#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
OIT3	170392	broad.mit.edu	37	10	74684366	74684366	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr10:74684366T>A	ENST00000334011.5	+	7	1549	c.1331T>A	c.(1330-1332)aTc>aAc	p.I444N		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	444	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.I444N(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					ACCTCCAAGATCGACGAGGTC	0.547																																					Colon(7;19 345 13446 17537)											1	Substitution - Missense(1)	ovary(1)	10											69.0	60.0	63.0					10																	74684366		2203	4300	6503	74354372	SO:0001583	missense	170392				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.1331T>A	10.37:g.74684366T>A	ENSP00000333900:p.Ile444Asn	Unknown		x	x	x	74354372	A0AVP3|Q8N1M8	Missense_Mutation	SNP	ENST00000334011.5	37	CCDS7318.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	13.08	2.129331	0.37630	.	.	ENSG00000138315	ENST00000334011	D	0.81821	-1.54	5.59	5.59	0.84812	Zona pellucida sperm-binding protein (3);	0.211793	0.31577	N	0.007412	T	0.66268	0.2772	L	0.29908	0.895	0.29520	N	0.853595	B	0.06786	0.001	B	0.08055	0.003	T	0.55774	-0.8088	10	0.21014	T	0.42	-16.0692	6.2333	0.20747	0.1426:0.0746:0.0:0.7828	.	444	Q8WWZ8	OIT3_HUMAN	N	444	ENSP00000333900:I444N	ENSP00000333900:I444N	I	+	2	0	OIT3	74354372	0.997000	0.39634	0.997000	0.53966	0.983000	0.72400	2.976000	0.49289	2.122000	0.65172	0.460000	0.39030	ATC		0.547	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048596.1	NM_152635		Missense_Mutation
GSTO2	119391	broad.mit.edu	37	10	106057406	106057406	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr10:106057406C>T	ENST00000338595.2	+	6	859	c.539C>T	c.(538-540)cCc>cTc	p.P180L	GSTO2_ENST00000450629.2_Missense_Mutation_p.P146L|GSTO2_ENST00000429569.2_Intron|GSTO2_ENST00000369707.2_Missense_Mutation_p.P152L	NM_183239.1	NP_899062.1	Q9H4Y5	GSTO2_HUMAN	glutathione S-transferase omega 2	180	GST C-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)	p.P180L(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)	CTCCTCTGGCCCTGGTTTGAG	0.413											OREG0020517	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	10											162.0	145.0	151.0					10																	106057406		2203	4300	6503	106047396	SO:0001583	missense	119391			AY191318	CCDS7556.1, CCDS53574.1, CCDS53575.1	10q25.1	2012-06-21			ENSG00000065621	ENSG00000065621	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	23064	protein-coding gene	gene with protein product		612314				12618591	Standard	NM_001191013		Approved		uc001kyb.3	Q9H4Y5	OTTHUMG00000019006	ENST00000338595.2:c.539C>T	10.37:g.106057406C>T	ENSP00000345023:p.Pro180Leu	Unknown	1394	x	x	x	106047396	A8K771|B4DJW6|E7ESD6|Q49TW5|Q5GM70|Q5JU15|Q86WP3	Missense_Mutation	SNP	ENST00000338595.2	37	CCDS7556.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755832	0.89843	.	.	ENSG00000065621	ENST00000369708;ENST00000338595;ENST00000450629;ENST00000369707	D;T;D	0.95272	-3.66;2.09;-3.66	6.17	6.17	0.99709	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.048732	0.85682	D	0.000000	D	0.97210	0.9088	M	0.82132	2.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.987;0.993	D	0.97253	0.9899	10	0.87932	D	0	-18.698	16.3795	0.83443	0.0:1.0:0.0:0.0	.	146;180	B4DJW6;Q9H4Y5	.;GSTO2_HUMAN	L	180;180;146;152	ENSP00000345023:P180L;ENSP00000390986:P146L;ENSP00000358721:P152L	ENSP00000345023:P180L	P	+	2	0	GSTO2	106047396	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.648000	0.61425	2.941000	0.99782	0.655000	0.94253	CCC		0.413	GSTO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050210.2	NM_183239		Missense_Mutation
PACS1	55690	broad.mit.edu	37	11	66000526	66000526	+	Silent	SNP	G	G	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr11:66000526G>C	ENST00000320580.4	+	15	1860	c.1827G>C	c.(1825-1827)cgG>cgC	p.R609R	PACS1_ENST00000529757.1_Silent_p.R145R	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	609					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.R609R(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TGCTCACCCGGATCCAGCGCT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	11											114.0	102.0	106.0					11																	66000526		2200	4295	6495	65757102	SO:0001819	synonymous_variant	55690			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1827G>C	11.37:g.66000526G>C		Unknown		x	x	x	65757102	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	ENST00000320580.4	37	CCDS8129.1	SNP	41	Broad																																																																																				0.607	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026		Silent
SERPINH1	871	broad.mit.edu	37	11	75283087	75283087	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr11:75283087C>G	ENST00000524558.1	+	5	2651	c.1216C>G	c.(1216-1218)Ctg>Gtg	p.L406V	SERPINH1_ENST00000525876.1_Missense_Mutation_p.L189V|SERPINH1_ENST00000358171.3_Missense_Mutation_p.L406V|SERPINH1_ENST00000533603.1_Missense_Mutation_p.L406V			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	406					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L406V(1)		endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					CATTGGGCGCCTGGTCCGGCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											30.0	30.0	30.0					11																	75283087		2200	4293	6493	74960735	SO:0001583	missense	871			X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.1216C>G	11.37:g.75283087C>G	ENSP00000434412:p.Leu406Val	Unknown		x	x	x	74960735	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	ENST00000524558.1	37	CCDS8239.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647676	0.47258	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000421448;ENST00000524558;ENST00000525876	D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87	5.0	4.06	0.47325	Serpin domain (3);	0.304109	0.32258	N	0.006346	T	0.77039	0.4072	L	0.28556	0.865	0.44908	D	0.997923	P	0.38129	0.619	B	0.37833	0.259	T	0.73493	-0.3965	10	0.26408	T	0.33	.	13.2252	0.59911	0.0:0.8386:0.1614:0.0	.	406	P50454	SERPH_HUMAN	V	406;406;385;406;189	ENSP00000434657:L406V;ENSP00000350894:L406V;ENSP00000434412:L406V;ENSP00000433532:L189V	ENSP00000350894:L406V	L	+	1	2	SERPINH1	74960735	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.259000	0.43259	1.179000	0.42884	0.462000	0.41574	CTG		0.612	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353		Missense_Mutation
ACAD8	27034	broad.mit.edu	37	11	134127114	134127115	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr11:134127114_134127115GG>AT	ENST00000281182.4	+	3	449_450	c.343_344GG>AT	c.(343-345)GGc>ATc	p.G115I	ACAD8_ENST00000374752.4_Intron|ACAD8_ENST00000524547.1_Intron|ACAD8_ENST00000543332.1_Intron|ACAD8_ENST00000537423.1_Missense_Mutation_p.G38I	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	115					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.G115I(1)		endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	CTTGGCTACAGGCTGCACCAGC	0.53																																					GBM(65;238 1125 33403 41853 48889)											1	Substitution - Missense(1)	ovary(1)	11																																								133632325	SO:0001583	missense	27034			AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	Exception_encountered	11.37:g.134127114_134127115delinsAT	ENSP00000281182:p.Gly115Ile	Unknown		x	x	x	133632324	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	DNP	ENST00000281182.4	37	CCDS8498.1	DNP	35	Broad																																																																																				0.530	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384		Missense_Mutation
ITGB7	3695	broad.mit.edu	37	12	53589942	53589942	+	Silent	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr12:53589942G>A	ENST00000267082.5	-	7	1089	c.858C>T	c.(856-858)ttC>ttT	p.F286F	ITGB7_ENST00000550743.2_Silent_p.F286F|ITGB7_ENST00000422257.3_Silent_p.F286F|ITGB7_ENST00000338737.4_Silent_p.F286F	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	286	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.F286F(1)		NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CGTCTGAAGTGAACACCAGCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	12											88.0	81.0	83.0					12																	53589942		2203	4300	6503	51876209	SO:0001819	synonymous_variant	3695				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.858C>T	12.37:g.53589942G>A		Unknown		x	x	x	51876209	Q9UCP7|Q9UCS7	Silent	SNP	ENST00000267082.5	37	CCDS8849.1	SNP	45	Broad																																																																																				0.577	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2			Silent
CAPS2	84698	broad.mit.edu	37	12	75687098	75687098	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr12:75687098C>A	ENST00000409445.3	-	13	1347	c.1151G>T	c.(1150-1152)aGc>aTc	p.S384I	CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000393284.3_Missense_Mutation_p.S152I|CAPS2_ENST00000442339.2_5'UTR|RP11-560G2.1_ENST00000549953.1_RNA|RP11-560G2.1_ENST00000534648.2_RNA|CAPS2_ENST00000409799.1_Missense_Mutation_p.S302I	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	384							calcium ion binding (GO:0005509)	p.S152I(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TTCTTTGATGCTTTCTGGAAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	113.0	116.0					12																	75687098		2203	4298	6501	73973365	SO:0001583	missense	84698			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1151G>T	12.37:g.75687098C>A	ENSP00000386959:p.Ser384Ile	Unknown		x	x	x	73973365	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	37	CCDS9008.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867405	0.51588	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284	T;T;T	0.27557	1.73;1.66;1.78	4.6	1.46	0.22682	.	0.120057	0.53938	D	0.000059	T	0.49864	0.1582	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.69078	0.997;0.993;0.991;0.989	D;P;P;P	0.65140	0.932;0.906;0.817;0.814	T	0.52756	-0.8533	10	0.72032	D	0.01	-4.1205	10.2991	0.43642	0.0:0.6753:0.251:0.0736	.	152;120;384;302	Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;CAYP2_HUMAN;.	I	302;384;120;152	ENSP00000386977:S302I;ENSP00000386959:S384I;ENSP00000376963:S152I	ENSP00000367975:S120I	S	-	2	0	CAPS2	73973365	1.000000	0.71417	0.980000	0.43619	0.501000	0.33797	1.667000	0.37471	0.466000	0.27193	0.446000	0.29264	AGC		0.323	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2			Missense_Mutation
N4BP2L2	10443	broad.mit.edu	37	13	33017740	33017740	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr13:33017740G>T	ENST00000504114.1	-	6	980	c.889C>A	c.(889-891)Ctt>Att	p.L297I	N4BP2L2_ENST00000399396.3_Missense_Mutation_p.L312I|N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000380121.3_5'UTR|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.L297I			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.L195I(1)|p.L312I(1)		kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TCCGCAGAAAGGTCCTGGGTG	0.388																																																2	Substitution - Missense(2)	ovary(2)	13											83.0	77.0	79.0					13																	33017740		1852	4092	5944	31915740	SO:0001583	missense	10443			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.889C>A	13.37:g.33017740G>T	ENSP00000427477:p.Leu297Ile	Unknown		x	x	x	31915740	A3KME8	Missense_Mutation	SNP	ENST00000504114.1	37		SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.44	1.940044	0.34283	.	.	ENSG00000139617;ENSG00000139617;ENSG00000244754;ENSG00000244754;ENSG00000244754	ENST00000380121;ENST00000503296;ENST00000504114;ENST00000357505;ENST00000399396	.	.	.	5.68	-4.47	0.03525	.	4.124510	0.00622	N	0.000447	T	0.19685	0.0473	N	0.22421	0.69	0.09310	N	1	P;P;P;P	0.41265	0.744;0.744;0.744;0.744	B;B;B;B	0.40825	0.271;0.211;0.341;0.341	T	0.11131	-1.0600	9	0.54805	T	0.06	3.5961	2.1563	0.03813	0.1401:0.3067:0.2763:0.2769	.	297;312;195;195	B4DPY1;Q92802-3;Q96KV2;Q9Y3H6	.;.;.;.	I	195;224;297;297;312	.	ENSP00000350104:L297I	L	-	1	0	N4BP2L2;RP11-298P3.4	31915740	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.160000	0.03147	-1.222000	0.02587	0.563000	0.77884	CTT		0.388	N4BP2L2-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000361380.1	NM_014887		Missense_Mutation
CHAMP1	283489	broad.mit.edu	37	13	115090658	115090658	+	Silent	SNP	T	T	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr13:115090658T>C	ENST00000361283.1	+	3	1650	c.1341T>C	c.(1339-1341)gaT>gaC	p.D447D		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	447	Mediates interaction with MAD2L2.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.D447D(1)									GGTCACCAGATCTTTGGAAGC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	13											112.0	129.0	123.0					13																	115090658		2203	4300	6503	114108760	SO:0001819	synonymous_variant	283489			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.1341T>C	13.37:g.115090658T>C		Unknown		x	x	x	114108760	B3KU06|Q6P181|Q8NC88|Q9BST0	Silent	SNP	ENST00000361283.1	37	CCDS9545.1	SNP	50	Broad																																																																																				0.532	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436		Silent
DYNC1H1	1778	broad.mit.edu	37	14	102474654	102474654	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr14:102474654C>G	ENST00000360184.4	+	29	6121	c.5957C>G	c.(5956-5958)tCc>tGc	p.S1986C		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1986	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.S1986C(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CGTGAACATTCCAACCCCAAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	14											63.0	56.0	58.0					14																	102474654		2203	4300	6503	101544407	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.5957C>G	14.37:g.102474654C>G	ENSP00000348965:p.Ser1986Cys	Unknown		x	x	x	101544407	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	14.34	2.504846	0.44558	.	.	ENSG00000197102	ENST00000360184	T	0.09911	2.93	5.32	5.32	0.75619	ATPase, AAA+ type, core (1);	0.164063	0.53938	D	0.000041	T	0.17238	0.0414	M	0.64170	1.965	0.53688	D	0.999971	B	0.15141	0.012	B	0.18871	0.023	T	0.02313	-1.1178	10	0.59425	D	0.04	.	19.3797	0.94527	0.0:1.0:0.0:0.0	.	1986	Q14204	DYHC1_HUMAN	C	1986	ENSP00000348965:S1986C	ENSP00000348965:S1986C	S	+	2	0	DYNC1H1	101544407	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	4.810000	0.62598	2.644000	0.89710	0.650000	0.86243	TCC		0.493	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		Missense_Mutation
TGM7	116179	broad.mit.edu	37	15	43579831	43579831	+	Silent	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr15:43579831G>A	ENST00000452443.2	-	5	599	c.595C>T	c.(595-597)Ctg>Ttg	p.L199L		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	199					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.L199L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CTCTTGTTCAGGATCTCAAAG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	15											114.0	103.0	107.0					15																	43579831		2201	4299	6500	41367123	SO:0001819	synonymous_variant	116179			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.595C>T	15.37:g.43579831G>A		Unknown		x	x	x	41367123		Silent	SNP	ENST00000452443.2	37	CCDS32213.1	SNP	35	Broad																																																																																				0.443	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955		Silent
TIPIN	54962	broad.mit.edu	37	15	66641743	66641743	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr15:66641743C>G	ENST00000261881.4	-	5	406	c.321G>C	c.(319-321)atG>atC	p.M107I	SCARNA14_ENST00000516903.1_RNA|TIPIN_ENST00000367709.4_Missense_Mutation_p.M6I|Y_RNA_ENST00000411339.1_RNA	NM_017858.2	NP_060328	Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein	107	Interaction with TIMELESS.				cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)		p.M107I(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						CCCAGTGCTCCATGTGTCTGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	15											114.0	110.0	111.0					15																	66641743		2201	4299	6500	64428797	SO:0001583	missense	54962			BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000261881.4:c.321G>C	15.37:g.66641743C>G	ENSP00000261881:p.Met107Ile	Unknown		x	x	x	64428797	B2CW64|Q9NWZ6	Missense_Mutation	SNP	ENST00000261881.4	37	CCDS10215.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	24.0	4.476849	0.84640	.	.	ENSG00000075131	ENST00000367709;ENST00000261881	T;T	0.44482	0.92;0.92	5.54	5.54	0.83059	Replication fork protection component Swi3 (2);	0.036385	0.85682	D	0.000000	T	0.54822	0.1882	L	0.48642	1.525	0.80722	D	1	D	0.54964	0.969	P	0.58660	0.843	T	0.50398	-0.8833	10	0.44086	T	0.13	-16.6675	18.0484	0.89340	0.0:1.0:0.0:0.0	.	107	Q9BVW5	TIPIN_HUMAN	I	6;107	ENSP00000356682:M6I;ENSP00000261881:M107I	ENSP00000261881:M107I	M	-	3	0	TIPIN	64428797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.427000	0.80284	2.610000	0.88304	0.555000	0.69702	ATG		0.423	TIPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256897.2	NM_017858		Missense_Mutation
SNX29	92017	broad.mit.edu	37	16	12571642	12571642	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr16:12571642C>T	ENST00000566228.1	+	19	2173	c.2104C>T	c.(2104-2106)Cac>Tac	p.H702Y	SNX29_ENST00000323433.4_Missense_Mutation_p.H317Y|SNX29_ENST00000306030.3_Missense_Mutation_p.H317Y	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	702	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)	p.H317Y(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CAGGAGTTTGCACCACAAGTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	16											68.0	65.0	66.0					16																	12571642		1901	4113	6014	12479143	SO:0001583	missense	92017			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2104C>T	16.37:g.12571642C>T	ENSP00000456480:p.His702Tyr	Unknown		x	x	x	12479143	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	37	CCDS10553.2	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332281	0.81801	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	T;T	0.51325	0.71;0.71	5.84	5.84	0.93424	.	0.120261	0.56097	D	0.000035	T	0.53465	0.1798	L	0.41124	1.26	0.36594	D	0.874262	.	.	.	.	.	.	T	0.54918	-0.8221	8	0.35671	T	0.21	-26.3962	17.6471	0.88151	0.0:1.0:0.0:0.0	.	.	.	.	Y	317	ENSP00000306940:H317Y;ENSP00000322226:H317Y	ENSP00000306940:H317Y	H	+	1	0	SNX29	12479143	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.303000	0.78871	2.758000	0.94735	0.655000	0.94253	CAC		0.448	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1			Missense_Mutation
CDH3	1001	broad.mit.edu	37	16	68716324	68716324	+	Silent	SNP	C	C	T	rs139565232		TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr16:68716324C>T	ENST00000264012.4	+	9	1660	c.1116C>T	c.(1114-1116)gaC>gaT	p.D372D	CDH3_ENST00000429102.2_Silent_p.D372D|CDH3_ENST00000581171.1_Silent_p.D317D	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	372	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D372D(2)|p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TGGGCGGTGACGACGGGGACC	0.587																																																4	Unknown(2)|Substitution - coding silent(2)	breast(2)|ovary(1)|endometrium(1)	16						C		3,4393	6.2+/-15.9	0,3,2195	115.0	87.0	96.0		1116	-5.4	0.0	16	dbSNP_134	96	0,8600		0,0,4300	no	coding-synonymous	CDH3	NM_001793.4		0,3,6495	TT,TC,CC		0.0,0.0682,0.0231		372/830	68716324	3,12993	2198	4300	6498	67273825	SO:0001819	synonymous_variant	1001			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1116C>T	16.37:g.68716324C>T		Unknown		x	x	x	67273825	B2R6F4|Q05DI6	Silent	SNP	ENST00000264012.4	37	CCDS10868.1	SNP	19	Broad																																																																																				0.587	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793		Silent
SHPK	23729	broad.mit.edu	37	17	3524627	3524627	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr17:3524627T>C	ENST00000225519.3	-	5	829	c.727A>G	c.(727-729)Atg>Gtg	p.M243V		NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	243					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)	p.M243V(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		TCAAACCACATGTGGGAAGTT	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											52.0	49.0	50.0					17																	3524627		2203	4300	6503	3471376	SO:0001583	missense	23729			AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.727A>G	17.37:g.3524627T>C	ENSP00000225519:p.Met243Val	Unknown		x	x	x	3471376	B2R640|Q8WUH3	Missense_Mutation	SNP	ENST00000225519.3	37	CCDS11030.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	2.729	-0.264949	0.05754	.	.	ENSG00000197417	ENST00000225519	T	0.44881	0.91	4.75	-9.1	0.00714	Carbohydrate kinase, FGGY, N-terminal (1);	1.030440	0.07677	N	0.936502	T	0.15869	0.0382	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17745	-1.0359	10	0.25106	T	0.35	0.1098	5.9487	0.19234	0.1912:0.589:0.0954:0.1244	.	243	Q9UHJ6	SHPK_HUMAN	V	243	ENSP00000225519:M243V	ENSP00000225519:M243V	M	-	1	0	SHPK	3471376	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.332000	0.07904	-1.530000	0.01751	-1.150000	0.01838	ATG		0.562	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	17	GRCh37	CM004908	TP53	M							62.0	48.0	53.0					17																	7574003		2203	4300	6503	7514728	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*	Unknown		x	x	x	7514728	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
MYH4	4622	broad.mit.edu	37	17	10360858	10360858	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr17:10360858G>T	ENST00000255381.2	-	16	1886	c.1776C>A	c.(1774-1776)aaC>aaA	p.N592K	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	592	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.N592K(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AGCCGGCGATGTTGTAGTCCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	117.0	117.0					17																	10360858		2203	4300	6503	10301583	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1776C>A	17.37:g.10360858G>T	ENSP00000255381:p.Asn592Lys	Unknown		x	x	x	10301583		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522030	0.64747	.	.	ENSG00000141048	ENST00000255381	T	0.72725	-0.68	5.01	5.01	0.66863	Myosin head, motor domain (2);	0.000000	0.40728	U	0.001031	D	0.86406	0.5925	M	0.87758	2.905	0.58432	D	0.999999	D	0.56287	0.975	D	0.70716	0.97	D	0.88797	0.3282	10	0.87932	D	0	.	18.6894	0.91577	0.0:0.0:1.0:0.0	.	592	Q9Y623	MYH4_HUMAN	K	592	ENSP00000255381:N592K	ENSP00000255381:N592K	N	-	3	2	MYH4	10301583	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	2.449000	0.44935	2.496000	0.84212	0.561000	0.74099	AAC		0.537	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		Missense_Mutation
C17orf102	400591	broad.mit.edu	37	17	32904575	32904575	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr17:32904575C>T	ENST00000357754.1	-	2	563	c.475G>A	c.(475-477)Gct>Act	p.A159T		NM_207454.2	NP_997337.2	A2RUQ5	CQ102_HUMAN	chromosome 17 open reading frame 102	159								p.A159T(1)		central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(3)|ovary(1)	9						aggacaagagctggttttgtc	0.478																																																1	Substitution - Missense(1)	ovary(1)	17											113.0	107.0	109.0					17																	32904575		2018	4194	6212	29928688	SO:0001583	missense	400591				CCDS42297.1	17q12	2009-02-11			ENSG00000197322	ENSG00000197322			34412	protein-coding gene	gene with protein product							Standard	NM_207454		Approved	FLJ44815	uc002hie.1	A2RUQ5	OTTHUMG00000156883	ENST00000357754.1:c.475G>A	17.37:g.32904575C>T	ENSP00000350392:p.Ala159Thr	Unknown		x	x	x	29928688	A5PKX0|Q6ZTB3	Missense_Mutation	SNP	ENST00000357754.1	37	CCDS42297.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	6.725	0.502571	0.12822	.	.	ENSG00000197322	ENST00000357754	T	0.38560	1.13	3.56	1.55	0.23275	.	.	.	.	.	T	0.24084	0.0583	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.21280	-1.0250	9	0.87932	D	0	.	5.9512	0.19248	0.0:0.7577:0.0:0.2423	.	159	A2RUQ5	CQ102_HUMAN	T	159	ENSP00000350392:A159T	ENSP00000350392:A159T	A	-	1	0	C17orf102	29928688	0.007000	0.16637	0.000000	0.03702	0.055000	0.15305	0.862000	0.27899	0.505000	0.28104	-0.123000	0.14984	GCT		0.478	C17orf102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346435.1	NM_207454		Missense_Mutation
POLD1	5424	broad.mit.edu	37	19	50912905	50912905	+	Silent	SNP	G	G	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr19:50912905G>T	ENST00000440232.2	+	17	2189	c.2136G>T	c.(2134-2136)ccG>ccT	p.P712P	POLD1_ENST00000595904.1_Silent_p.P738P|POLD1_ENST00000599857.1_Silent_p.P712P	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	712					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.P712P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GCAAGTTGCCGTGCCTGGAGA	0.682								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	19											44.0	51.0	49.0					19																	50912905		2203	4299	6502	55604717	SO:0001819	synonymous_variant	5424				CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2136G>T	19.37:g.50912905G>T		Unknown		x	x	x	55604717	Q8NER3|Q96H98	Silent	SNP	ENST00000440232.2	37	CCDS12795.1	SNP	40	Broad																																																																																				0.682	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1			Silent
TLX2	3196	broad.mit.edu	37	2	74742853	74742853	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr2:74742853C>G	ENST00000233638.7	+	2	817	c.494C>G	c.(493-495)tCc>tGc	p.S165C		NM_016170.4	NP_057254.1	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	165					enteric nervous system development (GO:0048484)|mesoderm formation (GO:0001707)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S165C(1)		kidney(1)|ovary(1)	2						ACGTCCTTCTCCCGCTCACAG	0.682																																					Esophageal Squamous(7;240 533 18610 24312)											1	Substitution - Missense(1)	ovary(1)	2											31.0	36.0	34.0					2																	74742853		2203	4300	6503	74596361	SO:0001583	missense	3196			AJ002607	CCDS1947.1	2p13.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000115297	ENSG00000115297		"""Homeoboxes / ANTP class : NKL subclass"""	5057	protein-coding gene	gene with protein product		604240	"""homeo box 11-like 1"", ""T-cell leukemia, homeobox 2"""	HOX11L1		10343123	Standard	NM_016170		Approved	Enx, Tlx2, NCX	uc002sma.2	O43763	OTTHUMG00000129960	ENST00000233638.7:c.494C>G	2.37:g.74742853C>G	ENSP00000233638:p.Ser165Cys	Unknown		x	x	x	74596361	Q9UD56|Q9UQ48	Missense_Mutation	SNP	ENST00000233638.7	37	CCDS1947.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630528	0.67015	.	.	ENSG00000115297	ENST00000233638	D	0.96459	-4.02	4.29	3.41	0.39046	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.421373	0.20396	N	0.093160	D	0.98535	0.9511	H	0.97186	3.955	0.43355	D	0.995424	D	0.89917	1.0	D	0.79108	0.992	D	0.98319	1.0527	10	0.87932	D	0	.	9.8188	0.40869	0.0:0.8989:0.0:0.1011	.	165	O43763	TLX2_HUMAN	C	165	ENSP00000233638:S165C	ENSP00000233638:S165C	S	+	2	0	TLX2	74596361	0.717000	0.27966	1.000000	0.80357	0.999000	0.98932	0.508000	0.22692	1.012000	0.39366	0.655000	0.94253	TCC		0.682	TLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252224.3			Missense_Mutation
COL5A2	1290	broad.mit.edu	37	2	189904245	189904245	+	Silent	SNP	A	A	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr2:189904245A>C	ENST00000374866.3	-	51	3952	c.3678T>G	c.(3676-3678)ccT>ccG	p.P1226P		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1226					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.P1226P(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TAAGGTGGCCAGGGGGACCCG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	2											26.0	27.0	27.0					2																	189904245		2203	4299	6502	189612490	SO:0001819	synonymous_variant	1290			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3678T>G	2.37:g.189904245A>C		Unknown		x	x	x	189612490	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	CCDS33350.1	SNP	7	Broad																																																																																				0.498	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		Silent
ACSL3	2181	broad.mit.edu	37	2	223786007	223786007	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr2:223786007C>A	ENST00000357430.3	+	8	1346	c.815C>A	c.(814-816)cCt>cAt	p.P272H	ACSL3_ENST00000392066.3_Missense_Mutation_p.P272H|AC097461.4_ENST00000446709.1_RNA	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	272					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.P272H(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	GAAAACCAACCTCATAGCAAA	0.353			T	ETV1	prostate																																		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	1	Substitution - Missense(1)	ovary(1)	2											141.0	136.0	138.0					2																	223786007		2203	4300	6503	223494251	SO:0001583	missense	2181			D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.815C>A	2.37:g.223786007C>A	ENSP00000350012:p.Pro272His	Unknown		x	x	x	223494251	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	37	CCDS2455.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262543	0.23051	.	.	ENSG00000123983	ENST00000357430;ENST00000392066;ENST00000540115;ENST00000421680	T;T;T;T	0.76316	2.73;2.73;0.64;-1.01	5.03	2.23	0.28157	AMP-dependent synthetase/ligase (1);	0.748735	0.13345	N	0.394885	T	0.80732	0.4679	M	0.74647	2.275	0.09310	N	1	B	0.29552	0.248	P	0.44477	0.451	T	0.74456	-0.3659	10	0.87932	D	0	-0.53	5.1274	0.14892	0.1828:0.5753:0.0:0.2419	.	272	O95573	ACSL3_HUMAN	H	272;272;120;42	ENSP00000350012:P272H;ENSP00000375918:P272H;ENSP00000441643:P120H;ENSP00000404182:P42H	ENSP00000350012:P272H	P	+	2	0	ACSL3	223494251	0.373000	0.25073	0.089000	0.20774	0.643000	0.38383	0.930000	0.28858	0.528000	0.28580	0.591000	0.81541	CCT		0.353	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457		Missense_Mutation
PPIL2	23759	broad.mit.edu	37	22	22039067	22039067	+	Silent	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr22:22039067G>A	ENST00000335025.8	+	10	670	c.579G>A	c.(577-579)ccG>ccA	p.P193P	PPIL2_ENST00000398831.3_Silent_p.P193P|PPIL2_ENST00000406385.1_Silent_p.P193P|PPIL2_ENST00000412327.1_Silent_p.P193P|PPIL2_ENST00000456792.2_Silent_p.P172P|PPIL2_ENST00000492445.2_Silent_p.P193P					peptidylprolyl isomerase (cyclophilin)-like 2									p.P193P(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					AACAGGACCCGTCTTATTATC	0.547																																																1	Substitution - coding silent(1)	ovary(1)	22											39.0	39.0	39.0					22																	22039067		2203	4300	6503	20369067	SO:0001819	synonymous_variant	23759				CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.579G>A	22.37:g.22039067G>A		Unknown		x	x	x	20369067		Silent	SNP	ENST00000335025.8	37	CCDS13793.1	SNP	40	Broad																																																																																				0.547	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075028.4			Silent
ZBED4	9889	broad.mit.edu	37	22	50280470	50280470	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr22:50280470C>G	ENST00000216268.5	+	2	3637	c.3160C>G	c.(3160-3162)Ccg>Gcg	p.P1054A		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	1054						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P1054A(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		TGCTGGCTCCCCGTCGAAAGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	22											60.0	54.0	56.0					22																	50280470		2203	4300	6503	48666474	SO:0001583	missense	9889			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.3160C>G	22.37:g.50280470C>G	ENSP00000216268:p.Pro1054Ala	Unknown		x	x	x	48666474	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	37	CCDS33677.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	4.270	0.049121	0.08243	.	.	ENSG00000100426	ENST00000216268	T	0.21031	2.03	5.18	4.15	0.48705	Ribonuclease H-like (1);	0.290655	0.32952	N	0.005451	T	0.14830	0.0358	L	0.46157	1.445	0.38290	D	0.942678	P	0.39282	0.666	B	0.27380	0.079	T	0.10086	-1.0645	10	0.45353	T	0.12	-19.1518	9.3357	0.38049	0.0:0.7789:0.1462:0.075	.	1054	O75132	ZBED4_HUMAN	A	1054	ENSP00000216268:P1054A	ENSP00000216268:P1054A	P	+	1	0	ZBED4	48666474	1.000000	0.71417	0.497000	0.27552	0.023000	0.10783	3.298000	0.51818	1.403000	0.46800	0.655000	0.94253	CCG		0.542	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838		Missense_Mutation
NUP210	23225	broad.mit.edu	37	3	13360796	13360796	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr3:13360796C>A	ENST00000254508.5	-	38	5495	c.5413G>T	c.(5413-5415)Gat>Tat	p.D1805Y		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1805					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.D1805Y(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TGGTAGGAATCCAGGAAGTGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											68.0	57.0	61.0					3																	13360796		2203	4300	6503	13335796	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.5413G>T	3.37:g.13360796C>A	ENSP00000254508:p.Asp1805Tyr	Unknown		x	x	x	13335796	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137479	0.37728	.	.	ENSG00000132182	ENST00000254508	T	0.05382	3.45	5.11	5.11	0.69529	.	0.122014	0.53938	D	0.000045	T	0.21761	0.0524	M	0.70595	2.14	0.54753	D	0.999984	D	0.69078	0.997	P	0.62014	0.897	T	0.00235	-1.1892	10	0.54805	T	0.06	.	15.6456	0.77046	0.0:0.8628:0.1372:0.0	.	1805	Q8TEM1	PO210_HUMAN	Y	1805	ENSP00000254508:D1805Y	ENSP00000254508:D1805Y	D	-	1	0	NUP210	13335796	1.000000	0.71417	0.983000	0.44433	0.015000	0.08874	2.975000	0.49281	2.378000	0.81104	0.563000	0.77884	GAT		0.557	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923		Missense_Mutation
WNT7A	7476	broad.mit.edu	37	3	13896218	13896218	+	Silent	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr3:13896218G>A	ENST00000285018.4	-	3	685	c.381C>T	c.(379-381)aaC>aaT	p.N127N		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	127					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.N127N(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						AGTCGCTCAGGTTGCCCTGGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	3											99.0	91.0	94.0					3																	13896218		2203	4300	6503	13871219	SO:0001819	synonymous_variant	7476			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.381C>T	3.37:g.13896218G>A		Unknown		x	x	x	13871219	Q96H90|Q9Y560	Silent	SNP	ENST00000285018.4	37	CCDS2616.1	SNP	44	Broad																																																																																				0.657	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625		Silent
GRID2	2895	broad.mit.edu	37	4	93511305	93511305	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr4:93511305A>C	ENST00000282020.4	+	2	370	c.112A>C	c.(112-114)Aaa>Caa	p.K38Q	GRID2_ENST00000510992.1_Missense_Mutation_p.K38Q|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	38					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.K38Q(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGAATCTGCCAAAAAGGATGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	4											102.0	99.0	100.0					4																	93511305		2203	4300	6503	93730328	SO:0001583	missense	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.112A>C	4.37:g.93511305A>C	ENSP00000282020:p.Lys38Gln	Unknown		x	x	x	93730328	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631778	0.46944	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.85861	-2.04;-2.04	5.83	5.83	0.93111	.	0.741961	0.12347	N	0.476925	T	0.78033	0.4220	N	0.19112	0.55	0.23834	N	0.996715	B;B	0.33694	0.421;0.421	B;B	0.33042	0.157;0.157	T	0.68345	-0.5433	10	0.33940	T	0.23	.	16.194	0.82011	1.0:0.0:0.0:0.0	.	38;38	E9PH24;O43424	.;GRID2_HUMAN	Q	38	ENSP00000282020:K38Q;ENSP00000421257:K38Q	ENSP00000282020:K38Q	K	+	1	0	GRID2	93730328	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.863000	0.69568	2.225000	0.72522	0.460000	0.39030	AAA		0.373	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2			Missense_Mutation
CDH18	1016	broad.mit.edu	37	5	19520790	19520790	+	Silent	SNP	T	T	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:19520790T>A	ENST00000507958.1	-	12	2478	c.1488A>T	c.(1486-1488)gtA>gtT	p.V496V	CDH18_ENST00000382275.1_Silent_p.V496V|CDH18_ENST00000506372.1_Silent_p.V496V|CDH18_ENST00000502796.1_Silent_p.V496V|CDH18_ENST00000511273.1_Silent_p.V496V|CDH18_ENST00000274170.4_Silent_p.V496V			Q13634	CAD18_HUMAN	cadherin 18, type 2	496	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V496V(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AATTTTCACATACAATAATAT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	5											112.0	115.0	114.0					5																	19520790		2203	4300	6503	19556547	SO:0001819	synonymous_variant	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1488A>T	5.37:g.19520790T>A		Unknown		x	x	x	19556547	A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	ENST00000507958.1	37	CCDS3889.1	SNP	49	Broad																																																																																				0.378	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		Silent
DMGDH	29958	broad.mit.edu	37	5	78322315	78322315	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:78322315C>G	ENST00000255189.3	-	13	2150	c.2122G>C	c.(2122-2124)Gac>Cac	p.D708H	DMGDH_ENST00000540686.1_Missense_Mutation_p.D328H|DMGDH_ENST00000380311.4_Missense_Mutation_p.D507H	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	708					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)	p.D708H(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		CCAAAATTGTCGATTCCCTCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	5											117.0	106.0	110.0					5																	78322315		2203	4300	6503	78358071	SO:0001583	missense	29958			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.2122G>C	5.37:g.78322315C>G	ENSP00000255189:p.Asp708His	Unknown		x	x	x	78358071	B2RBN0|B4E1J9	Missense_Mutation	SNP	ENST00000255189.3	37	CCDS4044.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493732	0.84962	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000540686;ENST00000539598	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.32	5.32	0.75619	Glycine cleavage T-protein, N-terminal (1);	0.186054	0.56097	D	0.000033	T	0.80221	0.4583	L	0.34521	1.04	0.54753	D	0.999982	D;D;B;B	0.69078	0.997;0.975;0.018;0.009	D;P;B;B	0.66979	0.948;0.808;0.005;0.008	T	0.80020	-0.1557	10	0.44086	T	0.13	.	18.9892	0.92784	0.0:1.0:0.0:0.0	.	328;507;558;708	B4E1J9;F8W6P8;F5H1C7;Q9UI17	.;.;.;M2GD_HUMAN	H	708;547;507;328;558	ENSP00000255189:D708H;ENSP00000430972:D547H;ENSP00000369667:D507H;ENSP00000439478:D328H	ENSP00000255189:D708H	D	-	1	0	DMGDH	78358071	1.000000	0.71417	0.970000	0.41538	0.876000	0.50452	5.924000	0.70054	2.500000	0.84329	0.561000	0.74099	GAC		0.463	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	NM_013391		Missense_Mutation
PPIC	5480	broad.mit.edu	37	5	122361523	122361523	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:122361523A>C	ENST00000306442.4	-	4	581	c.466T>G	c.(466-468)Ttg>Gtg	p.L156V		NM_000943.4	NP_000934.1	P45877	PPIC_HUMAN	peptidylprolyl isomerase C (cyclophilin C)	156	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.L156V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	6		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	TTGCCGTCCAACCAGGTGGGC	0.438																																					Ovarian(99;690 1502 20765 45543 49568)											1	Substitution - Missense(1)	ovary(1)	5											86.0	73.0	77.0					5																	122361523		2203	4300	6503	122389422	SO:0001583	missense	5480			S71018	CCDS4133.1	5q23.2	2008-02-05			ENSG00000168938	ENSG00000168938	5.2.1.8		9256	protein-coding gene	gene with protein product		123842				1383094, 8031755	Standard	NM_000943		Approved	CYPC	uc003kth.3	P45877	OTTHUMG00000128921	ENST00000306442.4:c.466T>G	5.37:g.122361523A>C	ENSP00000303057:p.Leu156Val	Unknown		x	x	x	122389422	A4LBB5	Missense_Mutation	SNP	ENST00000306442.4	37	CCDS4133.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003051	0.74932	.	.	ENSG00000168938	ENST00000306442	T	0.35605	1.3	5.65	-5.67	0.02444	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.66356	0.2781	H	0.96489	3.83	0.80722	D	1	D	0.67145	0.996	D	0.80764	0.994	T	0.76647	-0.2882	10	0.87932	D	0	.	15.9654	0.79966	0.4005:0.0:0.5995:0.0	.	156	P45877	PPIC_HUMAN	V	156	ENSP00000303057:L156V	ENSP00000303057:L156V	L	-	1	2	PPIC	122389422	0.597000	0.26874	0.835000	0.33067	0.988000	0.76386	-0.081000	0.11321	-1.275000	0.02417	-0.256000	0.11100	TTG		0.438	PPIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250898.2	NM_000943		Missense_Mutation
ADAMTS19	171019	broad.mit.edu	37	5	129070664	129070664	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:129070664A>T	ENST00000274487.4	+	22	3479	c.3334A>T	c.(3334-3336)Atc>Ttc	p.I1112F	ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1112	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I1112F(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GTCCCGTGTAATCCAATGCAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											102.0	101.0	101.0					5																	129070664		2203	4300	6503	129098563	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3334A>T	5.37:g.129070664A>T	ENSP00000274487:p.Ile1112Phe	Unknown		x	x	x	129098563		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	18.42	3.621184	0.66787	.	.	ENSG00000145808	ENST00000274487	T	0.52754	0.65	4.26	3.1	0.35709	.	0.280714	0.28001	N	0.016983	T	0.57257	0.2041	L	0.49455	1.56	0.51767	D	0.999939	D	0.71674	0.998	D	0.68765	0.96	T	0.53940	-0.8367	9	.	.	.	.	10.1071	0.42539	0.9192:0.0:0.0808:0.0	.	1112	Q8TE59	ATS19_HUMAN	F	1112	ENSP00000274487:I1112F	.	I	+	1	0	ADAMTS19	129098563	0.998000	0.40836	1.000000	0.80357	0.932000	0.56968	2.244000	0.43124	0.978000	0.38470	0.477000	0.44152	ATC		0.378	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		Missense_Mutation
PCDHB7	56129	broad.mit.edu	37	5	140554265	140554265	+	Missense_Mutation	SNP	G	G	A	rs149622872	byFrequency	TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:140554265G>A	ENST00000231137.3	+	1	2023	c.1849G>A	c.(1849-1851)Gtg>Atg	p.V617M		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	617	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V617M(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTATTCGGCGTGTGGGCGCA	0.677																																																1	Substitution - Missense(1)	ovary(1)	5											32.0	49.0	43.0					5																	140554265		2157	4253	6410	140534449	SO:0001583	missense	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1849G>A	5.37:g.140554265G>A	ENSP00000231137:p.Val617Met	Unknown		x	x	x	140534449	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542240	0.45280	.	.	ENSG00000113212	ENST00000231137	T	0.59502	0.26	4.3	2.27	0.28462	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72145	0.3424	M	0.81239	2.535	0.33472	D	0.586365	D	0.89917	1.0	D	0.80764	0.994	T	0.76677	-0.2871	9	0.72032	D	0.01	.	6.7083	0.23262	0.1659:0.3774:0.4566:0.0	.	617	Q9Y5E2	PCDB7_HUMAN	M	617	ENSP00000231137:V617M	ENSP00000231137:V617M	V	+	1	0	PCDHB7	140534449	0.008000	0.16893	0.998000	0.56505	0.749000	0.42624	0.161000	0.16481	0.931000	0.37242	-0.396000	0.06452	GTG		0.677	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		Missense_Mutation
PDGFRB	5159	broad.mit.edu	37	5	149516577	149516577	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:149516577G>C	ENST00000261799.4	-	2	503	c.34C>G	c.(34-36)Ctc>Gtc	p.L12V		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	12					adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)	p.L12V(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCACCTTTGAGGGCCAGAGCT	0.647			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	1	Substitution - Missense(1)	ovary(1)	5											60.0	57.0	58.0					5																	149516577		2203	4300	6503	149496770	SO:0001583	missense	5159			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.34C>G	5.37:g.149516577G>C	ENSP00000261799:p.Leu12Val	Unknown		x	x	x	149496770	B5A957|Q8N5L4	Missense_Mutation	SNP	ENST00000261799.4	37	CCDS4303.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441668	0.25900	.	.	ENSG00000113721	ENST00000261799;ENST00000517957	T;T	0.77098	-1.07;2.11	4.7	2.9	0.33743	.	0.187369	0.26220	N	0.025626	T	0.61986	0.2391	N	0.08118	0	0.23813	N	0.996777	D;P	0.56968	0.978;0.941	P;B	0.52957	0.714;0.265	T	0.55860	-0.8074	10	0.09338	T	0.73	.	7.561	0.27851	0.2025:0.0:0.7975:0.0	.	12;12	B5A957;P09619	.;PGFRB_HUMAN	V	12	ENSP00000261799:L12V;ENSP00000430715:L12V	ENSP00000261799:L12V	L	-	1	0	PDGFRB	149496770	0.072000	0.21174	0.743000	0.31040	0.792000	0.44763	0.330000	0.19715	0.672000	0.31204	0.557000	0.71058	CTC		0.647	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609		Missense_Mutation
DOCK2	1794	broad.mit.edu	37	5	169483729	169483729	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr5:169483729G>A	ENST00000256935.8	+	43	4417	c.4337G>A	c.(4336-4338)cGg>cAg	p.R1446Q	DOCK2_ENST00000540750.1_Missense_Mutation_p.R507Q|DOCK2_ENST00000520908.1_Missense_Mutation_p.R938Q|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1446	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.R1446Q(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACTACTCCCGGCCCGTGCGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	5											105.0	89.0	95.0					5																	169483729		2203	4300	6503	169416307	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4337G>A	5.37:g.169483729G>A	ENSP00000256935:p.Arg1446Gln	Unknown		x	x	x	169416307	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.817034	0.96982	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.18174	2.23;2.23;2.23	5.27	5.27	0.74061	.	0.070853	0.64402	D	0.000015	T	0.51770	0.1694	M	0.93638	3.44	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	P;P	0.61722	0.893;0.75	T	0.66412	-0.5930	10	0.72032	D	0.01	.	18.8867	0.92381	0.0:0.0:1.0:0.0	.	938;1446	E7ERW7;Q92608	.;DOCK2_HUMAN	Q	1446;938;507	ENSP00000256935:R1446Q;ENSP00000429283:R938Q;ENSP00000438827:R507Q	ENSP00000256935:R1446Q	R	+	2	0	DOCK2	169416307	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.026000	0.88783	2.449000	0.82847	0.650000	0.86243	CGG		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		Missense_Mutation
MYLK4	340156	broad.mit.edu	37	6	2689130	2689130	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr6:2689130G>A	ENST00000274643.7	-	4	638	c.296C>T	c.(295-297)gCg>gTg	p.A99V	MYLK4_ENST00000268446.5_Missense_Mutation_p.A99V	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	99						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A99V(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				GCTGTTGACCGCTCCTTGCTT	0.468																																																2	Substitution - Missense(2)	ovary(2)	6											208.0	216.0	213.0					6																	2689130		2203	4300	6503	2634129	SO:0001583	missense	340156				CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.296C>T	6.37:g.2689130G>A	ENSP00000274643:p.Ala99Val	Unknown		x	x	x	2634129	A2RUC0|Q5TAW2	Missense_Mutation	SNP	ENST00000274643.7	37	CCDS34330.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045175	0.36085	.	.	ENSG00000145949	ENST00000268446;ENST00000274643	T;T	0.68624	0.0;-0.34	5.37	5.37	0.77165	Protein kinase-like domain (1);	0.315387	0.22663	N	0.057169	T	0.32285	0.0824	L	0.29908	0.895	0.09310	N	1	B	0.25169	0.119	B	0.10450	0.005	T	0.02411	-1.1163	10	0.32370	T	0.25	.	8.339	0.32232	0.0836:0.1698:0.7466:0.0	.	99	Q86YV6	MYLK4_HUMAN	V	99	ENSP00000268446:A99V;ENSP00000274643:A99V	ENSP00000268446:A99V	A	-	2	0	MYLK4	2634129	0.198000	0.23374	0.083000	0.20561	0.930000	0.56654	1.546000	0.36179	2.697000	0.92050	0.655000	0.94253	GCG		0.468	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418		Missense_Mutation
GABBR1	2550	broad.mit.edu	37	6	29598265	29598265	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr6:29598265G>A	ENST00000377034.4	-	4	780	c.445C>T	c.(445-447)Cag>Tag	p.Q149*	GABBR1_ENST00000355973.3_5'Flank|GABBR1_ENST00000377012.4_5'Flank|GABBR1_ENST00000377016.4_Intron|GABBR1_ENST00000376977.3_Nonsense_Mutation_p.Q149*	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	149	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.Q149*(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GTGCTCCACTGGCCCTGACTA	0.652																																																1	Substitution - Nonsense(1)	ovary(1)	6											49.0	54.0	52.0					6																	29598265		1510	2708	4218	29706244	SO:0001587	stop_gained	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.445C>T	6.37:g.29598265G>A	ENSP00000366233:p.Gln149*	Unknown		x	x	x	29706244	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Nonsense_Mutation	SNP	ENST00000377034.4	37	CCDS4663.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529455	0.85706	.	.	ENSG00000204681	ENST00000376977;ENST00000377034;ENST00000462632	.	.	.	4.73	4.73	0.59995	.	0.150680	0.41712	D	0.000824	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-6.4593	13.2298	0.59936	0.0:0.0:1.0:0.0	.	.	.	.	X	149	.	ENSP00000366176:Q149X	Q	-	1	0	GABBR1	29706244	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.923000	0.56469	2.189000	0.69895	0.561000	0.74099	CAG		0.652	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3			Nonsense_Mutation
EPHA7	2045	broad.mit.edu	37	6	93953210	93953210	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr6:93953210G>C	ENST00000369303.4	-	17	3115	c.2931C>G	c.(2929-2931)atC>atG	p.I977M		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	977	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.I977M(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGCTGCTCATGATTTTCTTTT	0.373																																																1	Substitution - Missense(1)	ovary(1)	6											285.0	240.0	255.0					6																	93953210		2203	4300	6503	94009931	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2931C>G	6.37:g.93953210G>C	ENSP00000358309:p.Ile977Met	Unknown		x	x	x	94009931	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469553	0.43839	.	.	ENSG00000135333	ENST00000369303	T	0.67171	-0.25	5.79	2.92	0.33932	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	M	0.89904	3.07	0.80722	D	1	D;D;D	0.67145	0.988;0.988;0.996	D;P;D	0.69654	0.965;0.876;0.959	T	0.77308	-0.2636	10	0.87932	D	0	.	6.5482	0.22418	0.1345:0.0:0.6122:0.2533	.	973;972;977	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	M	977	ENSP00000358309:I977M	ENSP00000358309:I977M	I	-	3	3	EPHA7	94009931	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.422000	0.21296	0.763000	0.33175	0.591000	0.81541	ATC		0.373	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			Missense_Mutation
ABCA13	154664	broad.mit.edu	37	7	48428703	48428703	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:48428703T>C	ENST00000435803.1	+	37	11564	c.11540T>C	c.(11539-11541)gTg>gCg	p.V3847A		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3847	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V3792A(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTGGTGTCTGTGACCAAGGAA	0.542																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	76.0	75.0					7																	48428703		1916	4142	6058	48399249	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11540T>C	7.37:g.48428703T>C	ENSP00000411096:p.Val3847Ala	Unknown		x	x	x	48399249	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406793	0.62399	.	.	ENSG00000179869	ENST00000435803	D	0.94650	-3.48	4.59	4.59	0.56863	ABC transporter-like (1);	0.000000	0.39146	N	0.001460	D	0.96093	0.8727	M	0.72353	2.195	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.63793	0.91;0.918	D	0.96259	0.9189	10	0.87932	D	0	.	11.6197	0.51111	0.0:0.0:0.0:1.0	.	1549;3847	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	A	3847	ENSP00000411096:V3847A	ENSP00000411096:V3847A	V	+	2	0	ABCA13	48399249	1.000000	0.71417	0.994000	0.49952	0.265000	0.26407	6.183000	0.72002	1.828000	0.53243	0.533000	0.62120	GTG		0.542	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		Missense_Mutation
HIP1	3092	broad.mit.edu	37	7	75187544	75187544	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:75187544T>G	ENST00000336926.6	-	15	1417	c.1391A>C	c.(1390-1392)aAt>aCt	p.N464T	HIP1_ENST00000434438.2_Missense_Mutation_p.N464T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	464	pDED.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.N464T(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TCGCTGTTCATTGGCTTGAGC	0.532			T	PDGFRB	CMML																																		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	1	Substitution - Missense(1)	ovary(1)	7											211.0	170.0	184.0					7																	75187544		2203	4300	6503	75025480	SO:0001583	missense	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1391A>C	7.37:g.75187544T>G	ENSP00000336747:p.Asn464Thr	Unknown		x	x	x	75025480	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	8.029	0.761420	0.15914	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.13196	2.83;2.61	5.18	5.18	0.71444	.	0.087184	0.85682	D	0.000000	T	0.09992	0.0245	L	0.33485	1.01	0.53688	D	0.999971	B;P	0.41569	0.019;0.755	B;B	0.34824	0.005;0.19	T	0.25847	-1.0120	10	0.16896	T	0.51	-11.8834	14.2287	0.65877	0.0:0.0:0.0:1.0	.	464;464	E7ES17;O00291	.;HIP1_HUMAN	T	464	ENSP00000336747:N464T;ENSP00000410300:N464T	ENSP00000336747:N464T	N	-	2	0	HIP1	75025480	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.145000	0.58065	1.959000	0.56917	0.482000	0.46254	AAT		0.532	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		Missense_Mutation
PLOD3	8985	broad.mit.edu	37	7	100856464	100856464	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:100856464T>A	ENST00000223127.3	-	7	1099	c.701A>T	c.(700-702)gAt>gTt	p.D234V		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	234					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.D234V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	ACGGTTCCGATCAAACTTTAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	7											71.0	62.0	65.0					7																	100856464		2203	4300	6503	100643184	SO:0001583	missense	8985			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.701A>T	7.37:g.100856464T>A	ENSP00000223127:p.Asp234Val	Unknown		x	x	x	100643184	B2R6W6|Q540C3	Missense_Mutation	SNP	ENST00000223127.3	37	CCDS5715.1	SNP	50	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.22|13.22	2.172897|2.172897	0.38413|0.38413	.|.	.|.	ENSG00000106397|ENSG00000106397	ENST00000223127;ENST00000541462|ENST00000421736	T|.	0.64991|.	-0.13|.	5.25|5.25	4.11|4.11	0.48088|0.48088	.|.	0.197289|.	0.41938|.	D|.	0.000797|.	T|T	0.45994|0.45994	0.1370|0.1370	L|L	0.38175|0.38175	1.15|1.15	0.58432|0.58432	D|D	0.999996|0.999996	B|.	0.20887|.	0.049|.	B|.	0.19946|.	0.027|.	T|T	0.29150|0.29150	-1.0021|-1.0021	10|5	0.49607|.	T|.	0.09|.	-11.8207|-11.8207	6.8927|6.8927	0.24238|0.24238	0.0:0.1098:0.0:0.8902|0.0:0.1098:0.0:0.8902	.|.	234|.	O60568|.	PLOD3_HUMAN|.	V|F	234;138|67	ENSP00000223127:D234V|.	ENSP00000223127:D234V|.	D|I	-|-	2|1	0|0	PLOD3|PLOD3	100643184|100643184	0.996000|0.996000	0.38824|0.38824	0.805000|0.805000	0.32314|0.32314	0.557000|0.557000	0.35523|0.35523	2.626000|2.626000	0.46460|0.46460	0.862000|0.862000	0.35528|0.35528	0.379000|0.379000	0.24179|0.24179	GAT|ATC		0.532	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1			Missense_Mutation
FOXP2	93986	broad.mit.edu	37	7	114284750	114284750	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:114284750G>T	ENST00000393494.2	+	8	1279	c.1000G>T	c.(1000-1002)Gag>Tag	p.E334*	FOXP2_ENST00000393498.2_Nonsense_Mutation_p.E313*|FOXP2_ENST00000393500.3_Nonsense_Mutation_p.E259*|FOXP2_ENST00000360232.4_Nonsense_Mutation_p.E334*|FOXP2_ENST00000393491.3_Nonsense_Mutation_p.E242*|FOXP2_ENST00000408937.3_Nonsense_Mutation_p.E359*|FOXP2_ENST00000393489.3_Nonsense_Mutation_p.E242*|FOXP2_ENST00000378237.3_Nonsense_Mutation_p.E334*|FOXP2_ENST00000390668.3_Nonsense_Mutation_p.E358*|FOXP2_ENST00000403559.4_Nonsense_Mutation_p.E351*|FOXP2_ENST00000350908.4_Nonsense_Mutation_p.E334*			O15409	FOXP2_HUMAN	forkhead box P2	334					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E359*(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						CTCGTCACATGAGGAGACTGG	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	7											84.0	77.0	80.0					7																	114284750		2203	4300	6503	114071986	SO:0001587	stop_gained	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1000G>T	7.37:g.114284750G>T	ENSP00000377132:p.Glu334*	Unknown		x	x	x	114071986	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Nonsense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.812943	0.96975	.	.	ENSG00000128573	ENST00000393500;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000390668;ENST00000393491	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.7059	0.96071	0.0:0.0:1.0:0.0	.	.	.	.	X	259;334;359;351;334;311;334;242;334;358;242	.	ENSP00000265436:E334X	E	+	1	0	FOXP2	114071986	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.420000	0.97426	2.673000	0.90976	0.591000	0.81541	GAG		0.463	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491		Nonsense_Mutation
CPED1	79974	broad.mit.edu	37	7	120876863	120876863	+	Silent	SNP	A	A	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:120876863A>G	ENST00000310396.5	+	17	2618	c.2151A>G	c.(2149-2151)agA>agG	p.R717R	CPED1_ENST00000450913.2_Silent_p.R717R|CPED1_ENST00000423795.1_Silent_p.R497R	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	717						endoplasmic reticulum (GO:0005783)		p.R717R(1)									AACTAAAAAGATGTCCATCTG	0.363																																																1	Substitution - coding silent(1)	ovary(1)	7											95.0	91.0	93.0					7																	120876863		2203	4300	6503	120664099	SO:0001819	synonymous_variant	79974				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2151A>G	7.37:g.120876863A>G		Unknown		x	x	x	120664099	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	37	CCDS34739.1	SNP	12	Broad																																																																																				0.363	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		Silent
PARP12	64761	broad.mit.edu	37	7	139746809	139746809	+	Splice_Site	SNP	T	T	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:139746809T>A	ENST00000263549.3	-	5	1736		c.e5-2			NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12							nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.?(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					GGCACTTATCTGAAATAAAAA	0.448																																																1	Unknown(1)	ovary(1)	7											84.0	77.0	80.0					7																	139746809		2203	4300	6503	139393278	SO:0001630	splice_region_variant	64761			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.863-2A>T	7.37:g.139746809T>A		Unknown		x	x	x	139393278	Q9H610|Q9NP36|Q9NTI3	Splice_Site_SNP	SNP	ENST00000263549.3	37	CCDS5857.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	10.15	1.270751	0.23221	.	.	ENSG00000059378	ENST00000263549	.	.	.	5.56	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9194	0.41455	0.0:0.1383:0.0:0.8617	.	.	.	.	.	-1	.	.	.	-	.	.	PARP12	139393278	1.000000	0.71417	0.767000	0.31495	0.135000	0.20990	6.980000	0.76160	0.494000	0.27859	0.448000	0.29417	.		0.448	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	Intron	Splice_Site_SNP
TRPV5	56302	broad.mit.edu	37	7	142626208	142626208	+	Silent	SNP	G	G	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr7:142626208G>A	ENST00000265310.1	-	5	843	c.495C>T	c.(493-495)caC>caT	p.H165H	TRPV5_ENST00000442623.1_Silent_p.H165H	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	165					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.H165H(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					AGGACAAAGGGTGCTCCCCTG	0.602																																																1	Substitution - coding silent(1)	ovary(1)	7											65.0	52.0	57.0					7																	142626208		2203	4300	6503	142336330	SO:0001819	synonymous_variant	56302			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.495C>T	7.37:g.142626208G>A		Unknown		x	x	x	142336330	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	CCDS5875.1	SNP	44	Broad																																																																																				0.602	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		Silent
RP1	6101	broad.mit.edu	37	8	55537421	55537421	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr8:55537421C>G	ENST00000220676.1	+	4	1127	c.979C>G	c.(979-981)Caa>Gaa	p.Q327E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	327					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.Q327E(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TATTTTTAATCAAGACGGCAC	0.323																																					Colon(91;1014 1389 7634 14542 40420)											1	Substitution - Missense(1)	ovary(1)	8											62.0	64.0	63.0					8																	55537421		2203	4299	6502	55699974	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.979C>G	8.37:g.55537421C>G	ENSP00000220676:p.Gln327Glu	Unknown		x	x	x	55699974		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636856	0.47049	.	.	ENSG00000104237	ENST00000220676	T	0.23950	1.88	5.08	5.08	0.68730	.	0.000000	0.56097	D	0.000036	T	0.35595	0.0937	L	0.50333	1.59	0.32178	N	0.580706	P	0.52463	0.953	P	0.49387	0.609	T	0.40515	-0.9559	10	0.44086	T	0.13	.	18.4969	0.90867	0.0:1.0:0.0:0.0	.	327	P56715	RP1_HUMAN	E	327	ENSP00000220676:Q327E	ENSP00000220676:Q327E	Q	+	1	0	RP1	55699974	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.612000	0.61169	2.361000	0.80049	0.655000	0.94253	CAA		0.323	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		Missense_Mutation
KIF24	347240	broad.mit.edu	37	9	34256558	34256558	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr9:34256558G>C	ENST00000402558.2	-	10	3071	c.3047C>G	c.(3046-3048)cCa>cGa	p.P1016R	KIF24_ENST00000379174.3_Missense_Mutation_p.P882R|KIF24_ENST00000379166.2_Missense_Mutation_p.P1016R|KIF24_ENST00000345050.2_Missense_Mutation_p.P882R			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1016					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P498R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CACCTGGATTGGGCCGTCTGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	9											152.0	133.0	140.0					9																	34256558		2203	4300	6503	34246558	SO:0001583	missense	347240			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3047C>G	9.37:g.34256558G>C	ENSP00000384433:p.Pro1016Arg	Unknown		x	x	x	34246558	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632846	0.29068	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.70749	-0.3;-0.51;-0.3;-0.51	5.51	1.28	0.21552	.	0.700151	0.12488	N	0.464479	T	0.55016	0.1894	L	0.53249	1.67	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.31308	-0.9948	10	0.14252	T	0.57	.	1.0669	0.01612	0.199:0.1305:0.4122:0.2582	.	1016	Q5T7B8	KIF24_HUMAN	R	1016;882;1016;882;1016	ENSP00000384433:P1016R;ENSP00000368472:P882R;ENSP00000368464:P1016R;ENSP00000340179:P882R	ENSP00000340179:P882R	P	-	2	0	KIF24	34246558	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	0.053000	0.14184	0.684000	0.31448	0.563000	0.77884	CCA		0.532	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			Missense_Mutation
TRPM3	80036	broad.mit.edu	37	9	73426148	73426148	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chr9:73426148A>T	ENST00000396292.4	-	5	526	c.527T>A	c.(526-528)tTt>tAt	p.F176Y	TRPM3_ENST00000396283.1_Missense_Mutation_p.F176Y|TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000361823.5_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000360823.2_Missense_Mutation_p.F176Y|TRPM3_ENST00000377110.3_Intron|TRPM3_ENST00000358082.3_Missense_Mutation_p.F176Y|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000423814.3_Missense_Mutation_p.F331Y|MIR204_ENST00000385200.1_RNA|TRPM3_ENST00000377106.1_Missense_Mutation_p.F176Y|TRPM3_ENST00000377105.1_Intron			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	329					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.F176Y(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AAGAGAGAAAAACGGCAGGCA	0.338																																																1	Substitution - Missense(1)	ovary(1)	9											60.0	64.0	63.0					9																	73426148		2203	4300	6503	72615968	SO:0001583	missense	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000396292.4:c.527T>A	9.37:g.73426148A>T	ENSP00000379587:p.Phe176Tyr	Unknown		x	x	x	72615968	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000396292.4	37	CCDS6635.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	11.78	1.739479	0.30774	.	.	ENSG00000083067	ENST00000377106;ENST00000360823;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000396283	T;T;T;T;T;T	0.66995	0.6;0.61;0.6;0.61;0.65;-0.24	4.79	4.79	0.61399	.	.	.	.	.	T	0.62085	0.2399	N	0.11927	0.2	0.80722	D	1	P	0.43392	0.805	P	0.57776	0.827	T	0.60306	-0.7289	9	0.30854	T	0.27	.	11.0179	0.47701	1.0:0.0:0.0:0.0	.	176	A2A3F4	.	Y	176;176;176;176;331;176	ENSP00000366310:F176Y;ENSP00000354066:F176Y;ENSP00000379587:F176Y;ENSP00000350791:F176Y;ENSP00000389542:F331Y;ENSP00000379579:F176Y	ENSP00000350791:F176Y	F	-	2	0	TRPM3	72615968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.575000	0.53870	2.371000	0.80710	0.533000	0.62120	TTT		0.338	TRPM3-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214161.2	NM_206945		Missense_Mutation
DCAF8L1	139425	broad.mit.edu	37	X	27998772	27998772	+	Missense_Mutation	SNP	C	C	G	rs139420081		TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chrX:27998772C>G	ENST00000441525.1	-	1	794	c.680G>C	c.(679-681)cGg>cCg	p.R227P		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	227								p.R227P(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TGGCTTCTGCCGCACCCAGTC	0.517																																																1	Substitution - Missense(1)	ovary(1)	X											51.0	43.0	46.0					X																	27998772		2202	4300	6502	27908693	SO:0001583	missense	139425				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.680G>C	X.37:g.27998772C>G	ENSP00000405222:p.Arg227Pro	Unknown		x	x	x	27908693	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219955	0.39201	.	.	ENSG00000226372	ENST00000441525	T	0.81078	-1.45	0.842	0.842	0.18927	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.602490	0.15305	N	0.269393	T	0.82162	0.4977	M	0.77103	2.36	0.09310	N	1	D	0.53462	0.96	P	0.51415	0.669	T	0.71310	-0.4631	10	0.44086	T	0.13	-0.2257	7.2758	0.26283	0.0:0.9999:0.0:1.0E-4	.	227	A6NGE4	DC8L1_HUMAN	P	227	ENSP00000405222:R227P	ENSP00000405222:R227P	R	-	2	0	DCAF8L1	27908693	0.013000	0.17824	0.006000	0.13384	0.423000	0.31445	2.005000	0.40864	0.691000	0.31592	0.284000	0.19432	CGG		0.517	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		Missense_Mutation
BCOR	54880	broad.mit.edu	37	X	39916574	39916574	+	Splice_Site	SNP	C	C	A			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chrX:39916574C>A	ENST00000378444.4	-	11	4657	c.4429G>T	c.(4429-4431)Gaa>Taa	p.E1477*	BCOR_ENST00000397354.3_Splice_Site_p.E1443*|BCOR_ENST00000378463.1_Splice_Site_p.E320*|BCOR_ENST00000378455.4_Splice_Site_p.E1425*|BCOR_ENST00000342274.4_Splice_Site_p.E1443*	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1477					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E1443*(1)		breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						AGGACCACTTCCTGTGGGGAG	0.512			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		1	Substitution - Nonsense(1)	ovary(1)	X											87.0	58.0	68.0					X																	39916574		2202	4300	6502	39801518	SO:0001630	splice_region_variant	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4429-1G>T	X.37:g.39916574C>A		Unknown		x	x	x	39801518	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Nonsense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	SNP	30	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	46|46	12.555684|12.555684	0.99677|0.99677	.|.	.|.	ENSG00000183337|ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018|ENST00000427012	.|.	.|.	.|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74366	.|0.3707	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73861	.|-0.3849	.|3	0.87932|.	D|.	0|.	-21.7359|-21.7359	18.2232|18.2232	0.89907|0.89907	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|S	347;320;1425;1443;1477;1443;150|171	.|.	ENSP00000345923:E1443X|.	E|R	-|-	1|3	0|2	BCOR|BCOR	39801518|39801518	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.849000|0.849000	0.48306|0.48306	7.487000|7.487000	0.81328|0.81328	2.240000|2.240000	0.73641|0.73641	0.600000|0.600000	0.82982|0.82982	GAA|AGG		0.512	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	Nonsense_Mutation	Nonsense_Mutation
HUWE1	10075	broad.mit.edu	37	X	53579651	53579651	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chrX:53579651C>T	ENST00000342160.3	-	61	9155	c.8698G>A	c.(8698-8700)Gtg>Atg	p.V2900M	HUWE1_ENST00000262854.6_Missense_Mutation_p.V2900M			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2900					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.V2790M(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CTGCCTTGCACTTCCGCCACA	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											55.0	55.0	55.0					X																	53579651		2203	4300	6503	53596376	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8698G>A	X.37:g.53579651C>T	ENSP00000340648:p.Val2900Met	Unknown		x	x	x	53596376	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	20	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.361|3.361	-0.130467|-0.130467	0.06753|0.06753	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.38560	.|1.13;1.13	5.88|5.88	2.78|2.78	0.32641|0.32641	.|.	.|1.122650	.|0.06645	.|N	.|0.761856	T|T	0.25494|0.25494	0.0620|0.0620	N|N	0.08118|0.08118	0|0	0.18873|0.18873	N|N	0.999989|0.999989	.|B;B	.|0.31351	.|0.214;0.32	.|B;B	.|0.34138	.|0.094;0.176	T|T	0.27054|0.27054	-1.0085|-1.0085	5|10	.|0.48119	.|T	.|0.1	.|.	5.9311|5.9311	0.19140|0.19140	0.1424:0.6337:0.1362:0.0877|0.1424:0.6337:0.1362:0.0877	.|.	.|2900;2900	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	N|M	1933|2900	.|ENSP00000340648:V2900M;ENSP00000262854:V2900M	.|ENSP00000262854:V2900M	S|V	-|-	2|1	0|0	HUWE1|HUWE1	53596376|53596376	0.613000|0.613000	0.27009|0.27009	0.830000|0.830000	0.32933|0.32933	0.222000|0.222000	0.24845|0.24845	1.326000|1.326000	0.33735|0.33735	1.236000|1.236000	0.43740|0.43740	0.600000|0.600000	0.82982|0.82982	AGT|GTG		0.582	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		Missense_Mutation
HTR2C	3358	broad.mit.edu	37	X	114141607	114141607	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chrX:114141607C>G	ENST00000276198.1	+	6	1734	c.1006C>G	c.(1006-1008)Ctt>Gtt	p.L336V	HTR2C_ENST00000371950.3_3'UTR|HTR2C_ENST00000371951.1_Missense_Mutation_p.L336V	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	336					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.L336F(1)|p.L336V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCTGTCTGTTCTTTGTGAGAA	0.373																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	X											190.0	172.0	178.0					X																	114141607		2203	4300	6503	114047863	SO:0001583	missense	3358				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.1006C>G	X.37:g.114141607C>G	ENSP00000276198:p.Leu336Val	Unknown		x	x	x	114047863	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641714	0.29157	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.39787	1.06;1.06	5.14	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	0.074991	0.56097	D	0.000038	T	0.31857	0.0810	N	0.17872	0.535	0.80722	D	1	P	0.41597	0.756	P	0.46885	0.53	T	0.04495	-1.0947	10	0.36615	T	0.2	.	7.821	0.29288	0.1601:0.7449:0.0:0.0949	.	336	P28335	5HT2C_HUMAN	V	336	ENSP00000276198:L336V;ENSP00000361019:L336V	ENSP00000276198:L336V	L	+	1	0	HTR2C	114047863	1.000000	0.71417	0.941000	0.38009	0.620000	0.37586	3.974000	0.56852	1.079000	0.41038	0.468000	0.43344	CTT		0.373	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868		Missense_Mutation
DDX26B	203522	broad.mit.edu	37	X	134706896	134706896	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2097-01	TCGA-61-2097-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2097-01	TCGA-61-2097-11	g.chrX:134706896C>T	ENST00000370752.4	+	11	1778	c.1444C>T	c.(1444-1446)Ctt>Ttt	p.L482F	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	482								p.L482F(1)		large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					GGAAACTGCACTTAGACTGAC	0.333																																																1	Substitution - Missense(1)	ovary(1)	X											73.0	75.0	74.0					X																	134706896		2203	4300	6503	134534562	SO:0001583	missense	203522			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.1444C>T	X.37:g.134706896C>T	ENSP00000359788:p.Leu482Phe	Unknown		x	x	x	134534562	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	CCDS35401.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.446230	0.01089	.	.	ENSG00000165359	ENST00000370752	T	0.33865	1.39	5.35	3.48	0.39840	.	0.715528	0.14112	N	0.340629	T	0.30166	0.0756	L	0.47716	1.5	0.09310	N	1	P;B	0.39576	0.679;0.356	B;B	0.37989	0.262;0.078	T	0.14309	-1.0477	10	0.51188	T	0.08	5.5359	7.5773	0.27944	0.2641:0.6525:0.0:0.0834	.	482;482	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	F	482	ENSP00000359788:L482F	ENSP00000359788:L482F	L	+	1	0	DDX26B	134534562	0.006000	0.16342	0.033000	0.17914	0.027000	0.11550	0.787000	0.26858	1.149000	0.42402	0.594000	0.82650	CTT		0.333	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		Missense_Mutation
