#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CELA2A	63036	broad.mit.edu	37	1	15793978	15793978	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:15793978A>G	ENST00000359621.4	+	7	762	c.737A>G	c.(736-738)tAc>tGc	p.Y246C	CELA2B_ENST00000494280.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)	p.Y246C(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						TGCAACTACTACCACAAGCCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	91.0	94.0					1																	15793978		2203	4300	6503	15666565	SO:0001583	missense	63036				CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.737A>G	1.37:g.15793978A>G	ENSP00000352639:p.Tyr246Cys	Unknown		x	x	x	15666565	B2R5I4|Q14243	Missense_Mutation	SNP	ENST00000359621.4	37	CCDS157.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	6.776	0.512051	0.12944	.	.	ENSG00000142615	ENST00000359621	D	0.88586	-2.4	3.08	-1.76	0.08006	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.534222	0.16916	U	0.194293	D	0.85204	0.5643	N	0.12746	0.255	0.09310	N	1	D	0.64830	0.994	D	0.62955	0.909	T	0.78708	-0.2099	10	0.39692	T	0.17	.	11.6929	0.51527	0.3394:0.6606:0.0:0.0	.	246	P08217	CEL2A_HUMAN	C	246	ENSP00000352639:Y246C	ENSP00000352639:Y246C	Y	+	2	0	CELA2A	15666565	0.000000	0.05858	0.976000	0.42696	0.010000	0.07245	-0.149000	0.10204	-0.094000	0.12374	-0.867000	0.03001	TAC		0.617	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	NM_033440		Missense_Mutation
GRIK3	2899	broad.mit.edu	37	1	37346392	37346392	+	Silent	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:37346392G>A	ENST00000373091.3	-	3	409	c.393C>T	c.(391-393)ccC>ccT	p.P131P	GRIK3_ENST00000373093.4_Silent_p.P131P	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	131					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.P131P(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GCTGGATGTGGGGCACCTCCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											195.0	173.0	180.0					1																	37346392		2203	4300	6503	37118979	SO:0001819	synonymous_variant	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.393C>T	1.37:g.37346392G>A		Unknown		x	x	x	37118979	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	37	CCDS416.1	SNP	43	Broad																																																																																				0.627	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831		Silent
RPS8	6202	broad.mit.edu	37	1	45243434	45243434	+	Silent	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:45243434C>T	ENST00000396651.3	+	4	520	c.360C>T	c.(358-360)ccC>ccT	p.P120P	RPS8_ENST00000372209.3_Silent_p.P100P|RPS8_ENST00000485390.1_3'UTR|RP11-269F19.2_ENST00000428791.1_RNA|SNORD55_ENST00000581525.1_RNA|SNORD46_ENST00000364043.1_RNA|SNORD38B_ENST00000384690.1_RNA|SNORD38A_ENST00000365161.1_RNA			P62241	RS8_HUMAN	ribosomal protein S8	120					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.P120P(1)		central_nervous_system(2)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	10	Acute lymphoblastic leukemia(166;0.155)					ATGCGCTGCCCCTGGGCCGCA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	1											49.0	45.0	47.0					1																	45243434		2203	4300	6503	45016021	SO:0001819	synonymous_variant	6202			BC070875	CCDS513.1	1p34.1-p32	2011-04-05			ENSG00000142937	ENSG00000142937		"""S ribosomal proteins"""	10441	protein-coding gene	gene with protein product		600357				8432552	Standard	NM_001012		Approved	S8	uc001cmi.3	P62241	OTTHUMG00000008494	ENST00000396651.3:c.360C>T	1.37:g.45243434C>T		Unknown		x	x	x	45016021	P09058|Q6IRL7	Silent	SNP	ENST00000396651.3	37	CCDS513.1	SNP	22	Broad																																																																																				0.572	RPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023439.1	NM_001012		Silent
BEST4	266675	broad.mit.edu	37	1	45250854	45250854	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:45250854C>G	ENST00000372207.3	-	6	837	c.838G>C	c.(838-840)Gcc>Ccc	p.A280P		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	280						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.A280P(1)		large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					TCTCCCAGGGCTGGGGCTGGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											50.0	59.0	56.0					1																	45250854		2203	4300	6503	45023441	SO:0001583	missense	266675			AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.838G>C	1.37:g.45250854C>G	ENSP00000361281:p.Ala280Pro	Unknown		x	x	x	45023441	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	37	CCDS514.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	2.253	-0.371159	0.05034	.	.	ENSG00000142959	ENST00000372207	D	0.98012	-4.66	4.77	-0.642	0.11486	.	0.718217	0.12651	N	0.450434	D	0.91264	0.7246	N	0.14661	0.345	0.09310	N	1	P	0.41131	0.739	B	0.38428	0.273	D	0.86881	0.2042	10	0.32370	T	0.25	-3.328	4.089	0.09960	0.0:0.4045:0.175:0.4205	.	280	Q8NFU0	BEST4_HUMAN	P	280	ENSP00000361281:A280P	ENSP00000361281:A280P	A	-	1	0	BEST4	45023441	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.257000	0.08745	0.009000	0.14813	0.655000	0.94253	GCC		0.612	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274		Missense_Mutation
CDKN2C	1031	broad.mit.edu	37	1	51436162	51436162	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:51436162C>G	ENST00000262662.1	+	3	2156	c.122C>G	c.(121-123)gCg>gGg	p.A41G	CDKN2C_ENST00000396148.1_Missense_Mutation_p.A41G|CDKN2C_ENST00000371761.3_Missense_Mutation_p.A41G			P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	41					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|oligodendrocyte differentiation (GO:0048709)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0?(11)|p.A41G(1)		central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|thyroid(1)	23				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		GGAAGGACTGCGCTGCAGGTT	0.458			D		"""glioma, MM"""																																Melanoma(47;50 1155 4767 22863 47597)		Rec	yes		1	1p32	1031	"""cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)"""		"""O, L"""	12	Whole gene deletion(11)|Substitution - Missense(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(4)|thyroid(1)|ovary(1)	1											96.0	99.0	98.0					1																	51436162		2203	4300	6503	51208750	SO:0001583	missense	1031			BC000598	CCDS555.1	1p32.3	2013-01-10			ENSG00000123080	ENSG00000123080		"""Ankyrin repeat domain containing"""	1789	protein-coding gene	gene with protein product		603369				8001816, 9636670	Standard	NM_001262		Approved	INK4C, p18	uc001csg.3	P42773	OTTHUMG00000008046	ENST00000262662.1:c.122C>G	1.37:g.51436162C>G	ENSP00000262662:p.Ala41Gly	Unknown		x	x	x	51208750	Q8TB83	Missense_Mutation	SNP	ENST00000262662.1	37	CCDS555.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	19.97	3.926000	0.73327	.	.	ENSG00000123080	ENST00000262662;ENST00000396148;ENST00000371761	T;T;T	0.73047	-0.71;-0.71;-0.71	5.23	5.23	0.72850	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.89298	0.6675	H	0.95114	3.625	0.80722	D	1	D	0.65815	0.995	D	0.81914	0.995	D	0.92095	0.5683	10	0.87932	D	0	-6.842	18.9897	0.92786	0.0:1.0:0.0:0.0	.	41	P42773	CDN2C_HUMAN	G	41	ENSP00000262662:A41G;ENSP00000379452:A41G;ENSP00000360826:A41G	ENSP00000262662:A41G	A	+	2	0	CDKN2C	51208750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.648000	0.74359	2.714000	0.92807	0.655000	0.94253	GCG		0.458	CDKN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022058.1	NM_001262		Missense_Mutation
NEXN	91624	broad.mit.edu	37	1	78383348	78383348	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:78383348G>T	ENST00000334785.7	+	3	309	c.125G>T	c.(124-126)aGg>aTg	p.R42M	NEXN_ENST00000294624.8_Missense_Mutation_p.R42M|NEXN_ENST00000457030.1_Missense_Mutation_p.R42M|NEXN_ENST00000330010.8_Intron	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)									p.R42M(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		CAGAGAGCCAGGGAAGAAAGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	70.0	72.0					1																	78383348		1835	4085	5920	78155936	SO:0001583	missense	91624			AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.125G>T	1.37:g.78383348G>T	ENSP00000333938:p.Arg42Met	Unknown		x	x	x	78155936		Missense_Mutation	SNP	ENST00000334785.7	37	CCDS41351.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234786	0.79800	.	.	ENSG00000162614	ENST00000457030;ENST00000294624;ENST00000334785;ENST00000440324	T;T;T;T	0.74632	-0.27;-0.86;-0.29;-0.45	5.28	5.28	0.74379	.	0.000000	0.53938	D	0.000041	D	0.83663	0.5303	M	0.65975	2.015	0.58432	D	0.999992	D	0.89917	1.0	D	0.85130	0.997	D	0.84932	0.0860	10	0.87932	D	0	-12.574	19.2723	0.94015	0.0:0.0:1.0:0.0	.	42	Q0ZGT2	NEXN_HUMAN	M	42	ENSP00000388048:R42M;ENSP00000294624:R42M;ENSP00000333938:R42M;ENSP00000411902:R42M	ENSP00000294624:R42M	R	+	2	0	NEXN	78155936	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.235000	0.95353	2.618000	0.88619	0.609000	0.83330	AGG		0.383	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097549.1	NM_144573		Missense_Mutation
MCOLN2	255231	broad.mit.edu	37	1	85397190	85397190	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:85397190A>G	ENST00000370608.3	-	12	1464	c.1397T>C	c.(1396-1398)tTt>tCt	p.F466S	MCOLN2_ENST00000284027.5_Missense_Mutation_p.F438S	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	466					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F466S(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		AAAGGTTGCAAACATGTCATC	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											72.0	75.0	74.0					1																	85397190		2203	4300	6503	85169778	SO:0001583	missense	255231			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1397T>C	1.37:g.85397190A>G	ENSP00000359640:p.Phe466Ser	Unknown		x	x	x	85169778	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	37	CCDS30762.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	20.8	4.050747	0.75960	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.74632	-0.86;-0.86	4.93	3.79	0.43588	Polycystin cation channel, PKD1/PKD2 (1);	0.048293	0.85682	D	0.000000	T	0.80618	0.4657	M	0.87180	2.865	0.58432	D	0.999999	D	0.56968	0.978	P	0.60012	0.867	T	0.83341	-0.0008	10	0.72032	D	0.01	-49.2802	10.8805	0.46935	0.8507:0.0:0.0:0.1493	.	466	Q8IZK6	MCLN2_HUMAN	S	466;438	ENSP00000359640:F466S;ENSP00000284027:F438S	ENSP00000284027:F438S	F	-	2	0	MCOLN2	85169778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.781000	0.68964	0.834000	0.34852	0.528000	0.53228	TTT		0.388	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259		Missense_Mutation
LRRC39	127495	broad.mit.edu	37	1	100626046	100626046	+	Silent	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:100626046C>T	ENST00000370137.1	-	4	393	c.195G>A	c.(193-195)ttG>ttA	p.L65L	LRRC39_ENST00000342895.3_Silent_p.L65L|LRRC39_ENST00000370138.1_Silent_p.L65L	NM_001256386.1|NM_144620.3	NP_001243315.1|NP_653221.1	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39	65								p.L65L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	13		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TTTCTATCTTCAAAATGACTC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											170.0	167.0	168.0					1																	100626046		2203	4300	6503	100398634	SO:0001819	synonymous_variant	127495			AK096892	CCDS766.1, CCDS58014.1	1p21.3	2008-02-05			ENSG00000122477	ENSG00000122477			28228	protein-coding gene	gene with protein product						12975309	Standard	NM_001256385		Approved	MGC14816	uc001dsx.2	Q96DD0	OTTHUMG00000010839	ENST00000370137.1:c.195G>A	1.37:g.100626046C>T		Unknown		x	x	x	100398634	B3KUD2|D3DT56|Q5VVK7	Silent	SNP	ENST00000370137.1	37	CCDS766.1	SNP	29	Broad																																																																																				0.388	LRRC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029917.2	NM_144620		Silent
CD101	9398	broad.mit.edu	37	1	117554416	117554416	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:117554416G>C	ENST00000256652.4	+	3	727	c.669G>C	c.(667-669)caG>caC	p.Q223H	CD101_ENST00000369470.1_Missense_Mutation_p.Q223H	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	223	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.Q223H(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GTGACGTACAGCTCAACAAAC	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											85.0	75.0	79.0					1																	117554416		2203	4300	6503	117355939	SO:0001583	missense	9398			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.669G>C	1.37:g.117554416G>C	ENSP00000256652:p.Gln223His	Unknown		x	x	x	117355939	Q15856	Missense_Mutation	SNP	ENST00000256652.4	37	CCDS891.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343309	0.24339	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.65178	-0.14;-0.14	5.57	-4.11	0.03928	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.608916	0.15180	N	0.276180	T	0.21427	0.0516	N	0.14661	0.345	0.09310	N	1	P	0.37612	0.602	P	0.45377	0.478	T	0.31971	-0.9924	10	0.49607	T	0.09	-6.3817	0.3432	0.00337	0.3446:0.2114:0.2287:0.2152	.	223	Q93033	IGSF2_HUMAN	H	223	ENSP00000256652:Q223H;ENSP00000358482:Q223H	ENSP00000256652:Q223H	Q	+	3	2	CD101	117355939	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	-0.066000	0.11598	-0.816000	0.04340	-0.218000	0.12543	CAG		0.507	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258		Missense_Mutation
HMCN1	83872	broad.mit.edu	37	1	186034454	186034454	+	Missense_Mutation	SNP	G	G	A	rs199987140		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:186034454G>A	ENST00000271588.4	+	49	7827	c.7598G>A	c.(7597-7599)cGt>cAt	p.R2533H	HMCN1_ENST00000367492.2_Missense_Mutation_p.R2533H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2533	Ig-like C2-type 23.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R2533H(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCTGGTGGCCGTTTTCTTCAA	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		15102	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											80.0	75.0	77.0					1																	186034454		2203	4300	6503	184301077	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7598G>A	1.37:g.186034454G>A	ENSP00000271588:p.Arg2533His	Unknown		x	x	x	184301077	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	40	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.90	1.776805	0.31411	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66280	-0.2;-0.2	5.53	0.195	0.15151	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.304446	0.42821	N	0.000650	T	0.42177	0.1191	N	0.21142	0.635	0.52501	D	0.999959	B	0.14805	0.011	B	0.14578	0.011	T	0.11717	-1.0576	10	0.21540	T	0.41	.	10.4292	0.44398	0.5057:0.0:0.4943:0.0	.	2533	Q96RW7	HMCN1_HUMAN	H	2533	ENSP00000271588:R2533H;ENSP00000356462:R2533H	ENSP00000271588:R2533H	R	+	2	0	HMCN1	184301077	1.000000	0.71417	0.987000	0.45799	0.717000	0.41224	1.835000	0.39181	-0.006000	0.14370	-0.367000	0.07326	CGT		0.458	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Missense_Mutation
B3GALT2	8707	broad.mit.edu	37	1	193149686	193149686	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr1:193149686C>A	ENST00000367434.4	-	2	1762	c.1007G>T	c.(1006-1008)cGt>cTt	p.R336L	CDC73_ENST00000367435.3_Intron	NM_003783.3	NP_003774.1	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2	336					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.R336L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	16						CAAGTGCAAACGGCGGATACC	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	71.0	71.0					1																	193149686		2203	4300	6503	191416309	SO:0001583	missense	8707			Y15060	CCDS1383.1	1q31	2013-02-19			ENSG00000162630	ENSG00000162630		"""Beta 3-glycosyltransferases"""	917	protein-coding gene	gene with protein product		603018				9582303, 9417100	Standard	NM_003783		Approved	beta3Gal-T2	uc001gtc.4	O43825	OTTHUMG00000035687	ENST00000367434.4:c.1007G>T	1.37:g.193149686C>A	ENSP00000356404:p.Arg336Leu	Unknown		x	x	x	191416309	B2RAB1|Q9BZQ9	Missense_Mutation	SNP	ENST00000367434.4	37	CCDS1383.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	9.450	1.090354	0.20471	.	.	ENSG00000162630	ENST00000367434	T	0.39406	1.08	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.16854	0.0405	N	0.00811	-1.165	0.80722	D	1	B	0.30114	0.269	B	0.32583	0.148	T	0.32981	-0.9886	10	0.02654	T	1	.	19.2206	0.93795	0.0:1.0:0.0:0.0	.	336	O43825	B3GT2_HUMAN	L	336	ENSP00000356404:R336L	ENSP00000356404:R336L	R	-	2	0	B3GALT2	191416309	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.208000	0.51114	2.529000	0.85273	0.650000	0.86243	CGT		0.428	B3GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086759.1	NM_003783		Missense_Mutation
MGMT	4255	broad.mit.edu	37	10	131506261	131506261	+	Silent	SNP	C	C	T	rs112373357		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr10:131506261C>T	ENST00000306010.7	+	3	353	c.321C>T	c.(319-321)atC>atT	p.I107I	MGMT_ENST00000462672.1_3'UTR	NM_002412.3	NP_002403.2	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	76					cellular response to ionizing radiation (GO:0071479)|cellular response to organic cyclic compound (GO:0071407)|cellular response to oxidative stress (GO:0034599)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA ligation (GO:0006266)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to toxic substance (GO:0009636)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methylated-DNA-[protein]-cysteine S-methyltransferase activity (GO:0003908)|methyltransferase activity (GO:0008168)	p.I76I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	10		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	L-Cysteine(DB00151)	CCGAGGCTATCGAAGAGTTCC	0.597								Direct reversal of damage																																								1	Substitution - coding silent(1)	ovary(1)	10						C		1,4405	2.1+/-5.4	0,1,2202	108.0	107.0	108.0		321	-4.1	0.0	10	dbSNP_132	108	0,8600		0,0,4300	no	coding-synonymous	MGMT	NM_002412.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		107/239	131506261	1,13005	2203	4300	6503	131396251	SO:0001819	synonymous_variant	4255			M29971	CCDS7660.2	10q26	2005-10-06			ENSG00000170430	ENSG00000170430			7059	protein-coding gene	gene with protein product		156569					Standard	NM_002412		Approved		uc001lkh.2	P16455	OTTHUMG00000019261	ENST00000306010.7:c.321C>T	10.37:g.131506261C>T		Unknown		x	x	x	131396251	Q5VY78	Silent	SNP	ENST00000306010.7	37	CCDS7660.2	SNP	31	Broad																																																																																				0.597	MGMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051009.3	NM_002412		Silent
EFEMP2	30008	broad.mit.edu	37	11	65635353	65635353	+	Silent	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr11:65635353C>T	ENST00000307998.6	-	10	1379	c.1149G>A	c.(1147-1149)tcG>tcA	p.S383S	EFEMP2_ENST00000532648.1_5'Flank|EFEMP2_ENST00000528176.1_Silent_p.S383S	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	383					blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)	p.S383S(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		AGTCCCCCTGCGAGTTTCCAG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	11											88.0	88.0	88.0					11																	65635353		2201	4296	6497	65391929	SO:0001819	synonymous_variant	30008			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.1149G>A	11.37:g.65635353C>T		Unknown		x	x	x	65391929	A8K7R4|B3KM31|B3KQT1|O75967	Silent	SNP	ENST00000307998.6	37	CCDS8116.1	SNP	27	Broad																																																																																				0.562	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938		Silent
CACNA1C	775	broad.mit.edu	37	12	2774755	2774755	+	Silent	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr12:2774755C>T	ENST00000347598.4	+	38	4551	c.4551C>T	c.(4549-4551)aaC>aaT	p.N1517N	CACNA1C_ENST00000399617.1_Silent_p.N1469N|CACNA1C_ENST00000402845.3_Silent_p.N1469N|CACNA1C_ENST00000399644.1_Silent_p.N1469N|CACNA1C_ENST00000335762.5_Silent_p.N1494N|CACNA1C_ENST00000399641.1_Silent_p.N1469N|CACNA1C_ENST00000327702.7_Silent_p.N1469N|CACNA1C_ENST00000399649.1_Silent_p.N1456N|CACNA1C-AS2_ENST00000545526.1_RNA|CACNA1C_ENST00000399637.1_Silent_p.N1469N|CACNA1C_ENST00000399603.1_Silent_p.N1469N|CACNA1C_ENST00000399634.1_Silent_p.N1469N|CACNA1C_ENST00000399597.1_Silent_p.N1469N|CACNA1C_ENST00000399655.1_Silent_p.N1469N|CACNA1C_ENST00000406454.3_Silent_p.N1469N|CACNA1C_ENST00000399638.1_Silent_p.N1497N|CACNA1C_ENST00000399591.1_Silent_p.N1458N|CACNA1C_ENST00000399601.1_Silent_p.N1469N|CACNA1C_ENST00000399621.1_Silent_p.N1469N|CACNA1C_ENST00000399595.1_Silent_p.N1458N|CACNA1C_ENST00000344100.3_Silent_p.N1491N|CACNA1C_ENST00000399629.1_Silent_p.N1486N|CACNA1C_ENST00000399606.1_Silent_p.N1489N	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1517	Dihydropyridine binding. {ECO:0000250}.|Phenylalkylamine binding. {ECO:0000250}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.N1547N(1)|p.N1004N(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGATCATCAACCTCTTTGTAG	0.522																																																2	Substitution - coding silent(2)	ovary(2)	12											136.0	139.0	138.0					12																	2774755		2196	4300	6496	2645016	SO:0001819	synonymous_variant	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4551C>T	12.37:g.2774755C>T		Unknown		x	x	x	2645016	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1	SNP	18	Broad																																																																																				0.522	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		Silent
ERGIC2	51290	broad.mit.edu	37	12	29510635	29510635	+	Silent	SNP	T	T	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr12:29510635T>G	ENST00000360150.4	-	7	472	c.397A>C	c.(397-399)Agg>Cgg	p.R133R		NM_016570.2	NP_057654.2	Q96RQ1	ERGI2_HUMAN	ERGIC and golgi 2	133					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)		p.R133R(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)					TCTTGTAGCCTACTCTGAATC	0.343																																																1	Substitution - coding silent(1)	ovary(1)	12											125.0	123.0	124.0					12																	29510635		1852	4103	5955	29401902	SO:0001819	synonymous_variant	51290			AF216751	CCDS41765.1	12p11.22	2006-02-08							30208	protein-coding gene	gene with protein product		612236				11445006, 12932305	Standard	NM_016570		Approved	PTX1, Erv41	uc001riv.3	Q96RQ1		ENST00000360150.4:c.397A>C	12.37:g.29510635T>G		Unknown		x	x	x	29401902	A6NHH6|Q53GY2|Q8N2Q9|Q9BVV9|Q9NZA3	Silent	SNP	ENST00000360150.4	37	CCDS41765.1	SNP	53	Broad																																																																																				0.343	ERGIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403489.1	NM_016570		Silent
MDM1	56890	broad.mit.edu	37	12	68690735	68690735	+	Missense_Mutation	SNP	T	T	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr12:68690735T>A	ENST00000303145.7	-	13	2086	c.2000A>T	c.(1999-2001)cAg>cTg	p.Q667L	MDM1_ENST00000540418.1_Missense_Mutation_p.Q387L|MDM1_ENST00000411698.2_Missense_Mutation_p.Q632L	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	667					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)		p.Q667L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TTGAGGTAACTGCAAATTGTT	0.313																																																1	Substitution - Missense(1)	ovary(1)	12											128.0	122.0	124.0					12																	68690735		2202	4299	6501	66977002	SO:0001583	missense	56890			AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.2000A>T	12.37:g.68690735T>A	ENSP00000302537:p.Gln667Leu	Unknown		x	x	x	66977002	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	ENST00000303145.7	37	CCDS8983.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	8.038	0.763170	0.15914	.	.	ENSG00000111554	ENST00000540418;ENST00000303145;ENST00000411698	T;T;T	0.25579	1.79;2.09;2.1	5.02	3.88	0.44766	.	0.537282	0.20336	N	0.094339	T	0.26122	0.0637	M	0.72118	2.19	0.80722	D	1	B;B	0.14438	0.004;0.01	B;B	0.11329	0.006;0.006	T	0.04650	-1.0936	9	.	.	.	-5.3148	7.8707	0.29565	0.0:0.0927:0.0:0.9073	.	632;667	E7EPQ3;Q8TC05	.;MDM1_HUMAN	L	387;667;632	ENSP00000443815:Q387L;ENSP00000302537:Q667L;ENSP00000391006:Q632L	.	Q	-	2	0	MDM1	66977002	1.000000	0.71417	0.922000	0.36590	0.293000	0.27360	1.280000	0.33202	1.065000	0.40693	-0.281000	0.10026	CAG		0.313	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128		Missense_Mutation
CIT	11113	broad.mit.edu	37	12	120135501	120135501	+	Missense_Mutation	SNP	C	C	T	rs367930288		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr12:120135501C>T	ENST00000261833.7	-	45	5771	c.5719G>A	c.(5719-5721)Ggc>Agc	p.G1907S	CIT_ENST00000537607.1_5'UTR|RP1-127H14.3_ENST00000535109.1_5'Flank|CIT_ENST00000392521.2_Missense_Mutation_p.G1949S	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1907					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.G1935S(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TGTTCAGTGCCGGACTCCTTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	12						C	SER/GLY,SER/GLY	1,4405	2.1+/-5.4	0,1,2202	103.0	107.0	105.0		5845,5719	2.7	0.8	12		105	0,8600		0,0,4300	no	missense,missense	CIT	NM_001206999.1,NM_007174.2	56,56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	1949/2070,1907/2028	120135501	1,13005	2203	4300	6503	118619884	SO:0001583	missense	11113			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5719G>A	12.37:g.120135501C>T	ENSP00000261833:p.Gly1907Ser	Unknown		x	x	x	118619884	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665825	0.47677	2.27E-4	0.0	ENSG00000122966	ENST00000392521;ENST00000261833	T;T	0.63417	-0.02;-0.04	4.91	2.66	0.31614	.	0.373196	0.28871	N	0.013866	T	0.48003	0.1476	L	0.47716	1.5	0.26885	N	0.967448	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.0;0.0;0.001	T	0.35574	-0.9783	10	0.40728	T	0.16	.	4.1964	0.10445	0.0:0.499:0.0:0.501	.	1949;1907;1425	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	S	1949;1907	ENSP00000376306:G1949S;ENSP00000261833:G1907S	ENSP00000261833:G1907S	G	-	1	0	CIT	118619884	.	.	0.836000	0.33094	0.886000	0.51366	.	.	1.199000	0.43173	0.655000	0.94253	GGC		0.562	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		Missense_Mutation
HCAR2	338442	broad.mit.edu	37	12	123187813	123187813	+	Silent	SNP	C	C	T	rs200636697		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr12:123187813C>T	ENST00000328880.5	-	1	77	c.18G>A	c.(16-18)ctG>ctA	p.L6L	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	6					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)	p.L6L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	AGTGATCCTGCAGATGGTGCC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	12											97.0	90.0	92.0					12																	123187813		2203	4300	6503	121753766	SO:0001819	synonymous_variant	338442			AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.18G>A	12.37:g.123187813C>T		Unknown		x	x	x	121753766	A0PJL5|A7LGG3	Silent	SNP	ENST00000328880.5	37	CCDS9235.1	SNP	25	Broad																																																																																				0.527	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370202.1	NM_177551		Silent
HCAR3	8843	broad.mit.edu	37	12	123201267	123201267	+	Silent	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr12:123201267C>T	ENST00000528880.2	-	1	172	c.18G>A	c.(16-18)ctG>ctA	p.L6L	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	6					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L6L(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	AGTGATCCTGCAGATGGTGCC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	12											84.0	74.0	77.0					12																	123201267		2203	4300	6503	121767220	SO:0001819	synonymous_variant	8843			D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.18G>A	12.37:g.123201267C>T		Unknown		x	x	x	121767220	A8K4G5|B2R830|E9PI97|Q8NGE4	Silent	SNP	ENST00000528880.2	37	CCDS53842.1	SNP	25	Broad																																																																																				0.522	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018		Silent
TBC1D4	9882	broad.mit.edu	37	13	75873642	75873642	+	Missense_Mutation	SNP	G	G	C	rs370816364		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr13:75873642G>C	ENST00000377636.3	-	17	3326	c.2980C>G	c.(2980-2982)Ctc>Gtc	p.L994V	TBC1D4_ENST00000431480.2_Missense_Mutation_p.L986V|TBC1D4_ENST00000478591.1_5'UTR|TBC1D4_ENST00000377625.2_Missense_Mutation_p.L931V|TBC1D4_ENST00000425511.1_Missense_Mutation_p.L158V	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	994	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.L994V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GCTTTCAGGAGGTTAAACAGT	0.468																																																1	Substitution - Missense(1)	ovary(1)	13											55.0	57.0	56.0					13																	75873642		1896	4132	6028	74771643	SO:0001583	missense	9882			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.2980C>G	13.37:g.75873642G>C	ENSP00000366863:p.Leu994Val	Unknown		x	x	x	74771643	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	37	CCDS41901.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048531	0.75846	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	5.41	5.41	0.78517	Rab-GAP/TBC domain (4);	0.000000	0.64402	D	0.000018	T	0.11495	0.0280	N	0.02876	-0.465	0.80722	D	1	B;P;B;D	0.69078	0.242;0.805;0.361;0.997	B;B;B;D	0.85130	0.131;0.432;0.321;0.997	T	0.56414	-0.7983	10	0.19590	T	0.45	-16.8428	19.1956	0.93686	0.0:0.0:1.0:0.0	.	158;931;986;994	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	V	994;986;931;158	ENSP00000366863:L994V;ENSP00000395986:L986V;ENSP00000366852:L931V;ENSP00000390654:L158V	ENSP00000366852:L931V	L	-	1	0	TBC1D4	74771643	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.635000	0.83286	2.524000	0.85096	0.591000	0.81541	CTC		0.468	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832		Missense_Mutation
RNASE9	390443	broad.mit.edu	37	14	21024850	21024850	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr14:21024850T>G	ENST00000557068.1	-	4	2104	c.379A>C	c.(379-381)Att>Ctt	p.I127L	RNASE9_ENST00000557209.1_Missense_Mutation_p.I132L|RNASE9_ENST00000554964.1_Missense_Mutation_p.I127L|RNASE9_ENST00000556208.1_Missense_Mutation_p.I132L|RNASE9_ENST00000555230.1_Missense_Mutation_p.I127L|RNASE9_ENST00000553541.1_Missense_Mutation_p.I127L|RNASE9_ENST00000338904.3_Missense_Mutation_p.I127L|RNASE9_ENST00000553706.1_Missense_Mutation_p.I132L|RNASE9_ENST00000429244.2_Missense_Mutation_p.I127L|RNASE9_ENST00000404716.3_Missense_Mutation_p.I132L			P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)	127						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.I127L(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|ovary(2)|urinary_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		CATTTCCTAATTCCATTCTTA	0.368																																																1	Substitution - Missense(1)	ovary(1)	14											76.0	68.0	71.0					14																	21024850		2203	4300	6503	20094690	SO:0001583	missense	390443			AY665804	CCDS32036.1, CCDS53883.1, CCDS55904.1	14q11.2	2006-10-31				ENSG00000188655		"""Ribonucleases, RNase A"""	20673	protein-coding gene	gene with protein product		614014				15676279, 12920233	Standard	NM_001001673		Approved	h461	uc010ahu.3	P60153		ENST00000557068.1:c.379A>C	14.37:g.21024850T>G	ENSP00000451565:p.Ile127Leu	Unknown		x	x	x	20094690	A2RQR8|A8QJS1|Q5GAN7|Q6KG53	Missense_Mutation	SNP	ENST00000557068.1	37	CCDS32036.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	9.865	1.197338	0.22037	.	.	ENSG00000188655	ENST00000338904;ENST00000554964;ENST00000555230;ENST00000557068;ENST00000404716;ENST00000556208;ENST00000553541;ENST00000429244;ENST00000553706;ENST00000557209	T;T;T;T;T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	3.73	-7.47	0.01365	Ribonuclease A, domain (3);	.	.	.	.	T	0.55049	0.1896	L	0.29908	0.895	0.09310	N	1	B;B	0.23185	0.041;0.081	B;B	0.24155	0.051;0.03	T	0.43097	-0.9412	9	0.45353	T	0.12	-18.1418	13.2156	0.59859	0.0:0.5511:0.0:0.4489	.	127;132	P60153;P60153-2	RNAS9_HUMAN;.	L	127;127;127;127;132;132;127;127;132;132	ENSP00000340162:I127L;ENSP00000450599:I127L;ENSP00000450800:I127L;ENSP00000451565:I127L;ENSP00000384683:I132L;ENSP00000451160:I132L;ENSP00000451285:I127L;ENSP00000409504:I127L;ENSP00000450570:I132L;ENSP00000450987:I132L	ENSP00000340162:I127L	I	-	1	0	RNASE9	20094690	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.832000	0.01696	-1.960000	0.01017	-1.534000	0.00916	ATT		0.368	RNASE9-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411094.1	NM_001001673		Missense_Mutation
RSL24D1	51187	broad.mit.edu	37	15	55475541	55475541	+	Silent	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr15:55475541G>A	ENST00000260443.4	-	5	566	c.390C>T	c.(388-390)aaC>aaT	p.N130N		NM_016304.2	NP_057388.1	Q9UHA3	RLP24_HUMAN	ribosomal L24 domain containing 1	130					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)		p.N130N(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	7						TAAGATGGATGTTTTGCTTGA	0.353																																																1	Substitution - coding silent(1)	ovary(1)	15											83.0	74.0	77.0					15																	55475541		2193	4292	6485	53262833	SO:0001819	synonymous_variant	51187			AF201949	CCDS10152.1	15q21	2009-02-27	2009-02-27	2009-02-27	ENSG00000137876	ENSG00000137876			18479	protein-coding gene	gene with protein product		613262	"""chromosome 15 open reading frame 15"""	C15orf15		12808088, 11707418	Standard	NM_016304		Approved	HRP-L30-iso, L30, RPL24L, RPL24	uc002acn.3	Q9UHA3	OTTHUMG00000131957	ENST00000260443.4:c.390C>T	15.37:g.55475541G>A		Unknown		x	x	x	53262833	B2RD72|Q561V8|Q8N6S8|Q96B04|Q96C76|Q96HJ1	Silent	SNP	ENST00000260443.4	37	CCDS10152.1	SNP	48	Broad																																																																																				0.353	RSL24D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254916.1	NM_016304		Silent
SRRM2	23524	broad.mit.edu	37	16	2813347	2813347	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr16:2813347A>G	ENST00000301740.8	+	11	3367	c.2818A>G	c.(2818-2820)Agg>Ggg	p.R940G		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	940	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.R940G(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AAGTCCTAGTAGGGTGACGTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	16											90.0	83.0	85.0					16																	2813347		2198	4300	6498	2753348	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2818A>G	16.37:g.2813347A>G	ENSP00000301740:p.Arg940Gly	Unknown		x	x	x	2753348	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	6.450	0.451201	0.12223	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.27557	1.66	5.67	3.36	0.38483	.	0.000000	0.64402	D	0.000001	T	0.45418	0.1341	L	0.47716	1.5	0.29940	N	0.821118	D	0.57899	0.981	D	0.69824	0.966	T	0.45145	-0.9281	10	0.66056	D	0.02	-11.5969	11.2519	0.49031	0.5409:0.4591:0.0:0.0	.	940	Q9UQ35	SRRM2_HUMAN	G	940;940;192;905	ENSP00000301740:R940G	ENSP00000301740:R940G	R	+	1	2	SRRM2	2753348	0.944000	0.32072	0.981000	0.43875	0.539000	0.34962	1.100000	0.31025	0.393000	0.25203	-0.316000	0.08728	AGG		0.488	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			Missense_Mutation
SPN	6693	broad.mit.edu	37	16	29676215	29676215	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr16:29676215C>A	ENST00000360121.3	+	2	1258	c.1166C>A	c.(1165-1167)cCt>cAt	p.P389H	SPN_ENST00000395389.2_Missense_Mutation_p.P389H	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0	Pro-rich.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P389H(1)		central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						GCCCCAGCTCCTGATGAGCCC	0.647																																																1	Substitution - Missense(1)	ovary(1)	16											15.0	19.0	18.0					16																	29676215		2176	4286	6462	29583716	SO:0001583	missense	6693			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.1166C>A	16.37:g.29676215C>A	ENSP00000353238:p.Pro389His	Unknown		x	x	x	29583716	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	ENST00000360121.3	37	CCDS10650.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	.	16.85	3.236204	0.58886	.	.	ENSG00000197471	ENST00000395389;ENST00000360121	T;T	0.32272	1.46;1.46	4.94	2.93	0.34026	.	0.335067	0.21916	N	0.067238	T	0.21468	0.0517	N	0.22421	0.69	0.09310	N	1	P	0.45957	0.869	B	0.43018	0.405	T	0.06023	-1.0850	10	0.59425	D	0.04	-3.1531	8.4455	0.32838	0.1758:0.6548:0.1694:0.0	.	389	P16150	LEUK_HUMAN	H	389	ENSP00000378787:P389H;ENSP00000353238:P389H	ENSP00000353238:P389H	P	+	2	0	SPN	29583716	0.000000	0.05858	0.005000	0.12908	0.007000	0.05969	0.668000	0.25127	0.591000	0.29711	-0.499000	0.04595	CCT		0.647	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215001.2			Missense_Mutation
ZNF423	23090	broad.mit.edu	37	16	49823411	49823411	+	Silent	SNP	G	G	A	rs116537749	byFrequency	TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr16:49823411G>A	ENST00000561648.1	-	2	116	c.63C>T	c.(61-63)tcC>tcT	p.S21S	ZNF423_ENST00000262383.2_Silent_p.S21S|ZNF423_ENST00000562520.1_5'UTR|ZNF423_ENST00000563137.2_5'UTR	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	21					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S21S(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CTGCTGTCACGGAGGAATCCC	0.572													G|||	12	0.00239617	0.0083	0.0014	5008	,	,		16030	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	16						G		28,4368	35.2+/-66.4	0,28,2170	41.0	40.0	40.0		63	-7.6	0.9	16	dbSNP_132	40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF423	NM_015069.2		0,29,6469	AA,AG,GG		0.0116,0.6369,0.2231		21/1285	49823411	29,12967	2198	4300	6498	48380912	SO:0001819	synonymous_variant	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.63C>T	16.37:g.49823411G>A		Unknown		x	x	x	48380912	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1	SNP	39	Broad																																																																																				0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		Silent
TP53	7157	broad.mit.edu	37	17	7577142	7577142	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr17:7577142C>T	ENST00000269305.4	-	8	985	c.796G>A	c.(796-798)Gga>Aga	p.G266R	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.G266R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.G266R|TP53_ENST00000455263.2_Missense_Mutation_p.G266R|TP53_ENST00000359597.4_Missense_Mutation_p.G266R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266R(46)|p.G266*(14)|p.0?(8)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*79(2)|p.N263fs*5(1)|p.G266T(1)|p.L265_K305del41(1)|p.G266_E271delGRNSFE(1)|p.E258fs*71(1)|p.G266fs*9(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTTCCGTCCCAGTAGATTA	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	86	Substitution - Missense(47)|Substitution - Nonsense(14)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(3)|Insertion - Frameshift(1)	lung(16)|large_intestine(11)|ovary(8)|central_nervous_system(6)|urinary_tract(6)|oesophagus(6)|upper_aerodigestive_tract(5)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|liver(2)|skin(2)|pancreas(2)|biliary_tract(1)|peritoneum(1)|salivary_gland(1)|endometrium(1)|eye(1)|pleura(1)	17											49.0	44.0	46.0					17																	7577142		2203	4300	6503	7517867	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.796G>A	17.37:g.7577142C>T	ENSP00000269305:p.Gly266Arg	Unknown		x	x	x	7517867	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539769	0.85917	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.63;-7.63;-7.63;-7.63;-7.63;-7.63	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;0.986;0.997	D;D;D;D	0.97110	0.978;1.0;0.962;0.958	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	R	266;266;266;266;266;255;134	ENSP00000352610:G266R;ENSP00000269305:G266R;ENSP00000398846:G266R;ENSP00000391127:G266R;ENSP00000391478:G266R;ENSP00000425104:G134R	ENSP00000269305:G266R	G	-	1	0	TP53	7517867	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CA10	56934	broad.mit.edu	37	17	49825164	49825164	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr17:49825164C>T	ENST00000285273.4	-	5	1405	c.294G>A	c.(292-294)atG>atA	p.M98I	CA10_ENST00000340813.6_Missense_Mutation_p.M104I|CA10_ENST00000571918.1_5'UTR|CA10_ENST00000442502.2_Missense_Mutation_p.M98I|CA10_ENST00000570565.1_Missense_Mutation_p.M23I|CA10_ENST00000451037.2_Missense_Mutation_p.M98I	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	98					brain development (GO:0007420)			p.M98I(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CAGTGTTGTACATGGTCCCAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	105.0	110.0					17																	49825164		2203	4300	6503	47180163	SO:0001583	missense	56934			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.294G>A	17.37:g.49825164C>T	ENSP00000285273:p.Met98Ile	Unknown		x	x	x	47180163	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	c	22.6	4.309727	0.81247	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.72	5.72	0.89469	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.071779	0.85682	D	0.000000	T	0.52533	0.1740	N	0.11154	0.105	0.80722	D	1	P;P;B	0.49961	0.93;0.93;0.083	P;P;B	0.53102	0.718;0.718;0.055	T	0.50294	-0.8845	9	.	.	.	.	19.2318	0.93843	0.0:1.0:0.0:0.0	.	98;104;23	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	I	98;98;98;104	ENSP00000390666:M98I;ENSP00000285273:M98I;ENSP00000405388:M98I;ENSP00000340363:M104I	.	M	-	3	0	CA10	47180163	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.745000	0.85046	2.865000	0.98341	0.655000	0.94253	ATG		0.542	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178		Missense_Mutation
NPLOC4	55666	broad.mit.edu	37	17	79580491	79580491	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr17:79580491G>C	ENST00000331134.6	-	4	454	c.239C>G	c.(238-240)tCg>tGg	p.S80W	NPLOC4_ENST00000539314.1_5'UTR|NPLOC4_ENST00000374747.5_Missense_Mutation_p.S80W|NPLOC4_ENST00000574344.1_5'UTR	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	80					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S80W(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AGCAAGGCTCGAGGGAAACAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	17											60.0	57.0	58.0					17																	79580491		1981	4157	6138	77190937	SO:0001583	missense	55666			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.239C>G	17.37:g.79580491G>C	ENSP00000331487:p.Ser80Trp	Unknown		x	x	x	77190937	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	ENST00000331134.6	37	CCDS45812.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090874	0.76756	.	.	ENSG00000182446	ENST00000331134;ENST00000374747	.	.	.	5.82	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.66218	0.2767	L	0.44542	1.39	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.978;0.977	T	0.66720	-0.5852	9	0.72032	D	0.01	-7.7152	10.8268	0.46638	0.0676:0.0:0.8011:0.1313	.	80;80	Q8TAT6-2;Q8TAT6	.;NPL4_HUMAN	W	80;79	.	ENSP00000331487:S80W	S	-	2	0	NPLOC4	77190937	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.037000	0.76531	0.769000	0.33313	-0.136000	0.14681	TCG		0.512	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1			Missense_Mutation
MTCL1	23255	broad.mit.edu	37	18	8819155	8819155	+	Silent	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr18:8819155G>A	ENST00000306329.11	+	11	4011	c.4011G>A	c.(4009-4011)tcG>tcA	p.S1337S	SOGA2_ENST00000518815.1_Silent_p.S343S|SOGA2_ENST00000359865.3_Silent_p.S1018S|SOGA2_ENST00000306285.7_Silent_p.S343S|SOGA2_ENST00000400050.3_Silent_p.S977S|SOGA2_ENST00000517570.1_Silent_p.S977S														p.S1018S(1)									ACAGGTGCTCGGCCAGTGAGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	18											53.0	50.0	51.0					18																	8819155		2203	4300	6503	8809155	SO:0001819	synonymous_variant	23255																														ENST00000306329.11:c.4011G>A	18.37:g.8819155G>A		Unknown		x	x	x	8809155		Silent	SNP	ENST00000306329.11	37		SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526496	0.27299	.	.	ENSG00000168502	ENST00000519823	.	.	.	5.62	-11.2	0.00127	.	.	.	.	.	T	0.31136	0.0787	.	.	.	0.47183	D	0.99934	.	.	.	.	.	.	T	0.40040	-0.9584	4	.	.	.	-9.8281	1.4241	0.02319	0.4215:0.127:0.2304:0.2211	.	.	.	.	S	124	.	.	G	+	1	0	CCDC165	8809155	0.000000	0.05858	0.497000	0.27552	0.999000	0.98932	-4.074000	0.00300	-1.989000	0.00979	0.655000	0.94253	GGC		0.622	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			Silent
TRAPPC8	22878	broad.mit.edu	37	18	29419302	29419302	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr18:29419302G>A	ENST00000283351.4	-	27	4291	c.3956C>T	c.(3955-3957)tCa>tTa	p.S1319L	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.S1265L	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1319					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.S1319L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ATGATTAAATGATTCTGGGTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	18											117.0	122.0	120.0					18																	29419302		2203	4300	6503	27673300	SO:0001583	missense	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3956C>T	18.37:g.29419302G>A	ENSP00000283351:p.Ser1319Leu	Unknown		x	x	x	27673300	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373423	0.42105	.	.	ENSG00000153339	ENST00000283351	T	0.19532	2.14	5.44	5.44	0.79542	.	0.112845	0.64402	D	0.000010	T	0.25195	0.0612	L	0.55103	1.725	0.80722	D	1	P	0.36944	0.574	B	0.38616	0.277	T	0.01298	-1.1392	10	0.36615	T	0.2	.	15.9302	0.79654	0.0:0.1351:0.8649:0.0	.	1319	Q9Y2L5	TPPC8_HUMAN	L	1319	ENSP00000283351:S1319L	ENSP00000283351:S1319L	S	-	2	0	TRAPPC8	27673300	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	6.448000	0.73469	2.709000	0.92574	0.655000	0.94253	TCA		0.343	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939		Missense_Mutation
POLI	11201	broad.mit.edu	37	18	51809296	51809296	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr18:51809296A>G	ENST00000579534.1	+	6	1029	c.886A>G	c.(886-888)Aaa>Gaa	p.K296E	POLI_ENST00000406285.3_Missense_Mutation_p.K217E|POLI_ENST00000217800.5_Missense_Mutation_p.K170E|POLI_ENST00000579434.1_Missense_Mutation_p.K193E	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	296					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.K271E(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AATTTTAGAAAAAGAATTAGG	0.393								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	18											49.0	47.0	48.0					18																	51809296		2203	4300	6503	50063294	SO:0001583	missense	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.886A>G	18.37:g.51809296A>G	ENSP00000462664:p.Lys296Glu	Unknown		x	x	x	50063294	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	37	CCDS11954.2	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	15.13	2.742374	0.49151	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.22945	1.93	5.96	5.96	0.96718	DNA polymerase, Y-family, little finger domain (1);	0.096318	0.64402	D	0.000001	T	0.33206	0.0855	L	0.55743	1.74	0.58432	D	0.999997	P;D	0.55385	0.728;0.971	P;P	0.48304	0.5;0.573	T	0.02728	-1.1118	10	0.31617	T	0.26	-11.7965	15.431	0.75099	1.0:0.0:0.0:0.0	.	216;296	B7Z780;Q9UNA4	.;POLI_HUMAN	E	217;296	ENSP00000385196:K217E	ENSP00000217800:K296E	K	+	1	0	POLI	50063294	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.016000	0.57159	2.285000	0.76669	0.533000	0.62120	AAA		0.393	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195		Missense_Mutation
ATP9B	374868	broad.mit.edu	37	18	76856480	76856480	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr18:76856480C>G	ENST00000426216.2	+	2	141	c.124C>G	c.(124-126)Cag>Gag	p.Q42E	ATP9B_ENST00000591464.1_3'UTR|ATP9B_ENST00000458297.2_5'UTR|ATP9B_ENST00000586722.1_Missense_Mutation_p.Q42E|ATP9B_ENST00000307671.7_Missense_Mutation_p.Q42E	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	42					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.Q42E(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		AACTAGGTACCAGCTGGAGGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	18											141.0	125.0	130.0					18																	76856480		2203	4300	6503	74957468	SO:0001583	missense	374868			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.124C>G	18.37:g.76856480C>G	ENSP00000398076:p.Gln42Glu	Unknown		x	x	x	74957468	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	37	CCDS12014.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	13.37	2.217443	0.39201	.	.	ENSG00000166377	ENST00000426216;ENST00000307671	T;T	0.56275	0.47;0.47	5.03	5.03	0.67393	.	0.359929	0.23537	N	0.047113	T	0.36799	0.0980	N	0.20685	0.6	0.80722	D	1	B;B;B	0.22604	0.043;0.072;0.021	B;B;B	0.21708	0.01;0.036;0.013	T	0.27331	-1.0077	10	0.02654	T	1	.	18.7151	0.91672	0.0:1.0:0.0:0.0	.	42;42;42	O43861;O43861-2;B4DJ94	ATP9B_HUMAN;.;.	E	42	ENSP00000398076:Q42E;ENSP00000304500:Q42E	ENSP00000304500:Q42E	Q	+	1	0	ATP9B	74957468	1.000000	0.71417	0.986000	0.45419	0.841000	0.47740	4.045000	0.57368	2.511000	0.84671	0.563000	0.77884	CAG		0.433	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531		Missense_Mutation
NDUFA7	4701	broad.mit.edu	37	19	8381481	8381482	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr19:8381481_8381482GG>AA	ENST00000301457.2	-	3	186_187	c.149_150CC>TT	c.(148-150)tCC>tTT	p.S50F	NDUFA7_ENST00000598884.1_Missense_Mutation_p.S50F	NM_005001.3	NP_004992.2	O95182	NDUA7_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa	50					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.S50F(1)		NS(1)|central_nervous_system(1)|lung(2)|ovary(1)	5						AGTAATTGTTGGAGAGCTTGTG	0.559																																																1	Substitution - Missense(1)	ovary(1)	19																																								8287482	SO:0001583	missense	4701			AF050637	CCDS42492.1	19p13.2	2013-05-14	2002-08-29		ENSG00000267855	ENSG00000267855		"""Mitochondrial respiratory chain complex / Complex I"""	7691	protein-coding gene	gene with protein product	"""complex I B14.5a subunit"""	602139	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (14.5kD, B14.5a)"""			9763676	Standard	NM_005001		Approved	B14.5a	uc002mjm.2	O95182	OTTHUMG00000182459	ENST00000301457.2:c.149_150delinsAA	19.37:g.8381481_8381482delinsAA	ENSP00000301457:p.Ser50Phe	Unknown		x	x	x	8287481		Missense_Mutation	DNP	ENST00000301457.2	37	CCDS42492.1	DNP	47	Broad																																																																																				0.559	NDUFA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461373.1	NM_005001		Missense_Mutation
MAST3	23031	broad.mit.edu	37	19	18255395	18255395	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr19:18255395G>A	ENST00000262811.6	+	22	2617	c.2617G>A	c.(2617-2619)Gcc>Acc	p.A873T	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	873							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.A895T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						AAGAGACCCAGCCCCTGAGAA	0.697																																																1	Substitution - Missense(1)	ovary(1)	19											31.0	39.0	37.0					19																	18255395		2031	4172	6203	18116395	SO:0001583	missense	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.2617G>A	19.37:g.18255395G>A	ENSP00000262811:p.Ala873Thr	Unknown		x	x	x	18116395	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630596	0.28978	.	.	ENSG00000099308	ENST00000262811	T	0.67171	-0.25	4.57	3.45	0.39498	.	0.482219	0.18847	N	0.129502	T	0.42988	0.1227	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10660	-1.0620	10	0.31617	T	0.26	-8.3345	4.9076	0.13806	0.1495:0.0:0.6409:0.2096	.	873	O60307	MAST3_HUMAN	T	873	ENSP00000262811:A873T	ENSP00000262811:A873T	A	+	1	0	MAST3	18116395	0.000000	0.05858	0.015000	0.15790	0.980000	0.70556	0.583000	0.23849	2.100000	0.63781	0.491000	0.48974	GCC		0.697	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150		Missense_Mutation
ZNF383	163087	broad.mit.edu	37	19	37726942	37726942	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr19:37726942G>A	ENST00000589413.1	+	7	781	c.198G>A	c.(196-198)atG>atA	p.M66I	ZNF383_ENST00000352998.3_Missense_Mutation_p.M66I|ZNF383_ENST00000590503.1_Missense_Mutation_p.M66I			Q8NA42	ZN383_HUMAN	zinc finger protein 383	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M66I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGCCCTGGATGGTTGGCAGAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	19											121.0	114.0	116.0					19																	37726942		2203	4300	6503	42418782	SO:0001583	missense	163087			AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.198G>A	19.37:g.37726942G>A	ENSP00000464871:p.Met66Ile	Unknown		x	x	x	42418782	Q6X2C7	Missense_Mutation	SNP	ENST00000589413.1	37	CCDS12501.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915790	0.52546	.	.	ENSG00000188283	ENST00000352998	T	0.05925	3.37	3.39	2.35	0.29111	Krueppel-associated box (2);	0.000000	0.38381	N	0.001716	T	0.04363	0.0120	L	0.35288	1.05	0.22112	N	0.999357	P	0.39831	0.69	B	0.33454	0.164	T	0.41161	-0.9524	10	0.33940	T	0.23	.	8.7522	0.34622	0.1164:0.0:0.8836:0.0	.	66	Q8NA42	ZN383_HUMAN	I	66	ENSP00000340132:M66I	ENSP00000340132:M66I	M	+	3	0	ZNF383	42418782	0.090000	0.21635	0.978000	0.43139	0.994000	0.84299	0.265000	0.18515	0.988000	0.38734	0.563000	0.77884	ATG		0.488	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458141.1	NM_152604		Missense_Mutation
ZNF761	388561	broad.mit.edu	37	19	53958360	53958360	+	RNA	SNP	C	C	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr19:53958360C>A	ENST00000454407.1	+	0	1052							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S146*(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TGGAATTCTTCATTACTCACA	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	19											95.0	101.0	99.0					19																	53958360		2203	4300	6503	58650172			388561			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958360C>A		Unknown		x	x	x	58650172	Q6ZNB9	Nonsense_Mutation	SNP	ENST00000454407.1	37		SNP	29	Broad																																																																																				0.373	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		Nonsense_Mutation
ZSCAN4	201516	broad.mit.edu	37	19	58189283	58189283	+	Splice_Site	SNP	T	T	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr19:58189283T>G	ENST00000318203.5	+	4	1095	c.398T>G	c.(397-399)gTc>gGc	p.V133G		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	133					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V133G(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCTTTACAGGTCCACGTCCAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											117.0	102.0	107.0					19																	58189283		2203	4300	6503	62881095	SO:0001630	splice_region_variant	201516			AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.397-1T>G	19.37:g.58189283T>G		Unknown		x	x	x	62881095	Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	37	CCDS12958.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	15.14	2.746273	0.49257	.	.	ENSG00000180532	ENST00000318203	T	0.10763	2.84	4.04	4.04	0.47022	.	0.000000	0.41001	D	0.000977	T	0.27278	0.0669	M	0.76002	2.32	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	T	0.03784	-1.1004	10	0.19590	T	0.45	-15.7613	9.6829	0.40080	0.0:0.0:0.0:1.0	.	133	Q8NAM6	ZSCA4_HUMAN	G	133	ENSP00000321963:V133G	ENSP00000321963:V133G	V	+	2	0	ZSCAN4	62881095	0.961000	0.32948	1.000000	0.80357	0.441000	0.31987	1.158000	0.31737	2.054000	0.61138	0.533000	0.62120	GTC		0.438	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677	Missense_Mutation	Missense_Mutation
GLI2	2736	broad.mit.edu	37	2	121728096	121728096	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr2:121728096G>T	ENST00000452319.1	+	7	1033	c.973G>T	c.(973-975)Gcc>Tcc	p.A325S	GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.A325S|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2									p.A325S(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CACCTTCCTGGCCCAGCAGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	2											125.0	107.0	113.0					2																	121728096		2203	4300	6503	121444566	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.973G>T	2.37:g.121728096G>T	ENSP00000390436:p.Ala325Ser	Unknown		x	x	x	121444566		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	SNP	42	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.433|2.433	-0.330408|-0.330408	0.05314|0.05314	.|.	.|.	ENSG00000074047|ENSG00000074047	ENST00000452319;ENST00000361492|ENST00000440937	T;T|.	0.12984|.	2.63;2.63|.	4.65|4.65	2.7|2.7	0.31948|0.31948	.|.	0.560986|.	0.18182|.	N|.	0.149106|.	T|T	0.07369|0.07369	0.0186|0.0186	N|N	0.00210|0.00210	-1.845|-1.845	0.80722|0.80722	D|D	1|1	B;B|B	0.12630|0.33583	0.006;0.003|0.418	B;B|B	0.10450|0.30943	0.001;0.005|0.122	T|T	0.08086|0.08086	-1.0739|-1.0739	10|8	0.05525|0.87932	T|D	0.97|0	.|.	1.1128|1.1128	0.01707|0.01707	0.1753:0.2447:0.3536:0.2265|0.1753:0.2447:0.3536:0.2265	.|.	325;325|195	P10070;Q0VGA0|F5H4D9	GLI2_HUMAN;.|.	S|V	325|195	ENSP00000390436:A325S;ENSP00000354586:A325S|.	ENSP00000354586:A325S|ENSP00000395688:G195V	A|G	+|+	1|2	0|0	GLI2|GLI2	121444566|121444566	0.030000|0.030000	0.19436|0.19436	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	-0.108000|-0.108000	0.10857|0.10857	1.308000|1.308000	0.44962|0.44962	0.561000|0.561000	0.74099|0.74099	GCC|GGC		0.632	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		Missense_Mutation
KCTD18	130535	broad.mit.edu	37	2	201371645	201371645	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr2:201371645C>A	ENST00000359878.3	-	2	605	c.95G>T	c.(94-96)cGc>cTc	p.R32L	KCTD18_ENST00000468413.1_5'UTR|KCTD18_ENST00000409157.1_Missense_Mutation_p.R32L	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	32	BTB.				protein homooligomerization (GO:0051260)			p.R32L(1)|p.R32H(1)|p.R32P(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						GTCCTTGAAGCGGCACAAGGA	0.483																																																3	Substitution - Missense(3)	ovary(1)|lung(1)|endometrium(1)	2											75.0	81.0	79.0					2																	201371645		2203	4300	6503	201079890	SO:0001583	missense	130535			AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.95G>T	2.37:g.201371645C>A	ENSP00000352941:p.Arg32Leu	Unknown		x	x	x	201079890	Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	ENST00000359878.3	37	CCDS2330.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819003	0.71028	.	.	ENSG00000155729	ENST00000359878;ENST00000409157	T;T	0.48522	0.81;0.81	5.46	5.46	0.80206	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	D	0.000004	T	0.46908	0.1417	L	0.53617	1.68	0.43598	D	0.99595	B;P	0.52170	0.021;0.951	B;B	0.43728	0.011;0.429	T	0.48422	-0.9037	10	0.52906	T	0.07	-18.4704	14.0045	0.64453	0.1512:0.8488:0.0:0.0	.	32;32	Q6PI47-2;Q6PI47	.;KCD18_HUMAN	L	32	ENSP00000352941:R32L;ENSP00000386751:R32L	ENSP00000352941:R32L	R	-	2	0	KCTD18	201079890	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.085000	0.50151	2.840000	0.97914	0.655000	0.94253	CGC		0.483	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256188.1	NM_152387		Missense_Mutation
SP100	6672	broad.mit.edu	37	2	231406040	231406040	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr2:231406040G>C	ENST00000340126.4	+	27	2387	c.2356G>C	c.(2356-2358)Gtc>Ctc	p.V786L	AC010149.4_ENST00000414539.1_RNA|AC010149.4_ENST00000455357.1_RNA	NM_001080391.1	NP_001073860.1	P23497	SP100_HUMAN	SP100 nuclear antigen	0					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.V786L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CCTCTTGAAGGTCTACTGTGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											106.0	98.0	100.0					2																	231406040		1855	4111	5966	231114284	SO:0001583	missense	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000340126.4:c.2356G>C	2.37:g.231406040G>C	ENSP00000343023:p.Val786Leu	Unknown		x	x	x	231114284	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	ENST00000340126.4	37	CCDS42832.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.63|13.63	2.295774|2.295774	0.40594|0.40594	.|.	.|.	ENSG00000067066|ENSG00000067066	ENST00000431952|ENST00000340126;ENST00000414648	.|T	.|0.34472	.|1.36	4.25|4.25	-3.91|-3.91	0.04168|0.04168	.|.	.|.	.|.	.|.	.|.	T|T	0.15046|0.15046	0.0363|0.0363	N|N	0.08118|0.08118	0|0	0.30895|0.30895	N|N	0.729898|0.729898	.|B;B	.|0.31931	.|0.024;0.347	.|B;B	.|0.31751	.|0.036;0.135	T|T	0.28964|0.28964	-1.0027|-1.0027	5|9	.|0.29301	.|T	.|0.29	.|.	6.4834|6.4834	0.22075|0.22075	0.6381:0.0:0.2164:0.1455|0.6381:0.0:0.2164:0.1455	.|.	.|256;786	.|E9PHN1;P23497-4	.|.;.	A|L	159|786;256	.|ENSP00000343023:V786L	.|ENSP00000343023:V786L	G|V	+|+	2|1	0|0	SP100|SP100	231114284|231114284	0.000000|0.000000	0.05858|0.05858	0.045000|0.045000	0.18777|0.18777	0.618000|0.618000	0.37518|0.37518	-1.639000|-1.639000	0.02011|0.02011	-0.925000|-0.925000	0.03775|0.03775	0.655000|0.655000	0.94253|0.94253	GGT|GTC		0.378	SP100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332246.1	NM_003113		Missense_Mutation
PASK	23178	broad.mit.edu	37	2	242051706	242051706	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr2:242051706G>T	ENST00000405260.1	-	15	4180	c.3482C>A	c.(3481-3483)aCt>aAt	p.T1161N	PASK_ENST00000234040.4_Missense_Mutation_p.T1161N|PASK_ENST00000544142.1_Missense_Mutation_p.T975N|PASK_ENST00000358649.4_Missense_Mutation_p.T1168N|PASK_ENST00000475666.1_5'UTR|PASK_ENST00000539818.1_Missense_Mutation_p.T945N	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1161	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.T1161N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CCCACAAAAAGTATAAAATAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											58.0	57.0	58.0					2																	242051706		2203	4300	6503	241700379	SO:0001583	missense	23178			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3482C>A	2.37:g.242051706G>T	ENSP00000384016:p.Thr1161Asn	Unknown		x	x	x	241700379	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941249	0.53079	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818	T;T;T;T;T	0.67171	1.66;1.66;1.66;-0.25;1.66	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000061	T	0.75860	0.3907	L	0.49640	1.575	0.52501	D	0.999958	P;P;P;P	0.45531	0.61;0.86;0.69;0.736	P;P;P;P	0.54889	0.627;0.763;0.593;0.715	T	0.76889	-0.2792	10	0.87932	D	0	.	19.8073	0.96535	0.0:0.0:1.0:0.0	.	1126;975;1168;1161	B7Z7R6;F5GYW7;Q96RG2-2;Q96RG2	.;.;.;PASK_HUMAN	N	1161;975;1161;1168;945	ENSP00000234040:T1161N;ENSP00000441374:T975N;ENSP00000384016:T1161N;ENSP00000351475:T1168N;ENSP00000443083:T945N	ENSP00000234040:T1161N	T	-	2	0	PASK	241700379	1.000000	0.71417	0.295000	0.24960	0.065000	0.16274	7.039000	0.76544	2.684000	0.91462	0.655000	0.94253	ACT		0.522	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148		Missense_Mutation
ULK4	54986	broad.mit.edu	37	3	41746788	41746788	+	Nonsense_Mutation	SNP	T	T	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr3:41746788T>A	ENST00000301831.4	-	26	3106	c.2644A>T	c.(2644-2646)Aaa>Taa	p.K882*		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	882					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.K34*(1)		breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TCTACAGATTTAATATGACTC	0.303																																																1	Substitution - Nonsense(1)	ovary(1)	3											59.0	54.0	55.0					3																	41746788		1788	4060	5848	41721792	SO:0001587	stop_gained	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2644A>T	3.37:g.41746788T>A	ENSP00000301831:p.Lys882*	Unknown		x	x	x	41721792	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Nonsense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	44	10.903654	0.99486	.	.	ENSG00000168038	ENST00000301831	.	.	.	5.01	3.8	0.43715	.	0.163853	0.39909	U	0.001239	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.501	0.22168	0.1396:0.0765:0.0:0.7839	.	.	.	.	X	882	.	ENSP00000301831:K882X	K	-	1	0	ULK4	41721792	1.000000	0.71417	0.925000	0.36789	0.751000	0.42716	2.094000	0.41719	0.799000	0.34018	0.482000	0.46254	AAA		0.303	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		Nonsense_Mutation
ATP10D	57205	broad.mit.edu	37	4	47537946	47537946	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr4:47537946A>C	ENST00000273859.3	+	7	1180	c.911A>C	c.(910-912)aAc>aCc	p.N304T	ATP10D_ENST00000504445.1_Missense_Mutation_p.N304T	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	304					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N304T(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ATGCTGAACAACAGTGGGCCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											108.0	96.0	100.0					4																	47537946		2203	4300	6503	47232703	SO:0001583	missense	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.911A>C	4.37:g.47537946A>C	ENSP00000273859:p.Asn304Thr	Unknown		x	x	x	47232703	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	25.4	4.629934	0.87660	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	D;D	0.90069	-2.61;-2.61	5.31	5.31	0.75309	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.92980	0.7766	L	0.60957	1.885	0.58432	D	0.99999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.93617	0.6944	10	0.72032	D	0.01	-25.2807	14.7496	0.69516	1.0:0.0:0.0:0.0	.	304;304	Q9P241;Q6PEW3	AT10D_HUMAN;.	T	304	ENSP00000273859:N304T;ENSP00000420909:N304T	ENSP00000273859:N304T	N	+	2	0	ATP10D	47232703	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.287000	0.95975	2.129000	0.65627	0.460000	0.39030	AAC		0.408	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453		Missense_Mutation
FAT4	79633	broad.mit.edu	37	4	126241592	126241592	+	Silent	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr4:126241592C>T	ENST00000394329.3	+	1	4039	c.4026C>T	c.(4024-4026)tcC>tcT	p.S1342S		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1342	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1342S(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAACTGATTCCGATTCAGGTG	0.393																																																2	Substitution - coding silent(2)	ovary(2)	4											139.0	131.0	134.0					4																	126241592		1894	4107	6001	126461042	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4026C>T	4.37:g.126241592C>T		Unknown		x	x	x	126461042	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3	SNP	23	Broad																																																																																				0.393	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		Silent
LRBA	987	broad.mit.edu	37	4	151357919	151357919	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr4:151357919T>G	ENST00000357115.3	-	46	7154	c.6911A>C	c.(6910-6912)cAt>cCt	p.H2304P	LRBA_ENST00000507224.1_Missense_Mutation_p.H2293P|LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.H2293P|LRBA_ENST00000510413.1_Missense_Mutation_p.H2293P	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2304	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.H2304P(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGTTGAGTAATGAGTACCATA	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											86.0	79.0	81.0					4																	151357919		2203	4300	6503	151577369	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6911A>C	4.37:g.151357919T>G	ENSP00000349629:p.His2304Pro	Unknown		x	x	x	151577369	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	SNP	51	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.0|27.0	4.790277|4.790277	0.90367|0.90367	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.66995|.	-0.24;-0.24;-0.24;-0.24|.	5.93|5.93	5.93|5.93	0.95920|0.95920	BEACH domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87422|0.87422	0.6173|0.6173	H|H	0.95114|0.95114	3.625|3.625	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.998|.	D;D;D|.	0.97110|.	0.999;1.0;0.99|.	D|D	0.91079|0.91079	0.4898|0.4898	10|5	0.87932|.	D|.	0|.	.|.	16.3839|16.3839	0.83495|0.83495	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2304;2293;194|.	P50851;P50851-2;Q68D03|.	LRBA_HUMAN;.;.|.	P|L	2293;2293;2304;2293|946	ENSP00000446299:H2293P;ENSP00000421552:H2293P;ENSP00000349629:H2304P;ENSP00000422180:H2293P|.	ENSP00000349629:H2304P|.	H|I	-|-	2|1	0|0	LRBA|LRBA	151577369|151577369	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.963000|7.963000	0.87922|0.87922	2.258000|2.258000	0.74832|0.74832	0.533000|0.533000	0.62120|0.62120	CAT|ATT		0.383	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			Missense_Mutation
IQGAP2	10788	broad.mit.edu	37	5	75996930	75996930	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr5:75996930G>C	ENST00000274364.6	+	34	4694	c.4397G>C	c.(4396-4398)gGa>gCa	p.G1466A	IQGAP2_ENST00000502745.1_Missense_Mutation_p.G962A|IQGAP2_ENST00000379730.3_Missense_Mutation_p.G968A|IQGAP2_ENST00000396234.3_Missense_Mutation_p.G962A|CTD-2384B11.2_ENST00000507514.1_RNA	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1466					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.G1466A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAACTAGATGGAAAAGGAGAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	5											96.0	93.0	94.0					5																	75996930		2203	4300	6503	76032686	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4397G>C	5.37:g.75996930G>C	ENSP00000274364:p.Gly1466Ala	Unknown		x	x	x	76032686	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	12.63	1.994521	0.35226	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000396234;ENST00000502745	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.46	3.63	0.41609	RasGAP protein, C-terminal (1);	0.466924	0.25052	N	0.033504	T	0.40670	0.1126	L	0.56769	1.78	0.43203	D	0.995051	P;B;P	0.45474	0.859;0.365;0.772	B;B;P	0.46758	0.281;0.086;0.526	T	0.27088	-1.0084	10	0.08179	T	0.78	-9.414	10.5538	0.45105	0.0696:0.0:0.7967:0.1337	.	968;962;1466	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	A	1466;968;962;962	ENSP00000274364:G1466A;ENSP00000442313:G968A;ENSP00000379535:G962A;ENSP00000426027:G962A	ENSP00000274364:G1466A	G	+	2	0	IQGAP2	76032686	1.000000	0.71417	0.387000	0.26183	0.228000	0.25075	5.338000	0.65947	0.742000	0.32697	0.655000	0.94253	GGA		0.423	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		Missense_Mutation
CAST	831	broad.mit.edu	37	5	96078438	96078438	+	Missense_Mutation	SNP	G	G	A	rs139285603	byFrequency	TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr5:96078438G>A	ENST00000341926.3	+	14	1091	c.929G>A	c.(928-930)cGc>cAc	p.R310H	CAST_ENST00000511782.1_Missense_Mutation_p.R296H|CTC-506B8.1_ENST00000502568.1_RNA|CAST_ENST00000325674.7_Missense_Mutation_p.R358H|CAST_ENST00000511049.1_Missense_Mutation_p.R296H|CAST_ENST00000510756.1_Missense_Mutation_p.R371H|CAST_ENST00000504465.1_Missense_Mutation_p.R238H|CAST_ENST00000509903.1_Missense_Mutation_p.R275H|CAST_ENST00000515663.1_5'Flank|CAST_ENST00000359176.4_Missense_Mutation_p.R374H|CAST_ENST00000309190.5_Missense_Mutation_p.R288H|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000395812.2_Missense_Mutation_p.R352H|CAST_ENST00000508830.1_Missense_Mutation_p.R393H|CAST_ENST00000508579.1_Missense_Mutation_p.R25H|CAST_ENST00000508608.1_Missense_Mutation_p.R356H|CAST_ENST00000395813.1_Missense_Mutation_p.R393H|CAST_ENST00000338252.3_Missense_Mutation_p.R297H			P20810	ICAL_HUMAN	calpastatin	310					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)	p.R288H(1)		breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		CTCGACCTCCGCTCAATTAAG	0.448													G|||	7	0.00139776	0.0053	0.0	5008	,	,		18182	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	HIS/ARG,HIS/ARG,HIS/ARG	18,4388	25.3+/-52.1	0,18,2185	54.0	53.0	54.0		1055,890,863	4.1	0.1	5	dbSNP_134	54	0,8600		0,0,4300	yes	missense,missense,missense	CAST	NM_001042440.2,NM_001190442.1,NM_173060.3	29,29,29	0,18,6485	AA,AG,GG		0.0,0.4085,0.1384	benign,benign,benign	352/751,297/696,288/687	96078438	18,12988	2203	4300	6503	96104194	SO:0001583	missense	831			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.929G>A	5.37:g.96078438G>A	ENSP00000339914:p.Arg310His	Unknown		x	x	x	96104194	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	ENST00000341926.3	37		SNP	38	Broad	5|5	0.0022893772893772895|0.0022893772893772895	5|5	0.01016260162601626|0.01016260162601626	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	11.19|11.19	1.564271|1.564271	0.27915|0.27915	0.004085|0.004085	0.0|0.0	ENSG00000153113|ENSG00000153113	ENST00000437034|ENST00000338252;ENST00000508830;ENST00000511097;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508579;ENST00000509259;ENST00000503828	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.17213	.|2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.93|5.93	4.1|4.1	0.47936|0.47936	.|.	.|0.415798	.|0.27901	.|N	.|0.017390	T|T	0.11281|0.11281	0.0275|0.0275	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P;P;P;P;P;P;P;P;P;P;P	.|0.46512	.|0.75;0.879;0.702;0.81;0.786;0.668;0.839;0.705;0.786;0.705;0.746;0.839;0.653;0.746;0.746	.|B;P;B;B;B;P;B;B;P;B;B;B;B;B;B	.|0.47705	.|0.217;0.555;0.278;0.339;0.392;0.494;0.199;0.138;0.494;0.149;0.361;0.199;0.103;0.361;0.199	T|T	0.04885|0.04885	-1.0920|-1.0920	5|10	.|0.44086	.|T	.|0.13	0.1139|0.1139	9.5128|9.5128	0.39087|0.39087	0.0767:0.142:0.7813:0.0|0.0767:0.142:0.7813:0.0	.|.	.|238;158;356;61;296;275;288;269;310;358;352;374;371;393;297	.|E9PDE4;B7Z8S8;B7Z468;Q86YM9;E7EVY3;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2	.|.;.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.	T|H	62|297;393;358;393;374;358;352;371;356;310;296;288;310;238;275;296;25;25;25	.|ENSP00000343421:R297H;ENSP00000425721:R393H;ENSP00000422951:R358H;ENSP00000379158:R393H;ENSP00000352098:R374H;ENSP00000320319:R358H;ENSP00000379157:R352H;ENSP00000422176:R371H;ENSP00000422677:R356H;ENSP00000339914:R310H;ENSP00000421130:R296H;ENSP00000312523:R288H;ENSP00000422325:R310H;ENSP00000425670:R238H;ENSP00000426946:R275H;ENSP00000423638:R296H;ENSP00000425787:R25H;ENSP00000423846:R25H;ENSP00000422807:R25H	.|ENSP00000312523:R288H	A|R	+|+	1|2	0|0	CAST|CAST	96104194|96104194	0.171000|0.171000	0.23029|0.23029	0.133000|0.133000	0.22050|0.22050	0.038000|0.038000	0.13279|0.13279	3.562000|3.562000	0.53777|0.53777	1.526000|1.526000	0.49068|0.49068	-0.229000|-0.229000	0.12294|0.12294	GCT|CGC		0.448	CAST-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000250199.2	NM_173062		Missense_Mutation
FBN2	2201	broad.mit.edu	37	5	127710341	127710341	+	Missense_Mutation	SNP	A	A	T	rs146586596		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr5:127710341A>T	ENST00000508053.1	-	21	3049	c.2075T>A	c.(2074-2076)aTg>aAg	p.M692K	FBN2_ENST00000262464.4_Missense_Mutation_p.M692K|FBN2_ENST00000508989.1_Missense_Mutation_p.M659K|FBN2_ENST00000511489.1_5'UTR			P35556	FBN2_HUMAN	fibrillin 2	692	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.M692K(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACGTCCATCCATGCCCACAGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	5						A	LYS/MET	0,4406		0,0,2203	113.0	101.0	105.0		2075	4.4	1.0	5	dbSNP_134	105	1,8599	1.2+/-3.3	0,1,4299	no	missense	FBN2	NM_001999.3	95	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	benign	692/2913	127710341	1,13005	2203	4300	6503	127738240	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2075T>A	5.37:g.127710341A>T	ENSP00000424571:p.Met692Lys	Unknown		x	x	x	127738240	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	9.469	1.095037	0.20471	0.0	1.16E-4	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.91295	-2.82;-2.82;-2.82	4.45	4.45	0.53987	Matrix fibril-associated (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.189541	0.34362	N	0.004032	T	0.79569	0.4468	N	0.11560	0.145	0.41015	D	0.98503	B;B	0.19817	0.004;0.039	B;B	0.20577	0.015;0.03	T	0.74414	-0.3673	10	0.07030	T	0.85	.	14.7854	0.69800	1.0:0.0:0.0:0.0	.	659;692	D6RJI3;P35556	.;FBN2_HUMAN	K	692;692;659	ENSP00000262464:M692K;ENSP00000424571:M692K;ENSP00000425596:M659K	ENSP00000262464:M692K	M	-	2	0	FBN2	127738240	0.761000	0.28439	0.990000	0.47175	0.996000	0.88848	6.001000	0.70685	2.231000	0.72958	0.533000	0.62120	ATG		0.483	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		Missense_Mutation
GPRIN1	114787	broad.mit.edu	37	5	176025191	176025191	+	Missense_Mutation	SNP	C	C	A	rs79982520	byFrequency	TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr5:176025191C>A	ENST00000303991.4	-	2	1822	c.1645G>T	c.(1645-1647)Ggc>Tgc	p.G549C		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	549					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.G549C(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCTCCTTGCCCACCGCGAGG	0.617																																																1	Substitution - Missense(1)	ovary(1)	5											55.0	54.0	54.0					5																	176025191		2203	4300	6503	175957797	SO:0001583	missense	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1645G>T	5.37:g.176025191C>A	ENSP00000305839:p.Gly549Cys	Unknown		x	x	x	175957797	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	CCDS4405.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417295	0.42918	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.12255	2.7	3.9	-1.14	0.09741	.	0.958535	0.08514	N	0.934487	T	0.12987	0.0315	M	0.62723	1.935	0.09310	N	1	B	0.21452	0.056	B	0.25405	0.06	T	0.41945	-0.9480	10	0.48119	T	0.1	0.2373	1.5311	0.02536	0.1507:0.4301:0.1478:0.2714	.	549	Q7Z2K8	GRIN1_HUMAN	C	549	ENSP00000305839:G549C	ENSP00000305839:G549C	G	-	1	0	GPRIN1	175957797	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.320000	0.02700	-0.123000	0.11745	0.455000	0.32223	GGC		0.617	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899		Missense_Mutation
DDX39B	7919	broad.mit.edu	37	6	31498580	31498580	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr6:31498580C>G	ENST00000396172.1	-	10	1876	c.1246G>C	c.(1246-1248)Gat>Cat	p.D416H	DDX39B_ENST00000462421.1_Intron|DDX39B_ENST00000376177.2_Silent_p.L423L|DDX39B_ENST00000415382.2_Missense_Mutation_p.D338H|DDX39B_ENST00000458640.1_Missense_Mutation_p.D416H|DDX39B_ENST00000417556.2_Missense_Mutation_p.D431H|ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	416	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)	p.D416H(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						TCTATCTCATCAGGCAGCTCA	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											85.0	85.0	85.0					6																	31498580		1511	2707	4218	31606559	SO:0001583	missense	7919			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.1246G>C	6.37:g.31498580C>G	ENSP00000379475:p.Asp416His	Unknown		x	x	x	31606559	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	ENST00000396172.1	37	CCDS4697.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670120	0.67814	.	.	ENSG00000198563	ENST00000458640;ENST00000396172;ENST00000417556;ENST00000415382	T;T;T;T	0.49720	1.41;1.41;1.4;0.77	4.81	4.81	0.61882	Helicase, C-terminal (1);	0.147481	0.42682	D	0.000672	T	0.44746	0.1308	L	0.50333	1.59	0.80722	D	1	P;B;P;P	0.45902	0.868;0.248;0.845;0.726	B;B;P;B	0.50708	0.365;0.152;0.648;0.325	T	0.45702	-0.9243	10	0.59425	D	0.04	-14.9604	15.4202	0.75006	0.0:1.0:0.0:0.0	.	338;416;431;315	B4DP52;Q13838;F8VQ10;B0V2L1	.;DX39B_HUMAN;.;.	H	416;416;431;338	ENSP00000416269:D416H;ENSP00000379475:D416H;ENSP00000412582:D431H;ENSP00000392669:D338H	ENSP00000379475:D416H	D	-	1	0	DDX39B	31606559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.095000	0.76952	2.504000	0.84457	0.563000	0.77884	GAT		0.463	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1	NM_004640		Missense_Mutation
GPR110	266977	broad.mit.edu	37	6	46984473	46984473	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr6:46984473C>G	ENST00000371253.2	-	8	858	c.643G>C	c.(643-645)Gtt>Ctt	p.V215L	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Missense_Mutation_p.V18L	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	215	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V215L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						CTGGAGCCAACAACTTCATAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											105.0	90.0	95.0					6																	46984473		2203	4300	6503	47092432	SO:0001583	missense	266977			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.643G>C	6.37:g.46984473C>G	ENSP00000360299:p.Val215Leu	Unknown		x	x	x	47092432	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	37	CCDS34471.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101758	0.37048	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	T;T	0.41400	1.0;1.41	5.82	0.432	0.16529	SEA (1);	0.422273	0.19036	N	0.124410	T	0.12860	0.0312	L	0.35414	1.06	0.09310	N	1	B	0.29531	0.247	B	0.33620	0.167	T	0.26916	-1.0089	10	0.28530	T	0.3	-7.4249	8.0275	0.30446	0.0:0.3265:0.0:0.6735	.	215	Q5T601	GP110_HUMAN	L	215;215;18	ENSP00000360299:V215L;ENSP00000283297:V18L	ENSP00000283297:V18L	V	-	1	0	GPR110	47092432	0.014000	0.17966	0.412000	0.26496	0.654000	0.38779	-0.028000	0.12350	0.235000	0.21160	0.655000	0.94253	GTT		0.463	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840		Missense_Mutation
UTRN	7402	broad.mit.edu	37	6	144783798	144783798	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr6:144783798T>G	ENST00000367545.3	+	22	2862	c.2862T>G	c.(2860-2862)gaT>gaG	p.D954E		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	954					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.D954E(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGACCCTTGATGAAATCCTTG	0.313																																																1	Substitution - Missense(1)	ovary(1)	6											31.0	33.0	32.0					6																	144783798		2202	4296	6498	144825491	SO:0001583	missense	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2862T>G	6.37:g.144783798T>G	ENSP00000356515:p.Asp954Glu	Unknown		x	x	x	144825491	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	2.392	-0.339554	0.05243	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.57595	0.39	5.36	4.07	0.47477	.	0.390122	0.21963	N	0.066571	T	0.13884	0.0336	N	0.17082	0.46	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.11421	-1.0588	10	0.02654	T	1	.	11.0482	0.47872	0.2294:0.0:0.0:0.7705	.	954	P46939	UTRO_HUMAN	E	954	ENSP00000356515:D954E	ENSP00000356499:D954E	D	+	3	2	UTRN	144825491	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	0.959000	0.29240	2.012000	0.59069	0.533000	0.62120	GAT		0.313	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			Missense_Mutation
MEOX2	4223	broad.mit.edu	37	7	15725599	15725599	+	Silent	SNP	C	C	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr7:15725599C>A	ENST00000262041.5	-	1	838	c.429G>T	c.(427-429)gcG>gcT	p.A143A	AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	143					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.A143A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		CCGGCGCGCACGCGGCCCCAG	0.706																																					Esophageal Squamous(140;197 1769 16409 18257 29929)											1	Substitution - coding silent(1)	ovary(1)	7											26.0	32.0	30.0					7																	15725599		2190	4271	6461	15692124	SO:0001819	synonymous_variant	4223				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.429G>T	7.37:g.15725599C>A		Unknown		x	x	x	15692124	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	37	CCDS34605.1	SNP	19	Broad																																																																																				0.706	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924		Silent
CCDC126	90693	broad.mit.edu	37	7	23682719	23682719	+	Silent	SNP	G	G	A	rs368070236		TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr7:23682719G>A	ENST00000307471.3	+	4	865	c.408G>A	c.(406-408)tcG>tcA	p.S136S	CCDC126_ENST00000409765.1_Silent_p.S136S|CCDC126_ENST00000410069.1_Silent_p.S136S	NM_138771.3	NP_620126.2	Q96EE4	CC126_HUMAN	coiled-coil domain containing 126	136					protein N-linked glycosylation (GO:0006487)	extracellular region (GO:0005576)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.S136S(1)		endometrium(3)|kidney(1)|large_intestine(1)|ovary(1)|skin(1)	7						CGAATGTCTCGGGCAGTATCA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	7						G		2,4404	4.2+/-10.8	0,2,2201	89.0	75.0	80.0		408	-9.3	0.6	7		80	0,8600		0,0,4300	no	coding-synonymous	CCDC126	NM_138771.3		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		136/141	23682719	2,13004	2203	4300	6503	23649244	SO:0001819	synonymous_variant	90693			BC012427	CCDS5384.1	7p15.3	2006-08-15			ENSG00000169193	ENSG00000169193			22398	protein-coding gene	gene with protein product						12477932	Standard	NM_138771		Approved	FLJ23031	uc003swl.3	Q96EE4	OTTHUMG00000128461	ENST00000307471.3:c.408G>A	7.37:g.23682719G>A		Unknown		x	x	x	23649244	A8K1J6|Q6UWP1|Q75MQ6	Silent	SNP	ENST00000307471.3	37	CCDS5384.1	SNP	39	Broad																																																																																				0.428	CCDC126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250259.1	NM_138771		Silent
HOXA10	3206	broad.mit.edu	37	7	27213806	27213806	+	Silent	SNP	G	G	A			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr7:27213806G>A	ENST00000283921.4	-	1	119	c.120C>T	c.(118-120)ggC>ggT	p.G40G	RP1-170O19.20_ENST00000470747.4_Intron|HOXA-AS4_ENST00000519935.1_RNA|HOXA10_ENST00000521421.1_5'Flank|HOXA10_ENST00000396344.4_Intron|HOXA-AS4_ENST00000519694.1_RNA|RP1-170O19.20_ENST00000465941.1_Intron|HOXA-AS4_ENST00000523790.1_RNA	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	40					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G23G(1)		breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						cgccTGCCTCGCCTCTGCCCG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	7											32.0	36.0	35.0					7																	27213806		1111	2596	3707	27180331	SO:0001819	synonymous_variant	3206				CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.120C>T	7.37:g.27213806G>A		Unknown		x	x	x	27180331	O43370|O43605|Q15949|Q504T1	Silent	SNP	ENST00000283921.4	37	CCDS5410.2	SNP	38	Broad																																																																																				0.682	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2			Silent
MUC17	140453	broad.mit.edu	37	7	100678491	100678491	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr7:100678491G>T	ENST00000306151.4	+	3	3858	c.3794G>T	c.(3793-3795)gGt>gTt	p.G1265V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1265	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.G1265V(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACCGCTGAAGGTACCAGCTTG	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											288.0	276.0	280.0					7																	100678491		2203	4300	6503	100465211	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3794G>T	7.37:g.100678491G>T	ENSP00000302716:p.Gly1265Val	Unknown		x	x	x	100465211	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	1.635	-0.517920	0.04171	.	.	ENSG00000169876	ENST00000306151	T	0.03607	3.87	0.373	0.373	0.16178	.	.	.	.	.	T	0.07007	0.0178	L	0.29908	0.895	0.09310	N	1	D	0.76494	0.999	D	0.71184	0.972	T	0.43065	-0.9414	8	0.17369	T	0.5	.	.	.	.	.	1265	Q685J3	MUC17_HUMAN	V	1265	ENSP00000302716:G1265V	ENSP00000302716:G1265V	G	+	2	0	MUC17	100465211	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.503000	0.06383	0.472000	0.27344	0.134000	0.15878	GGT		0.517	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Missense_Mutation
PRKDC	5591	broad.mit.edu	37	8	48811097	48811097	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr8:48811097G>C	ENST00000314191.2	-	29	3453	c.3397C>G	c.(3397-3399)Cac>Gac	p.H1133D	PRKDC_ENST00000338368.3_Missense_Mutation_p.H1133D|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1133					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.H1133D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CGGCATAGGTGATCAATGGCA	0.368								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Substitution - Missense(1)	ovary(1)	8											81.0	78.0	79.0					8																	48811097		1873	4106	5979	48973650	SO:0001583	missense	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3397C>G	8.37:g.48811097G>C	ENSP00000313420:p.His1133Asp	Unknown		x	x	x	48973650	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	26.7	4.763751	0.89932	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.63744	-0.06;-0.06	5.46	5.46	0.80206	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81356	0.4805	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.83371	0.0007	9	0.72032	D	0.01	.	19.3005	0.94143	0.0:0.0:1.0:0.0	.	1133;1133	E7EUY0;P78527	.;PRKDC_HUMAN	D	1133	ENSP00000313420:H1133D;ENSP00000345182:H1133D	ENSP00000313420:H1133D	H	-	1	0	PRKDC	48973650	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.879000	0.92398	2.567000	0.86603	0.557000	0.71058	CAC		0.368	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		Missense_Mutation
DCSTAMP	81501	broad.mit.edu	37	8	105360851	105360851	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr8:105360851C>T	ENST00000297581.2	+	2	120	c.71C>T	c.(70-72)cCc>cTc	p.P24L	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.P24L|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	24					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)		p.P24L(3)									CCAAGAAGCCCCGGATGGATG	0.493																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	8											110.0	102.0	105.0					8																	105360851		2203	4300	6503	105430027	SO:0001583	missense	81501			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.71C>T	8.37:g.105360851C>T	ENSP00000297581:p.Pro24Leu	Unknown		x	x	x	105430027	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	7.615	0.675555	0.14841	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.30981	1.51	5.51	1.68	0.24146	.	0.763345	0.13211	N	0.405189	T	0.25644	0.0624	M	0.64997	1.995	0.42701	D	0.993615	B	0.31680	0.335	B	0.26614	0.071	T	0.03673	-1.1014	10	0.35671	T	0.21	-0.8203	5.7692	0.18243	0.1349:0.6513:0.0:0.2138	.	24	Q9H295	TM7S4_HUMAN	L	24	ENSP00000297581:P24L	ENSP00000297581:P24L	P	+	2	0	TM7SF4	105430027	0.002000	0.14202	0.004000	0.12327	0.008000	0.06430	0.923000	0.28757	0.033000	0.15463	-0.136000	0.14681	CCC		0.493	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		Missense_Mutation
TPM2	7169	broad.mit.edu	37	9	35689193	35689193	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr9:35689193C>G	ENST00000360958.2	-	2	294	c.190G>C	c.(190-192)Gtg>Ctg	p.V64L	TPM2_ENST00000378292.3_Missense_Mutation_p.V64L|TPM2_ENST00000329305.2_Missense_Mutation_p.V64L|TPM2_ENST00000378300.5_Missense_Mutation_p.V64L	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)	64					muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.V64L(1)		NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCCTCCTTCACGGATTCAGAA	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											163.0	153.0	156.0					9																	35689193		2203	4300	6503	35679193	SO:0001583	missense	7169				CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.190G>C	9.37:g.35689193C>G	ENSP00000354219:p.Val64Leu	Unknown		x	x	x	35679193	A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	Missense_Mutation	SNP	ENST00000360958.2	37	CCDS6587.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	6.850	0.526091	0.13066	.	.	ENSG00000198467	ENST00000378300;ENST00000378292;ENST00000329305;ENST00000360958	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	4.94	4.94	0.65067	.	.	.	.	.	T	0.38585	0.1046	N	0.00462	-1.47	0.32606	N	0.525292	B;B;B;B;B	0.10296	0.0;0.001;0.001;0.003;0.001	B;B;B;B;B	0.15052	0.003;0.007;0.012;0.007;0.002	T	0.39742	-0.9599	9	0.02654	T	1	-8.4515	13.6685	0.62409	0.0:0.845:0.155:0.0	.	64;64;64;64;64	B4DGC2;A7XZE4;P07951;Q5TCU8;P07951-2	.;.;TPM2_HUMAN;.;.	L	64	ENSP00000367550:V64L;ENSP00000367542:V64L;ENSP00000367541:V64L;ENSP00000354219:V64L	ENSP00000367541:V64L	V	-	1	0	TPM2	35679193	0.985000	0.35326	0.954000	0.39281	0.995000	0.86356	2.195000	0.42677	2.559000	0.86315	0.561000	0.74099	GTG		0.582	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052376.1	NM_003289		Missense_Mutation
SPTAN1	6709	broad.mit.edu	37	9	131360733	131360733	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr9:131360733C>G	ENST00000372731.4	+	25	3579	c.3469C>G	c.(3469-3471)Ctg>Gtg	p.L1157V	SPTAN1_ENST00000475367.1_3'UTR|SPTAN1_ENST00000358161.5_Missense_Mutation_p.L1157V|SPTAN1_ENST00000372739.3_Missense_Mutation_p.L1157V	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1157					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L1157V(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AGCTGAAGACCTGGAGTCTGA	0.478																																					NSCLC(120;833 1744 2558 35612 37579)											1	Substitution - Missense(1)	ovary(1)	9											119.0	89.0	99.0					9																	131360733		2203	4300	6503	130400554	SO:0001583	missense	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3469C>G	9.37:g.131360733C>G	ENSP00000361816:p.Leu1157Val	Unknown		x	x	x	130400554	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643077	0.67244	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.63255	-0.03;-0.03;-0.03	6.08	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.82669	0.5087	M	0.90309	3.105	0.80722	D	1	D;D;D;D;D	0.89917	0.979;0.979;1.0;0.974;0.979	D;D;D;D;D	0.87578	0.982;0.973;0.998;0.969;0.982	D	0.86702	0.1930	10	0.87932	D	0	.	15.1955	0.73084	0.0:0.9331:0.0:0.0669	.	1157;1137;1137;1157;1157	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	V	1157;1157;1157;1137	ENSP00000350882:L1157V;ENSP00000361816:L1157V;ENSP00000361824:L1157V	ENSP00000350882:L1157V	L	+	1	2	SPTAN1	130400554	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.702000	0.54800	1.590000	0.49995	0.591000	0.81541	CTG		0.478	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		Missense_Mutation
CCBL1	883	broad.mit.edu	37	9	131600011	131600011	+	Missense_Mutation	SNP	G	G	A	rs183682394	byFrequency	TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr9:131600011G>A	ENST00000302586.3	-	6	682	c.520C>T	c.(520-522)Cgc>Tgc	p.R174C	CCBL1_ENST00000483599.1_5'UTR|CCBL1_ENST00000320665.6_Missense_Mutation_p.R124C|CCBL1_ENST00000436267.2_Missense_Mutation_p.R268C	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	174					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.R174C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	GCTTTGGTGCGTGATGTGAAT	0.617													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19960	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9						G	CYS/ARG,CYS/ARG,CYS/ARG	2,4128		0,2,2063	81.0	88.0	86.0		520,370,520	4.5	0.8	9		86	0,8362		0,0,4181	yes	missense,missense,missense	CCBL1	NM_001122671.1,NM_001122672.1,NM_004059.4	180,180,180	0,2,6244	AA,AG,GG		0.0,0.0484,0.016	benign,benign,benign	174/423,124/373,174/423	131600011	2,12490	2065	4181	6246	130639832	SO:0001583	missense	883			Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.520C>T	9.37:g.131600011G>A	ENSP00000302227:p.Arg174Cys	Unknown		x	x	x	130639832	Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	37	CCDS43884.1	SNP	40	Broad	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	13.45	2.239771	0.39598	4.84E-4	0.0	ENSG00000171097	ENST00000302586;ENST00000320665;ENST00000436267;ENST00000451800;ENST00000416084	D;D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84;-2.84	5.36	4.47	0.54385	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.182891	0.49916	N	0.000129	D	0.92958	0.7759	H	0.95260	3.645	0.50171	D	0.999853	B;B;B;B	0.26845	0.07;0.107;0.07;0.161	B;B;B;B	0.23716	0.016;0.048;0.016;0.044	D	0.91867	0.5504	10	0.66056	D	0.02	-24.3281	13.053	0.58964	0.0788:0.0:0.9212:0.0	.	268;124;174;174	B7Z4W5;Q16773-2;Q16773;Q5T278	.;.;KAT1_HUMAN;.	C	174;124;268;174;174	ENSP00000302227:R174C;ENSP00000317342:R124C;ENSP00000399415:R268C;ENSP00000390377:R174C;ENSP00000412402:R174C	ENSP00000302227:R174C	R	-	1	0	CCBL1	130639832	0.553000	0.26513	0.767000	0.31495	0.792000	0.44763	3.447000	0.52936	1.255000	0.44051	-0.126000	0.14955	CGC		0.617	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2			Missense_Mutation
PPL	5493	broad.mit.edu	37	16	4935453	4935458	+	In_Frame_Del	DEL	GCCTCC	GCCTCC	-	rs202140447	byFrequency	TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr16:4935453_4935458delGCCTCC	ENST00000345988.2	-	22	3287_3292	c.3198_3203delGGAGGC	c.(3196-3204)ctggaggca>cta	p.EA1067del	PPL_ENST00000590782.2_In_Frame_Del_p.EA1065del	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1067					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.A1068_E1069del(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CTGGTACTCTGCCTCCAGCTGGGGGT	0.617																																																1	Deletion - In frame(1)	ovary(1)	16																																								4875459	SO:0001651	inframe_deletion	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3198_3203delGGAGGC	16.37:g.4935453_4935458delGCCTCC	ENSP00000340510:p.Glu1067_Ala1068del	Unknown		Capture	Illumina GAIIx	Phase_I	4875454	O60314|O60454|Q14C98	In_Frame_Del	DEL	ENST00000345988.2	37	CCDS10526.1	DEL	46	Broad																																																																																				0.617	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705		In_Frame_Del
C16orf70	80262	broad.mit.edu	37	16	67159946	67159947	+	Splice_Site	INS	-	-	T			TCGA-61-2102-01	TCGA-61-2102-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2102-01	TCGA-61-2102-11	g.chr16:67159946_67159947insT	ENST00000219139.3	+	3	419		c.e3+1		C16orf70_ENST00000569683.1_Splice_Site|C16orf70_ENST00000569600.1_Splice_Site	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70									p.?(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GAGACTTAAGGTAACTATAAAT	0.371																																																1	Unknown(1)	ovary(1)	16																																								65717448	SO:0001630	splice_region_variant	80262			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.231+1->T	16.37:g.67159947_67159947dupT		Unknown		Capture	Illumina GAIIx	Phase_I	65717447	Q9HA86	Splice_Site_Ins	INS	ENST00000219139.3	37	CCDS10828.1	INS	44	Broad																																																																																				0.371	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	Intron	Splice_Site_Ins
