#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CSMD2	114784	broad.mit.edu	37	1	34070923	34070923	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:34070923C>A	ENST00000373380.1	-	21	3330	c.3110G>T	c.(3109-3111)gGc>gTc	p.G1037V	CSMD2_ENST00000489419.1_5'Flank|CSMD2_ENST00000373388.2_Missense_Mutation_p.G263V|CSMD2_ENST00000373377.1_Missense_Mutation_p.G263V|CSMD2_ENST00000373381.4_Missense_Mutation_p.G2164V			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2166	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G2166V(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCGGTTGGTGCCATGTTGACA	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	91.0	95.0					1																	34070923		2203	4300	6503	33843510	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.3110G>T	1.37:g.34070923C>A	ENSP00000362478:p.Gly1037Val	Unknown		x	x	x	33843510	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019523	0.93462	.	.	ENSG00000121904	ENST00000373381;ENST00000373380;ENST00000373377;ENST00000373388	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	5.7	5.7	0.88788	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.57330	0.2046	M	0.83118	2.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.61603	-0.7029	10	0.87932	D	0	.	18.8088	0.92050	0.0:1.0:0.0:0.0	.	1037;2166;2164	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	V	2164;1037;263;263	ENSP00000362479:G2164V;ENSP00000362478:G1037V;ENSP00000362475:G263V;ENSP00000362486:G263V	ENSP00000241312:G2166V	G	-	2	0	CSMD2	33843510	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.689000	0.91719	0.561000	0.74099	GGC		0.587	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		Missense_Mutation
MACF1	23499	broad.mit.edu	37	1	39854014	39854014	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:39854014A>G	ENST00000372915.3	+	57	15602	c.15515A>G	c.(15514-15516)aAc>aGc	p.N5172S	MACF1_ENST00000539005.1_Missense_Mutation_p.N3084S|MACF1_ENST00000361689.2_Missense_Mutation_p.N3105S|MACF1_ENST00000567887.1_Missense_Mutation_p.N5204S|MACF1_ENST00000564288.1_Missense_Mutation_p.N5167S|MACF1_ENST00000317713.7_Missense_Mutation_p.N3105S|MACF1_ENST00000545844.1_Missense_Mutation_p.N3105S|MACF1_ENST00000289893.4_Missense_Mutation_p.N3607S			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5172					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.N3105S(1)|p.N3607S(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTATTCCTTAACAAAATTCAC	0.473																																																2	Substitution - Missense(2)	ovary(2)	1											64.0	62.0	63.0					1																	39854014		2203	4300	6503	39626601	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.15515A>G	1.37:g.39854014A>G	ENSP00000362006:p.Asn5172Ser	Unknown		x	x	x	39626601	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	4.140	0.024225	0.08006	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4	5.6	2.93	0.34026	.	0.300838	0.29822	N	0.011114	T	0.11367	0.0277	N	0.01048	-1.04	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.001	B;B;B	0.11329	0.004;0.006;0.004	T	0.05053	-1.0909	10	0.34782	T	0.22	.	6.1611	0.20364	0.6999:0.0:0.3001:0.0	.	5172;3105;3049	Q9UPN3;F8W8Q1;Q9UPN3-3	MACF1_HUMAN;.;.	S	3105;5172;3105;3105;3084;3607	ENSP00000439537:N3105S;ENSP00000362006:N5172S;ENSP00000354573:N3105S;ENSP00000313438:N3105S;ENSP00000444364:N3084S;ENSP00000289893:N3607S	ENSP00000289893:N3607S	N	+	2	0	MACF1	39626601	0.468000	0.25839	1.000000	0.80357	0.562000	0.35680	0.533000	0.23082	1.022000	0.39626	0.460000	0.39030	AAC		0.473	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		Missense_Mutation
IPO13	9670	broad.mit.edu	37	1	44423750	44423750	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:44423750G>A	ENST00000372343.3	+	8	2304	c.1642G>A	c.(1642-1644)Gtg>Atg	p.V548M		NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	548					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V548M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TGTCTCTTCTGTGTCCACCCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											206.0	188.0	194.0					1																	44423750		2203	4300	6503	44196337	SO:0001583	missense	9670			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1642G>A	1.37:g.44423750G>A	ENSP00000361418:p.Val548Met	Unknown		x	x	x	44196337	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	37	CCDS503.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519841	0.85495	.	.	ENSG00000117408	ENST00000372343	T	0.69175	-0.38	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79088	0.4387	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	T	0.79120	-0.1934	10	0.87932	D	0	-9.5406	20.4238	0.99064	0.0:0.0:1.0:0.0	.	548	O94829	IPO13_HUMAN	M	548	ENSP00000361418:V548M	ENSP00000361418:V548M	V	+	1	0	IPO13	44196337	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.735000	0.98825	2.828000	0.97474	0.655000	0.94253	GTG		0.557	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652		Missense_Mutation
SRSF11	9295	broad.mit.edu	37	1	70715640	70715640	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:70715640G>C	ENST00000370950.3	+	11	1110	c.1028G>C	c.(1027-1029)aGa>aCa	p.R343T	SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370951.1_Missense_Mutation_p.R343T|SRSF11_ENST00000405432.1_Missense_Mutation_p.R343T|SRSF11_ENST00000370949.1_Missense_Mutation_p.R283T			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	343	10 X 8 AA approximate repeats of R-R-S-R- S-R-S-R.|Poly-Arg.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R343T(1)		large_intestine(3)|ovary(2)|skin(1)	6						TCTAGAGAGAGACGACGACGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	87.0	85.0					1																	70715640		2203	4300	6503	70488228	SO:0001583	missense	9295			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.1028G>C	1.37:g.70715640G>C	ENSP00000359988:p.Arg343Thr	Unknown		x	x	x	70488228	Q5T758|Q8IWE6	Missense_Mutation	SNP	ENST00000370950.3	37	CCDS647.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	16.60	3.168885	0.57584	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000395136;ENST00000370949	D;D;D;D;T	0.97138	-1.73;-1.73;-1.73;-4.26;-0.48	5.45	5.45	0.79879	.	0.158445	0.64402	D	0.000013	D	0.93400	0.7895	M	0.64404	1.975	0.80722	D	1	P;B;B;B	0.36535	0.557;0.18;0.281;0.281	B;B;B;B	0.30855	0.121;0.083;0.083;0.083	D	0.93943	0.7225	10	0.66056	D	0.02	.	12.6115	0.56554	0.0769:0.0:0.9231:0.0	.	283;350;343;343	Q5T757;Q6PJB9;Q8IWE6;Q05519	.;.;.;SRS11_HUMAN	T	343;343;343;350;283	ENSP00000359989:R343T;ENSP00000359988:R343T;ENSP00000384357:R343T;ENSP00000378568:R350T;ENSP00000359987:R283T	ENSP00000359987:R283T	R	+	2	0	SRSF11	70488228	1.000000	0.71417	0.889000	0.34880	0.841000	0.47740	6.108000	0.71522	2.730000	0.93505	0.655000	0.94253	AGA		0.413	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768		Missense_Mutation
KPRP	448834	broad.mit.edu	37	1	152733551	152733551	+	Missense_Mutation	SNP	G	G	A	rs201034376		TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:152733551G>A	ENST00000606109.1	+	1	1515	c.1487G>A	c.(1486-1488)cGc>cAc	p.R496H	KPRP_ENST00000368773.1_Missense_Mutation_p.R496H			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	496	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.R496H(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGACTTGGCGCAGCCCCAGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											45.0	51.0	49.0					1																	152733551		2203	4300	6503	151000175	SO:0001583	missense	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1487G>A	1.37:g.152733551G>A	ENSP00000475216:p.Arg496His	Unknown		x	x	x	151000175		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	10.94	1.492517	0.26774	.	.	ENSG00000203786	ENST00000368773	T	0.15017	2.46	4.46	2.55	0.30701	.	0.806480	0.10804	N	0.632297	T	0.03695	0.0105	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.41998	-0.9477	10	0.38643	T	0.18	-3.4942	4.4113	0.11434	0.192:0.0:0.6315:0.1764	.	496	Q5T749	KPRP_HUMAN	H	496	ENSP00000357762:R496H	ENSP00000357762:R496H	R	+	2	0	KPRP	151000175	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	1.343000	0.33930	0.606000	0.29965	-0.379000	0.06801	CGC		0.647	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	215848522	215848522	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:215848522T>C	ENST00000307340.3	-	63	13117	c.12731A>G	c.(12730-12732)aAt>aGt	p.N4244S	USH2A_ENST00000366943.2_Missense_Mutation_p.N4244S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4244	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.N4244S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCCAGCTGAATTCCAAGTGTA	0.398										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											95.0	91.0	92.0					1																	215848522		2203	4300	6503	213915145	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12731A>G	1.37:g.215848522T>C	ENSP00000305941:p.Asn4244Ser	Unknown		x	x	x	213915145	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528474	0.64860	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;T	0.88741	-2.42;0.11	5.26	4.12	0.48240	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000201	D	0.88691	0.6505	M	0.77103	2.36	0.51482	D	0.99992	P	0.36753	0.568	B	0.39068	0.289	D	0.86594	0.1862	10	0.49607	T	0.09	.	11.0019	0.47611	0.0:0.0733:0.0:0.9267	.	4244	O75445	USH2A_HUMAN	S	4244	ENSP00000305941:N4244S;ENSP00000355910:N4244S	ENSP00000305941:N4244S	N	-	2	0	USH2A	213915145	1.000000	0.71417	0.995000	0.50966	0.814000	0.46013	7.596000	0.82721	0.838000	0.34948	0.533000	0.62120	AAT		0.398	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
OR2T5	401993	broad.mit.edu	37	1	248652031	248652031	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr1:248652031G>C	ENST00000366473.2	+	1	147	c.142G>C	c.(142-144)Gtc>Ctc	p.V48L		NM_001004697.1	NP_001004697.1	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T, member 5	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V48L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(2)|pancreas(1)|skin(2)	9	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGAAATGCTGTCCTGATCCT	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	67.0	58.0					1																	248652031		2191	4295	6486	246718654	SO:0001583	missense	401993			BK004465	CCDS31118.1	1q44	2012-08-09			ENSG00000203661	ENSG00000203661		"""GPCR / Class A : Olfactory receptors"""	15017	protein-coding gene	gene with protein product							Standard	NM_001004697		Approved		uc001iem.1	Q6IEZ7	OTTHUMG00000040481	ENST00000366473.2:c.142G>C	1.37:g.248652031G>C	ENSP00000355429:p.Val48Leu	Unknown		x	x	x	246718654		Missense_Mutation	SNP	ENST00000366473.2	37	CCDS31118.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	t	0.011	-1.724888	0.00694	.	.	ENSG00000203661	ENST00000366473	T	0.00444	7.4	2.64	-2.36	0.06663	GPCR, rhodopsin-like superfamily (1);	1.007080	0.08003	N	0.989044	T	0.00109	0.0003	N	0.00894	-1.105	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32241	-0.9914	10	0.02654	T	1	.	3.1348	0.06435	0.5406:0.0:0.2814:0.178	.	48	Q6IEZ7	OR2T5_HUMAN	L	48	ENSP00000355429:V48L	ENSP00000355429:V48L	V	+	1	0	OR2T5	246718654	0.000000	0.05858	0.055000	0.19348	0.121000	0.20230	-4.545000	0.00218	-0.405000	0.07599	-1.321000	0.01291	GTC		0.473	OR2T5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097422.1	NM_001004697		Missense_Mutation
GAD2	2572	broad.mit.edu	37	10	26562620	26562620	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr10:26562620G>T	ENST00000376261.3	+	11	1651	c.1148G>T	c.(1147-1149)gGc>gTc	p.G383V	GAD2_ENST00000259271.3_Missense_Mutation_p.G383V	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	383					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.G383V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AAACTGAGTGGCGTGGAGAGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	10											125.0	119.0	121.0					10																	26562620		2203	4300	6503	26602626	SO:0001583	missense	2572			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1148G>T	10.37:g.26562620G>T	ENSP00000365437:p.Gly383Val	Unknown		x	x	x	26602626	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430511	0.83776	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.55413	0.52;0.52	5.63	5.63	0.86233	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.84853	0.5564	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90883	0.4755	10	0.87932	D	0	-20.0868	19.283	0.94060	0.0:0.0:1.0:0.0	.	383	Q05329	DCE2_HUMAN	V	383	ENSP00000365437:G383V;ENSP00000259271:G383V	ENSP00000259271:G383V	G	+	2	0	GAD2	26602626	1.000000	0.71417	0.981000	0.43875	0.871000	0.50021	9.023000	0.93683	2.639000	0.89480	0.650000	0.86243	GGC		0.383	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818		Missense_Mutation
ADAMTS14	140766	broad.mit.edu	37	10	72468478	72468478	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr10:72468478G>C	ENST00000373207.1	+	4	814	c.814G>C	c.(814-816)Gtt>Ctt	p.V272L	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.V272L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	272	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V272L(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CGACTCGGTGGTTCGCTTCCA	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											149.0	118.0	129.0					10																	72468478		2203	4300	6503	72138484	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.814G>C	10.37:g.72468478G>C	ENSP00000362303:p.Val272Leu	Unknown		x	x	x	72138484	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736171	0.89482	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.63255	-0.03;-0.03	4.48	4.48	0.54585	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000005	T	0.70962	0.3284	L	0.43646	1.37	0.50467	D	0.999873	P;D	0.60575	0.711;0.988	B;P	0.61940	0.38;0.896	T	0.74586	-0.3616	10	0.66056	D	0.02	.	16.9214	0.86165	0.0:0.0:1.0:0.0	.	272;272	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	L	272	ENSP00000362304:V272L;ENSP00000362303:V272L	ENSP00000362303:V272L	V	+	1	0	ADAMTS14	72138484	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.766000	0.85320	2.320000	0.78422	0.491000	0.48974	GTT		0.617	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		Missense_Mutation
ZNF215	7762	broad.mit.edu	37	11	6964392	6964392	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr11:6964392C>G	ENST00000278319.5	+	5	1150	c.562C>G	c.(562-564)Ctg>Gtg	p.L188V	ZNF215_ENST00000414517.2_Missense_Mutation_p.L188V|ZNF215_ENST00000527171.1_Intron|ZNF215_ENST00000529903.1_Missense_Mutation_p.L188V	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	188	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L188V(1)|p.L188M(1)		NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		TGTAAAGAACCTGTACAGGAA	0.393																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											169.0	160.0	163.0					11																	6964392		2201	4296	6497	6920968	SO:0001583	missense	7762			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.562C>G	11.37:g.6964392C>G	ENSP00000278319:p.Leu188Val	Unknown		x	x	x	6920968	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601034	0.46423	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.05081	3.5;3.5;3.5	4.38	1.37	0.22104	Krueppel-associated box (4);	0.270310	0.19863	N	0.104397	T	0.11110	0.0271	M	0.91972	3.26	0.23249	N	0.99805	P;B	0.37423	0.594;0.339	B;B	0.36030	0.191;0.216	T	0.19811	-1.0294	10	0.66056	D	0.02	1.557	3.0264	0.06092	0.1834:0.5397:0.1775:0.0993	.	188;188	Q96C84;Q9UL58	.;ZN215_HUMAN	V	188	ENSP00000278319:L188V;ENSP00000393202:L188V;ENSP00000432306:L188V	ENSP00000278319:L188V	L	+	1	2	ZNF215	6920968	0.038000	0.19896	0.998000	0.56505	0.938000	0.57974	0.068000	0.14531	0.194000	0.20326	-1.045000	0.02358	CTG		0.393	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1			Missense_Mutation
SBF2	81846	broad.mit.edu	37	11	9810830	9810830	+	Silent	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr11:9810830C>T	ENST00000256190.8	-	35	4895	c.4758G>A	c.(4756-4758)gaG>gaA	p.E1586E	SBF2-AS1_ENST00000498905.2_RNA|SBF2-AS1_ENST00000534671.1_RNA|SBF2-AS1_ENST00000526617.1_RNA|SBF2-AS1_ENST00000525636.1_RNA|SBF2-AS1_ENST00000499953.2_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1586				E -> G (in Ref. 4; CAH18167). {ECO:0000305}.	cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E1586E(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TGGACAGGGTCTCTTCTATGT	0.498																																																1	Substitution - coding silent(1)	ovary(1)	11											101.0	109.0	106.0					11																	9810830		2201	4294	6495	9767406	SO:0001819	synonymous_variant	81846			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.4758G>A	11.37:g.9810830C>T		Unknown		x	x	x	9767406	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Silent	SNP	ENST00000256190.8	37	CCDS31427.1	SNP	32	Broad																																																																																				0.498	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962		Silent
METTL15	196074	broad.mit.edu	37	11	28135059	28135059	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr11:28135059T>G	ENST00000407364.3	+	3	530	c.178T>G	c.(178-180)Tct>Gct	p.S60A	METTL15_ENST00000379199.2_Missense_Mutation_p.S60A|METTL15_ENST00000403099.1_Missense_Mutation_p.S60A|METTL15_ENST00000303459.6_Missense_Mutation_p.S60A|METTL15_ENST00000406787.3_Missense_Mutation_p.S60A|METTL15_ENST00000342303.5_Missense_Mutation_p.S60A			A6NJ78	MET15_HUMAN	methyltransferase like 15	60							methyltransferase activity (GO:0008168)	p.S60A(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						GTTACACAGATCTCAAGATAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											59.0	66.0	64.0					11																	28135059		2202	4299	6501	28091635	SO:0001583	missense	196074			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.178T>G	11.37:g.28135059T>G	ENSP00000384369:p.Ser60Ala	Unknown		x	x	x	28091635	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Missense_Mutation	SNP	ENST00000407364.3	37	CCDS44559.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	10.39	1.335931	0.24253	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000403099;ENST00000407364;ENST00000379199;ENST00000303459	T;T;T;T;T;T	0.55588	1.49;1.5;0.52;1.93;0.51;1.5	5.35	1.74	0.24563	.	0.890365	0.09942	N	0.735791	T	0.42562	0.1208	L	0.59436	1.845	0.09310	N	1	B;B;P	0.42871	0.022;0.167;0.792	B;B;B	0.40864	0.01;0.085;0.342	T	0.30937	-0.9961	10	0.27785	T	0.31	.	0.607	0.00754	0.1853:0.1836:0.1544:0.4766	.	60;60;60	A6NJ78;A6NJ78-2;A6NJ78-4	MET15_HUMAN;.;.	A	60	ENSP00000385507:S60A;ENSP00000342259:S60A;ENSP00000385860:S60A;ENSP00000384369:S60A;ENSP00000368497:S60A;ENSP00000307251:S60A	ENSP00000307251:S60A	S	+	1	0	METTL15	28091635	0.001000	0.12720	0.003000	0.11579	0.006000	0.05464	0.480000	0.22244	0.407000	0.25591	0.482000	0.46254	TCT		0.393	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318135.2	NM_152636		Missense_Mutation
TMEM109	79073	broad.mit.edu	37	11	60687238	60687238	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr11:60687238C>T	ENST00000227525.3	+	2	476	c.73C>T	c.(73-75)Ctt>Ttt	p.L25F	TMEM109_ENST00000536171.1_Missense_Mutation_p.L25F|RP11-881M11.4_ENST00000543907.1_RNA	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109	25					cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)		p.L25F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						CCTAGTGGCCCTTATCCTCCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											167.0	137.0	148.0					11																	60687238		2203	4299	6502	60443814	SO:0001583	missense	79073				CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.73C>T	11.37:g.60687238C>T	ENSP00000227525:p.Leu25Phe	Unknown		x	x	x	60443814		Missense_Mutation	SNP	ENST00000227525.3	37	CCDS7996.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412561	0.62511	.	.	ENSG00000110108	ENST00000227525;ENST00000446886;ENST00000536171	.	.	.	5.21	3.27	0.37495	.	0.370221	0.21124	N	0.079761	T	0.42040	0.1185	L	0.59436	1.845	0.30004	N	0.815751	B	0.14438	0.01	B	0.19946	0.027	T	0.42396	-0.9454	9	0.44086	T	0.13	-6.0649	8.5042	0.33177	0.0:0.7618:0.1527:0.0855	.	25	Q9BVC6	TM109_HUMAN	F	25	.	ENSP00000227525:L25F	L	+	1	0	TMEM109	60443814	0.000000	0.05858	0.524000	0.27887	0.967000	0.64934	-0.340000	0.07821	1.144000	0.42321	0.462000	0.41574	CTT		0.552	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396343.1	NM_024092		Missense_Mutation
CHD4	1108	broad.mit.edu	37	12	6700958	6700958	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr12:6700958C>A	ENST00000357008.2	-	21	3287	c.3124G>T	c.(3124-3126)Ggc>Tgc	p.G1042C	CHD4_ENST00000544040.1_Missense_Mutation_p.G1035C|CHD4_ENST00000544484.1_Missense_Mutation_p.G1039C|CHD4_ENST00000309577.6_Missense_Mutation_p.G1042C	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1042					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.G1042C(1)		central_nervous_system(2)	2						AGGGCACTGCCATCATACATG	0.453																																					Colon(32;586 792 4568 16848 45314)											1	Substitution - Missense(1)	ovary(1)	12											91.0	86.0	88.0					12																	6700958		2203	4300	6503	6571219	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3124G>T	12.37:g.6700958C>A	ENSP00000349508:p.Gly1042Cys	Unknown		x	x	x	6571219	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	24.4	4.529149	0.85706	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.91540	0.7328	H	0.97365	3.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93515	0.6856	10	0.49607	T	0.09	.	19.1432	0.93452	0.0:1.0:0.0:0.0	.	1042;1042;1035	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	C	1039;1035;1042;1042;1016	ENSP00000440392:G1039C;ENSP00000440542:G1035C;ENSP00000312419:G1042C;ENSP00000349508:G1042C	ENSP00000312419:G1042C	G	-	1	0	CHD4	6571219	1.000000	0.71417	0.998000	0.56505	0.830000	0.47004	7.792000	0.85828	2.519000	0.84933	0.655000	0.94253	GGC		0.453	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
ESYT1	23344	broad.mit.edu	37	12	56531064	56531064	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr12:56531064G>C	ENST00000394048.5	+	17	2109	c.1845G>C	c.(1843-1845)tgG>tgC	p.W615C	ESYT1_ENST00000267113.4_Missense_Mutation_p.W625C|ESYT1_ENST00000541590.1_Missense_Mutation_p.W625C	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	615					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.W615C(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CTGGTGCTTGGGACGTGGACA	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											161.0	145.0	150.0					12																	56531064		2203	4300	6503	54817331	SO:0001583	missense	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1845G>C	12.37:g.56531064G>C	ENSP00000377612:p.Trp615Cys	Unknown		x	x	x	54817331	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548849	0.27652	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.55052	0.54;0.55;0.55	4.97	4.97	0.65823	C2 calcium/lipid-binding domain, CaLB (1);	0.916152	0.09311	N	0.819577	T	0.47619	0.1455	L	0.36672	1.1	0.26786	N	0.96951	P;P	0.44946	0.846;0.679	B;B	0.40329	0.326;0.188	T	0.42732	-0.9434	10	0.38643	T	0.18	0.0449	15.5427	0.76066	0.0:0.0:1.0:0.0	.	625;615	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	C	615;569;625;625	ENSP00000377612:W615C;ENSP00000267113:W625C;ENSP00000445952:W625C	ENSP00000267113:W625C	W	+	3	0	ESYT1	54817331	0.985000	0.35326	0.109000	0.21407	0.021000	0.10359	1.873000	0.39558	2.461000	0.83175	0.655000	0.94253	TGG		0.532	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292		Missense_Mutation
NACA	4666	broad.mit.edu	37	12	57108144	57108144	+	Splice_Site	SNP	A	A	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr12:57108144A>T	ENST00000454682.1	-	5	6105		c.e5+1		NACA_ENST00000546392.1_Splice_Site|NACA_ENST00000550952.1_Splice_Site|NACA_ENST00000552540.1_Splice_Site|NACA_ENST00000393891.4_Splice_Site|NACA_ENST00000548563.1_Splice_Site|NACA_ENST00000356769.3_Splice_Site|NACA_ENST00000551793.1_5'UTR	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.?(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TTCAAATCTTACCTTCCGTGC	0.398			T	BCL6	NHL																																		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	1	Unknown(1)	ovary(1)	12											141.0	124.0	130.0					12																	57108144		2203	4300	6503	55394411	SO:0001630	splice_region_variant	4666			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5823+1T>A	12.37:g.57108144A>T		Unknown		x	x	x	55394411		Splice_Site_SNP	SNP	ENST00000454682.1	37		SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	15.79	2.936507	0.52972	.	.	ENSG00000196531	ENST00000550920;ENST00000454682;ENST00000550952;ENST00000356769;ENST00000552540;ENST00000393891;ENST00000546392;ENST00000549259;ENST00000552055;ENST00000549855	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1877	0.59691	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NACA	55394411	1.000000	0.71417	0.944000	0.38274	0.514000	0.34195	9.229000	0.95273	1.758000	0.51981	0.377000	0.23210	.		0.398	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	Intron	Splice_Site_SNP
C12orf29	91298	broad.mit.edu	37	12	88439433	88439433	+	Missense_Mutation	SNP	G	G	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr12:88439433G>A	ENST00000356891.3	+	5	699	c.496G>A	c.(496-498)Gcc>Acc	p.A166T	C12orf29_ENST00000548757.2_3'UTR	NM_001009894.2	NP_001009894.2	Q8N999	CL029_HUMAN	chromosome 12 open reading frame 29	166					hematopoietic progenitor cell differentiation (GO:0002244)			p.A166T(1)		large_intestine(3)|lung(1)|ovary(1)	5						ATTTGAAATTGCCCTGGTACT	0.353																																																1	Substitution - Missense(1)	ovary(1)	12											85.0	81.0	82.0					12																	88439433		2203	4300	6503	86963564	SO:0001583	missense	91298			AL137488	CCDS31866.1	12q21.32	2012-05-30			ENSG00000133641	ENSG00000133641			25322	protein-coding gene	gene with protein product						14702039	Standard	NM_001009894		Approved	DKFZp434N2030	uc001tao.3	Q8N999	OTTHUMG00000169870	ENST00000356891.3:c.496G>A	12.37:g.88439433G>A	ENSP00000349358:p.Ala166Thr	Unknown		x	x	x	86963564	Q569K5|Q6AWA8|Q6PEK5|Q8IYQ5|Q9NT75	Missense_Mutation	SNP	ENST00000356891.3	37	CCDS31866.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346270	0.82022	.	.	ENSG00000133641	ENST00000356891	T	0.47528	0.84	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.49677	0.1571	M	0.74881	2.28	0.80722	D	1	P	0.35628	0.513	B	0.29524	0.103	T	0.54977	-0.8212	10	0.54805	T	0.06	-5.1714	18.022	0.89258	0.0:0.0:1.0:0.0	.	166	Q8N999	CL029_HUMAN	T	166	ENSP00000349358:A166T	ENSP00000349358:A166T	A	+	1	0	C12orf29	86963564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.872000	0.92352	2.700000	0.92200	0.655000	0.94253	GCC		0.353	C12orf29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406335.1	NM_001009894		Missense_Mutation
EXOC5	10640	broad.mit.edu	37	14	57698281	57698281	+	Missense_Mutation	SNP	A	A	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr14:57698281A>T	ENST00000413566.2	-	11	1450	c.1091T>A	c.(1090-1092)aTc>aAc	p.I364N	EXOC5_ENST00000340918.7_Missense_Mutation_p.I299N	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	364					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.I366N(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						GCGCTGTAGGATCATAGCACT	0.353																																																1	Substitution - Missense(1)	ovary(1)	14											65.0	61.0	62.0					14																	57698281		1843	4087	5930	56768034	SO:0001583	missense	10640			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1091T>A	14.37:g.57698281A>T	ENSP00000389934:p.Ile364Asn	Unknown		x	x	x	56768034	B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	37	CCDS45111.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372259	0.82573	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.48201	0.83;0.82	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.55257	0.1909	L	0.40543	1.245	0.80722	D	1	D;D	0.67145	0.996;0.985	P;P	0.61533	0.89;0.883	T	0.46871	-0.9160	10	0.17369	T	0.5	-8.255	16.1251	0.81386	1.0:0.0:0.0:0.0	.	299;364	F8W9B8;O00471	.;EXOC5_HUMAN	N	364;299	ENSP00000389934:I364N;ENSP00000342100:I299N	ENSP00000342100:I299N	I	-	2	0	EXOC5	56768034	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.852000	0.92215	2.267000	0.75376	0.477000	0.44152	ATC		0.353	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544		Missense_Mutation
CCDC88C	440193	broad.mit.edu	37	14	91745644	91745644	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr14:91745644C>T	ENST00000389857.6	-	28	4792	c.4706G>A	c.(4705-4707)cGg>cAg	p.R1569Q	CCDC88C_ENST00000331194.7_Missense_Mutation_p.R93Q	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1569					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.R1569Q(1)|p.R93Q(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCTACTTGGCCGCGACACTGA	0.403																																																2	Substitution - Missense(2)	ovary(2)	14											87.0	80.0	82.0					14																	91745644		1935	4142	6077	90815397	SO:0001583	missense	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4706G>A	14.37:g.91745644C>T	ENSP00000374507:p.Arg1569Gln	Unknown		x	x	x	90815397	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547524	0.86022	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.64260	1.22;-0.09	5.14	5.14	0.70334	.	0.153533	0.29205	U	0.012822	T	0.78541	0.4299	M	0.71581	2.175	0.51482	D	0.999928	D;D;D	0.89917	1.0;1.0;1.0	P;D;D	0.75020	0.86;0.985;0.985	T	0.77715	-0.2484	10	0.44086	T	0.13	-34.499	18.7977	0.92001	0.0:1.0:0.0:0.0	.	1569;93;19	Q9P219;Q9P219-2;Q9P219-3	DAPLE_HUMAN;.;.	Q	1569;93;93	ENSP00000374507:R1569Q;ENSP00000330332:R93Q	ENSP00000330332:R93Q	R	-	2	0	CCDC88C	90815397	1.000000	0.71417	0.736000	0.30914	0.782000	0.44232	2.369000	0.44231	2.666000	0.90696	0.561000	0.74099	CGG		0.403	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		Missense_Mutation
AHNAK2	113146	broad.mit.edu	37	14	105416244	105416244	+	Silent	SNP	C	C	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr14:105416244C>G	ENST00000333244.5	-	7	5663	c.5544G>C	c.(5542-5544)gtG>gtC	p.V1848V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1848						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.V1848V(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCGGCGCAGACACATCCACCG	0.602																																																1	Substitution - coding silent(1)	ovary(1)	14											167.0	206.0	194.0					14																	105416244		1939	4104	6043	104487289	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5544G>C	14.37:g.105416244C>G		Unknown		x	x	x	104487289	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	17	Broad																																																																																				0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Silent
RYR3	6263	broad.mit.edu	37	15	33858923	33858923	+	Silent	SNP	G	G	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr15:33858923G>A	ENST00000389232.4	+	12	1261	c.1191G>A	c.(1189-1191)ctG>ctA	p.L397L	RYR3_ENST00000415757.3_Silent_p.L397L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	397	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.L397L(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GATTAACACTGCAGAGATGCC	0.517																																																1	Substitution - coding silent(1)	ovary(1)	15											176.0	179.0	178.0					15																	33858923		2123	4231	6354	31646215	SO:0001819	synonymous_variant	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1191G>A	15.37:g.33858923G>A		Unknown		x	x	x	31646215	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1	SNP	46	Broad																																																																																				0.517	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			Silent
CSK	1445	broad.mit.edu	37	15	75094671	75094671	+	Splice_Site	SNP	G	G	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr15:75094671G>T	ENST00000220003.9	+	13	1899		c.e13-1		CSK_ENST00000309470.9_Splice_Site|CSK_ENST00000439220.2_Splice_Site|CSK_ENST00000567571.1_Splice_Site	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase						adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)	p.?(1)		central_nervous_system(1)|lung(2)	3						CCTGGCCACAGCCCCTGAAGG	0.647																																																1	Unknown(1)	ovary(1)	15											39.0	47.0	44.0					15																	75094671		2197	4296	6493	72881724	SO:0001630	splice_region_variant	1445				CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1171-1G>T	15.37:g.75094671G>T		Unknown		x	x	x	72881724	Q2M3N2|Q6FGZ6	Splice_Site_SNP	SNP	ENST00000220003.9	37	CCDS10269.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.06	2.421960	0.43020	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	.	.	.	3.71	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7916	0.69846	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CSK	72881724	1.000000	0.71417	0.997000	0.53966	0.670000	0.39368	9.463000	0.97652	2.100000	0.63781	0.563000	0.77884	.		0.647	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	Intron	Splice_Site_SNP
MGRN1	23295	broad.mit.edu	37	16	4700456	4700456	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr16:4700456T>G	ENST00000399577.5	+	2	272	c.179T>G	c.(178-180)cTg>cGg	p.L60R	MGRN1_ENST00000262370.7_Missense_Mutation_p.L60R|MGRN1_ENST00000586183.1_Missense_Mutation_p.L60R|MGRN1_ENST00000588994.1_Missense_Mutation_p.L60R|MGRN1_ENST00000415496.1_Missense_Mutation_p.L60R	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	60					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L60R(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						AACATGGATCTGAACTTCCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	16											86.0	91.0	89.0					16																	4700456		1893	4130	6023	4640457	SO:0001583	missense	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.179T>G	16.37:g.4700456T>G	ENSP00000382487:p.Leu60Arg	Unknown		x	x	x	4640457	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	23.6	4.432846	0.83776	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.39	5.39	0.77823	.	0.063724	0.64402	D	0.000005	T	0.60405	0.2266	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.992;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.992;0.998;0.939;0.996;0.997;0.983	T	0.67891	-0.5553	10	0.87932	D	0	-17.6236	13.3663	0.60687	0.0:0.0:0.0:1.0	.	60;60;60;60;60;60	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	R	60	ENSP00000262370:L60R;ENSP00000382487:L60R;ENSP00000393311:L60R;ENSP00000443810:L60R	ENSP00000262370:L60R	L	+	2	0	MGRN1	4640457	1.000000	0.71417	0.997000	0.53966	0.758000	0.43043	7.974000	0.88039	2.048000	0.60808	0.454000	0.30748	CTG		0.572	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2			Missense_Mutation
MYH11	4629	broad.mit.edu	37	16	15844137	15844137	+	Missense_Mutation	SNP	A	A	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr16:15844137A>C	ENST00000300036.5	-	16	2025	c.1916T>G	c.(1915-1917)cTg>cGg	p.L639R	MYH11_ENST00000452625.2_Missense_Mutation_p.L646R|MYH11_ENST00000576790.2_Missense_Mutation_p.L639R|MYH11_ENST00000396324.3_Missense_Mutation_p.L646R	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	639	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.L639R(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGCGCTGGGCAGCGAGCTCTC	0.637			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	1	Substitution - Missense(1)	ovary(1)	16											116.0	84.0	95.0					16																	15844137		2197	4300	6497	15751638	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1916T>G	16.37:g.15844137A>C	ENSP00000300036:p.Leu639Arg	Unknown		x	x	x	15751638	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	20.9	4.067186	0.76301	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.397790	0.25878	N	0.027704	T	0.59487	0.2197	L	0.31420	0.93	0.48452	D	0.999659	P;B;B;B;B;B	0.36660	0.564;0.289;0.289;0.289;0.41;0.41	B;B;B;B;B;B	0.37422	0.249;0.138;0.138;0.138;0.183;0.183	T	0.57015	-0.7883	10	0.17832	T	0.49	.	14.723	0.69323	1.0:0.0:0.0:0.0	.	646;639;639;646;639;646	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	R	639;639;646;646;646	ENSP00000300036:L639R;ENSP00000345136:L639R;ENSP00000379616:L646R;ENSP00000407821:L646R	ENSP00000300036:L639R	L	-	2	0	MYH11	15751638	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	4.960000	0.63673	2.078000	0.62432	0.459000	0.35465	CTG		0.637	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		Missense_Mutation
GOSR1	9527	broad.mit.edu	37	17	28847010	28847010	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr17:28847010C>T	ENST00000225724.5	+	8	671	c.599C>T	c.(598-600)tCa>tTa	p.S200L	GOSR1_ENST00000451249.2_Missense_Mutation_p.S198L|GOSR1_ENST00000467337.2_Missense_Mutation_p.S135L|GOSR1_ENST00000581721.1_Missense_Mutation_p.S186L	NM_001007024.1|NM_001007025.1|NM_004871.2	NP_001007025.1|NP_001007026.1|NP_004862.1	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1	200					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.S200L(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	12						ATGTTGAAGTCAATTCACAGC	0.388																																																1	Substitution - Missense(1)	ovary(1)	17											237.0	237.0	237.0					17																	28847010		2203	4300	6503	25871136	SO:0001583	missense	9527			AF047438	CCDS11258.1, CCDS45643.1, CCDS45644.1	17q11	2011-04-15			ENSG00000108587	ENSG00000108587			4430	protein-coding gene	gene with protein product	"""golgi integral membrane protein 2"""	604026				8638159, 9653160, 15004235	Standard	XM_005258072		Approved	GOS28, P28, GS28, GOS-28, GOLIM2	uc002hfe.3	O95249	OTTHUMG00000132796	ENST00000225724.5:c.599C>T	17.37:g.28847010C>T	ENSP00000225724:p.Ser200Leu	Unknown		x	x	x	25871136	J3KST5|O75392	Missense_Mutation	SNP	ENST00000225724.5	37	CCDS11258.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617699	0.87359	.	.	ENSG00000108587	ENST00000225724;ENST00000451249;ENST00000414833	T;T	0.78246	-1.16;-1.16	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	M	0.74647	2.275	0.80722	D	1	P;P	0.35656	0.514;0.514	B;B	0.41135	0.348;0.348	T	0.80741	-0.1247	10	0.46703	T	0.11	-7.4627	19.6475	0.95784	0.0:1.0:0.0:0.0	.	200;198	O95249;E9PCW1	GOSR1_HUMAN;.	L	200;198;135	ENSP00000225724:S200L;ENSP00000414441:S198L	ENSP00000225724:S200L	S	+	2	0	GOSR1	25871136	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.133000	0.77259	2.885000	0.99019	0.655000	0.94253	TCA		0.388	GOSR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256208.2			Missense_Mutation
C17orf104	284071	broad.mit.edu	37	17	42745439	42745439	+	Silent	SNP	T	T	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr17:42745439T>C	ENST00000409122.2	+	5	2302	c.2160T>C	c.(2158-2160)ccT>ccC	p.P720P	C17orf104_ENST00000409464.1_Silent_p.P554P|C17orf104_ENST00000359945.3_Silent_p.P720P	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	720								p.P720P(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						ATTTGTACCCTTATTTTAATA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	17											73.0	64.0	67.0					17																	42745439		2203	4300	6503	40100965	SO:0001819	synonymous_variant	284071				CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.2160T>C	17.37:g.42745439T>C		Unknown		x	x	x	40100965	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Silent	SNP	ENST00000409122.2	37	CCDS45703.2	SNP	56	Broad																																																																																				0.398	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080		Silent
MARCH2	51257	broad.mit.edu	37	19	8503305	8503305	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr19:8503305G>T	ENST00000602117.1	+	5	1071	c.616G>T	c.(616-618)Gag>Tag	p.E206*	MARCH2_ENST00000393944.1_Nonsense_Mutation_p.E206*|MARCH2_ENST00000601283.1_Intron|MARCH2_ENST00000381035.4_Nonsense_Mutation_p.E136*|MARCH2_ENST00000215555.2_Nonsense_Mutation_p.E206*			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	206					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E136*(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						GCTGTACTCCGAGTGGAGAAA	0.627																																																1	Substitution - Nonsense(1)	ovary(1)	19											59.0	60.0	59.0					19																	8503305		2203	4300	6503	8409305	SO:0001587	stop_gained	51257			AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.616G>T	19.37:g.8503305G>T	ENSP00000471536:p.Glu206*	Unknown		x	x	x	8409305	A6NP10|Q5H785|Q8N5A3|Q96B78	Nonsense_Mutation	SNP	ENST00000602117.1	37	CCDS12202.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.653217	0.96724	.	.	ENSG00000099785	ENST00000393944;ENST00000215555;ENST00000381035	.	.	.	5.33	5.33	0.75918	.	0.112320	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-26.6879	17.6131	0.88060	0.0:0.0:1.0:0.0	.	.	.	.	X	206;206;136	.	ENSP00000215555:E206X	E	+	1	0	MARCH2	8409305	1.000000	0.71417	0.930000	0.37139	0.772000	0.43724	9.548000	0.98103	2.490000	0.84030	0.655000	0.94253	GAG		0.627	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460361.2	NM_016496		Nonsense_Mutation
ZNF20	7568	broad.mit.edu	37	19	12244390	12244390	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr19:12244390C>G	ENST00000334213.5	-	4	835	c.611G>C	c.(610-612)tGt>tCt	p.C204S	ZNF20_ENST00000485451.1_5'Flank|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000600335.1_Intron	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C204S(1)		endometrium(1)|kidney(1)|lung(6)	8						GGCTTTCCCACAAAACTTACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											145.0	157.0	153.0					19																	12244390		2199	4298	6497	12105390	SO:0001583	missense	7568			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.611G>C	19.37:g.12244390C>G	ENSP00000335437:p.Cys204Ser	Unknown		x	x	x	12105390	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664946	0.47572	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	D	0.85861	-2.04	0.94	0.94	0.19513	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92961	0.7760	H	0.94542	3.55	0.33001	D	0.526242	D	0.89917	1.0	D	0.91635	0.999	D	0.91671	0.5350	9	0.87932	D	0	.	7.7068	0.28655	0.0:1.0:0.0:0.0	.	204	P17024	ZNF20_HUMAN	S	204	ENSP00000335437:C204S	ENSP00000292241:C204S	C	-	2	0	ZNF20	12105390	1.000000	0.71417	0.088000	0.20740	0.505000	0.33919	4.015000	0.57152	0.783000	0.33636	0.313000	0.20887	TGT		0.363	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143		Missense_Mutation
ZNF708	7562	broad.mit.edu	37	19	21492104	21492104	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr19:21492104T>C	ENST00000356929.3	-	3	367	c.170A>G	c.(169-171)gAg>gGg	p.E57G		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E57G(1)		breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						TTTTCCTTGCTCCAGACAGGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											116.0	114.0	115.0					19																	21492104		2203	4300	6503	21283944	SO:0001583	missense	7562			X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.170A>G	19.37:g.21492104T>C	ENSP00000349401:p.Glu57Gly	Unknown		x	x	x	21283944	Q6ZMR0	Missense_Mutation	SNP	ENST00000356929.3	37	CCDS32980.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	.	14.93	2.681484	0.47991	.	.	ENSG00000182141	ENST00000356929	T	0.01159	5.25	0.225	0.225	0.15325	Krueppel-associated box (3);	.	.	.	.	T	0.05547	0.0146	M	0.87180	2.865	0.24027	N	0.996124	D	0.53885	0.963	P	0.61328	0.887	T	0.12451	-1.0547	8	0.72032	D	0.01	.	.	.	.	.	57	P17019	ZN708_HUMAN	G	57	ENSP00000349401:E57G	ENSP00000349401:E57G	E	-	2	0	ZNF708	21283944	0.982000	0.34865	0.973000	0.42090	0.973000	0.67179	1.132000	0.31418	0.257000	0.21650	0.254000	0.18369	GAG		0.423	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463953.1	NM_021269		Missense_Mutation
GSK3A	2931	broad.mit.edu	37	19	42736733	42736733	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr19:42736733G>C	ENST00000222330.3	-	9	1327	c.1200C>G	c.(1198-1200)caC>caG	p.H400Q	GSK3A_ENST00000398249.4_Missense_Mutation_p.H318Q	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	400	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.H400Q(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CAAAGAAGCTGTGCGCACAGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											75.0	71.0	72.0					19																	42736733		2203	4300	6503	47428573	SO:0001583	missense	2931				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1200C>G	19.37:g.42736733G>C	ENSP00000222330:p.His400Gln	Unknown		x	x	x	47428573	O14959	Missense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635160	0.67130	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.55930	0.49;0.49	4.88	1.33	0.21861	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71492	0.3346	M	0.89840	3.065	0.58432	D	0.999996	D;D	0.89917	1.0;0.98	D;P	0.77557	0.99;0.666	T	0.71652	-0.4528	10	0.87932	D	0	-23.8298	6.7058	0.23250	0.1605:0.0:0.6968:0.1427	.	400;318	P49840;A8MT37	GSK3A_HUMAN;.	Q	400;318;345	ENSP00000222330:H400Q;ENSP00000381301:H318Q	ENSP00000222330:H400Q	H	-	3	2	GSK3A	47428573	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	1.495000	0.35627	0.620000	0.30215	-0.215000	0.12644	CAC		0.582	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1			Missense_Mutation
ZNF45	7596	broad.mit.edu	37	19	44418233	44418233	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr19:44418233C>G	ENST00000269973.5	-	10	2445	c.1355G>C	c.(1354-1356)gGc>gCc	p.G452A	RP11-15A1.2_ENST00000586247.1_RNA|ZNF45_ENST00000589703.1_Missense_Mutation_p.G452A	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	452					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G452A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CTGGCTGAAGCCCTTGCCACA	0.483																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	63.0	63.0					19																	44418233		2203	4300	6503	49110073	SO:0001583	missense	7596			M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1355G>C	19.37:g.44418233C>G	ENSP00000269973:p.Gly452Ala	Unknown		x	x	x	49110073	P17016|P78472|Q9P1U9	Missense_Mutation	SNP	ENST00000269973.5	37	CCDS12632.1	SNP	26	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.51|14.51	2.557545|2.557545	0.45590|0.45590	.|.	.|.	ENSG00000124459|ENSG00000124459	ENST00000328762|ENST00000269973	.|T	.|0.35236	.|1.32	3.62|3.62	2.47|2.47	0.30058|0.30058	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.37178	.|N	.|0.002211	T|T	0.12902|0.12902	0.0313|0.0313	N|N	0.01473|0.01473	-0.845|-0.845	0.26797|0.26797	N|N	0.96929|0.96929	.|B	.|0.24651	.|0.108	.|B	.|0.31869	.|0.137	T|T	0.29336|0.29336	-1.0015|-1.0015	6|10	0.72032|0.02654	D|T	0.01|1	-11.8092|-11.8092	12.4201|12.4201	0.55516|0.55516	0.0:0.8283:0.1717:0.0|0.0:0.8283:0.1717:0.0	.|.	.|452	.|Q02386	.|ZNF45_HUMAN	P|A	452|452	.|ENSP00000269973:G452A	ENSP00000367176:A452P|ENSP00000269973:G452A	A|G	-|-	1|2	0|0	ZNF45|ZNF45	49110073|49110073	0.000000|0.000000	0.05858|0.05858	0.998000|0.998000	0.56505|0.56505	0.841000|0.841000	0.47740|0.47740	-0.254000|-0.254000	0.08781|0.08781	2.030000|2.030000	0.59900|0.59900	0.462000|0.462000	0.41574|0.41574	GCT|GGC		0.483	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425		Missense_Mutation
BIRC6	57448	broad.mit.edu	37	2	32688401	32688401	+	Silent	SNP	A	A	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr2:32688401A>C	ENST00000421745.2	+	24	5027	c.4893A>C	c.(4891-4893)ctA>ctC	p.L1631L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1631					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.L1603L(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGCAACAGCTACAGGTGCTGC	0.507																																					Pancreas(94;175 1509 16028 18060 45422)											1	Substitution - coding silent(1)	ovary(1)	2											66.0	62.0	64.0					2																	32688401		2203	4300	6503	32541905	SO:0001819	synonymous_variant	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.4893A>C	2.37:g.32688401A>C		Unknown		x	x	x	32541905	Q9ULD1	Silent	SNP	ENST00000421745.2	37	CCDS33175.2	SNP	14	Broad																																																																																				0.507	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		Silent
LTBP1	4052	broad.mit.edu	37	2	33500114	33500114	+	Silent	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr2:33500114C>T	ENST00000404816.2	+	17	3179	c.2826C>T	c.(2824-2826)tgC>tgT	p.C942C	LTBP1_ENST00000390003.4_Silent_p.C617C|LTBP1_ENST00000418533.2_Silent_p.C616C|LTBP1_ENST00000354476.3_Silent_p.C943C|LTBP1_ENST00000404525.1_Silent_p.C563C|LTBP1_ENST00000402934.1_Silent_p.C563C|LTBP1_ENST00000407925.1_Silent_p.C616C			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	942	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.C943C(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGTGCATTTGCCCAGCAGGAT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	2											116.0	108.0	111.0					2																	33500114		2203	4300	6503	33353618	SO:0001819	synonymous_variant	4052				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2826C>T	2.37:g.33500114C>T		Unknown		x	x	x	33353618	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	CCDS33177.2	SNP	26	Broad																																																																																				0.448	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		Silent
LRRTM4	80059	broad.mit.edu	37	2	77746316	77746316	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr2:77746316G>C	ENST00000409093.1	-	3	1015	c.679C>G	c.(679-681)Cgt>Ggt	p.R227G	LRRTM4_ENST00000409282.1_Missense_Mutation_p.R228G|LRRTM4_ENST00000409088.3_Missense_Mutation_p.R227G|LRRTM4_ENST00000409911.1_Missense_Mutation_p.R228G|LRRTM4_ENST00000409884.1_Missense_Mutation_p.R227G			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	227					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.R227G(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		TTGAAGAGACGTGGAAAATGA	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	63.0	64.0					2																	77746316		1882	4106	5988	77599824	SO:0001583	missense	80059			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.679C>G	2.37:g.77746316G>C	ENSP00000386357:p.Arg227Gly	Unknown		x	x	x	77599824	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968788	0.53614	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.03951	3.75;3.75;3.75;3.75;3.75	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.05181	0.0138	N	0.01109	-1.01	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.78314	0.979;0.991;0.986	T	0.58978	-0.7540	10	0.06757	T	0.87	.	18.4529	0.90710	0.0:0.0:1.0:0.0	.	228;227;227	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	G	228;227;227;227;228	ENSP00000387228:R228G;ENSP00000387297:R227G;ENSP00000386357:R227G;ENSP00000386236:R227G;ENSP00000386286:R228G	ENSP00000386236:R227G	R	-	1	0	LRRTM4	77599824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.621000	0.74228	2.689000	0.91719	0.655000	0.94253	CGT		0.448	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		Missense_Mutation
ST6GAL2	84620	broad.mit.edu	37	2	107423391	107423391	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr2:107423391T>C	ENST00000409382.3	-	6	1943	c.1333A>G	c.(1333-1335)Atg>Gtg	p.M445V	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.M445V	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	445					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.M445V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CACATGGACATCATTATGAGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											49.0	44.0	46.0					2																	107423391		2203	4300	6503	106789823	SO:0001583	missense	84620			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1333A>G	2.37:g.107423391T>C	ENSP00000386942:p.Met445Val	Unknown		x	x	x	106789823	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	SNP	50	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.76|17.76	3.468861|3.468861	0.63625|0.63625	.|.	.|.	ENSG00000144057|ENSG00000144057	ENST00000361803|ENST00000361686;ENST00000409382	.|T;T	.|0.29397	.|1.57;1.57	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.39572|0.39572	0.1083|0.1083	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	.|B	.|0.29232	.|0.238	.|B	.|0.36335	.|0.222	T|T	0.34453|0.34453	-0.9828|-0.9828	5|10	.|0.72032	.|D	.|0.01	-50.6212|-50.6212	14.9082|14.9082	0.70735|0.70735	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|445	.|Q96JF0	.|SIAT2_HUMAN	G|V	10|445	.|ENSP00000355273:M445V;ENSP00000386942:M445V	.|ENSP00000355273:M445V	D|M	-|-	2|1	0|0	ST6GAL2|ST6GAL2	106789823|106789823	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.958000|7.958000	0.87877|0.87877	2.118000|2.118000	0.64928|0.64928	0.533000|0.533000	0.62120|0.62120	GAT|ATG		0.502	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		Missense_Mutation
HSPA12B	116835	broad.mit.edu	37	20	3725632	3725632	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr20:3725632G>T	ENST00000254963.2	+	5	495	c.350G>T	c.(349-351)aGc>aTc	p.S117I	HSPA12B_ENST00000542646.1_5'UTR	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	117							ATP binding (GO:0005524)	p.S117I(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						GCCTTCCACAGCTTTGGCTAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	20											84.0	96.0	92.0					20																	3725632		2203	4300	6503	3673632	SO:0001583	missense	116835			AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.350G>T	20.37:g.3725632G>T	ENSP00000254963:p.Ser117Ile	Unknown		x	x	x	3673632	D3DVX7|Q2TAK3|Q9BR52	Missense_Mutation	SNP	ENST00000254963.2	37	CCDS13061.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.611787	0.96637	.	.	ENSG00000132622	ENST00000254963;ENST00000399701	T;T	0.03635	3.86;3.86	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.15955	0.0384	M	0.80746	2.51	0.80722	D	1	P;P	0.50819	0.732;0.939	P;P	0.58873	0.681;0.847	T	0.00196	-1.1931	10	0.59425	D	0.04	-4.3468	14.895	0.70636	0.0:0.0:1.0:0.0	.	117;117	B7ZLP2;Q96MM6	.;HS12B_HUMAN	I	117;31	ENSP00000254963:S117I;ENSP00000382608:S31I	ENSP00000254963:S117I	S	+	2	0	HSPA12B	3673632	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.543000	0.98089	2.468000	0.83385	0.561000	0.74099	AGC		0.647	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970		Missense_Mutation
ITSN1	6453	broad.mit.edu	37	21	35208859	35208859	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr21:35208859G>C	ENST00000381318.3	+	29	3872	c.3584G>C	c.(3583-3585)gGa>gCa	p.G1195A	ITSN1_ENST00000381285.4_Missense_Mutation_p.G1195A|ITSN1_ENST00000399353.1_Missense_Mutation_p.G1153A|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399349.1_Missense_Mutation_p.G1119A|ITSN1_ENST00000437442.2_Missense_Mutation_p.G1190A|ITSN1_ENST00000399367.3_Missense_Mutation_p.G1190A|ITSN1_ENST00000399355.2_Missense_Mutation_p.G1124A|ITSN1_ENST00000399326.3_3'UTR|ITSN1_ENST00000379960.5_3'UTR|ITSN1_ENST00000381291.4_Missense_Mutation_p.G1195A|ITSN1_ENST00000399352.1_Missense_Mutation_p.G1190A	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1195	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G1195A(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						TGGTGGAAAGGAGAAGTCAAT	0.537																																																1	Substitution - Missense(1)	ovary(1)	21											117.0	105.0	109.0					21																	35208859		2203	4300	6503	34130729	SO:0001583	missense	6453			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3584G>C	21.37:g.35208859G>C	ENSP00000370719:p.Gly1195Ala	Unknown		x	x	x	34130729	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211165	0.58343	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000437442	T;T;T;T;T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	4.37	4.37	0.52481	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	L	0.60845	1.875	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.80051	-0.1544	10	0.87932	D	0	.	16.9317	0.86191	0.0:0.0:1.0:0.0	.	1087;1158;1082;1190;1124;1190;1195;1119;1153	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;ITSN1_HUMAN;.;.	A	1153;1195;1195;1195;1124;1190;1190;1124;1119;1190	ENSP00000382290:G1153A;ENSP00000370719:G1195A;ENSP00000370691:G1195A;ENSP00000370685:G1195A;ENSP00000382301:G1190A;ENSP00000382289:G1190A;ENSP00000382292:G1124A;ENSP00000382286:G1119A;ENSP00000387377:G1190A	ENSP00000370685:G1195A	G	+	2	0	ITSN1	34130729	1.000000	0.71417	0.920000	0.36463	0.791000	0.44710	9.671000	0.98627	1.969000	0.57287	0.637000	0.83480	GGA		0.537	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		Missense_Mutation
PFKL	5211	broad.mit.edu	37	21	45746605	45746605	+	Missense_Mutation	SNP	A	A	G	rs568750535		TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr21:45746605A>G	ENST00000349048.4	+	22	2258	c.2203A>G	c.(2203-2205)Atg>Gtg	p.M735V	AP001062.8_ENST00000422357.1_RNA|PFKL_ENST00000403390.1_Missense_Mutation_p.M782V	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	735	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)	p.M782V(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		CAGGCACCGCATGCCACGGGA	0.667																																																1	Substitution - Missense(1)	ovary(1)	21											29.0	24.0	26.0					21																	45746605		2200	4291	6491	44571033	SO:0001583	missense	5211				CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.2203A>G	21.37:g.45746605A>G	ENSP00000269848:p.Met735Val	Unknown		x	x	x	44571033	Q96A64|Q96IH4|Q9BR91	Missense_Mutation	SNP	ENST00000349048.4	37	CCDS33582.1	SNP	8	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.894|4.894	0.166071|0.166071	0.09339|0.09339	.|.	.|.	ENSG00000183486|ENSG00000141959	ENST00000552110|ENST00000349048;ENST00000534847;ENST00000403390	.|T;T	.|0.77229	.|-1.08;-1.08	3.55|3.55	3.55|3.55	0.40652|0.40652	.|Phosphofructokinase domain (1);	.|0.097721	.|0.64402	.|U	.|0.000002	T|T	0.60728|0.60728	0.2291|0.2291	L|L	0.39020|0.39020	1.185|1.185	0.39530|0.39530	D|D	0.968655|0.968655	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.09377	.|0.001;0.004	T|T	0.52155|0.52155	-0.8613|-0.8613	5|10	.|0.02654	.|T	.|1	-43.9438|-43.9438	8.0224|8.0224	0.30417|0.30417	0.6343:0.3657:0.0:0.0|0.6343:0.3657:0.0:0.0	.|.	.|735;782	.|P17858;P17858-2	.|K6PL_HUMAN;.	R|V	15|735;528;782	.|ENSP00000269848:M735V;ENSP00000384038:M782V	.|ENSP00000269848:M735V	H|M	+|+	2|1	0|0	MX2|PFKL	44571033|44571033	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.937000|0.937000	0.57800|0.57800	3.633000|3.633000	0.54295|0.54295	1.374000|1.374000	0.46228|0.46228	0.372000|0.372000	0.22366|0.22366	CAT|ATG		0.667	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1			Missense_Mutation
TCF20	6942	broad.mit.edu	37	22	42610198	42610198	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr22:42610198G>T	ENST00000359486.3	-	1	1250	c.1114C>A	c.(1114-1116)Cca>Aca	p.P372T	TCF20_ENST00000335626.4_Missense_Mutation_p.P372T	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.P372T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GAGGCAGCTGGAGAAGGGTTA	0.557																																																1	Substitution - Missense(1)	ovary(1)	22											81.0	84.0	83.0					22																	42610198		2203	4300	6503	40940142	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.1114C>A	22.37:g.42610198G>T	ENSP00000352463:p.Pro372Thr	Unknown		x	x	x	40940142	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761278	0.69763	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.34072	1.38;1.38	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000001	T	0.62085	0.2399	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.62358	-0.6871	10	0.87932	D	0	-11.2477	20.1577	0.98120	0.0:0.0:1.0:0.0	.	372;372	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	T	372	ENSP00000352463:P372T;ENSP00000335561:P372T	ENSP00000335561:P372T	P	-	1	0	TCF20	40940142	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.414000	0.97362	2.767000	0.95098	0.655000	0.94253	CCA		0.557	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		Missense_Mutation
WNT7B	7477	broad.mit.edu	37	22	46327087	46327087	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr22:46327087G>C	ENST00000339464.4	-	3	835	c.461C>G	c.(460-462)gCc>gGc	p.A154G	WNT7B_ENST00000410058.1_Missense_Mutation_p.A154G|WNT7B_ENST00000410089.1_Missense_Mutation_p.A138G|WNT7B_ENST00000409496.3_Missense_Mutation_p.A158G	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	154					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.A154G(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		ACGCACGTCGGCCGAGCAGCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	22											53.0	55.0	54.0					22																	46327087		2203	4300	6503	44705751	SO:0001583	missense	7477			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.461C>G	22.37:g.46327087G>C	ENSP00000341032:p.Ala154Gly	Unknown		x	x	x	44705751	B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	37	CCDS33667.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	17.80	3.479291	0.63849	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496;ENST00000410058	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	3.22	3.22	0.36961	.	0.000000	0.85682	U	0.000000	D	0.86335	0.5908	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.989;0.993	D	0.88063	0.2795	10	0.66056	D	0.02	.	13.586	0.61931	0.0:0.0:1.0:0.0	.	158;154	A8K0G1;P56706	.;WNT7B_HUMAN	G	154;138;158;154	ENSP00000341032:A154G;ENSP00000386781:A138G;ENSP00000386546:A158G;ENSP00000387217:A154G	ENSP00000341032:A154G	A	-	2	0	WNT7B	44705751	1.000000	0.71417	0.898000	0.35279	0.210000	0.24377	5.965000	0.70387	1.641000	0.50575	0.313000	0.20887	GCC		0.642	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238		Missense_Mutation
KALRN	8997	broad.mit.edu	37	3	124132427	124132427	+	Silent	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr3:124132427G>C	ENST00000240874.3	+	14	2608	c.2451G>C	c.(2449-2451)cgG>cgC	p.R817R	KALRN_ENST00000360013.3_Silent_p.R817R|KALRN_ENST00000460856.1_Silent_p.R817R	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	817					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R817R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						ACACAGAACGGAAGCTAGCCA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	3											155.0	109.0	125.0					3																	124132427		2203	4300	6503	125615117	SO:0001819	synonymous_variant	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.2451G>C	3.37:g.124132427G>C		Unknown		x	x	x	125615117	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	37	CCDS3027.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	9.905	1.207887	0.22205	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.65	3.87	0.44632	.	.	.	.	.	T	0.58004	0.2092	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53697	-0.8402	4	.	.	.	.	7.8436	0.29412	0.1398:0.1329:0.7273:0.0	.	.	.	.	A	795	.	.	G	+	2	0	KALRN	125615117	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.241000	0.43097	0.941000	0.37499	0.655000	0.94253	GGA		0.547	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947		Silent
PIK3R4	30849	broad.mit.edu	37	3	130442413	130442413	+	Missense_Mutation	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr3:130442413C>T	ENST00000356763.3	-	7	2383	c.1826G>A	c.(1825-1827)gGc>gAc	p.G609D		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	609					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G609D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						GCTTTGCCAGCCAACATAGGC	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											67.0	62.0	64.0					3																	130442413		2203	4300	6503	131925103	SO:0001583	missense	30849			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1826G>A	3.37:g.130442413C>T	ENSP00000349205:p.Gly609Asp	Unknown		x	x	x	131925103	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	CCDS3067.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792731	0.90453	.	.	ENSG00000196455	ENST00000356763	T	0.53640	0.61	5.14	5.14	0.70334	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74191	0.3684	M	0.93375	3.41	0.80722	D	1	D	0.63880	0.993	P	0.57960	0.83	T	0.82061	-0.0644	10	0.66056	D	0.02	-22.5179	18.9774	0.92743	0.0:1.0:0.0:0.0	.	609	Q99570	PI3R4_HUMAN	D	609	ENSP00000349205:G609D	ENSP00000349205:G609D	G	-	2	0	PIK3R4	131925103	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.321000	0.79088	2.555000	0.86185	0.591000	0.81541	GGC		0.363	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602		Missense_Mutation
EPHB1	2047	broad.mit.edu	37	3	134670439	134670439	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr3:134670439C>A	ENST00000398015.3	+	3	720	c.350C>A	c.(349-351)aCt>aAt	p.T117N	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	117	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.T117N(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TACTATGAGACTGACTCTGTC	0.522																																																2	Substitution - Missense(2)	ovary(2)	3											77.0	78.0	77.0					3																	134670439		2043	4231	6274	136153129	SO:0001583	missense	2047			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.350C>A	3.37:g.134670439C>A	ENSP00000381097:p.Thr117Asn	Unknown		x	x	x	136153129	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290537	0.80914	.	.	ENSG00000154928	ENST00000460895;ENST00000398015;ENST00000473867;ENST00000474732	T;T;T;T	0.03860	3.78;3.78;3.78;3.78	5.49	5.49	0.81192	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.22126	0.0533	M	0.69358	2.11	0.80722	D	1	P;D	0.89917	0.901;1.0	D;D	0.87578	0.93;0.998	T	0.00105	-1.2057	10	0.87932	D	0	.	19.3701	0.94480	0.0:1.0:0.0:0.0	.	117;117	B5A969;P54762	.;EPHB1_HUMAN	N	95;117;95;95	ENSP00000417435:T95N;ENSP00000381097:T117N;ENSP00000417216:T95N;ENSP00000418352:T95N	ENSP00000381097:T117N	T	+	2	0	EPHB1	136153129	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	4.893000	0.63199	2.574000	0.86865	0.650000	0.86243	ACT		0.522	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		Missense_Mutation
CCDC39	339829	broad.mit.edu	37	3	180378492	180378492	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr3:180378492T>C	ENST00000442201.2	-	4	501	c.382A>G	c.(382-384)Aaa>Gaa	p.K128E	CCDC39_ENST00000273654.4_Missense_Mutation_p.K212E	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	128					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.K212E(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CCATCCAATTTTTGAGTGGCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											61.0	53.0	56.0					3																	180378492		1813	4081	5894	181861186	SO:0001583	missense	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.382A>G	3.37:g.180378492T>C	ENSP00000405708:p.Lys128Glu	Unknown		x	x	x	181861186	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	21.9	4.215559	0.79352	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	.	.	.	5.54	5.54	0.83059	.	0.047882	0.85682	D	0.000000	T	0.67850	0.2937	M	0.64676	1.99	0.49299	D	0.999773	D	0.62365	0.991	P	0.55824	0.785	T	0.67768	-0.5585	9	0.38643	T	0.18	-31.4628	15.3383	0.74277	0.0:0.0:0.0:1.0	.	128	Q9UFE4	CCD39_HUMAN	E	212;128	.	ENSP00000273654:K212E	K	-	1	0	CCDC39	181861186	1.000000	0.71417	0.990000	0.47175	0.667000	0.39255	7.394000	0.79862	2.102000	0.63906	0.482000	0.46254	AAA		0.368	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		Missense_Mutation
KLHL24	54800	broad.mit.edu	37	3	183397050	183397050	+	Nonsense_Mutation	SNP	C	C	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr3:183397050C>G	ENST00000454652.2	+	9	2165	c.1779C>G	c.(1777-1779)taC>taG	p.Y593*	KLHL24_ENST00000242810.6_Nonsense_Mutation_p.Y593*	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	593						cell projection (GO:0042995)|cytoplasm (GO:0005737)		p.Y593*(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			TTCATAGATACAATGAGAAAT	0.438																																																1	Substitution - Nonsense(1)	ovary(1)	3											83.0	79.0	80.0					3																	183397050		2203	4300	6503	184879744	SO:0001587	stop_gained	54800				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1779C>G	3.37:g.183397050C>G	ENSP00000395012:p.Tyr593*	Unknown		x	x	x	184879744	A5PLN8|Q9H620|Q9NXT9	Nonsense_Mutation	SNP	ENST00000454652.2	37	CCDS3246.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.018832	0.98613	.	.	ENSG00000114796	ENST00000242810;ENST00000454652	.	.	.	5.93	5.93	0.95920	.	0.131239	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9464	0.64086	0.0:0.9222:0.0:0.0778	.	.	.	.	X	593	.	ENSP00000242810:Y593X	Y	+	3	2	KLHL24	184879744	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.532000	0.45659	2.803000	0.96430	0.585000	0.79938	TAC		0.438	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644		Nonsense_Mutation
GPRIN3	285513	broad.mit.edu	37	4	90170334	90170334	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr4:90170334T>G	ENST00000609438.1	-	2	1446	c.928A>C	c.(928-930)Aag>Cag	p.K310Q	GPRIN3_ENST00000333209.4_Missense_Mutation_p.K310Q	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	310								p.K310Q(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GGAACTTCCTTGATTTCACTT	0.562																																																1	Substitution - Missense(1)	ovary(1)	4											116.0	111.0	113.0					4																	90170334		2203	4300	6503	90389357	SO:0001583	missense	285513			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.928A>C	4.37:g.90170334T>G	ENSP00000476603:p.Lys310Gln	Unknown		x	x	x	90389357	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	11.82	1.751740	0.31046	.	.	ENSG00000185477	ENST00000333209	T	0.10860	2.83	5.53	-7.29	0.01451	.	1.071110	0.07436	N	0.896525	T	0.04815	0.0130	N	0.24115	0.695	0.09310	N	1	B	0.16802	0.019	B	0.12156	0.007	T	0.44034	-0.9354	10	0.16420	T	0.52	-0.3421	3.9049	0.09177	0.0883:0.2865:0.3776:0.2475	.	310	Q6ZVF9	GRIN3_HUMAN	Q	310	ENSP00000328672:K310Q	ENSP00000328672:K310Q	K	-	1	0	GPRIN3	90389357	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.541000	0.06099	-0.720000	0.04935	-1.642000	0.00770	AAG		0.562	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		Missense_Mutation
FAT1	2195	broad.mit.edu	37	4	187549459	187549459	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr4:187549459G>C	ENST00000441802.2	-	9	4868	c.4659C>G	c.(4657-4659)agC>agG	p.S1553R		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1553	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1553R(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CATTCGTGTCGCTGACATTGA	0.498										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											61.0	63.0	62.0					4																	187549459		2080	4216	6296	187786453	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4659C>G	4.37:g.187549459G>C	ENSP00000406229:p.Ser1553Arg	Unknown		x	x	x	187786453		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721662	0.48728	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.01838	4.61	5.36	-3.37	0.04898	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.225081	0.53938	D	0.000049	T	0.03477	0.0100	L	0.39898	1.24	0.40710	D	0.982562	P	0.47034	0.889	P	0.51415	0.669	T	0.34725	-0.9817	10	0.18710	T	0.47	.	14.413	0.67128	0.4132:0.0:0.5868:0.0	.	1553	Q14517	FAT1_HUMAN	R	1553;1552	ENSP00000406229:S1553R	ENSP00000260147:S1552R	S	-	3	2	FAT1	187786453	0.000000	0.05858	0.991000	0.47740	0.750000	0.42670	-2.255000	0.01182	-0.415000	0.07484	0.563000	0.77884	AGC		0.498	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
ANKRD55	79722	broad.mit.edu	37	5	55398346	55398346	+	Missense_Mutation	SNP	G	G	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr5:55398346G>T	ENST00000341048.4	-	11	1849	c.1698C>A	c.(1696-1698)aaC>aaA	p.N566K	ANKRD55_ENST00000504958.2_Missense_Mutation_p.N523K|ANKRD55_ENST00000434982.2_Missense_Mutation_p.N278K	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	566								p.N566K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				GGGGAGCTAGGTTGTTCCGAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	5											181.0	173.0	176.0					5																	55398346		2203	4300	6503	55434103	SO:0001583	missense	79722			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.1698C>A	5.37:g.55398346G>T	ENSP00000342295:p.Asn566Lys	Unknown		x	x	x	55434103	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	CCDS34161.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673732	0.47781	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000434982	T;T;T	0.40225	1.3;1.04;1.41	5.93	4.88	0.63580	.	0.181304	0.45126	D	0.000397	T	0.24392	0.0591	N	0.19112	0.55	0.23816	N	0.996762	B;P	0.39665	0.376;0.682	B;B	0.30401	0.115;0.115	T	0.28586	-1.0039	10	0.59425	D	0.04	.	11.0324	0.47781	0.1562:0.0:0.8438:0.0	.	566;565	B3KVT8;Q3KP44	.;ANR55_HUMAN	K	566;566;523;278	ENSP00000342295:N566K;ENSP00000424230:N523K;ENSP00000429421:N278K	ENSP00000342295:N566K	N	-	3	2	ANKRD55	55434103	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.826000	0.39092	2.805000	0.96524	0.655000	0.94253	AAC		0.368	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669		Missense_Mutation
PDLIM7	9260	broad.mit.edu	37	5	176910884	176910884	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr5:176910884G>C	ENST00000355841.2	-	12	1337	c.1271C>G	c.(1270-1272)aCc>aGc	p.T424S	PDLIM7_ENST00000359895.2_Missense_Mutation_p.T390S|PDLIM7_ENST00000505746.1_5'UTR|PDLIM7_ENST00000356618.4_3'UTR	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	424	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.T424S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACGAAGCAGGTGTCATGCCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											51.0	51.0	51.0					5																	176910884		2203	4300	6503	176843490	SO:0001583	missense	9260			BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.1271C>G	5.37:g.176910884G>C	ENSP00000348099:p.Thr424Ser	Unknown		x	x	x	176843490	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Missense_Mutation	SNP	ENST00000355841.2	37	CCDS4422.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869730	0.72065	.	.	ENSG00000196923	ENST00000359895;ENST00000355841	D;D	0.86562	-2.14;-2.14	5.55	5.55	0.83447	Zinc finger, LIM-type (5);	0.000000	0.64402	D	0.000005	D	0.89308	0.6678	N	0.21324	0.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.88385	0.3004	10	0.34782	T	0.22	.	19.1667	0.93560	0.0:0.0:1.0:0.0	.	424;390	Q9NR12;Q9NR12-2	PDLI7_HUMAN;.	S	390;424	ENSP00000352964:T390S;ENSP00000348099:T424S	ENSP00000348099:T424S	T	-	2	0	PDLIM7	176843490	1.000000	0.71417	0.943000	0.38184	0.244000	0.25665	7.824000	0.86668	2.640000	0.89533	0.555000	0.69702	ACC		0.602	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253423.1	NM_005451		Missense_Mutation
BACH2	60468	broad.mit.edu	37	6	90660242	90660242	+	Missense_Mutation	SNP	T	T	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr6:90660242T>G	ENST00000257749.4	-	7	2290	c.1583A>C	c.(1582-1584)tAc>tCc	p.Y528S	RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.Y528S|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000343122.3_Missense_Mutation_p.Y528S	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	528						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.Y528S(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GTCCTCCGCGTAGGAATAGGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	6											55.0	59.0	58.0					6																	90660242		2203	4300	6503	90716963	SO:0001583	missense	60468			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1583A>C	6.37:g.90660242T>G	ENSP00000257749:p.Tyr528Ser	Unknown		x	x	x	90716963	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	17.99	3.524215	0.64747	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.59224	0.28;0.28;0.28	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	L	0.29908	0.895	0.54753	D	0.999987	D	0.89917	1.0	D	0.85130	0.997	T	0.64394	-0.6418	10	0.59425	D	0.04	-8.8894	15.0695	0.72024	0.0:0.0:0.0:1.0	.	528	Q9BYV9	BACH2_HUMAN	S	528	ENSP00000257749:Y528S;ENSP00000437473:Y528S;ENSP00000345642:Y528S	ENSP00000257749:Y528S	Y	-	2	0	BACH2	90716963	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.499000	0.81566	1.972000	0.57404	0.377000	0.23210	TAC		0.627	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813		Missense_Mutation
MAP3K7	6885	broad.mit.edu	37	6	91278296	91278296	+	Missense_Mutation	SNP	T	T	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr6:91278296T>C	ENST00000369329.3	-	3	439	c.278A>G	c.(277-279)tAt>tGt	p.Y93C	MAP3K7_ENST00000369327.3_Missense_Mutation_p.Y93C|MAP3K7_ENST00000369325.3_Missense_Mutation_p.Y93C|MAP3K7_ENST00000369332.3_Missense_Mutation_p.Y93C	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	93	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)	p.Y93C(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GCAGGCTCCATAAAGCTTTAC	0.358																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	88.0	90.0					6																	91278296		2203	4300	6503	91335017	SO:0001583	missense	6885			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.278A>G	6.37:g.91278296T>C	ENSP00000358335:p.Tyr93Cys	Unknown		x	x	x	91335017	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	37	CCDS5028.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	22.3	4.272315	0.80580	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.89	5.89	0.94794	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	M	0.92880	3.355	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.99;0.969;0.994;0.987	T	0.73534	-0.3952	10	0.62326	D	0.03	.	16.3158	0.82923	0.0:0.0:0.0:1.0	.	93;93;93;93	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	C	93	ENSP00000358338:Y93C;ENSP00000358335:Y93C;ENSP00000358331:Y93C;ENSP00000358333:Y93C	ENSP00000358331:Y93C	Y	-	2	0	MAP3K7	91335017	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.840000	0.86819	2.254000	0.74563	0.533000	0.62120	TAT		0.358	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331		Missense_Mutation
HIVEP2	3097	broad.mit.edu	37	6	143094147	143094147	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr6:143094147A>G	ENST00000367604.1	-	4	2368	c.1729T>C	c.(1729-1731)Ttc>Ctc	p.F577L	HIVEP2_ENST00000367603.2_Missense_Mutation_p.F577L|HIVEP2_ENST00000012134.2_Missense_Mutation_p.F577L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	577					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F577L(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CCTGGATAGAATACATCGTCG	0.502																																					Esophageal Squamous(107;843 1510 13293 16805 42198)											1	Substitution - Missense(1)	ovary(1)	6											88.0	87.0	87.0					6																	143094147		1944	4151	6095	143135840	SO:0001583	missense	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.1729T>C	6.37:g.143094147A>G	ENSP00000356576:p.Phe577Leu	Unknown		x	x	x	143135840	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	17.08	3.298019	0.60086	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.10860	2.83;2.83;2.83	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	M	0.80616	2.505	0.48975	D	0.999738	D	0.76494	0.999	D	0.63793	0.918	T	0.01940	-1.1243	10	0.35671	T	0.21	-9.7336	15.5682	0.76309	1.0:0.0:0.0:0.0	.	577	P31629	ZEP2_HUMAN	L	577	ENSP00000356576:F577L;ENSP00000356575:F577L;ENSP00000012134:F577L	ENSP00000012134:F577L	F	-	1	0	HIVEP2	143135840	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	8.962000	0.93254	2.075000	0.62263	0.533000	0.62120	TTC		0.502	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			Missense_Mutation
SAMD9	54809	broad.mit.edu	37	7	92733135	92733135	+	Missense_Mutation	SNP	C	C	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr7:92733135C>G	ENST00000379958.2	-	3	2545	c.2276G>C	c.(2275-2277)aGa>aCa	p.R759T		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	759						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.R759T(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CACAGCACATCTGAATTTCTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											178.0	169.0	172.0					7																	92733135		2203	4299	6502	92571071	SO:0001583	missense	54809			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2276G>C	7.37:g.92733135C>G	ENSP00000369292:p.Arg759Thr	Unknown		x	x	x	92571071	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.15	3.561025	0.65538	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.81163	-1.46;-1.46	4.44	4.44	0.53790	.	0.000000	0.64402	U	0.000002	D	0.89656	0.6778	M	0.80847	2.515	0.37150	D	0.902127	D	0.89917	1.0	D	0.83275	0.996	D	0.92863	0.6307	10	0.87932	D	0	.	15.7702	0.78162	0.0:1.0:0.0:0.0	.	759	Q5K651	SAMD9_HUMAN	T	759	ENSP00000369292:R759T;ENSP00000414529:R759T	ENSP00000369292:R759T	R	-	2	0	SAMD9	92571071	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.295000	0.78780	2.303000	0.77524	0.609000	0.83330	AGA		0.413	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		Missense_Mutation
PPP1R3A	5506	broad.mit.edu	37	7	113519848	113519848	+	Silent	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr7:113519848G>C	ENST00000284601.3	-	4	1367	c.1299C>G	c.(1297-1299)ggC>ggG	p.G433G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	433					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.G433G(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CTTCTTTGCTGCCAGTATGTA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	7											136.0	123.0	127.0					7																	113519848		2203	4299	6502	113307084	SO:0001819	synonymous_variant	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1299C>G	7.37:g.113519848G>C		Unknown		x	x	x	113307084	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	37	CCDS5759.1	SNP	46	Broad																																																																																				0.428	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		Silent
POT1	25913	broad.mit.edu	37	7	124510987	124510987	+	Missense_Mutation	SNP	A	A	G			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr7:124510987A>G	ENST00000357628.3	-	7	831	c.233T>C	c.(232-234)aTt>aCt	p.I78T	POT1_ENST00000393329.1_Intron	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	78					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)	p.I78T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						AAAGCGAACAATATCTCCATT	0.328																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)											1	Substitution - Missense(1)	ovary(1)	7											69.0	73.0	71.0					7																	124510987		2202	4297	6499	124298223	SO:0001583	missense	25913			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.233T>C	7.37:g.124510987A>G	ENSP00000350249:p.Ile78Thr	Unknown		x	x	x	124298223	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	CCDS5793.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	18.94	3.729503	0.69074	.	.	ENSG00000128513	ENST00000357628;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391;ENST00000446993	T	0.64438	-0.1	5.87	4.71	0.59529	Nucleic acid-binding, OB-fold-like (1);Telomere end binding protein (2);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.79458	0.4449	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82472	-0.0440	10	0.87932	D	0	-0.1295	11.2584	0.49067	0.9263:0.0:0.0737:0.0	.	78	Q9NUX5	POTE1_HUMAN	T	78;78;78;78;77;78	ENSP00000350249:I78T	ENSP00000265391:I77T	I	-	2	0	POT1	124298223	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.600000	0.67599	2.236000	0.73375	0.528000	0.53228	ATT		0.328	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			Missense_Mutation
ZBED6CL	113763	broad.mit.edu	37	7	150028097	150028097	+	Missense_Mutation	SNP	G	G	C			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr7:150028097G>C	ENST00000343855.4	+	1	1160	c.604G>C	c.(604-606)Gag>Cag	p.E202Q	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	202								p.E202Q(1)									GTATCTGTGGGAGAATGAGAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											41.0	43.0	42.0					7																	150028097		2203	4300	6503	149659030	SO:0001583	missense	113763			BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.604G>C	7.37:g.150028097G>C	ENSP00000343242:p.Glu202Gln	Unknown		x	x	x	149659030		Missense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753333	0.31046	.	.	ENSG00000188707	ENST00000343855	.	.	.	4.18	4.18	0.49190	.	0.168060	0.25762	U	0.028474	T	0.44685	0.1305	N	0.19112	0.55	0.23585	N	0.997359	D	0.61080	0.989	P	0.58928	0.848	T	0.38693	-0.9649	9	0.72032	D	0.01	.	14.4297	0.67240	0.0:0.0:1.0:0.0	.	202	Q96FA7	CG029_HUMAN	Q	202	.	ENSP00000343242:E202Q	E	+	1	0	C7orf29	149659030	0.926000	0.31397	0.088000	0.20740	0.036000	0.12997	2.453000	0.44970	2.057000	0.61298	0.558000	0.71614	GAG		0.592	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434		Missense_Mutation
NEFM	4741	broad.mit.edu	37	8	24773150	24773150	+	Silent	SNP	G	G	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr8:24773150G>A	ENST00000221166.5	+	2	1895	c.1113G>A	c.(1111-1113)cgG>cgA	p.R371R	NEFM_ENST00000518131.1_Silent_p.R371R|GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000433454.2_5'UTR|NEFM_ENST00000437366.2_Silent_p.R371R|NEFM_ENST00000521540.1_3'UTR			P07197	NFM_HUMAN	neurofilament, medium polypeptide	371	Coil 2B.|Rod.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)	p.R371R(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		ATGAGCTTCGGGGCACAAAGT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	8											149.0	135.0	140.0					8																	24773150		2203	4300	6503	24829055	SO:0001819	synonymous_variant	4741			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1113G>A	8.37:g.24773150G>A		Unknown		x	x	x	24829055	B4DGN2|E9PBF7|Q4QRK6	Silent	SNP	ENST00000221166.5	37	CCDS6046.1	SNP	43	Broad																																																																																				0.502	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382		Silent
PIGO	84720	broad.mit.edu	37	9	35091650	35091650	+	Missense_Mutation	SNP	C	C	T	rs371317684		TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr9:35091650C>T	ENST00000378617.3	-	7	2628	c.2234G>A	c.(2233-2235)cGg>cAg	p.R745Q	PIGO_ENST00000361778.2_Intron|PIGO_ENST00000298004.5_Intron|PIGO_ENST00000341666.3_Missense_Mutation_p.R745Q	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	745					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.R745Q(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGCTACAGCCCGAGGCAGCAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	9						C	,GLN/ARG,	0,4390		0,0,2195	32.0	37.0	35.0		,2234,	5.4	1.0	9		35	1,8561		0,1,4280	no	intron,missense,intron	PIGO	NM_001201484.1,NM_032634.3,NM_152850.3	,43,	0,1,6475	TT,TC,CC		0.0117,0.0,0.0077	,probably-damaging,	,745/1090,	35091650	1,12951	2195	4281	6476	35081650	SO:0001583	missense	84720			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2234G>A	9.37:g.35091650C>T	ENSP00000367880:p.Arg745Gln	Unknown		x	x	x	35081650	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	ENST00000378617.3	37	CCDS6575.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127414	0.56721	0.0	1.17E-4	ENSG00000165282	ENST00000378617;ENST00000341666	T;T	0.55930	0.49;0.49	5.44	5.44	0.79542	.	0.214676	0.38005	N	0.001856	T	0.60274	0.2256	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	P	0.61874	0.895	T	0.60632	-0.7225	10	0.51188	T	0.08	-18.4883	19.4628	0.94924	0.0:1.0:0.0:0.0	.	745	Q8TEQ8	PIGO_HUMAN	Q	745	ENSP00000367880:R745Q;ENSP00000339382:R745Q	ENSP00000339382:R745Q	R	-	2	0	PIGO	35081650	0.997000	0.39634	1.000000	0.80357	0.326000	0.28443	3.926000	0.56491	2.837000	0.97791	0.655000	0.94253	CGG		0.667	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634		Missense_Mutation
ABCA1	19	broad.mit.edu	37	9	107591257	107591257	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr9:107591257C>T	ENST00000374736.3	-	15	2449	c.2055G>A	c.(2053-2055)tgG>tgA	p.W685*	ABCA1_ENST00000494467.1_5'UTR	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	685					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.W685*(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	TACTAATGAACCAGCTAAACC	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	9											134.0	105.0	115.0					9																	107591257		2203	4300	6503	106631078	SO:0001587	stop_gained	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2055G>A	9.37:g.107591257C>T	ENSP00000363868:p.Trp685*	Unknown		x	x	x	106631078	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Nonsense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	45	11.441095	0.99561	.	.	ENSG00000165029	ENST00000374736	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	.	.	.	X	685	.	ENSP00000363868:W685X	W	-	3	0	ABCA1	106631078	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	TGG		0.542	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		Nonsense_Mutation
SPIN2A	54466	broad.mit.edu	37	X	57162278	57162278	+	Silent	SNP	G	G	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chrX:57162278G>A	ENST00000374908.1	-	1	1152	c.753C>T	c.(751-753)gtC>gtT	p.V251V	SPIN2A_ENST00000374906.3_Silent_p.V251V			Q99865	SPI2A_HUMAN	spindlin family, member 2A	251					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)		p.V251V(1)		breast(1)|kidney(1)|ovary(1)	3						CCAAATCGTAGACATAGATAT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	X											47.0	43.0	44.0					X																	57162278		2201	4292	6493	57179003	SO:0001819	synonymous_variant	54466			Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.753C>T	X.37:g.57162278G>A		Unknown		x	x	x	57179003	O75650|Q6IPW2|Q9UJJ0	Silent	SNP	ENST00000374908.1	37	CCDS35312.1	SNP	33	Broad																																																																																				0.373	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058915.1	NM_019003		Silent
AWAT2	158835	broad.mit.edu	37	X	69262168	69262168	+	Missense_Mutation	SNP	C	C	A			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chrX:69262168C>A	ENST00000276101.3	-	6	721	c.716G>T	c.(715-717)gGt>gTt	p.G239V		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	239					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)	p.G239V(1)		endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						GACAAAGCCACCAGGAGTGAA	0.512																																					NSCLC(80;1334 1436 9350 24214 26427)											1	Substitution - Missense(1)	ovary(1)	X											110.0	89.0	96.0					X																	69262168		2203	4300	6503	69178893	SO:0001583	missense	158835			BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.716G>T	X.37:g.69262168C>A	ENSP00000421172:p.Gly239Val	Unknown		x	x	x	69178893	Q6IEE3|Q6P437	Missense_Mutation	SNP	ENST00000276101.3	37	CCDS35320.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414514	0.42817	.	.	ENSG00000147160	ENST00000276101	T	0.19532	2.14	5.04	3.19	0.36642	.	0.256724	0.34133	N	0.004239	T	0.51584	0.1683	H	0.94771	3.58	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	T	0.51725	-0.8669	10	0.87932	D	0	.	5.7088	0.17923	0.0:0.63:0.0:0.37	.	239	Q6E213	AWAT2_HUMAN	V	239	ENSP00000421172:G239V	ENSP00000421172:G239V	G	-	2	0	AWAT2	69178893	0.986000	0.35501	0.012000	0.15200	0.483000	0.33249	3.002000	0.49496	0.464000	0.27142	0.600000	0.82982	GGT		0.512	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358738.1	NM_001002254		Missense_Mutation
KPNA3	3839	broad.mit.edu	37	13	50283736	50283740	+	Frame_Shift_Del	DEL	AAGAG	AAGAG	-			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr13:50283736_50283740delAAGAG	ENST00000261667.3	-	12	1414_1418	c.1000_1004delCTCTT	c.(1000-1005)ctcttafs	p.LL334fs		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	334	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)	p.L334fs*9(1)|p.L334F(1)		cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		TGGGTGTGATAAGAGATTTGGGAAG	0.42																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|endometrium(1)	13																																								49181741	SO:0001589	frameshift_variant	3839			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.1000_1004delCTCTT	13.37:g.50283736_50283740delAAGAG	ENSP00000261667:p.Leu334fs	Unknown		Capture	Illumina GAIIx	Phase_I	49181737	O00191|O43195|Q5JVM9|Q96AA7	Frame_Shift_Del	DEL	ENST00000261667.3	37	CCDS9421.1	DEL	13	Broad																																																																																				0.420	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044939.2	NM_002267		Frame_Shift_Del
ALOX12	239	broad.mit.edu	37	17	6913409	6913418	+	Frame_Shift_Del	DEL	CATCTCATGG	CATCTCATGG	-			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr17:6913409_6913418delCATCTCATGG	ENST00000251535.6	+	13	1829_1838	c.1776_1785delCATCTCATGG	c.(1774-1785)gccatctcatggfs	p.AISW592fs	RNASEK_ENST00000548577.1_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000399540.2_Intron|AC027763.2_ENST00000573939.1_Intron|AC027763.2_ENST00000574377.1_Start_Codon_Del|RNASEK_ENST00000402093.1_5'Flank	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	592	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.S594fs*1(1)|p.W595R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						TTCAAATGGCCATCTCATGGCATCTGAGTC	0.581																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	17																																								6854142	SO:0001589	frameshift_variant	239			M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1776_1785delCATCTCATGG	17.37:g.6913409_6913418delCATCTCATGG	ENSP00000251535:p.Ala592fs	Unknown		Capture	Illumina GAIIx	Phase_I	6854133	O95569|Q6ISF8|Q9UQM4	Frame_Shift_Del	DEL	ENST00000251535.6	37	CCDS11084.1	DEL	21	Broad																																																																																				0.581	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2			Frame_Shift_Del
TP53	7157	broad.mit.edu	37	17	7577019	7577020	+	Splice_Site	DEL	CT	CT	-			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr17:7577019_7577020delCT	ENST00000269305.4	-	8	1107_1108	c.918_919delAG	c.(916-921)cgagca>cgca	p.A307fs	TP53_ENST00000359597.4_Splice_Site_p.A307fs|TP53_ENST00000420246.2_Splice_Site_p.A307fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Splice_Site_p.A307fs|TP53_ENST00000455263.2_Splice_Site_p.A307fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	307	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		A -> P (in a sporadic cancer; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.A307fs*38(4)|p.?(3)|p.A307T(2)|p.A307fs*29(2)|p.R306R(2)|p.A307fs*34(1)|p.A307fs*63(1)|p.A307S(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTTGCTTACCTCGCTTAGTGC	0.564		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	25	Whole gene deletion(8)|Deletion - Frameshift(8)|Unknown(3)|Substitution - Missense(3)|Substitution - coding silent(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(3)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|ovary(2)|large_intestine(1)|stomach(1)|urinary_tract(1)|liver(1)|skin(1)	17																																								7517745	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1AG>-	17.37:g.7577019_7577020delCT		Unknown		Capture	Illumina GAIIx	Phase_I	7517744	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	24	Broad																																																																																				0.564	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Frame_Shift_Del	Frame_Shift_Del
ZNF708	7562	broad.mit.edu	37	19	21476562	21476562	+	Frame_Shift_Del	DEL	G	G	-			TCGA-61-2109-01	TCGA-61-2109-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-61-2109-01	TCGA-61-2109-11	g.chr19:21476562delG	ENST00000356929.3	-	4	1403	c.1206delC	c.(1204-1206)accfs	p.T402fs		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K403fs*10(1)		breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						TTGAGGACTTGGTAAAGGCTT	0.368																																																1	Deletion - Frameshift(1)	ovary(1)	19											61.0	66.0	64.0					19																	21476562		2201	4296	6497	21268402	SO:0001589	frameshift_variant	7562			X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.1206delC	19.37:g.21476562delG	ENSP00000349401:p.Thr402fs	Unknown		Capture	Illumina GAIIx	Phase_I	21268402	Q6ZMR0	Frame_Shift_Del	DEL	ENST00000356929.3	37	CCDS32980.1	DEL	47	Broad																																																																																				0.368	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463953.1	NM_021269		Frame_Shift_Del
