CCDS43582.1	SNP	43	Broad																																																																																				0.647	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1			Silent
PCLO	27445	broad.mit.edu	37	7	82583854	82583854	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:82583854C>A	ENST00000333891.9	-	5	6752	c.6415G>T	c.(6415-6417)Gaa>Taa	p.E2139*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.E2139*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E2139Q(2)|p.E2070Q(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCAATTTCTTCTGTTGAAAAA	0.393																																																3	Substitution - Missense(3)	lung(3)	7											78.0	77.0	77.0					7																	82583854		1845	4099	5944	82421790	SO:0001587	stop_gained	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6415G>T	7.37:g.82583854C>A	ENSP00000334319:p.Glu2139*	Unknown		x	x	x	82421790		Nonsense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	49	15.731666	0.99843	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9785	0.97317	0.0:1.0:0.0:0.0	.	.	.	.	X	2070;2139;2139	.	ENSP00000334319:E2139X	E	-	1	0	PCLO	82421790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.534000	0.82004	2.724000	0.93272	0.650000	0.86243	GAA		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		Nonsense_Mutation
ACN9	57001	broad.mit.edu	37	7	96747118	96747118	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:96747118A>G	ENST00000360382.4	+	1	84	c.83A>G	c.(82-84)aAa>aGa	p.K28R	ACN9_ENST00000432641.2_Missense_Mutation_p.K28R					ACN9 homolog (S. cerevisiae)									p.K28R(1)		large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(3)	10	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					CCGGACCTCAAATCCCTGGGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											100.0	90.0	93.0					7																	96747118		2203	4300	6503	96585054	SO:0001583	missense	57001			BC028409	CCDS5648.1	7q22.1	2006-02-09			ENSG00000196636	ENSG00000196636			21752	protein-coding gene	gene with protein product		615773					Standard	NM_020186		Approved	DC11	uc003uoo.4	Q9NRP4	OTTHUMG00000154064	ENST00000360382.4:c.83A>G	7.37:g.96747118A>G	ENSP00000353548:p.Lys28Arg	Unknown		x	x	x	96585054		Missense_Mutation	SNP	ENST00000360382.4	37		SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	4.761	0.141492	0.09083	.	.	ENSG00000196636	ENST00000432641;ENST00000360382	.	.	.	5.07	2.72	0.32119	.	0.127727	0.48767	D	0.000162	T	0.12860	0.0312	N	0.05280	-0.08	0.29840	N	0.82927	B	0.25955	0.138	B	0.25884	0.064	T	0.31081	-0.9956	9	0.02654	T	1	-16.7651	6.2217	0.20685	0.7492:0.1645:0.0863:0.0	.	28	Q9NRP4	ACN9_HUMAN	R	28	.	ENSP00000353548:K28R	K	+	2	0	ACN9	96585054	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	2.454000	0.44979	1.044000	0.40200	-0.313000	0.08912	AAA		0.592	ACN9-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333686.3	NM_020186		Missense_Mutation
GAL3ST4	79690	broad.mit.edu	37	7	99758403	99758403	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:99758403G>C	ENST00000360039.4	-	4	1001	c.609C>G	c.(607-609)gaC>gaG	p.D203E	GAL3ST4_ENST00000413800.1_Missense_Mutation_p.D203E|C7orf43_ENST00000457641.1_5'Flank|C7orf43_ENST00000316937.3_5'Flank|GAL3ST4_ENST00000426974.2_Missense_Mutation_p.D141E|GAL3ST4_ENST00000411994.1_Missense_Mutation_p.T102S|GAL3ST4_ENST00000423751.1_Missense_Mutation_p.T102S	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	203				RGDH -> VGTT (in Ref. 2; AAL55759). {ECO:0000305}.	cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.D203E(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGCGTAGTGGTCCCCACGGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											53.0	57.0	56.0					7																	99758403		2203	4300	6503	99596339	SO:0001583	missense	79690			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.609C>G	7.37:g.99758403G>C	ENSP00000353142:p.Asp203Glu	Unknown		x	x	x	99596339	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Missense_Mutation	SNP	ENST00000360039.4	37	CCDS5688.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.38|16.38	3.108178|3.108178	0.56291|0.56291	.|.	.|.	ENSG00000197093|ENSG00000197093	ENST00000413800;ENST00000360039;ENST00000426974|ENST00000423751;ENST00000411994	T;T;T|.	0.13196|.	2.61;2.61;2.61|.	4.82|4.82	3.94|3.94	0.45596|0.45596	.|.	0.211286|.	0.37437|.	U|.	0.002086|.	T|T	0.40196|0.40196	0.1107|0.1107	L|L	0.33485|0.33485	1.01|1.01	0.30076|0.30076	N|N	0.809575|0.809575	D;P|.	0.63046|.	0.992;0.472|.	P;B|.	0.54815|.	0.761;0.197|.	T|T	0.44528|0.44528	-0.9322|-0.9322	10|6	0.16896|0.87932	T|D	0.51|0	-7.8831|-7.8831	10.6008|10.6008	0.45365|0.45365	0.0942:0.0:0.9058:0.0|0.0942:0.0:0.9058:0.0	.|.	141;203|.	B4DWL8;Q96RP7|.	.;G3ST4_HUMAN|.	E|S	203;203;141|102	ENSP00000400451:D203E;ENSP00000353142:D203E;ENSP00000398304:D141E|.	ENSP00000353142:D203E|ENSP00000414733:T102S	D|T	-|-	3|2	2|0	GAL3ST4|GAL3ST4	99596339|99596339	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.288000|3.288000	0.51739|0.51739	1.259000|1.259000	0.44117|0.44117	0.511000|0.511000	0.50034|0.50034	GAC|ACC		0.567	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637		Missense_Mutation
CUX1	1523	broad.mit.edu	37	7	101882758	101882758	+	Silent	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:101882758C>A	ENST00000292535.7	+	23	3819	c.3781C>A	c.(3781-3783)Cga>Aga	p.R1261R	CUX1_ENST00000556210.1_Silent_p.R1103R|CUX1_ENST00000546411.2_Silent_p.R1159R|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000549414.2_Silent_p.R1239R|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000360264.3_Silent_p.R1272R|CUX1_ENST00000437600.4_Intron|AC005088.1_ENST00000580604.1_RNA|CUX1_ENST00000550008.2_Silent_p.R1205R|CUX1_ENST00000560541.1_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1261					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.R1261R(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GGCGCTGAAACGAGCGTATCA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	7											99.0	96.0	97.0					7																	101882758		2203	4300	6503	101669478	SO:0001819	synonymous_variant	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3781C>A	7.37:g.101882758C>A		Unknown		x	x	x	101669478	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	37	CCDS5721.1	SNP	19	Broad																																																																																				0.602	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		Silent
NUP205	23165	broad.mit.edu	37	7	135301468	135301468	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:135301468A>T	ENST00000285968.6	+	25	3552	c.3526A>T	c.(3526-3528)Aca>Tca	p.T1176S		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1176					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.T1176S(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TGACACTGCTACAAAAGGTAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	7											51.0	49.0	50.0					7																	135301468		2203	4296	6499	134952008	SO:0001583	missense	23165			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3526A>T	7.37:g.135301468A>T	ENSP00000285968:p.Thr1176Ser	Unknown		x	x	x	134952008	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	3.505	-0.101087	0.06967	.	.	ENSG00000155561	ENST00000285968	T	0.28666	1.6	5.53	4.37	0.52481	.	0.098834	0.64402	D	0.000001	T	0.13884	0.0336	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08827	-1.0703	10	0.07482	T	0.82	-17.9564	6.2104	0.20626	0.6729:0.0:0.0738:0.2533	.	1176	Q92621	NU205_HUMAN	S	1176	ENSP00000285968:T1176S	ENSP00000285968:T1176S	T	+	1	0	NUP205	134952008	0.921000	0.31238	0.815000	0.32552	0.624000	0.37722	3.077000	0.50089	0.925000	0.37094	0.454000	0.30748	ACA		0.313	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			Missense_Mutation
RP1L1	94137	broad.mit.edu	37	8	10469533	10469533	+	Missense_Mutation	SNP	C	C	G	rs142446035		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr8:10469533C>G	ENST00000382483.3	-	4	2298	c.2075G>C	c.(2074-2076)cGg>cCg	p.R692P		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	692					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.R692P(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGCCCTTCGCCGCTCAGGAGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	8											51.0	62.0	59.0					8																	10469533		2149	4237	6386	10506943	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2075G>C	8.37:g.10469533C>G	ENSP00000371923:p.Arg692Pro	Unknown		x	x	x	10506943	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	11.80	1.745316	0.30955	.	.	ENSG00000183638	ENST00000382483	T	0.05081	3.5	4.23	-1.25	0.09405	.	2.070540	0.02681	N	0.109630	T	0.04907	0.0132	L	0.27053	0.805	0.09310	N	1	P	0.35226	0.491	B	0.31495	0.131	T	0.32322	-0.9911	10	0.72032	D	0.01	0.9063	3.1638	0.06529	0.2801:0.3636:0.2729:0.0834	.	692	A6NKC6	.	P	692	ENSP00000371923:R692P	ENSP00000371923:R692P	R	-	2	0	RP1L1	10506943	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.070000	0.03440	-0.132000	0.11557	-0.355000	0.07637	CGG		0.632	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Missense_Mutation
SOX7	83595	broad.mit.edu	37	8	10583964	10583964	+	Missense_Mutation	SNP	C	C	G	rs144520548		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr8:10583964C>G	ENST00000304501.1	-	2	529	c.451G>C	c.(451-453)Ggc>Cgc	p.G151R	SOX7_ENST00000554914.1_Missense_Mutation_p.G203R|SOX7_ENST00000553390.1_Missense_Mutation_p.G203R|CTD-2135J3.3_ENST00000506149.2_RNA	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	151					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G151R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		CCCCGGCTGCCGCTTCTCTTC	0.711																																																1	Substitution - Missense(1)	ovary(1)	8											15.0	18.0	17.0					8																	10583964		2179	4263	6442	10621374	SO:0001583	missense	83595			AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.451G>C	8.37:g.10583964C>G	ENSP00000301921:p.Gly151Arg	Unknown		x	x	x	10621374	B4DKV0|Q53YD0	Missense_Mutation	SNP	ENST00000304501.1	37	CCDS5977.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	5.330	0.246199	0.10130	.	.	ENSG00000171056;ENSG00000171056;ENSG00000258724	ENST00000304501;ENST00000553390;ENST00000554914	D;D;D	0.99519	-5.12;-6.07;-6.07	4.49	0.63	0.17693	.	0.525120	0.20109	N	0.099041	D	0.97126	0.9061	L	0.29908	0.895	0.09310	N	1	B;P	0.47034	0.236;0.889	B;P	0.45829	0.111;0.494	D	0.95172	0.8291	10	0.23891	T	0.37	.	3.5193	0.07736	0.2559:0.3678:0.0:0.3764	.	203;151	B4DKV0;Q9BT81	.;SOX7_HUMAN	R	151;203;203	ENSP00000301921:G151R;ENSP00000452017:G203R;ENSP00000451145:G203R	ENSP00000346908:G203R	G	-	1	0	SOX7;CTD-2135J3.4	10621374	0.726000	0.28059	0.001000	0.08648	0.931000	0.56810	0.432000	0.21461	-0.076000	0.12775	0.561000	0.74099	GGC		0.711	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207131.1			Missense_Mutation
GLIS3	169792	broad.mit.edu	37	9	4117947	4117947	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:4117947A>C	ENST00000324333.10	-	3	1259	c.1066T>G	c.(1066-1068)Tac>Gac	p.Y356D	GLIS3_ENST00000381971.3_Missense_Mutation_p.Y511D	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	356					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Y356D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TGCTGGTCGTACAGGGCGCTG	0.657																																																1	Substitution - Missense(1)	ovary(1)	9											85.0	76.0	79.0					9																	4117947		2203	4300	6503	4107947	SO:0001583	missense	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1066T>G	9.37:g.4117947A>C	ENSP00000325494:p.Tyr356Asp	Unknown		x	x	x	4107947	B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	CCDS6451.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297507	0.60086	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	D;D	0.86694	-2.16;-2.16	5.51	5.51	0.81932	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.47852	D	0.000212	D	0.93825	0.8025	M	0.86178	2.8	0.58432	D	0.999997	D;D;D;D;D	0.76494	0.999;0.99;0.998;0.998;0.999	D;D;D;D;D	0.75020	0.979;0.936;0.985;0.975;0.985	D	0.94754	0.7930	10	0.87932	D	0	.	15.6315	0.76912	1.0:0.0:0.0:0.0	.	19;24;24;511;356	Q1PHK4;Q1PHK2;Q1PHK3;Q8NEA6-2;Q8NEA6	.;.;.;.;GLIS3_HUMAN	D	356;511	ENSP00000325494:Y356D;ENSP00000371398:Y511D	ENSP00000325494:Y356D	Y	-	1	0	GLIS3	4107947	1.000000	0.71417	0.999000	0.59377	0.793000	0.44817	7.409000	0.80053	2.098000	0.63641	0.533000	0.62120	TAC		0.657	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629		Missense_Mutation
FANCC	2176	broad.mit.edu	37	9	97869533	97869533	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:97869533G>T	ENST00000289081.3	-	14	1602	c.1348C>A	c.(1348-1350)Ctg>Atg	p.L450M	FANCC_ENST00000375305.1_Missense_Mutation_p.L450M	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	450					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L450M(1)		kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				AGGTGGCCCAGCACGGCCTTC	0.542			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	1	Substitution - Missense(1)	ovary(1)	9											90.0	76.0	81.0					9																	97869533		2203	4300	6503	96909354	SO:0001583	missense	2176	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.1348C>A	9.37:g.97869533G>T	ENSP00000289081:p.Leu450Met	Unknown		x	x	x	96909354	B1ALR8	Missense_Mutation	SNP	ENST00000289081.3	37	CCDS35071.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047930	0.36085	.	.	ENSG00000158169	ENST00000289081;ENST00000375305	T;T	0.53423	0.62;0.62	4.66	2.79	0.32731	.	0.595996	0.17454	N	0.173695	T	0.48021	0.1477	L	0.57536	1.79	0.09310	N	1	P	0.48998	0.918	P	0.52957	0.714	T	0.37079	-0.9721	10	0.39692	T	0.17	-4.4041	1.9303	0.03325	0.1282:0.2004:0.4653:0.2061	.	450	Q00597	FANCC_HUMAN	M	450	ENSP00000289081:L450M;ENSP00000364454:L450M	ENSP00000289081:L450M	L	-	1	2	FANCC	96909354	0.000000	0.05858	0.031000	0.17742	0.023000	0.10783	0.549000	0.23329	0.539000	0.28788	0.557000	0.71058	CTG		0.542	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053219.1	NM_000136		Missense_Mutation
AKNA	80709	broad.mit.edu	37	9	117139344	117139344	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:117139344C>T	ENST00000307564.4	-	3	904	c.743G>A	c.(742-744)gGc>gAc	p.G248D	AKNA_ENST00000312033.3_Missense_Mutation_p.G248D|AKNA_ENST00000374075.5_Missense_Mutation_p.G167D|AKNA_ENST00000223791.3_5'Flank|AKNA_ENST00000374088.3_Missense_Mutation_p.G248D	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	248					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G248D(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TCCAGTTCTGCCATCTGGGCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	9											43.0	46.0	45.0					9																	117139344		2203	4300	6503	116179165	SO:0001583	missense	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.743G>A	9.37:g.117139344C>T	ENSP00000303769:p.Gly248Asp	Unknown		x	x	x	116179165	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.320893	0.00232	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.20598	3.27;3.27;3.25;2.06	4.49	-1.08	0.09936	.	1.083490	0.07195	N	0.856398	T	0.05135	0.0137	N	0.01352	-0.895	0.33386	D	0.575441	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.47381	-0.9122	10	0.10377	T	0.69	-1.598	1.078	0.01637	0.1515:0.1888:0.156:0.5037	.	248;248;167	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	D	248;248;167;248;248	ENSP00000303769:G248D;ENSP00000363201:G248D;ENSP00000363188:G167D;ENSP00000309222:G248D	ENSP00000303769:G248D	G	-	2	0	AKNA	116179165	0.000000	0.05858	0.016000	0.15963	0.149000	0.21700	-0.020000	0.12525	-0.125000	0.11703	-0.605000	0.04089	GGC		0.622	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767		Missense_Mutation
CDK5RAP2	55755	broad.mit.edu	37	9	123199658	123199658	+	Silent	SNP	C	C	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:123199658C>G	ENST00000349780.4	-	25	4049	c.3870G>C	c.(3868-3870)gtG>gtC	p.V1290V	CDK5RAP2_ENST00000360822.3_Silent_p.V1258V|CDK5RAP2_ENST00000359309.3_Silent_p.V1249V|CDK5RAP2_ENST00000360190.4_Silent_p.V1290V	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1290					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)	p.V1290V(1)		breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CACAGTAATCCACATCACTGG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	9											158.0	120.0	133.0					9																	123199658		2203	4300	6503	122239479	SO:0001819	synonymous_variant	55755			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3870G>C	9.37:g.123199658C>G		Unknown		x	x	x	122239479	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	CCDS6823.1	SNP	21	Broad																																																																																				0.498	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		Silent
TRAF1	7185	broad.mit.edu	37	9	123688240	123688241	+	Missense_Mutation	DNP	AC	AC	GT			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:123688240_123688241AC>GT	ENST00000373887.3	-	2	2558_2559	c.113_114GT>AC	c.(112-114)tGT>tAC	p.C38Y	TRAF1_ENST00000540010.1_Missense_Mutation_p.C38Y	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	38					apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C38Y(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						GACAGCCTGCACAGCAGAGAGC	0.649																																																1	Substitution - Missense(1)	ovary(1)	9																																								122728062	SO:0001583	missense	7185			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.113_114delinsGT	9.37:g.123688240_123688241delinsGT	ENSP00000362994:p.Cys38Tyr	Unknown		x	x	x	122728061	B4DJ77|Q658U1|Q8NF13	Missense_Mutation	DNP	ENST00000373887.3	37	CCDS6825.1	DNP	6	Broad																																																																																				0.649	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053843.1	NM_005658		Missense_Mutation
TTC16	158248	broad.mit.edu	37	9	130489643	130489643	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:130489643C>G	ENST00000373289.3	+	12	1743	c.1663C>G	c.(1663-1665)Ctg>Gtg	p.L555V	TTC16_ENST00000489226.1_3'UTR|PTRH1_ENST00000419060.1_5'Flank|PTRH1_ENST00000429848.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	555								p.L555V(1)		central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CTCCGAGGAGCTGAAGGCCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											29.0	29.0	29.0					9																	130489643		2203	4299	6502	129529464	SO:0001583	missense	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1663C>G	9.37:g.130489643C>G	ENSP00000362386:p.Leu555Val	Unknown		x	x	x	129529464	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	8.838	0.941622	0.18281	.	.	ENSG00000167094	ENST00000373289;ENST00000373288	T	0.17054	2.3	4.34	-1.45	0.08828	.	1.968600	0.02318	N	0.072757	T	0.09598	0.0236	L	0.29908	0.895	0.09310	N	0.999999	P;P	0.40731	0.728;0.728	B;B	0.31946	0.138;0.138	T	0.15549	-1.0433	10	0.42905	T	0.14	0.0513	0.7222	0.00943	0.368:0.286:0.1518:0.1942	.	542;555	B4DZ42;Q8NEE8	.;TTC16_HUMAN	V	555;333	ENSP00000362386:L555V	ENSP00000362385:L333V	L	+	1	2	TTC16	129529464	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.051000	0.14141	-0.255000	0.09486	-0.258000	0.10820	CTG		0.582	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965		Missense_Mutation
SH3GLB2	56904	broad.mit.edu	37	9	131777127	131777127	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:131777127C>A	ENST00000372564.3	-	4	536	c.391G>T	c.(391-393)Gat>Tat	p.D131Y	SH3GLB2_ENST00000372559.1_Missense_Mutation_p.D131Y|SH3GLB2_ENST00000416629.1_Missense_Mutation_p.D131Y|SH3GLB2_ENST00000372554.4_Missense_Mutation_p.D131Y|SH3GLB2_ENST00000417224.1_Missense_Mutation_p.D131Y	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	131	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)		p.D131Y(1)		NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						TGGATAAAATCCCTCTCCGCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	9											112.0	114.0	113.0					9																	131777127		2203	4300	6503	130816948	SO:0001583	missense	56904			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.391G>T	9.37:g.131777127C>A	ENSP00000361645:p.Asp131Tyr	Unknown		x	x	x	130816948	A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	ENST00000372564.3	37	CCDS6916.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252038	0.80135	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.45	5.45	0.79879	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.132076	0.64402	D	0.000002	T	0.78181	0.4243	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.999;0.984	D;P	0.70935	0.971;0.905	T	0.79463	-0.1793	10	0.72032	D	0.01	-35.0923	18.6307	0.91359	0.0:1.0:0.0:0.0	.	131;131	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	Y	131	ENSP00000361645:D131Y;ENSP00000361640:D131Y;ENSP00000361634:D131Y;ENSP00000402566:D131Y;ENSP00000388282:D131Y	ENSP00000361634:D131Y	D	-	1	0	SH3GLB2	130816948	1.000000	0.71417	0.993000	0.49108	0.534000	0.34807	7.454000	0.80714	2.720000	0.93068	0.655000	0.94253	GAT		0.562	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054535.2			Missense_Mutation
LAMC3	10319	broad.mit.edu	37	9	133936591	133936592	+	Missense_Mutation	DNP	CT	CT	GA	rs201283727		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:133936591_133936592CT>GA	ENST00000361069.4	+	13	2461_2462	c.2328_2329CT>GA	c.(2326-2331)caCTgc>caGAgc	p.776_777HC>QS	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	776	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.H776_C777>QS(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TGTGTACCCACTGCCCCCCGGG	0.693																																																1	Complex - compound substitution(1)	ovary(1)	9																																								132926413	SO:0001583	missense	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	Exception_encountered	9.37:g.133936591_133936592delinsGA	ENSP00000354360:p.H776_C777delinsQS	Unknown		x	x	x	132926412	B1APX9|B1APY0|Q59H72	Missense_Mutation	DNP	ENST00000361069.4	37	CCDS6938.1	DNP	20	Broad																																																																																				0.693	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059		Missense_Mutation
DBH	1621	broad.mit.edu	37	9	136501728	136501728	+	Missense_Mutation	SNP	C	C	T	rs77273740	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr9:136501728C>T	ENST00000393056.2	+	1	247	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	79	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.				behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.R79W(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GCTCCTGGTGCGGAGGCTCAA	0.617													C|||	10	0.00199681	0.0	0.0	5008	,	,		18203	0.001		0.0089	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9						C	TRP/ARG	0,4406		0,0,2203	68.0	51.0	57.0		235	3.2	0.3	9	dbSNP_131	57	19,8581	14.0+/-48.4	0,19,4281	yes	missense	DBH	NM_000787.3	101	0,19,6484	TT,TC,CC		0.2209,0.0,0.1461	probably-damaging	79/618	136501728	19,12987	2203	4300	6503	135491549	SO:0001583	missense	1621			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.235C>T	9.37:g.136501728C>T	ENSP00000376776:p.Arg79Trp	Unknown		x	x	x	135491549	Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	CCDS6977.2	SNP	27	Broad	9	0.004120879120879121	0	0.0	0	0.0	0	0.0	9	0.011873350923482849	C	10.70	1.423715	0.25639	0.0	0.002209	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.77877	-1.13;-1.13	5.24	3.21	0.36854	DOMON domain (3);	0.605115	0.17061	N	0.188562	T	0.80297	0.4597	M	0.75615	2.305	0.09310	N	1	D	0.57571	0.98	P	0.55303	0.773	T	0.75631	-0.3251	10	0.66056	D	0.02	-26.951	15.2551	0.73579	0.3864:0.6136:0.0:0.0	.	79	P09172	DOPO_HUMAN	W	79;65;65	ENSP00000376776:R79W;ENSP00000263611:R65W	ENSP00000263611:R65W	R	+	1	2	DBH	135491549	0.855000	0.29742	0.255000	0.24374	0.002000	0.02628	2.777000	0.47717	0.604000	0.29930	-1.367000	0.01198	CGG		0.617	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787		Missense_Mutation
EIF1AX	1964	broad.mit.edu	37	X	20156742	20156742	+	Splice_Site	SNP	T	T	G			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chrX:20156742T>G	ENST00000379607.5	-	2	220		c.e2-2		snoU2-30_ENST00000365012.1_RNA|snoU2_19_ENST00000364722.1_RNA|EIF1AX_ENST00000379593.1_Intron|EIF1AX-AS1_ENST00000424026.1_RNA	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.?(1)		endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						CTCCTTTACCTGATGGTTTAA	0.303																																																1	Unknown(1)	ovary(1)	X											124.0	116.0	118.0					X																	20156742		2203	4300	6503	20066663	SO:0001630	splice_region_variant	1964			L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.17-2A>C	X.37:g.20156742T>G		Unknown		x	x	x	20066663	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Splice_Site_SNP	SNP	ENST00000379607.5	37	CCDS14196.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	18.53	3.643786	0.67244	.	.	ENSG00000173674	ENST00000379607	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8225	0.63331	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EIF1AX	20066663	1.000000	0.71417	0.984000	0.44739	0.900000	0.52787	7.441000	0.80485	1.708000	0.51301	0.486000	0.48141	.		0.303	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		Intron	Splice_Site_SNP
ACRC	93953	broad.mit.edu	37	X	70823914	70823914	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chrX:70823914G>C	ENST00000373695.1	+	7	1324	c.787G>C	c.(787-789)Gaa>Caa	p.E263Q	ACRC_ENST00000373696.3_Missense_Mutation_p.E263Q			Q96QF7	ACRC_HUMAN	acidic repeat containing	263	Asp/Ser-rich.					nucleus (GO:0005634)		p.E263Q(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TGATGATTCGGAAGCTCCCGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											20.0	21.0	21.0					X																	70823914		2089	4079	6168	70740639	SO:0001583	missense	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.787G>C	X.37:g.70823914G>C	ENSP00000362799:p.Glu263Gln	Unknown		x	x	x	70740639	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	CCDS35326.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	2.888	-0.230400	0.05983	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.31247	1.5;1.5	0.14	0.14	0.14804	.	.	.	.	.	T	0.11367	0.0277	N	0.08118	0	0.09310	N	1	B	0.23185	0.081	B	0.11329	0.006	T	0.30794	-0.9966	9	0.16420	T	0.52	.	2.6715	0.05068	0.479:0.0:0.5209:0.0	.	263	Q96QF7	ACRC_HUMAN	Q	263	ENSP00000362800:E263Q;ENSP00000362799:E263Q	ENSP00000362799:E263Q	E	+	1	0	ACRC	70740639	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.345000	0.07770	0.168000	0.19655	0.169000	0.16792	GAA		0.547	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			Missense_Mutation
FAM50A	9130	broad.mit.edu	37	X	153678059	153678059	+	Silent	SNP	C	C	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chrX:153678059C>T	ENST00000393600.3	+	9	866	c.756C>T	c.(754-756)atC>atT	p.I252I		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	252					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I252I(1)		breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCATGTACATCAAGGAGGACT	0.647											OREG0003609	type=REGULATORY REGION|Gene=FAM50A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - coding silent(1)	ovary(1)	X											90.0	70.0	77.0					X																	153678059		2203	4300	6503	153331253	SO:0001819	synonymous_variant	9130			BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.756C>T	X.37:g.153678059C>T		Unknown	1757	x	x	x	153331253	A8KAQ4|B2R997|Q5HY37|Q6PJH5	Silent	SNP	ENST00000393600.3	37	CCDS14751.1	SNP	29	Broad																																																																																				0.647	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081643.2	NM_004699		Silent
GAB3	139716	broad.mit.edu	37	X	153940577	153940577	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chrX:153940577G>T	ENST00000369575.3	-	4	1024	c.993C>A	c.(991-993)agC>agA	p.S331R	GAB3_ENST00000496390.1_Intron|GAB3_ENST00000424127.2_Missense_Mutation_p.S332R	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	331					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTGGCTTCTTGCTACCACTGT	0.507																																																0			X											134.0	115.0	122.0					X																	153940577		2203	4300	6503	153593771	SO:0001583	missense	139716			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.993C>A	X.37:g.153940577G>T	ENSP00000358588:p.Ser331Arg	Unknown		x	x	x	153593771	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	0.904	-0.721445	0.03182	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.18502	2.21;2.21;2.21	5.42	2.61	0.31194	.	1.050970	0.07340	N	0.880569	T	0.10508	0.0257	N	0.25647	0.755	0.09310	N	1	B;B;B	0.25521	0.128;0.128;0.128	B;B;B	0.18263	0.021;0.021;0.021	T	0.41840	-0.9486	10	0.15066	T	0.55	-13.7264	4.4207	0.11479	0.2791:0.1623:0.5585:0.0	.	332;332;331	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	R	331;332;332	ENSP00000358588:S331R;ENSP00000358581:S332R;ENSP00000399588:S332R	ENSP00000358581:S332R	S	-	3	2	GAB3	153593771	0.253000	0.23982	0.002000	0.10522	0.130000	0.20726	2.036000	0.41165	0.110000	0.17919	0.506000	0.49869	AGC		0.507	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573		Missense_Mutation
CHD5	26038	broad.mit.edu	37	1	6186740	6186741	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:6186740_6186741insAT	ENST00000262450.3	-	26	4068_4069	c.3969_3970insAT	c.(3967-3972)ctgctgfs	p.L1324fs	CHD5_ENST00000378021.1_Frame_Shift_Ins_p.L181fs	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L1324fs*78(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGGTGCCGCAGCAGCTTCTCCC	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								6109328	SO:0001589	frameshift_variant	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3969_3970insAT	1.37:g.6186740_6186741insAT	ENSP00000262450:p.Leu1324fs	Unknown		Capture	Illumina GAIIx	Phase_I	6109327	A8KAP8|A8MQ44|D3DSH9|O60740	Frame_Shift_Ins	INS	ENST00000262450.3	37	CCDS57.1	INS	34	Broad																																																																																				0.629	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		Frame_Shift_Ins
H6PD	9563	broad.mit.edu	37	1	9324782	9324785	+	Frame_Shift_Del	DEL	GTCC	GTCC	-			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:9324782_9324785delGTCC	ENST00000377403.2	+	5	2532_2535	c.2230_2233delGTCC	c.(2230-2235)gtcctgfs	p.VL744fs	H6PD_ENST00000602477.1_Frame_Shift_Del_p.VL755fs	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	744	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)	p.V744fs*6(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		GAAGGTGGCAGTCCTGGTCATGGG	0.657																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								9247372	SO:0001589	frameshift_variant	9563			AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.2230_2233delGTCC	1.37:g.9324782_9324785delGTCC	ENSP00000366620:p.Val744fs	Unknown		Capture	Illumina GAIIx	Phase_I	9247369	Q4TT33|Q66I35|Q68DT3	Frame_Shift_Del	DEL	ENST00000377403.2	37	CCDS101.1	DEL	36	Broad																																																																																				0.657	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285		Frame_Shift_Del
CNKSR1	10256	broad.mit.edu	37	1	26515913	26515917	+	Frame_Shift_Del	DEL	CAGCT	CAGCT	-	rs115839469		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:26515913_26515917delCAGCT	ENST00000374253.5	+	21	2076_2080	c.2037_2041delCAGCT	c.(2035-2043)ggcagctccfs	p.SS680fs	CNKSR1_ENST00000531191.1_Frame_Shift_Del_p.SS415fs|CATSPER4_ENST00000456354.2_5'Flank|CNKSR1_ENST00000361530.6_Frame_Shift_Del_p.SS673fs	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	680					Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)	p.S673fs*6(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCTGAAGGCAGCTCCCACATCTT	0.624																																					NSCLC(180;1396 2109 28270 30756 34275)											1	Deletion - Frameshift(1)	ovary(1)	1																																								26388504	SO:0001589	frameshift_variant	10256			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.2037_2041delCAGCT	1.37:g.26515913_26515917delCAGCT	ENSP00000363371:p.Ser680fs	Unknown		Capture	Illumina GAIIx	Phase_I	26388500	B1AMW9|O95381	Frame_Shift_Del	DEL	ENST00000374253.5	37		DEL	25	Broad																																																																																				0.624	CNKSR1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000089943.2	NM_006314		Frame_Shift_Del
ZMYM6	9204	broad.mit.edu	37	1	35452848	35452850	+	In_Frame_Del	DEL	AAA	AAA	-	rs375181410		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr1:35452848_35452850delAAA	ENST00000357182.4	-	16	4060_4062	c.3833_3835delTTT	c.(3832-3837)ttttca>tca	p.F1278del	ZMYM6NB_ENST00000373337.3_5'Flank|RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1278					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.F1278delF(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TAAACAGTTGAAAAGGGTAATAA	0.379																																																1	Deletion - In frame(1)	ovary(1)	1																																								35225437	SO:0001651	inframe_deletion	9204			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3833_3835delTTT	1.37:g.35452848_35452850delAAA	ENSP00000349708:p.Phe1278del	Unknown		Capture	Illumina GAIIx	Phase_I	35225435	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	In_Frame_Del	DEL	ENST00000357182.4	37	CCDS387.2	DEL	9	Broad																																																																																				0.379	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167		In_Frame_Del
KIAA1462	57608	broad.mit.edu	37	10	30318203	30318209	+	Frame_Shift_Del	DEL	GCCTCCC	GCCTCCC	-	rs183822750	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:30318203_30318209delGCCTCCC	ENST00000375377.1	-	3	969_975	c.868_874delGGGAGGC	c.(868-876)gggaggcccfs	p.GRP290fs		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	290	Pro-rich.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.G290fs*73(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GGCTTGAGGGGCCTCCCAAACTTAGGC	0.58																																																1	Deletion - Frameshift(1)	ovary(1)	10																																								30358215	SO:0001589	frameshift_variant	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.868_874delGGGAGGC	10.37:g.30318203_30318209delGCCTCCC	ENSP00000364526:p.Gly290fs	Unknown		Capture	Illumina GAIIx	Phase_I	30358209	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Frame_Shift_Del	DEL	ENST00000375377.1	37	CCDS41500.1	DEL	42	Broad																																																																																				0.580	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		Frame_Shift_Del
DOCK1	1793	broad.mit.edu	37	10	128925903	128925938	+	Splice_Site	DEL	GTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCA	GTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCA	-	rs77791924|rs540787166|rs183386929	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr10:128925903_128925938delGTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCA	ENST00000280333.6	+	27	2797_2803	c.2688_2694delGTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCA	c.(2686-2694)gtgttggtg>gt	p.VLV896del		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	896					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.?(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTTCTCTGGTGTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCAACCCAGAGGC	0.449																																																1	Unknown(1)	ovary(1)	10																																								128815928	SO:0001630	splice_region_variant	1793			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.2689-1GTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCA>-	10.37:g.128925903_128925938delGTTGGTGTTCATTGGTGTGTCCTTCCCCAGGGGCCA		Unknown		Capture	Illumina GAIIx	Phase_I	128815893	A9Z1Z5	Splice_Site_Del	DEL	ENST00000280333.6	37		DEL	48	Broad																																																																																				0.449	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	In_Frame_Del	Splice_Site_Del
ACTN3	89	broad.mit.edu	37	11	66326795	66326798	+	lincRNA	DEL	GAGC	GAGC	-	rs369128953		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr11:66326795_66326798delGAGC	ENST00000504911.1	-	0	220				ACTN3_ENST00000502692.1_RNA|ACTN3_ENST00000513398.1_RNA																							AGGCCTTTGAGAGCGACCTGGCGG	0.691																																																0			11																																								66083374			89																															11.37:g.66326795_66326798delGAGC		Unknown		Capture	Illumina GAIIx	Phase_I	66083371		Frame_Shift_Del	DEL	ENST00000504911.1	37		DEL	33	Broad																																																																																				0.691	CTD-3074O7.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000362463.1			Frame_Shift_Del
KBTBD7	84078	broad.mit.edu	37	13	41768239	41768276	+	Frame_Shift_Del	DEL	TGTGCCAGCAGGGCTGCAGAATGGGCCGTGTCCTTTAA	TGTGCCAGCAGGGCTGCAGAATGGGCCGTGTCCTTTAA	-	rs376321477|rs370755143		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr13:41768239_41768276delTGTGCCAGCAGGGCTGCAGAATGGGCCGTGTCCTTTAA	ENST00000379483.3	-	1	426_463	c.118_155delTTAAAGGACACGGCCCATTCTGCAGCCCTGCTGGCACA	c.(118-156)ttaaaggacacggcccattctgcagccctgctggcacagfs	p.LKDTAHSAALLAQ40fs		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	40								p.L40fs*12(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GGACTTGAGCTGTGCCAGCAGGGCTGCAGAATGGGCCGTGTCCTTTAACTCCTCTGGA	0.643																																																1	Deletion - Frameshift(1)	ovary(1)	13																																								40666276	SO:0001589	frameshift_variant	84078			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.118_155delTTAAAGGACACGGCCCATTCTGCAGCCCTGCTGGCACA	13.37:g.41768239_41768276delTGTGCCAGCAGGGCTGCAGAATGGGCCGTGTCCTTTAA	ENSP00000368797:p.Leu40fs	Unknown		Capture	Illumina GAIIx	Phase_I	40666239	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Frame_Shift_Del	DEL	ENST00000379483.3	37	CCDS9377.1	DEL	55	Broad																																																																																				0.643	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138		Frame_Shift_Del
FURIN	5045	broad.mit.edu	37	15	91424873	91424898	+	Frame_Shift_Del	DEL	TGGCCGGCCTCAGCTGCGCCTTCATC	TGGCCGGCCTCAGCTGCGCCTTCATC	-	rs202152215|rs541235814|rs376428494	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr15:91424873_91424898delTGGCCGGCCTCAGCTGCGCCTTCATC	ENST00000268171.3	+	16	2429_2454	c.2150_2175delTGGCCGGCCTCAGCTGCGCCTTCATC	c.(2149-2175)gtggccggcctcagctgcgccttcatcfs	p.VAGLSCAFI717fs	FES_ENST00000414248.2_5'Flank|FES_ENST00000328850.3_5'Flank|FES_ENST00000394302.1_5'Flank	NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	717					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.I725I(1)|p.V717fs*18(1)		breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CCTGAGGTGGTGGCCGGCCTCAGCTGCGCCTTCATCGTGCTGGTCT	0.668																																																2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	15																																								89225902	SO:0001589	frameshift_variant	5045			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.2150_2175delTGGCCGGCCTCAGCTGCGCCTTCATC	15.37:g.91424873_91424898delTGGCCGGCCTCAGCTGCGCCTTCATC	ENSP00000268171:p.Val717fs	Unknown		Capture	Illumina GAIIx	Phase_I	89225877	Q14336|Q6LBS3|Q9UCZ5	Frame_Shift_Del	DEL	ENST00000268171.3	37	CCDS10364.1	DEL	59	Broad																																																																																				0.668	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569		Frame_Shift_Del
UBE2O	63893	broad.mit.edu	37	17	74387112	74387118	+	Frame_Shift_Del	DEL	CCCTTGG	CCCTTGG	-			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr17:74387112_74387118delCCCTTGG	ENST00000319380.7	-	18	3849_3855	c.3785_3791delCCAAGGG	c.(3784-3792)tccaagggtfs	p.SKG1262fs		NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	1262					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S1262fs*10(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						CTTGATGAAACCCTTGGAAAGTGGGAA	0.58																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								71898713	SO:0001589	frameshift_variant	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.3785_3791delCCAAGGG	17.37:g.74387112_74387118delCCCTTGG	ENSP00000323687:p.Ser1262fs	Unknown		Capture	Illumina GAIIx	Phase_I	71898707	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Frame_Shift_Del	DEL	ENST00000319380.7	37	CCDS32742.1	DEL	18	Broad																																																																																				0.580	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066		Frame_Shift_Del
MYO9B	4650	broad.mit.edu	37	19	17305612	17305617	+	In_Frame_Del	DEL	ACTCTC	ACTCTC	-			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr19:17305612_17305617delACTCTC	ENST00000594824.1	+	22	3523_3528	c.3376_3381delACTCTC	c.(3376-3381)actctcdel	p.TL1126del	MYO9B_ENST00000397274.2_In_Frame_Del_p.TL1126del|MYO9B_ENST00000595618.1_In_Frame_Del_p.TL1126del			Q13459	MYO9B_HUMAN	myosin IXB	1126	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.T1126_L1127delTL(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CCCAGAGAAGACTCTCCCACCCCAGA	0.631																																																1	Deletion - In frame(1)	ovary(1)	19																																								17166617	SO:0001651	inframe_deletion	4650				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.3376_3381delACTCTC	19.37:g.17305612_17305617delACTCTC	ENSP00000471367:p.Thr1126_Leu1127del	Unknown		Capture	Illumina GAIIx	Phase_I	17166612	O75314|Q9NUJ2|Q9UHN0	In_Frame_Del	DEL	ENST00000594824.1	37		DEL	10	Broad																																																																																				0.631	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1			In_Frame_Del
CBFA2T2	9139	broad.mit.edu	37	20	32162069	32162099	+	Splice_Site	DEL	TATGTGTGAAACATTCATTTCTAATAGAGGA	TATGTGTGAAACATTCATTTCTAATAGAGGA	-	rs144793325	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr20:32162069_32162099delTATGTGTGAAACATTCATTTCTAATAGAGGA	ENST00000346541.3	+	2	598		c.e2+2		CBFA2T2_ENST00000397800.1_Intron|CBFA2T2_ENST00000344201.3_Intron|CBFA2T2_ENST00000342704.6_Intron|CBFA2T2_ENST00000397798.2_Splice_Site|CBFA2T2_ENST00000492345.1_Splice_Site|CBFA2T2_ENST00000375279.2_Splice_Site	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2						epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						AATGGAAAGGTATGTGTGAAACATTCATTTCTAATAGAGGACTAATTTAAT	0.407																																					Esophageal Squamous(174;142 1955 14837 21276 28041)											0			20																																								31625760	SO:0001630	splice_region_variant	9139			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.61+2TATGTGTGAAACATTCATTTCTAATAGAGGA>-	20.37:g.32162069_32162099delTATGTGTGAAACATTCATTTCTAATAGAGGA		Unknown		Capture	Illumina GAIIx	Phase_I	31625730	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Splice_Site_Del	DEL	ENST00000346541.3	37	CCDS13221.1	DEL	57	Broad																																																																																				0.407	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	Intron	Splice_Site_Del
EPM2AIP1	9852	broad.mit.edu	37	3	37033079	37033080	+	Frame_Shift_Ins	INS	-	-	C			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:37033079_37033080insC	ENST00000322716.5	-	1	1715_1716	c.1489_1490insG	c.(1489-1491)gaafs	p.E497fs	MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000455445.2_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000435176.1_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000539477.1_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	497					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)		p.E497fs*19(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						AGGTGCATATTCAGGTTTAAAG	0.356																																																1	Insertion - Frameshift(1)	ovary(1)	3																																								37008084	SO:0001589	frameshift_variant	9852			AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.1490dupG	3.37:g.37033080_37033080dupC	ENSP00000406027:p.Glu497fs	Unknown		Capture	Illumina GAIIx	Phase_I	37008083	O94866|Q9H3L3	Frame_Shift_Ins	INS	ENST00000322716.5	37	CCDS46790.1	INS	62	Broad																																																																																				0.356	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470593.1	NM_014805		Frame_Shift_Ins
PDZRN3	23024	broad.mit.edu	37	3	73433934	73433950	+	Frame_Shift_Del	DEL	CGGTGGCGTCGTCGCCA	CGGTGGCGTCGTCGCCA	-	rs368331137|rs146622509|rs138272885	byFrequency	TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr3:73433934_73433950delCGGTGGCGTCGTCGCCA	ENST00000263666.4	-	10	1881_1897	c.1767_1783delTGGCGACGACGCCACCG	c.(1765-1785)aatggcgacgacgccaccgcafs	p.GDDATA590fs	PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Frame_Shift_Del_p.GDDATA312fs|PDZRN3_ENST00000462146.2_Frame_Shift_Del_p.GDDATA247fs|PDZRN3_ENST00000466780.1_Frame_Shift_Del_p.GDDATA247fs|PDZRN3_ENST00000479530.1_Frame_Shift_Del_p.GDDATA307fs	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	590					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G590fs*73(1)|p.D591N(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TTGGAGGATGCGGTGGCGTCGTCGCCATTGTTCTCTT	0.622																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|breast(1)	3																																								73516640	SO:0001589	frameshift_variant	23024			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1767_1783delTGGCGACGACGCCACCG	3.37:g.73433934_73433950delCGGTGGCGTCGTCGCCA	ENSP00000263666:p.Gly590fs	Unknown		Capture	Illumina GAIIx	Phase_I	73516624	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Frame_Shift_Del	DEL	ENST00000263666.4	37	CCDS33789.1	DEL	27	Broad																																																																																				0.622	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		Frame_Shift_Del
TACC3	10460	broad.mit.edu	37	4	1742665	1742684	+	Frame_Shift_Del	DEL	CTTCAAGCGTTTTGAGAAAC	CTTCAAGCGTTTTGAGAAAC	-	rs373390451		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:1742665_1742684delCTTCAAGCGTTTTGAGAAAC	ENST00000313288.4	+	13	2281_2300	c.2175_2194delCTTCAAGCGTTTTGAGAAAC	c.(2173-2196)ctcttcaagcgttttgagaaacagfs	p.FKRFEKQ726fs		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	726					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.F726fs*87(1)		central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TCTCCGACCTCTTCAAGCGTTTTGAGAAACAGAAAGAGGT	0.505																																					Ovarian(120;482 2294 11894 35824)											1	Deletion - Frameshift(1)	ovary(1)	4																																								1712482	SO:0001589	frameshift_variant	10460			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.2175_2194delCTTCAAGCGTTTTGAGAAAC	4.37:g.1742665_1742684delCTTCAAGCGTTTTGAGAAAC	ENSP00000326550:p.Phe726fs	Unknown		Capture	Illumina GAIIx	Phase_I	1712463	Q2NKK4|Q3KQS5|Q9UMQ1	Frame_Shift_Del	DEL	ENST00000313288.4	37	CCDS3352.1	DEL	32	Broad																																																																																				0.505	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2			Frame_Shift_Del
UNC5C	8633	broad.mit.edu	37	4	96106271	96106272	+	Frame_Shift_Ins	INS	-	-	T			TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr4:96106271_96106272insT	ENST00000453304.1	-	13	2560_2561	c.2212_2213insA	c.(2212-2214)accfs	p.T738fs		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	738					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.T738fs*23(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CAGGTTGTGGGTGCTGCCTTTA	0.46																																																1	Insertion - Frameshift(1)	ovary(1)	4																																								96325295	SO:0001589	frameshift_variant	8633			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2213dupA	4.37:g.96106272_96106272dupT	ENSP00000406022:p.Thr738fs	Unknown		Capture	Illumina GAIIx	Phase_I	96325294	Q8IUT0	Frame_Shift_Ins	INS	ENST00000453304.1	37	CCDS3643.1	INS	44	Broad																																																																																				0.460	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		Frame_Shift_Ins
AGFG2	3268	broad.mit.edu	37	7	100161491	100161515	+	Frame_Shift_Del	DEL	CTTCCCCCAGGCAGTGCCACCCACT	CTTCCCCCAGGCAGTGCCACCCACT	-	rs202000689		TCGA-61-2095-01	TCGA-61-2095-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2095-01	TCGA-61-2095-11	g.chr7:100161491_100161515delCTTCCCCCAGGCAGTGCCACCCACT	ENST00000300176.4	+	10	1328_1352	c.1206_1230delCTTCCCCCAGGCAGTGCCACCCACT	c.(1204-1230)ggcttcccccaggcagtgccacccactfs	p.GFPQAVPPT402fs	AGFG2_ENST00000474713.1_Intron|AGFG2_ENST00000262935.4_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	402	Pro-rich.				regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.F403fs*30(1)|p.P409H(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTGGGCCTGGCTTCCCCCAGGCAGTGCCACCCACTGGGGCCTTTG	0.596											OREG0018204	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	7																																								99999451	SO:0001589	frameshift_variant	3268			AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.1206_1230delCTTCCCCCAGGCAGTGCCACCCACT	7.37:g.100161491_100161515delCTTCCCCCAGGCAGTGCCACCCACT	ENSP00000300176:p.Gly402fs	Unknown	1349	Capture	Illumina GAIIx	Phase_I	99999427	O75429|Q96AB9|Q96GL4	Frame_Shift_Del	DEL	ENST00000300176.4	37	CCDS5697.1	DEL	28	Broad																																																																																				0.596	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342769.1	NM_006076		Frame_Shift_Del
