#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRRC41	10489	broad.mit.edu	37	1	46751997	46751997	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:46751997C>T	ENST00000343304.6	-	4	817	c.532G>A	c.(532-534)Gag>Aag	p.E178K	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	178					protein ubiquitination (GO:0016567)	membrane (GO:0016020)		p.E178K(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCCACCAGCTCGGTTGCACCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											57.0	60.0	59.0					1																	46751997		2203	4300	6503	46524584	SO:0001583	missense	10489			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.532G>A	1.37:g.46751997C>T	ENSP00000343298:p.Glu178Lys	Somatic		Capture	Illumina GAIIx	Phase_I	46524584	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	CCDS533.1	.	.	.	.	.	.	.	.	.	.	c	28.5	4.926338	0.92319	.	.	ENSG00000132128	ENST00000343304;ENST00000371972;ENST00000254454	D	0.86432	-2.12	5.08	5.08	0.68730	.	0.151564	0.45126	D	0.000386	D	0.89849	0.6834	L	0.27053	0.805	0.42862	D	0.994113	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.987;0.996;0.987	D	0.91695	0.5369	10	0.87932	D	0	-20.5144	18.583	0.91178	0.0:1.0:0.0:0.0	.	178;156;178	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	K	178;156;7	ENSP00000343298:E178K	ENSP00000254454:E7K	E	-	1	0	LRRC41	46524584	0.998000	0.40836	0.999000	0.59377	0.987000	0.75469	4.986000	0.63851	2.389000	0.81357	0.430000	0.28490	GAG		0.592	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369	
ERICH3	127254	broad.mit.edu	37	1	75055494	75055494	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:75055494T>G	ENST00000326665.5	-	12	2215	c.1997A>C	c.(1996-1998)gAg>gCg	p.E666A	C1orf173_ENST00000420661.2_Missense_Mutation_p.E469A|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		666	Glu-rich.							p.E666A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AAGAACATTCTCAAAGCTTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											147.0	147.0	147.0					1																	75055494		2203	4300	6503	74828082	SO:0001583	missense	127254																														ENST00000326665.5:c.1997A>C	1.37:g.75055494T>G	ENSP00000322609:p.Glu666Ala	Somatic		Capture	Illumina GAIIx	Phase_I	74828082	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	T	12.41	1.929978	0.34096	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.18338	2.68;2.22	5.35	-3.08	0.05347	.	.	.	.	.	T	0.04497	0.0123	L	0.48642	1.525	0.09310	N	1	B;P	0.46859	0.4;0.885	B;P	0.45753	0.121;0.492	T	0.20638	-1.0269	9	0.19590	T	0.45	-0.3347	1.22	0.01922	0.1272:0.246:0.2608:0.366	.	469;666	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	A	666;469	ENSP00000322609:E666A;ENSP00000398581:E469A	ENSP00000322609:E666A	E	-	2	0	C1orf173	74828082	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.797000	0.04570	-0.200000	0.10300	0.472000	0.43445	GAG		0.408	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
SSX2IP	117178	broad.mit.edu	37	1	85128152	85128152	+	Silent	SNP	A	A	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:85128152A>G	ENST00000342203.3	-	7	998	c.735T>C	c.(733-735)ggT>ggC	p.G245G	SSX2IP_ENST00000605755.1_Silent_p.G218G|SSX2IP_ENST00000437941.2_Silent_p.G218G|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000370612.4_Silent_p.G245G	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	245					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.G245G(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CTTCAGTTTTACCAGTCCTCC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	105.0	103.0					1																	85128152		2203	4300	6503	84900740	SO:0001819	synonymous_variant	117178				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.735T>C	1.37:g.85128152A>G		Somatic		Capture	Illumina GAIIx	Phase_I	84900740	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Silent	SNP	ENST00000342203.3	37	CCDS699.1																																																																																				0.363	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
NTNG1	22854	broad.mit.edu	37	1	107866918	107866918	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:107866918G>A	ENST00000370068.1	+	3	1107	c.261G>A	c.(259-261)atG>atA	p.M87I	NTNG1_ENST00000370065.1_Missense_Mutation_p.M87I|NTNG1_ENST00000370067.1_Missense_Mutation_p.M87I|NTNG1_ENST00000370074.4_Missense_Mutation_p.M87I|NTNG1_ENST00000370070.2_Missense_Mutation_p.M87I|NTNG1_ENST00000370071.2_Missense_Mutation_p.M87I|NTNG1_ENST00000542803.1_Missense_Mutation_p.M87I|NTNG1_ENST00000370072.3_Missense_Mutation_p.M87I|NTNG1_ENST00000370066.1_Missense_Mutation_p.M87I|NTNG1_ENST00000370061.3_Missense_Mutation_p.M87I|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370073.2_Missense_Mutation_p.M87I			Q9Y2I2	NTNG1_HUMAN	netrin G1	87	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.|NGL discriminant loop I.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.M87I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		ATCCCTACATGTGCAATAATG	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											256.0	260.0	259.0					1																	107866918		2203	4300	6503	107668441	SO:0001583	missense	22854			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.261G>A	1.37:g.107866918G>A	ENSP00000359085:p.Met87Ile	Somatic		Capture	Illumina GAIIx	Phase_I	107668441	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.821003	0.71028	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.68	5.68	0.88126	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.78786	0.4338	L	0.40543	1.245	0.58432	D	0.999999	D;D;B;P;P	0.71674	0.982;0.998;0.294;0.929;0.455	D;D;P;D;B	0.83275	0.989;0.996;0.522;0.946;0.342	T	0.76130	-0.3072	10	0.38643	T	0.18	.	19.7998	0.96502	0.0:0.0:1.0:0.0	.	87;87;87;87;87	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	I	87	ENSP00000359090:M87I;ENSP00000359088:M87I;ENSP00000440561:M87I;ENSP00000359078:M87I;ENSP00000359089:M87I;ENSP00000359087:M87I;ENSP00000359091:M87I;ENSP00000359085:M87I;ENSP00000359084:M87I;ENSP00000359083:M87I;ENSP00000359082:M87I	ENSP00000294649:M87I	M	+	3	0	NTNG1	107668441	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.876000	0.87215	2.683000	0.91414	0.655000	0.94253	ATG		0.478	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
PGLYRP3	114771	broad.mit.edu	37	1	153274927	153274927	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:153274927G>T	ENST00000290722.1	-	5	738	c.686C>A	c.(685-687)tCc>tAc	p.S229Y		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	229					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.S229Y(1)|p.S229F(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATGTGAAAGGACTGTATGTT	0.458																																																2	Substitution - Missense(2)	ovary(1)|pancreas(1)	1											281.0	257.0	265.0					1																	153274927		2203	4300	6503	151541551	SO:0001583	missense	114771			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.686C>A	1.37:g.153274927G>T	ENSP00000290722:p.Ser229Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	151541551	A1A4U8|Q5SY65	Missense_Mutation	SNP	ENST00000290722.1	37	CCDS1035.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586553	0.46110	.	.	ENSG00000159527	ENST00000290722	T	0.18502	2.21	4.3	4.3	0.51218	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.230345	0.31071	N	0.008319	T	0.26557	0.0649	M	0.74647	2.275	0.35602	D	0.807928	D	0.63046	0.992	P	0.60949	0.881	T	0.05533	-1.0879	10	0.59425	D	0.04	-22.8123	12.1343	0.53961	0.0:0.0:1.0:0.0	.	229	Q96LB9	PGRP3_HUMAN	Y	229	ENSP00000290722:S229Y	ENSP00000290722:S229Y	S	-	2	0	PGLYRP3	151541551	0.989000	0.36119	0.858000	0.33744	0.824000	0.46624	2.670000	0.46833	2.230000	0.72887	0.655000	0.94253	TCC		0.458	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891	
FBXO28	23219	broad.mit.edu	37	1	224321795	224321795	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:224321795A>T	ENST00000366862.5	+	3	440	c.397A>T	c.(397-399)Aac>Tac	p.N133Y	FBXO28_ENST00000424254.2_Missense_Mutation_p.N133Y	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	133								p.N133Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		AGAAAGGAGAAACCATTCATT	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	57.0	60.0					1																	224321795		2203	4299	6502	222388418	SO:0001583	missense	23219			AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.397A>T	1.37:g.224321795A>T	ENSP00000355827:p.Asn133Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	222388418	E9PEM8|O75070	Missense_Mutation	SNP	ENST00000366862.5	37	CCDS1539.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.491949	0.84962	.	.	ENSG00000143756	ENST00000366862;ENST00000424254	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.99	T	0.78723	-0.2093	9	0.54805	T	0.06	-15.8636	14.9872	0.71356	1.0:0.0:0.0:0.0	.	133;133	E9PEM8;Q9NVF7	.;FBX28_HUMAN	Y	133	.	ENSP00000355827:N133Y	N	+	1	0	FBXO28	222388418	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.953000	0.93041	2.120000	0.65058	0.455000	0.32223	AAC		0.343	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176	
OR2M2	391194	broad.mit.edu	37	1	248343719	248343719	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr1:248343719G>A	ENST00000359682.2	+	1	432	c.432G>A	c.(430-432)atG>atA	p.M144I		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M144I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTGGACTTATGGCTACCTTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											202.0	210.0	207.0					1																	248343719		2203	4300	6503	246410342	SO:0001583	missense	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.432G>A	1.37:g.248343719G>A	ENSP00000352710:p.Met144Ile	Somatic		Capture	Illumina GAIIx	Phase_I	246410342	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	g	2.782	-0.253388	0.05829	.	.	ENSG00000198601	ENST00000359682	T	0.35605	1.3	1.7	-1.97	0.07503	GPCR, rhodopsin-like superfamily (1);	0.466003	0.15537	U	0.257149	T	0.25717	0.0626	L	0.41961	1.31	0.09310	N	1	B	0.24092	0.097	B	0.27887	0.084	T	0.21143	-1.0254	10	0.31617	T	0.26	.	7.5709	0.27907	0.3628:0.0:0.6372:0.0	.	144	Q96R28	OR2M2_HUMAN	I	144	ENSP00000352710:M144I	ENSP00000352710:M144I	M	+	3	0	OR2M2	246410342	0.019000	0.18553	0.000000	0.03702	0.001000	0.01503	0.076000	0.14712	-0.392000	0.07751	-0.396000	0.06452	ATG		0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
MKX	283078	broad.mit.edu	37	10	28023684	28023684	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr10:28023684C>A	ENST00000375790.5	-	5	971	c.539G>T	c.(538-540)gGg>gTg	p.G180V	MKX_ENST00000419761.1_Missense_Mutation_p.G180V			Q8IYA7	MKX_HUMAN	mohawk homeobox	180					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G180V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						ATTATAGCCCCCTTCGTTCAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	10											121.0	121.0	121.0					10																	28023684		2203	4300	6503	28063690	SO:0001583	missense	283078			BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.539G>T	10.37:g.28023684C>A	ENSP00000364946:p.Gly180Val	Somatic		Capture	Illumina GAIIx	Phase_I	28063690	B3KWM5	Missense_Mutation	SNP	ENST00000375790.5	37	CCDS7156.1	.	.	.	.	.	.	.	.	.	.	C	8.413	0.844714	0.16963	.	.	ENSG00000150051	ENST00000375790;ENST00000419761	T;T	0.64438	-0.1;-0.1	5.71	1.38	0.22167	.	0.589336	0.19010	N	0.125099	T	0.43411	0.1246	N	0.22421	0.69	0.39722	D	0.971483	B	0.09022	0.002	B	0.08055	0.003	T	0.28427	-1.0044	10	0.52906	T	0.07	-11.4336	7.4191	0.27061	0.0:0.5947:0.1224:0.2829	.	180	Q8IYA7	MKX_HUMAN	V	180	ENSP00000364946:G180V;ENSP00000400896:G180V	ENSP00000364946:G180V	G	-	2	0	MKX	28063690	0.016000	0.18221	0.219000	0.23793	0.723000	0.41478	0.067000	0.14510	0.337000	0.23665	0.558000	0.71614	GGG		0.493	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047332.3	NM_173576	
LZTS2	84445	broad.mit.edu	37	10	102763427	102763427	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr10:102763427C>G	ENST00000370220.1	+	2	3635	c.572C>G	c.(571-573)tCc>tGc	p.S191C	LZTS2_ENST00000370223.3_Missense_Mutation_p.S191C					leucine zipper, putative tumor suppressor 2									p.S191C(1)|p.S54C(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		tcctcctcctcctcttcctcc	0.647																																					Esophageal Squamous(8;38 437 13604 19902 37640)											2	Substitution - Missense(2)	ovary(2)	10											97.0	115.0	109.0					10																	102763427		2203	4299	6502	102753417	SO:0001583	missense	84445			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.572C>G	10.37:g.102763427C>G	ENSP00000359240:p.Ser191Cys	Somatic		Capture	Illumina GAIIx	Phase_I	102753417		Missense_Mutation	SNP	ENST00000370220.1	37	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635554	0.67130	.	.	ENSG00000107816	ENST00000426584;ENST00000370223;ENST00000429732;ENST00000315797;ENST00000370220;ENST00000454422	T;T	0.33865	1.39;1.39	5.12	5.12	0.69794	.	0.536231	0.21286	N	0.077066	T	0.31389	0.0795	N	0.08118	0	0.33103	D	0.539512	D	0.69078	0.997	P	0.52881	0.712	T	0.46569	-0.9182	10	0.62326	D	0.03	-15.161	14.4181	0.67165	0.0:1.0:0.0:0.0	.	191	Q9BRK4	LZTS2_HUMAN	C	191	ENSP00000359243:S191C;ENSP00000359240:S191C	ENSP00000314437:S191C	S	+	2	0	LZTS2	102753417	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	4.225000	0.58600	2.539000	0.85634	0.561000	0.74099	TCC		0.647	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
C11orf30	56946	broad.mit.edu	37	11	76207393	76207393	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr11:76207393G>C	ENST00000529032.1	+	8	1243	c.1243G>C	c.(1243-1245)Gtg>Ctg	p.V415L	C11orf30_ENST00000525038.1_Missense_Mutation_p.V430L|C11orf30_ENST00000343878.3_Missense_Mutation_p.V415L|C11orf30_ENST00000533248.1_Missense_Mutation_p.V429L|C11orf30_ENST00000525919.1_Missense_Mutation_p.V416L|C11orf30_ENST00000334736.3_Missense_Mutation_p.V415L|C11orf30_ENST00000524490.1_Intron|C11orf30_ENST00000524767.1_Missense_Mutation_p.V430L			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	415	Gln-rich.|Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V415L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						GTTATATCAAGTGCAACAGCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											152.0	133.0	139.0					11																	76207393		2200	4292	6492	75885041	SO:0001583	missense	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1243G>C	11.37:g.76207393G>C	ENSP00000432327:p.Val415Leu	Somatic		Capture	Illumina GAIIx	Phase_I	75885041	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851537	0.51270	.	.	ENSG00000158636	ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	.	.	.	5.82	4.89	0.63831	.	0.323261	0.30134	N	0.010324	T	0.17195	0.0413	N	0.08118	0	0.25616	N	0.986448	B;B;B;B;B;B;B	0.20261	0.005;0.003;0.005;0.012;0.043;0.007;0.007	B;B;B;B;B;B;B	0.20955	0.002;0.002;0.002;0.008;0.032;0.003;0.003	T	0.13872	-1.0493	9	0.26408	T	0.33	-4.7892	6.2074	0.20610	0.1772:0.0:0.6736:0.1492	.	429;430;430;415;365;416;415	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;Q7Z589	.;.;.;.;.;.;EMSY_HUMAN	L	415;415;365;430;429;416;430;415	.	ENSP00000334130:V415L	V	+	1	0	C11orf30	75885041	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	1.840000	0.39230	1.424000	0.47217	0.563000	0.77884	GTG		0.483	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	
GRAMD1B	57476	broad.mit.edu	37	11	123480517	123480517	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr11:123480517C>T	ENST00000529750.1	+	12	1570	c.1243C>T	c.(1243-1245)Cca>Tca	p.P415S	GRAMD1B_ENST00000450171.2_Missense_Mutation_p.P106S|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.P422S|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.P415S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	415						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P415S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CATCTTCCATCCATGGAAAAA	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											47.0	50.0	49.0					11																	123480517		1905	4126	6031	122985727	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1243C>T	11.37:g.123480517C>T	ENSP00000436500:p.Pro415Ser	Somatic		Capture	Illumina GAIIx	Phase_I	122985727	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.899462	0.91962	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764;ENST00000450171	T;T;T;T;T;T	0.50813	1.62;1.63;1.63;1.64;1.31;0.73	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	M	0.72353	2.195	0.80722	D	1	P;D;D;D;D	0.89917	0.768;0.985;1.0;0.999;0.974	B;P;D;P;P	0.87578	0.325;0.828;0.998;0.895;0.677	T	0.63373	-0.6652	10	0.28530	T	0.3	.	19.8471	0.96713	0.0:1.0:0.0:0.0	.	375;422;106;415;422	B7Z4N9;F5H572;Q3KR37-3;Q3KR37;E7EPH8	.;.;.;GRM1B_HUMAN;.	S	422;422;415;415;375;411;106	ENSP00000402457:P422S;ENSP00000325628:P415S;ENSP00000436500:P415S;ENSP00000432987:P375S;ENSP00000434214:P411S;ENSP00000388458:P106S	ENSP00000325628:P415S	P	+	1	0	GRAMD1B	122985727	1.000000	0.71417	0.412000	0.26496	0.945000	0.59286	7.765000	0.85310	2.688000	0.91661	0.655000	0.94253	CCA		0.527	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
FEZ1	9638	broad.mit.edu	37	11	125359623	125359623	+	Silent	SNP	G	G	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr11:125359623G>C	ENST00000278919.3	-	2	285	c.51C>G	c.(49-51)ccC>ccG	p.P17P	FEZ1_ENST00000524435.1_Silent_p.P17P|FEZ1_ENST00000366139.3_Silent_p.P17P	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	17					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.P17P(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CCGAGCAGGAGGGTCGAAGGT	0.527																																					Melanoma(180;509 2033 10762 15939 24711)											1	Substitution - coding silent(1)	ovary(1)	11											68.0	72.0	71.0					11																	125359623		2201	4299	6500	124864833	SO:0001819	synonymous_variant	9638			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.51C>G	11.37:g.125359623G>C		Somatic		Capture	Illumina GAIIx	Phase_I	124864833	O00679|O00728|Q6IBI7	Silent	SNP	ENST00000278919.3	37	CCDS31716.1																																																																																				0.527	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1	NM_005103	
CAPRIN2	65981	broad.mit.edu	37	12	30906458	30906458	+	Silent	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr12:30906458C>T	ENST00000395805.2	-	1	787	c.240G>A	c.(238-240)ggG>ggA	p.G80G	RP11-77I22.2_ENST00000500076.2_lincRNA|CAPRIN2_ENST00000298892.5_Silent_p.G80G|CAPRIN2_ENST00000251071.5_Silent_p.G80G|CAPRIN2_ENST00000417045.1_Silent_p.G80G|CAPRIN2_ENST00000308433.5_5'UTR	NM_001206856.1	NP_001193785.1			caprin family member 2									p.G80G(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ACTTCATATTCCCCTCTCTTT	0.537											OREG0021723	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	12											162.0	155.0	157.0					12																	30906458		2203	4300	6503	30797725	SO:0001819	synonymous_variant	65981			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.240G>A	12.37:g.30906458C>T		Somatic	820	Capture	Illumina GAIIx	Phase_I	30797725		Silent	SNP	ENST00000395805.2	37	CCDS55816.1																																																																																				0.537	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
KRT6A	3853	broad.mit.edu	37	12	52884933	52884933	+	Missense_Mutation	SNP	C	C	T	rs376821206		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr12:52884933C>T	ENST00000330722.6	-	3	847	c.779G>A	c.(778-780)cGc>cAc	p.R260H		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	260	Coil 1B.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.R260H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCTGCTGTGCGCTTGTTGAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	12						C	HIS/ARG	0,4404		0,0,2202	72.0	67.0	69.0		779	5.1	1.0	12		69	1,8561	1.2+/-3.3	0,1,4280	no	missense	KRT6A	NM_005554.3	29	0,1,6482	TT,TC,CC		0.0117,0.0,0.0077	possibly-damaging	260/565	52884933	1,12965	2202	4281	6483	51171200	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.779G>A	12.37:g.52884933C>T	ENSP00000369317:p.Arg260His	Somatic		Capture	Illumina GAIIx	Phase_I	51171200	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	c	27.0	4.794489	0.90453	0.0	1.17E-4	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.89939	-2.59	5.14	5.14	0.70334	Filament (1);	0.000000	0.56097	D	0.000022	D	0.92466	0.7608	M	0.87547	2.89	0.50632	D	0.999882	P	0.51653	0.947	P	0.48982	0.597	D	0.93679	0.6997	10	0.66056	D	0.02	.	16.0286	0.80560	0.0:0.8657:0.1343:0.0	.	260	P02538	K2C6A_HUMAN	H	260;216	ENSP00000369317:R260H	ENSP00000369317:R260H	R	-	2	0	KRT6A	51171200	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.937000	0.70162	2.550000	0.86006	0.555000	0.69702	CGC		0.458	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
CSAD	51380	broad.mit.edu	37	12	53553935	53553935	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr12:53553935G>A	ENST00000444623.1	-	14	1402	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	CSAD_ENST00000379843.3_Missense_Mutation_p.R232W|CSAD_ENST00000453446.2_Missense_Mutation_p.R379W|CSAD_ENST00000379846.1_Missense_Mutation_p.R232W|CSAD_ENST00000267085.4_Missense_Mutation_p.R406W|RP11-1136G11.8_ENST00000550908.1_lincRNA	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	379					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)	p.R379W(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	TCGATGCGCCGCTCCAGCCCT	0.657											OREG0021859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(109;252 1546 16882 28524 44645)											1	Substitution - Missense(1)	ovary(1)	12											96.0	85.0	89.0					12																	53553935		2203	4300	6503	51840202	SO:0001583	missense	51380			AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1135C>T	12.37:g.53553935G>A	ENSP00000415485:p.Arg379Trp	Somatic	993	Capture	Illumina GAIIx	Phase_I	51840202	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	37	CCDS58235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.833|9.833	1.189033|1.189033	0.21954|0.21954	.|.	.|.	ENSG00000139631|ENSG00000139631	ENST00000379850|ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446	.|T;T;T;T;T	.|0.39997	.|1.05;1.05;1.05;1.05;1.05	4.67|4.67	3.77|3.77	0.43336|0.43336	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|1.166190	.|0.06061	.|N	.|0.658452	T|T	0.41766|0.41766	0.1173|0.1173	L|L	0.58583|0.58583	1.82|1.82	0.48087|0.48087	D|D	0.999582|0.999582	.|B;B;B	.|0.23540	.|0.005;0.002;0.087	.|B;B;B	.|0.17979	.|0.002;0.002;0.02	T|T	0.37337|0.37337	-0.9710|-0.9710	5|10	.|0.66056	.|D	.|0.02	-1.8474|-1.8474	7.6902|7.6902	0.28563|0.28563	0.0862:0.0:0.7527:0.1611|0.0862:0.0:0.7527:0.1611	.|.	.|406;379;232	.|Q9Y600-3;Q9Y600;Q9Y600-2	.|.;CSAD_HUMAN;.	V|W	404|468;232;406;232;379;340;379	.|ENSP00000369172:R232W;ENSP00000267085:R406W;ENSP00000369175:R232W;ENSP00000415485:R379W;ENSP00000410648:R379W	.|ENSP00000267085:R406W	A|R	-|-	2|1	0|2	CSAD|CSAD	51840202|51840202	0.203000|0.203000	0.23435|0.23435	0.832000|0.832000	0.32986|0.32986	0.097000|0.097000	0.18754|0.18754	1.102000|1.102000	0.31050|0.31050	1.305000|1.305000	0.44909|0.44909	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.657	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
DDIT3	1649	broad.mit.edu	37	12	57911116	57911116	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr12:57911116A>C	ENST00000346473.3	-	3	253	c.74T>G	c.(73-75)cTg>cGg	p.L25R	MIR616_ENST00000385293.1_RNA|DDIT3_ENST00000551116.1_Missense_Mutation_p.L48R|DDIT3_ENST00000552740.1_Missense_Mutation_p.L48R|DDIT3_ENST00000547303.1_Missense_Mutation_p.L25R	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	25	N-terminal.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.L25R(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						GACCTCTTGCAGGTCCTCATA	0.498			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	1	Substitution - Missense(1)	ovary(1)	12											65.0	59.0	61.0					12																	57911116		2203	4300	6503	56197383	SO:0001583	missense	1649			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.74T>G	12.37:g.57911116A>C	ENSP00000340671:p.Leu25Arg	Somatic		Capture	Illumina GAIIx	Phase_I	56197383	F8VS99	Missense_Mutation	SNP	ENST00000346473.3	37	CCDS8943.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.288084	0.80803	.	.	ENSG00000175197	ENST00000547303;ENST00000551116;ENST00000346473;ENST00000552740;ENST00000547526	T;T;T;T	0.70045	-0.36;-0.45;-0.36;-0.45	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000002	T	0.74215	0.3687	L	0.36672	1.1	0.52099	D	0.999945	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.77159	-0.2690	10	0.87932	D	0	-2.6048	14.1539	0.65405	1.0:0.0:0.0:0.0	.	48;25	F8VS99;P35638	.;DDIT3_HUMAN	R	25;48;25;48;48	ENSP00000447188:L25R;ENSP00000448665:L48R;ENSP00000340671:L25R;ENSP00000447803:L48R	ENSP00000340671:L25R	L	-	2	0	DDIT3	56197383	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.141000	0.89618	2.240000	0.73641	0.533000	0.62120	CTG		0.498	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083	
C12orf49	79794	broad.mit.edu	37	12	117158152	117158152	+	Silent	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr12:117158152G>A	ENST00000261318.3	-	3	529	c.369C>T	c.(367-369)ggC>ggT	p.G123G	C12orf49_ENST00000548356.1_5'Flank|C12orf49_ENST00000536380.1_Silent_p.G93G	NM_024738.1	NP_079014.1	Q9H741	CL049_HUMAN	chromosome 12 open reading frame 49	123	Cys-rich.					extracellular region (GO:0005576)		p.G123G(1)		endometrium(1)|lung(1)|ovary(1)|skin(1)	4	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0281)		CGCTGCAGCAGCCGTTGGGCC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	12											102.0	89.0	94.0					12																	117158152		2203	4300	6503	115642535	SO:0001819	synonymous_variant	79794			AK025068	CCDS9179.1	12q24.22	2012-05-30			ENSG00000111412	ENSG00000111412			26128	protein-coding gene	gene with protein product						12477932	Standard	NM_024738		Approved	FLJ21415	uc001tvz.1	Q9H741	OTTHUMG00000169392	ENST00000261318.3:c.369C>T	12.37:g.117158152G>A		Somatic		Capture	Illumina GAIIx	Phase_I	115642535	Q53GE8	Silent	SNP	ENST00000261318.3	37	CCDS9179.1																																																																																				0.552	C12orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403847.1	NM_024738	
BRCA2	675	broad.mit.edu	37	13	32910625	32910625	+	Nonsense_Mutation	SNP	C	C	A	rs535547513	byFrequency	TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr13:32910625C>A	ENST00000380152.3	+	11	2366	c.2133C>A	c.(2131-2133)tgC>tgA	p.C711*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.C711*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	711	Interaction with NPM1.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.C711*(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CTCTGTCATGCCTGCAGGAAG	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Substitution - Nonsense(1)	ovary(1)	13											54.0	57.0	56.0					13																	32910625		2203	4300	6503	31808625	SO:0001587	stop_gained	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.2133C>A	13.37:g.32910625C>A	ENSP00000369497:p.Cys711*	Somatic		Capture	Illumina GAIIx	Phase_I	31808625	O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025060	0.93518	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.58	0.395	0.16304	.	1.186530	0.05852	N	0.621294	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	7.935	0.29925	0.0:0.6087:0.1847:0.2066	.	.	.	.	X	711	.	ENSP00000369497:C711X	C	+	3	2	BRCA2	31808625	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.310000	0.19356	0.064000	0.16427	-1.094000	0.02160	TGC		0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
ABHD13	84945	broad.mit.edu	37	13	108882235	108882235	+	Silent	SNP	A	A	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr13:108882235A>G	ENST00000375898.3	+	2	970	c.669A>G	c.(667-669)ccA>ccG	p.P223P		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	223						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.P223P(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TAAGCATACCACATATGGCCA	0.388																																					Pancreas(22;506 789 38166 45896 51596)											1	Substitution - coding silent(1)	ovary(1)	13											121.0	119.0	119.0					13																	108882235		2203	4300	6503	107680236	SO:0001819	synonymous_variant	84945			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.669A>G	13.37:g.108882235A>G		Somatic		Capture	Illumina GAIIx	Phase_I	107680236	B3KWE7|Q8NBW1|Q96JX9	Silent	SNP	ENST00000375898.3	37	CCDS32007.1																																																																																				0.388	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859	
CPSF2	53981	broad.mit.edu	37	14	92621554	92621554	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr14:92621554G>T	ENST00000298875.4	+	11	1614	c.1329G>T	c.(1327-1329)atG>atT	p.M443I		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	443					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)	p.M443I(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		ACTTGATGATGAAAGGTGAAG	0.398																																					Ovarian(78;28 1788 18702 44111)											1	Substitution - Missense(1)	ovary(1)	14											115.0	104.0	108.0					14																	92621554		2203	4300	6503	91691307	SO:0001583	missense	53981			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.1329G>T	14.37:g.92621554G>T	ENSP00000298875:p.Met443Ile	Somatic		Capture	Illumina GAIIx	Phase_I	91691307	B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	ENST00000298875.4	37	CCDS9902.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.51|14.51	2.555486|2.555486	0.45487|0.45487	.|.	.|.	ENSG00000165934|ENSG00000165934	ENST00000298875|ENST00000555244	T|.	0.41400|.	1.0|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55545|.	0.1927|.	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|.	0.11235|.	0.004|.	B|.	0.08055|.	0.003|.	T|.	0.48163|.	-0.9059|.	10|.	0.37606|.	T|.	0.19|.	.|.	20.0745|20.0745	0.97737|0.97737	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	443|.	Q9P2I0|.	CPSF2_HUMAN|.	I|L	443|11	ENSP00000298875:M443I|.	ENSP00000298875:M443I|.	M|X	+|+	3|2	0|2	CPSF2|CPSF2	91691307|91691307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.613000|9.613000	0.98350|0.98350	2.748000|2.748000	0.94277|0.94277	0.462000|0.462000	0.41574|0.41574	ATG|TGA		0.398	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1		
AHNAK2	113146	broad.mit.edu	37	14	105420500	105420500	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr14:105420500C>G	ENST00000333244.5	-	7	1407	c.1288G>C	c.(1288-1290)Gag>Cag	p.E430Q	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	430						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E430Q(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACTGCTGTCTCCTGTGCCTGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	14											50.0	55.0	53.0					14																	105420500		2028	4174	6202	104491545	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1288G>C	14.37:g.105420500C>G	ENSP00000353114:p.Glu430Gln	Somatic		Capture	Illumina GAIIx	Phase_I	104491545	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	16.09	3.024810	0.54683	.	.	ENSG00000185567	ENST00000333244	T	0.05717	3.4	4.5	0.937	0.19494	.	.	.	.	.	T	0.03520	0.0101	N	0.14661	0.345	0.09310	N	1	B	0.24823	0.112	B	0.20184	0.028	T	0.43686	-0.9376	9	0.36615	T	0.2	.	4.9838	0.14180	0.0:0.3356:0.4191:0.2453	.	430	Q8IVF2	AHNK2_HUMAN	Q	430	ENSP00000353114:E430Q	ENSP00000353114:E430Q	E	-	1	0	AHNAK2	104491545	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.294000	0.19047	0.415000	0.25817	0.555000	0.69702	GAG		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NEDD4	4734	broad.mit.edu	37	15	56208548	56208548	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr15:56208548G>T	ENST00000508342.1	-	1	781	c.482C>A	c.(481-483)tCt>tAt	p.S161Y	NEDD4_ENST00000506154.1_Missense_Mutation_p.S161Y|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000338963.2_Missense_Mutation_p.S161Y	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	161	Ser-rich.				adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)	p.S161Y(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GCTGCTGTAAGACCCATTATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	15											155.0	139.0	145.0					15																	56208548		2193	4292	6485	53995840	SO:0001583	missense	4734			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.482C>A	15.37:g.56208548G>T	ENSP00000424827:p.Ser161Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	53995840	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	37		.	.	.	.	.	.	.	.	.	.	G	18.91	3.723016	0.68959	.	.	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.51574	0.7;0.7;0.7	5.17	5.17	0.71159	.	286.185000	0.00166	N	0.000000	T	0.66858	0.2832	L	0.34521	1.04	0.30523	N	0.768271	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.85130	0.997;0.994;0.997	T	0.63229	-0.6684	10	0.51188	T	0.08	.	18.0099	0.89220	0.0:0.0:1.0:0.0	.	161;161;161	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	Y	161	ENSP00000424827:S161Y;ENSP00000345530:S161Y;ENSP00000422705:S161Y	ENSP00000345530:S161Y	S	-	2	0	NEDD4	53995840	1.000000	0.71417	0.991000	0.47740	0.918000	0.54935	5.366000	0.66122	2.585000	0.87301	0.591000	0.81541	TCT		0.403	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
CA12	771	broad.mit.edu	37	15	63634277	63634277	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr15:63634277T>G	ENST00000178638.3	-	5	889	c.449A>C	c.(448-450)aAc>aCc	p.N150T	CA12_ENST00000344366.3_Missense_Mutation_p.N150T|CA12_ENST00000422263.2_Missense_Mutation_p.N90T	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	150					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.N150T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AAGGTCTGAGTTATAATGGAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	60.0	65.0					15																	63634277		2203	4300	6503	61421330	SO:0001583	missense	771			AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.449A>C	15.37:g.63634277T>G	ENSP00000178638:p.Asn150Thr	Somatic		Capture	Illumina GAIIx	Phase_I	61421330	B2RE24|Q53YE5|Q9BWG2	Missense_Mutation	SNP	ENST00000178638.3	37	CCDS10185.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.436368	0.83885	.	.	ENSG00000074410	ENST00000178638;ENST00000344366;ENST00000422263	T;T;T	0.72051	-0.62;-0.62;-0.62	5.3	5.3	0.74995	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	M	0.91038	3.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.89810	0.3981	10	0.87932	D	0	.	14.0751	0.64885	0.0:0.0:0.0:1.0	.	90;150;150	B3KUB4;O43570-2;O43570	.;.;CAH12_HUMAN	T	150;150;90	ENSP00000178638:N150T;ENSP00000343088:N150T;ENSP00000403028:N90T	ENSP00000178638:N150T	N	-	2	0	CA12	61421330	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.538000	0.82048	1.999000	0.58509	0.533000	0.62120	AAC		0.498	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218	
TICRR	90381	broad.mit.edu	37	15	90145047	90145047	+	Missense_Mutation	SNP	G	G	A	rs115860712	byFrequency	TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr15:90145047G>A	ENST00000268138.7	+	12	2512	c.2407G>A	c.(2407-2409)Gtc>Atc	p.V803I	TICRR_ENST00000560985.1_Missense_Mutation_p.V802I			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	803					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.V803I(1)									GCTGGCTGGTGTCCTTCCTAC	0.423													G|||	12	0.00239617	0.0076	0.0014	5008	,	,		20047	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						G	ILE/VAL	54,3752		0,54,1849	170.0	159.0	163.0		2407	4.8	1.0	15	dbSNP_132	163	1,8249		0,1,4124	yes	missense	C15orf42	NM_152259.3	29	0,55,5973	AA,AG,GG		0.0121,1.4188,0.4562	possibly-damaging	803/1911	90145047	55,12001	1903	4125	6028	87946051	SO:0001583	missense	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2407G>A	15.37:g.90145047G>A	ENSP00000268138:p.Val803Ile	Somatic		Capture	Illumina GAIIx	Phase_I	87946051	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	5	0.0022893772893772895	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	G	16.88	3.245726	0.59103	0.014188	1.21E-4	ENSG00000140534	ENST00000268138	T	0.17691	2.26	5.76	4.83	0.62350	.	0.270122	0.34959	N	0.003551	T	0.13030	0.0316	L	0.47190	1.495	0.38114	D	0.93765	P	0.41450	0.75	B	0.39152	0.292	T	0.02437	-1.1159	10	0.49607	T	0.09	-11.6649	15.7201	0.77700	0.0686:0.0:0.9314:0.0	.	803	Q7Z2Z1	TICRR_HUMAN	I	803	ENSP00000268138:V803I	ENSP00000268138:V803I	V	+	1	0	C15orf42	87946051	1.000000	0.71417	0.963000	0.40424	0.999000	0.98932	4.013000	0.57138	2.882000	0.98803	0.655000	0.94253	GTC		0.423	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
VIMP	55829	broad.mit.edu	37	15	101812979	101812979	+	Silent	SNP	G	G	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr15:101812979G>C	ENST00000398226.3	-	6	599	c.567C>G	c.(565-567)ggC>ggG	p.G189G	VIMP_ENST00000531964.1_Silent_p.G166G|VIMP_ENST00000537379.1_3'UTR|VIMP_ENST00000526049.1_Silent_p.G189G			Q9BQE4	SELS_HUMAN	VCP-interacting membrane protein	189					cell redox homeostasis (GO:0045454)|cellular response to insulin stimulus (GO:0032869)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oxidative stress (GO:0034599)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of tumor necrosis factor production (GO:0032720)|regulation of gluconeogenesis (GO:0006111)|regulation of nitric oxide metabolic process (GO:0080164)|response to glucose (GO:0009749)|response to redox state (GO:0051775)|retrograde protein transport, ER to cytosol (GO:0030970)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|selenium binding (GO:0008430)	p.G189G(1)									AAGATTCTTAGCCTCATCCGC	0.517																																																1	Substitution - coding silent(1)	ovary(1)	15											38.0	41.0	40.0					15																	101812979		1957	4159	6116	99630502	SO:0001819	synonymous_variant	55829			AF328864	CCDS53979.1	15q26.3	2012-10-02			ENSG00000131871	ENSG00000131871			30396	protein-coding gene	gene with protein product	"""selenoprotein S"""	607918				16227999, 16186510	Standard	NM_018445		Approved	SELS, MGC2553, SBBI8, AD-015, SEPS1	uc021sxu.1	Q9BQE4	OTTHUMG00000166441	ENST00000398226.3:c.567C>G	15.37:g.101812979G>C		Somatic		Capture	Illumina GAIIx	Phase_I	99630502	Q3B771|Q9P0I6	Silent	SNP	ENST00000398226.3	37	CCDS53979.1																																																																																				0.517	VIMP-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389784.2	NM_018445	
CCDC102A	92922	broad.mit.edu	37	16	57559891	57559891	+	Missense_Mutation	SNP	G	G	T	rs563952674		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr16:57559891G>T	ENST00000258214.2	-	3	980	c.734C>A	c.(733-735)aCg>aAg	p.T245K		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	245								p.T245K(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						CTCCTCCTCCGTGGCAGCTGT	0.716																																																1	Substitution - Missense(1)	ovary(1)	16											33.0	28.0	30.0					16																	57559891		2198	4300	6498	56117392	SO:0001583	missense	92922			BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.734C>A	16.37:g.57559891G>T	ENSP00000258214:p.Thr245Lys	Somatic		Capture	Illumina GAIIx	Phase_I	56117392	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	.	.	.	.	.	.	.	.	.	.	G	1.394	-0.580037	0.03854	.	.	ENSG00000135736	ENST00000258214	T	0.42513	0.97	5.15	1.44	0.22558	.	1.007110	0.07968	N	0.983485	T	0.21550	0.0519	N	0.19112	0.55	0.09310	N	1	B	0.15719	0.014	B	0.15484	0.013	T	0.29058	-1.0024	10	0.06365	T	0.9	-9.0099	3.6057	0.08042	0.4979:0.2047:0.2974:0.0	.	245	Q96A19	C102A_HUMAN	K	245	ENSP00000258214:T245K	ENSP00000258214:T245K	T	-	2	0	CCDC102A	56117392	0.000000	0.05858	0.018000	0.16275	0.867000	0.49689	1.097000	0.30988	0.591000	0.29711	-0.362000	0.07510	ACG		0.716	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	17	GRCh37	CM971506	TP53	M	rs121913344						120.0	106.0	110.0					17																	7577022		2203	4300	6503	7517747	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*	Somatic		Capture	Illumina GAIIx	Phase_I	7517747	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NF1	4763	broad.mit.edu	37	17	29585518	29585518	+	Missense_Mutation	SNP	A	A	G	rs137854550		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr17:29585518A>G	ENST00000358273.4	+	32	4713	c.4330A>G	c.(4330-4332)Aag>Gag	p.K1444E	NF1_ENST00000356175.3_Missense_Mutation_p.K1423E	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1444	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		K -> E (in NF1 and NFNS; significant reduction of intrinsic GAP activity; dbSNP:rs137854550). {ECO:0000269|PubMed:11857752, ECO:0000269|PubMed:1568247, ECO:0000269|PubMed:16380919, ECO:0000269|PubMed:9003501}.|K -> N (in NF1; dbSNP:rs199474750). {ECO:0000269|PubMed:12552569, ECO:0000269|PubMed:15146469}.|K -> R (in NF1; dbSNP:rs199474781). {ECO:0000269|PubMed:11735023}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)|p.K1444E(3)|p.K1444Q(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTTAATGTCAAAGGTGAATTA	0.348			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	17	Whole gene deletion(8)|Unknown(5)|Substitution - Missense(4)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	17	GRCh37	CM920506	NF1	M	rs137854550						52.0	49.0	50.0					17																	29585518		2203	4299	6502	26609644	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4330A>G	17.37:g.29585518A>G	ENSP00000351015:p.Lys1444Glu	Somatic		Capture	Illumina GAIIx	Phase_I	26609644	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	A	32	5.123099	0.94429	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.90844	-2.74;-2.74;-2.74	6.02	6.02	0.97574	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.97238	0.9097	H	0.97852	4.09	0.80722	A	1	D;D;D	0.89917	1.0;0.974;0.998	D;D;D	0.91635	0.999;0.969;0.997	D	0.98561	1.0641	9	0.87932	D	0	.	15.1131	0.72375	1.0:0.0:0.0:0.0	.	473;1423;1444	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	E	1444;1423;1089	ENSP00000351015:K1444E;ENSP00000348498:K1423E;ENSP00000389907:K1089E	ENSP00000348498:K1423E	K	+	1	0	NF1	26609644	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.923000	0.92808	2.304000	0.77564	0.528000	0.53228	AAG		0.348	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
EMILIN2	84034	broad.mit.edu	37	18	2890859	2890859	+	Missense_Mutation	SNP	C	C	A	rs200574377		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr18:2890859C>A	ENST00000254528.3	+	4	893	c.734C>A	c.(733-735)aCg>aAg	p.T245K		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	245					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.T245K(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GACACAGAAACGGGCCAGAGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	18											54.0	60.0	58.0					18																	2890859		2203	4300	6503	2880859	SO:0001583	missense	84034			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.734C>A	18.37:g.2890859C>A	ENSP00000254528:p.Thr245Lys	Somatic		Capture	Illumina GAIIx	Phase_I	2880859	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249647	0.22880	.	.	ENSG00000132205	ENST00000254528	T	0.36157	1.27	5.41	1.68	0.24146	.	0.627640	0.15689	N	0.249510	T	0.33673	0.0871	M	0.68952	2.095	0.09310	N	1	P	0.46621	0.881	P	0.49140	0.601	T	0.25847	-1.0120	10	0.05959	T	0.93	-4.1037	2.9721	0.05926	0.1115:0.5175:0.1087:0.2624	.	245	Q9BXX0	EMIL2_HUMAN	K	245	ENSP00000254528:T245K	ENSP00000254528:T245K	T	+	2	0	EMILIN2	2880859	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.188000	0.03064	0.024000	0.15214	-0.226000	0.12346	ACG		0.502	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
DSEL	92126	broad.mit.edu	37	18	65178448	65178448	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr18:65178448A>T	ENST00000310045.7	-	2	4901	c.3428T>A	c.(3427-3429)tTt>tAt	p.F1143Y	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1133					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.F1143Y(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TTTCTGAGGAAAATGCACAAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	18											54.0	53.0	53.0					18																	65178448		2203	4300	6503	63329428	SO:0001583	missense	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3428T>A	18.37:g.65178448A>T	ENSP00000310565:p.Phe1143Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	63329428	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.088729	0.36855	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.21932	1.98	4.79	2.2	0.27929	Sulfotransferase domain (1);	0.377447	0.24298	U	0.039750	T	0.11452	0.0279	L	0.40543	1.245	0.27984	N	0.935931	B	0.06786	0.001	B	0.13407	0.009	T	0.35724	-0.9777	10	0.02654	T	1	-6.7002	4.1187	0.10095	0.6872:0.0:0.1622:0.1506	.	1133	Q8IZU8	DSEL_HUMAN	Y	1143;1133	ENSP00000310565:F1143Y	ENSP00000310565:F1143Y	F	-	2	0	DSEL	63329428	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	1.728000	0.38105	0.785000	0.33685	0.460000	0.39030	TTT		0.388	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
DSEL	92126	broad.mit.edu	37	18	65181739	65181739	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr18:65181739G>A	ENST00000310045.7	-	2	1610	c.137C>T	c.(136-138)aCa>aTa	p.T46I	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	36					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.T46I(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TATATCATCTGTGAAAACTGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	18											101.0	96.0	97.0					18																	65181739		2203	4300	6503	63332719	SO:0001583	missense	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.137C>T	18.37:g.65181739G>A	ENSP00000310565:p.Thr46Ile	Somatic		Capture	Illumina GAIIx	Phase_I	63332719	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.615076	0.46631	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.23950	1.88	4.87	3.99	0.46301	.	0.217217	0.36234	U	0.002717	T	0.17534	0.0421	L	0.27053	0.805	0.30691	N	0.751343	B	0.02656	0.0	B	0.04013	0.001	T	0.08046	-1.0741	10	0.42905	T	0.14	-2.5467	9.9923	0.41879	0.1782:0.0:0.8218:0.0	.	36	Q8IZU8	DSEL_HUMAN	I	46;36	ENSP00000310565:T46I	ENSP00000310565:T46I	T	-	2	0	DSEL	63332719	1.000000	0.71417	0.609000	0.28983	0.891000	0.51852	5.403000	0.66338	1.059000	0.40554	0.561000	0.74099	ACA		0.333	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
MAP4K3	8491	broad.mit.edu	37	2	39553363	39553363	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:39553363C>T	ENST00000263881.3	-	9	910	c.586G>A	c.(586-588)Gat>Aat	p.D196N	MAP4K3_ENST00000536018.1_5'Flank|MAP4K3_ENST00000437545.1_Missense_Mutation_p.D133N|RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000341681.5_Missense_Mutation_p.D196N	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.D196N(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GCCCAGAGATCACAGAGTTGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											121.0	123.0	122.0					2																	39553363		2203	4300	6503	39406867	SO:0001583	missense	8491			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.586G>A	2.37:g.39553363C>T	ENSP00000263881:p.Asp196Asn	Somatic		Capture	Illumina GAIIx	Phase_I	39406867	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	CCDS1803.1	.	.	.	.	.	.	.	.	.	.	C	36	5.793501	0.96952	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.75154	-0.91;0.73;-0.91	5.68	5.68	0.88126	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93552	0.7942	H	0.99863	4.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96382	0.9282	9	.	.	.	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	196;196	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	N	196;133;196	ENSP00000263881:D196N;ENSP00000416958:D133N;ENSP00000345434:D196N	.	D	-	1	0	MAP4K3	39406867	1.000000	0.71417	0.994000	0.49952	0.945000	0.59286	7.631000	0.83237	2.668000	0.90789	0.585000	0.79938	GAT		0.418	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618	
C2orf78	388960	broad.mit.edu	37	2	74042850	74042850	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:74042850G>C	ENST00000409561.1	+	3	1621	c.1500G>C	c.(1498-1500)agG>agC	p.R500S		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	500								p.R470S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						ATCAAGTCAGGAAGAACAAGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	79.0	80.0					2																	74042850		1943	4142	6085	73896358	SO:0001583	missense	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1500G>C	2.37:g.74042850G>C	ENSP00000387124:p.Arg500Ser	Somatic		Capture	Illumina GAIIx	Phase_I	73896358		Missense_Mutation	SNP	ENST00000409561.1	37	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814495	0.50527	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.11	3.27	0.37495	.	0.279729	0.25214	N	0.032287	T	0.43389	0.1245	M	0.75777	2.31	0.09310	N	1	P	0.47106	0.89	B	0.42738	0.396	T	0.41680	-0.9495	9	0.72032	D	0.01	-8.6865	8.4655	0.32953	0.0:0.1683:0.6571:0.1746	.	500	A6NCI8	CB078_HUMAN	S	500;470	.	ENSP00000340692:R470S	R	+	3	2	C2orf78	73896358	1.000000	0.71417	0.056000	0.19401	0.198000	0.23893	1.702000	0.37836	0.631000	0.30412	0.655000	0.94253	AGG		0.468	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474	
MALL	7851	broad.mit.edu	37	2	110845256	110845256	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:110845256T>A	ENST00000272462.2	-	3	1065	c.292A>T	c.(292-294)Acc>Tcc	p.T98S	MALL_ENST00000427178.1_Intron|MIR4436B1_ENST00000583272.1_RNA	NM_005434.4	NP_005425.1	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like	98	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cholesterol homeostasis (GO:0042632)	clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.T98S(1)		kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	9				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		ATGCCAGTGGTCCCGTGGTAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	2																																								110202545	SO:0001583	missense	7851			U17077	CCDS2085.1	2q13	2008-02-05			ENSG00000144063	ENSG00000144063			6818	protein-coding gene	gene with protein product		602022				9326933	Standard	NM_005434		Approved	BENE	uc002tfk.3	Q13021	OTTHUMG00000131196	ENST00000272462.2:c.292A>T	2.37:g.110845256T>A	ENSP00000272462:p.Thr98Ser	Somatic		Capture	Illumina GAIIx	Phase_I	110202545	B3KWR6|Q9BTU0	Missense_Mutation	SNP	ENST00000272462.2	37	CCDS2085.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.676833	0.29783	.	.	ENSG00000144063	ENST00000272462	T	0.25250	1.81	3.6	3.6	0.41247	Marvel (1);MARVEL-like domain (1);	0.109439	0.40554	N	0.001071	T	0.23532	0.0569	L	0.56396	1.775	0.80722	D	1	B	0.26445	0.149	B	0.27380	0.079	T	0.04229	-1.0967	10	0.26408	T	0.33	-28.5535	8.8789	0.35363	0.0:0.0:0.0:1.0	.	98	Q13021	MALL_HUMAN	S	98	ENSP00000272462:T98S	ENSP00000272462:T98S	T	-	1	0	MALL	110202545	0.594000	0.26849	0.997000	0.53966	0.329000	0.28539	0.606000	0.24194	1.417000	0.47077	0.254000	0.18369	ACC		0.493	MALL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253921.1	NM_005434	
LRP2	4036	broad.mit.edu	37	2	170147490	170147490	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:170147490C>T	ENST00000263816.3	-	8	1072	c.787G>A	c.(787-789)Gtt>Att	p.V263I	LRP2_ENST00000443831.1_Missense_Mutation_p.V263I	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	263					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.V263I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CATTTATGAACATCATGAGGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	2											110.0	108.0	109.0					2																	170147490		2203	4300	6503	169855736	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.787G>A	2.37:g.170147490C>T	ENSP00000263816:p.Val263Ile	Somatic		Capture	Illumina GAIIx	Phase_I	169855736	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	5.630	0.300873	0.10678	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.94376	-2.47;-3.41	3.69	-7.38	0.01407	.	1.878100	0.03031	N	0.152011	T	0.81250	0.4783	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.0;0.002	T	0.72754	-0.4198	9	.	.	.	.	1.2371	0.01955	0.3325:0.2381:0.2965:0.1328	.	263;263	E9PC35;P98164	.;LRP2_HUMAN	I	263	ENSP00000263816:V263I;ENSP00000409813:V263I	.	V	-	1	0	LRP2	169855736	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.968000	0.03817	-1.688000	0.01435	-0.274000	0.10170	GTT		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	broad.mit.edu	37	2	179457223	179457223	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:179457223G>A	ENST00000591111.1	-	251	54810	c.54586C>T	c.(54586-54588)Cca>Tca	p.P18196S	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P19837S|TTN_ENST00000342992.6_Missense_Mutation_p.P17269S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P10772S|TTN_ENST00000342175.6_Missense_Mutation_p.P10964S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P10897S			Q8WZ42	TITIN_HUMAN	titin	18196	Ig-like 105.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P17267S(1)|p.P10772S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACCAACTGGAGTCACATCA	0.403																																																2	Substitution - Missense(2)	ovary(2)	2											289.0	267.0	274.0					2																	179457223		1898	4116	6014	179165469	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.54586C>T	2.37:g.179457223G>A	ENSP00000465570:p.Pro18196Ser	Somatic		Capture	Illumina GAIIx	Phase_I	179165469	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	10.23	1.291667	0.23564	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47078	0.1426	N	0.25485	0.75	0.34085	D	0.660075	P;P;P;P	0.43231	0.801;0.801;0.801;0.801	B;B;B;B	0.34931	0.192;0.192;0.192;0.192	T	0.64626	-0.6363	9	0.87932	D	0	.	12.3433	0.55105	0.0:0.1344:0.7411:0.1245	.	10772;10897;10964;18196	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	17269;10772;10964;10897;10770	ENSP00000343764:P17269S;ENSP00000434586:P10772S;ENSP00000340554:P10964S;ENSP00000352154:P10897S	ENSP00000340554:P10964S	P	-	1	0	TTN	179165469	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.223000	0.58587	2.868000	0.98415	0.557000	0.71058	CCA		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
MAP2	4133	broad.mit.edu	37	2	210517994	210517994	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:210517994C>A	ENST00000360351.4	+	4	606	c.100C>A	c.(100-102)Caa>Aaa	p.Q34K	MAP2_ENST00000447185.1_Missense_Mutation_p.Q34K|MAP2_ENST00000199940.6_Missense_Mutation_p.Q34K|MAP2_ENST00000361559.4_Missense_Mutation_p.Q34K|MAP2_ENST00000392194.1_Missense_Mutation_p.Q34K	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	34					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.Q34K(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GATTAAGGATCAAGGCGGAGC	0.542																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											110.0	81.0	91.0					2																	210517994		2203	4300	6503	210226239	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.100C>A	2.37:g.210517994C>A	ENSP00000353508:p.Gln34Lys	Somatic		Capture	Illumina GAIIx	Phase_I	210226239	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643054	0.87859	.	.	ENSG00000078018	ENST00000199940;ENST00000392193;ENST00000360351;ENST00000361559;ENST00000445941;ENST00000392194;ENST00000447185	T;T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2;2.2	5.45	5.45	0.79879	.	0.000000	0.53938	D	0.000043	T	0.35307	0.0927	L	0.27053	0.805	0.43868	D	0.996475	D;B;P;B;D;P	0.61080	0.988;0.135;0.891;0.034;0.989;0.801	D;B;P;B;D;B	0.75020	0.985;0.12;0.877;0.015;0.966;0.258	T	0.07233	-1.0783	10	0.51188	T	0.08	-13.6884	18.2826	0.90103	0.0:1.0:0.0:0.0	.	34;34;35;34;34;34	P11137-3;P11137-2;Q59FX9;E7EV03;P11137;Q8IUX2	.;.;.;.;MAP2_HUMAN;.	K	34	ENSP00000199940:Q34K;ENSP00000376031:Q34K;ENSP00000353508:Q34K;ENSP00000355290:Q34K;ENSP00000409969:Q34K;ENSP00000376032:Q34K;ENSP00000392164:Q34K	ENSP00000199940:Q34K	Q	+	1	0	MAP2	210226239	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.333000	0.65917	2.561000	0.86390	0.655000	0.94253	CAA		0.542	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
STK36	27148	broad.mit.edu	37	2	219559278	219559278	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:219559278G>T	ENST00000295709.3	+	21	2710	c.2431G>T	c.(2431-2433)Ggt>Tgt	p.G811C	STK36_ENST00000392105.3_Missense_Mutation_p.G811C|STK36_ENST00000392106.2_Missense_Mutation_p.G811C|STK36_ENST00000440309.1_Missense_Mutation_p.G811C	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.G811C(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GGGACAGCTTGGTCAGCAAGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	110.0	111.0					2																	219559278		2203	4300	6503	219267522	SO:0001583	missense	27148			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2431G>T	2.37:g.219559278G>T	ENSP00000295709:p.Gly811Cys	Somatic		Capture	Illumina GAIIx	Phase_I	219267522		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.49|11.49	1.654865|1.654865	0.29425|0.29425	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309|ENST00000431040	T;T;T;T|.	0.71222|.	-0.55;-0.54;-0.55;-0.55|.	5.01|5.01	1.92|1.92	0.25849|0.25849	.|.	0.297179|.	0.24366|.	N|.	0.039148|.	T|T	0.28863|0.28863	0.0716|0.0716	N|N	0.19112|0.19112	0.55|0.55	0.31044|0.31044	N|N	0.716014|0.716014	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.09377|.	0.004;0.001|.	T|T	0.35968|0.35968	-0.9767|-0.9767	10|6	0.46703|0.87932	T|D	0.11|0	-0.5893|-0.5893	4.071|4.071	0.09882|0.09882	0.2839:0.0:0.5159:0.2002|0.2839:0.0:0.5159:0.2002	.|.	811;811|.	Q9NRP7-2;Q9NRP7|.	.;STK36_HUMAN|.	C|F	811|4	ENSP00000295709:G811C;ENSP00000375955:G811C;ENSP00000375954:G811C;ENSP00000394095:G811C|.	ENSP00000295709:G811C|ENSP00000416372:L4F	G|L	+|+	1|3	0|2	STK36|STK36	219267522|219267522	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.442000|0.442000	0.21628|0.21628	0.661000|0.661000	0.30985|0.30985	-0.136000|-0.136000	0.14681|0.14681	GGT|TTG		0.557	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
BRPF1	7862	broad.mit.edu	37	3	9782526	9782526	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr3:9782526C>G	ENST00000457855.1	+	3	1634	c.1623C>G	c.(1621-1623)caC>caG	p.H541Q	BRPF1_ENST00000302054.3_Missense_Mutation_p.H541Q|BRPF1_ENST00000383829.2_Missense_Mutation_p.H541Q|BRPF1_ENST00000433861.2_Missense_Mutation_p.H541Q|BRPF1_ENST00000424362.1_Missense_Mutation_p.H541Q			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	541	Interaction with MEAF6 and ING5.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.H541Q(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					AGAGGCTGCACAGCTACTGGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											85.0	74.0	78.0					3																	9782526		2203	4300	6503	9757526	SO:0001583	missense	7862			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1623C>G	3.37:g.9782526C>G	ENSP00000410210:p.His541Gln	Somatic		Capture	Illumina GAIIx	Phase_I	9757526	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	37	CCDS2575.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855714	0.51376	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.16743	2.33;2.32;3.72;2.33;2.33	5.74	4.86	0.63082	.	0.093789	0.85682	D	0.000000	T	0.20414	0.0491	L	0.52823	1.66	0.80722	D	1	B;B;B;B	0.32324	0.364;0.198;0.198;0.249	B;B;B;B	0.36922	0.236;0.171;0.176;0.186	T	0.02533	-1.1145	10	0.29301	T	0.29	.	13.03	0.58837	0.0:0.865:0.0:0.135	.	541;541;541;541	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	Q	541	ENSP00000402485:H541Q;ENSP00000398863:H541Q;ENSP00000373340:H541Q;ENSP00000306297:H541Q;ENSP00000410210:H541Q	ENSP00000306297:H541Q	H	+	3	2	BRPF1	9757526	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.999000	0.29757	1.403000	0.46800	0.650000	0.86243	CAC		0.537	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694	
WNT7A	7476	broad.mit.edu	37	3	13896086	13896086	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr3:13896086C>A	ENST00000285018.4	-	3	817	c.513G>T	c.(511-513)gaG>gaT	p.E171D		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	171					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.E171D(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						TCTGCTTGATCTCCCGGGCAT	0.632																																																1	Substitution - Missense(1)	ovary(1)	3											115.0	127.0	123.0					3																	13896086		2203	4300	6503	13871087	SO:0001583	missense	7476			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.513G>T	3.37:g.13896086C>A	ENSP00000285018:p.Glu171Asp	Somatic		Capture	Illumina GAIIx	Phase_I	13871087	Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	37	CCDS2616.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273519	0.80580	.	.	ENSG00000154764	ENST00000285018	T	0.78481	-1.18	5.11	3.28	0.37604	.	0.000000	0.85682	D	0.000000	D	0.86112	0.5855	M	0.80332	2.49	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86688	0.1921	10	0.87932	D	0	.	9.2472	0.37534	0.0:0.7918:0.0:0.2082	.	171	O00755	WNT7A_HUMAN	D	171	ENSP00000285018:E171D	ENSP00000285018:E171D	E	-	3	2	WNT7A	13871087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.339000	0.33885	2.386000	0.81285	0.561000	0.74099	GAG		0.632	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
CSRNP1	64651	broad.mit.edu	37	3	39185371	39185371	+	Silent	SNP	A	A	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr3:39185371A>T	ENST00000273153.5	-	5	1122	c.945T>A	c.(943-945)ccT>ccA	p.P315P	CSRNP1_ENST00000514182.1_Silent_p.P315P	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	315					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P315P(1)		central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						TGCCCTGGGCAGGGGCCTCCA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	3											34.0	35.0	35.0					3																	39185371		2203	4300	6503	39160375	SO:0001819	synonymous_variant	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.945T>A	3.37:g.39185371A>T		Somatic		Capture	Illumina GAIIx	Phase_I	39160375	Q69YY5	Silent	SNP	ENST00000273153.5	37	CCDS2682.1																																																																																				0.592	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027	
RRP9	9136	broad.mit.edu	37	3	51975463	51975463	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr3:51975463C>A	ENST00000232888.6	-	2	205	c.132G>T	c.(130-132)aaG>aaT	p.K44N	PARP3_ENST00000417220.2_5'Flank|PARP3_ENST00000398755.3_5'Flank|PARP3_ENST00000431474.1_5'Flank	NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	44					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.K44N(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CCTCATTCATCTTGCCGCCAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											135.0	129.0	131.0					3																	51975463		2203	4300	6503	51950503	SO:0001583	missense	9136			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.132G>T	3.37:g.51975463C>A	ENSP00000232888:p.Lys44Asn	Somatic		Capture	Illumina GAIIx	Phase_I	51950503	B2R996|Q8IZ30	Missense_Mutation	SNP	ENST00000232888.6	37	CCDS2837.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452403	0.43531	.	.	ENSG00000114767	ENST00000232888	T	0.52983	0.64	5.83	3.03	0.35002	.	0.199371	0.42172	D	0.000759	T	0.33818	0.0876	N	0.24115	0.695	0.41825	D	0.990046	B	0.29301	0.241	B	0.33454	0.164	T	0.05517	-1.0880	10	0.30078	T	0.28	-19.3197	11.1163	0.48262	0.0:0.7713:0.0:0.2287	.	44	O43818	U3IP2_HUMAN	N	44	ENSP00000232888:K44N	ENSP00000232888:K44N	K	-	3	2	RRP9	51950503	0.997000	0.39634	0.989000	0.46669	0.509000	0.34042	0.914000	0.28624	0.092000	0.17331	-1.134000	0.01955	AAG		0.552	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704	
TBL1XR1	79718	broad.mit.edu	37	3	176769438	176769438	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr3:176769438G>C	ENST00000430069.1	-	5	540	c.281C>G	c.(280-282)aCa>aGa	p.T94R	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.T94R			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	94					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.T94R(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TTGTTGTCTTGTTTGTACTAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	62.0	65.0					3																	176769438		1879	4105	5984	178252132	SO:0001583	missense	79718			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.281C>G	3.37:g.176769438G>C	ENSP00000405574:p.Thr94Arg	Somatic		Capture	Illumina GAIIx	Phase_I	178252132	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	ENST00000430069.1	37	CCDS46961.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489162	0.44249	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758;ENST00000428970;ENST00000424913;ENST00000352800;ENST00000437738;ENST00000431421;ENST00000450267;ENST00000431674	T;T	0.51817	0.69;0.69	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.44540	0.1298	L	0.50333	1.59	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.30268	-0.9984	10	0.18710	T	0.47	-26.9563	18.4353	0.90643	0.0:0.0:1.0:0.0	.	94	Q9BZK7	TBL1R_HUMAN	R	94;94;7;7;7;94;94;7;94;94	ENSP00000405574:T94R;ENSP00000413251:T94R	ENSP00000263964:T94R	T	-	2	0	TBL1XR1	178252132	1.000000	0.71417	0.373000	0.26003	0.930000	0.56654	9.476000	0.97823	2.609000	0.88269	0.557000	0.71058	ACA		0.473	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665	
KIAA1109	84162	broad.mit.edu	37	4	123280783	123280783	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr4:123280783T>C	ENST00000264501.4	+	85	15080	c.14707T>C	c.(14707-14709)Tcc>Ccc	p.S4903P	KIAA1109_ENST00000388738.3_Missense_Mutation_p.S4903P			Q2LD37	K1109_HUMAN	KIAA1109	4903					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S4903P(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGACGACAATTCCTCTGATAA	0.353																																																1	Substitution - Missense(1)	ovary(1)	4											127.0	114.0	118.0					4																	123280783		1850	4087	5937	123500233	SO:0001583	missense	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14707T>C	4.37:g.123280783T>C	ENSP00000264501:p.Ser4903Pro	Somatic		Capture	Illumina GAIIx	Phase_I	123500233	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339840	0.81911	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.47177	0.85;0.85;0.85	5.57	4.4	0.53042	Fragile site-associated protein, C-terminal (1);	0.058425	0.64402	D	0.000001	T	0.54175	0.1842	L	0.48642	1.525	0.80722	D	1	P;D	0.53462	0.95;0.96	P;P	0.56514	0.698;0.8	T	0.50466	-0.8825	10	0.38643	T	0.18	.	12.4954	0.55925	0.0:0.0:0.1516:0.8484	.	4902;4903	Q2LD37-4;Q2LD37	.;K1109_HUMAN	P	4903;4903;1572;504	ENSP00000264501:S4903P;ENSP00000373390:S4903P;ENSP00000410874:S1572P	ENSP00000264501:S4903P	S	+	1	0	KIAA1109	123500233	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.363000	0.59473	0.948000	0.37687	0.528000	0.53228	TCC		0.353	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
PAPD7	11044	broad.mit.edu	37	5	6748679	6748679	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr5:6748679C>G	ENST00000230859.6	+	8	941	c.812C>G	c.(811-813)tCc>tGc	p.S271C		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	501					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)	p.S271C(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CTGGCCAGGTCCTATCCAAAC	0.547																																					NSCLC(7;212 333 5667 23379 46547)											1	Substitution - Missense(1)	ovary(1)	5											277.0	241.0	253.0					5																	6748679		2203	4300	6503	6801679	SO:0001583	missense	11044			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.812C>G	5.37:g.6748679C>G	ENSP00000230859:p.Ser271Cys	Somatic		Capture	Illumina GAIIx	Phase_I	6801679	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697168	0.48202	.	.	ENSG00000112941	ENST00000230859	T	0.35236	1.32	5.62	4.74	0.60224	.	0.241327	0.43416	D	0.000567	T	0.30510	0.0767	L	0.47716	1.5	0.46564	D	0.999105	B;B	0.18968	0.032;0.014	B;B	0.17098	0.017;0.017	T	0.08310	-1.0728	10	0.39692	T	0.17	-6.4797	9.2368	0.37470	0.1465:0.7816:0.0:0.0719	.	271;271	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	C	271	ENSP00000230859:S271C	ENSP00000230859:S271C	S	+	2	0	PAPD7	6801679	0.983000	0.35010	0.994000	0.49952	0.970000	0.65996	2.181000	0.42547	1.337000	0.45525	0.561000	0.74099	TCC		0.547	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
TRIO	7204	broad.mit.edu	37	5	14297204	14297204	+	Silent	SNP	C	C	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr5:14297204C>G	ENST00000344204.4	+	7	1224	c.1200C>G	c.(1198-1200)cgC>cgG	p.R400R	TRIO_ENST00000509967.2_Silent_p.R351R|TRIO_ENST00000537187.1_Silent_p.R400R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	400					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R400R(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ATATAAACCGCATCATGTCGG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	5											91.0	82.0	85.0					5																	14297204		2203	4300	6503	14350204	SO:0001819	synonymous_variant	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.1200C>G	5.37:g.14297204C>G		Somatic		Capture	Illumina GAIIx	Phase_I	14350204	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1																																																																																				0.542	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
MROH2B	133558	broad.mit.edu	37	5	41049516	41049516	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr5:41049516G>T	ENST00000399564.4	-	14	1817	c.1367C>A	c.(1366-1368)aCt>aAt	p.T456N	MROH2B_ENST00000506092.2_Missense_Mutation_p.T11N	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	456								p.T456N(2)									TACCACAAAAGTCAGGATCCT	0.458																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											63.0	59.0	60.0					5																	41049516		1898	4125	6023	41085273	SO:0001583	missense	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1367C>A	5.37:g.41049516G>T	ENSP00000382476:p.Thr456Asn	Somatic		Capture	Illumina GAIIx	Phase_I	41085273	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174440	0.38413	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.66995	3.19;-0.24	5.7	4.83	0.62350	Armadillo-type fold (1);	0.000000	0.46758	D	0.000276	T	0.72542	0.3473	L	0.54323	1.7	0.33885	D	0.636657	D	0.76494	0.999	D	0.69479	0.964	T	0.73033	-0.4110	10	0.18710	T	0.47	.	9.6167	0.39696	0.0921:0.0:0.9079:0.0	.	456	Q7Z745	HTRB2_HUMAN	N	11;160;456	ENSP00000441504:T11N;ENSP00000382476:T456N	ENSP00000296803:T160N	T	-	2	0	HEATR7B2	41085273	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.269000	0.33074	2.705000	0.92388	0.650000	0.86243	ACT		0.458	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
TRPC7	57113	broad.mit.edu	37	5	135692447	135692447	+	Missense_Mutation	SNP	T	T	A	rs565522086		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr5:135692447T>A	ENST00000513104.1	-	2	911	c.629A>T	c.(628-630)gAc>gTc	p.D210V	TRPC7_ENST00000426057.2_Missense_Mutation_p.D210V|TRPC7_ENST00000355180.3_Missense_Mutation_p.D210V	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	210					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTGAAGGAGTCTTTCCGCTG	0.602													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19986	0.0		0.0	False		,,,				2504	0.0															0			5											57.0	63.0	61.0					5																	135692447		2157	4269	6426	135720346	SO:0001583	missense	57113			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.629A>T	5.37:g.135692447T>A	ENSP00000426070:p.Asp210Val	Somatic		Capture	Illumina GAIIx	Phase_I	135720346	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.346766|4.346766	0.82022|0.82022	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	D;D;D|.	0.85171|.	-1.95;-1.95;-1.95|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Transient receptor potential II (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83529|0.83529	0.5274|0.5274	M|M	0.90595|0.90595	3.13|3.13	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;0.998;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.957;1.0;0.999|.	D|D	0.87004|0.87004	0.2118|0.2118	10|5	0.87932|.	D|.	0|.	-31.9821|-31.9821	15.3565|15.3565	0.74431|0.74431	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	210;210;210;210|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	V|S	210|209	ENSP00000347312:D210V;ENSP00000441628:D210V;ENSP00000426070:D210V|.	ENSP00000265193:D210V|.	D|R	-|-	2|3	0|2	TRPC7|TRPC7	135720346|135720346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.868000|7.868000	0.87116|0.87116	2.205000|2.205000	0.71048|0.71048	0.528000|0.528000	0.53228|0.53228	GAC|AGA		0.602	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
TCOF1	6949	broad.mit.edu	37	5	149753735	149753735	+	Splice_Site	SNP	A	A	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr5:149753735A>C	ENST00000504761.2	+	8	870		c.e8-1		TCOF1_ENST00000377797.3_Splice_Site|TCOF1_ENST00000513346.1_Splice_Site|TCOF1_ENST00000323668.7_Splice_Site|TCOF1_ENST00000394269.3_Splice_Site|TCOF1_ENST00000451292.1_Splice_Site|TCOF1_ENST00000445265.2_Splice_Site|TCOF1_ENST00000439160.2_Splice_Site			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1						skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)	p.?(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTTTTCACCAGGTAAAGGCC	0.547																																																1	Unknown(1)	ovary(1)	5											13.0	13.0	13.0					5																	149753735		2185	4258	6443	149733928	SO:0001630	splice_region_variant	6949				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.871-1A>C	5.37:g.149753735A>C		Somatic		Capture	Illumina GAIIx	Phase_I	149733928	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Splice_Site	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	A	8.784	0.928845	0.18131	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	.	.	.	4.66	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.34083	D	0.659766	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1861	0.20498	0.8893:0.0:0.1107:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TCOF1	149733928	0.989000	0.36119	0.147000	0.22382	0.027000	0.11550	3.864000	0.56024	2.030000	0.59900	0.379000	0.24179	.		0.547	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	Intron
COL9A1	1297	broad.mit.edu	37	6	70983761	70983761	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr6:70983761G>A	ENST00000357250.6	-	12	1212	c.1054C>T	c.(1054-1056)Cgt>Tgt	p.R352C	COL9A1_ENST00000370499.4_Missense_Mutation_p.R109C|COL9A1_ENST00000320755.7_Missense_Mutation_p.R109C|COL9A1_ENST00000489611.1_5'UTR	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	352	Collagen-like 2.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.R352C(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGAAATCCACGCGATCCAGGC	0.294																																																1	Substitution - Missense(1)	ovary(1)	6											53.0	56.0	55.0					6																	70983761		2203	4300	6503	71040482	SO:0001583	missense	1297				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1054C>T	6.37:g.70983761G>A	ENSP00000349790:p.Arg352Cys	Somatic		Capture	Illumina GAIIx	Phase_I	71040482	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393632	0.62066	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.94537	-3.45;-3.41;-3.45	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.97742	0.9259	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.97820	1.0256	10	0.66056	D	0.02	.	18.1531	0.89682	0.0:0.0:1.0:0.0	.	352;109	P20849;P20849-2	CO9A1_HUMAN;.	C	352;109;109	ENSP00000349790:R352C;ENSP00000315252:R109C;ENSP00000359530:R109C	ENSP00000315252:R109C	R	-	1	0	COL9A1	71040482	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.822000	0.75277	2.885000	0.99019	0.655000	0.94253	CGT		0.294	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
HACE1	57531	broad.mit.edu	37	6	105291160	105291160	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr6:105291160T>C	ENST00000262903.4	-	5	616	c.340A>G	c.(340-342)Atg>Gtg	p.M114V	RP11-809N15.2_ENST00000422930.2_RNA|HACE1_ENST00000369125.2_Missense_Mutation_p.M114V	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	114					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.M114V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		AATTTACTCATACATTTCTTC	0.284																																																1	Substitution - Missense(1)	ovary(1)	6											115.0	129.0	125.0					6																	105291160		2202	4297	6499	105397853	SO:0001583	missense	57531			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.340A>G	6.37:g.105291160T>C	ENSP00000262903:p.Met114Val	Somatic		Capture	Illumina GAIIx	Phase_I	105397853	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	T	6.273	0.418421	0.11870	.	.	ENSG00000085382	ENST00000262903;ENST00000369125;ENST00000519645;ENST00000524020	T;T;T;T	0.57595	0.39;0.39;0.56;0.39	5.92	5.92	0.95590	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.22205	0.0535	N	0.00315	-1.66	0.80722	D	1	P;P	0.35542	0.508;0.508	P;P	0.51945	0.685;0.685	T	0.57676	-0.7770	10	0.28530	T	0.3	.	16.3604	0.83263	0.0:0.0:0.0:1.0	.	114;114	E9PGP0;Q8IYU2	.;HACE1_HUMAN	V	114;114;114;80	ENSP00000262903:M114V;ENSP00000358121:M114V;ENSP00000429765:M114V;ENSP00000427901:M80V	ENSP00000262903:M114V	M	-	1	0	HACE1	105397853	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.423000	0.80229	2.260000	0.74910	0.528000	0.53228	ATG		0.284	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
NCOA7	135112	broad.mit.edu	37	6	126236497	126236497	+	Silent	SNP	A	A	C			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr6:126236497A>C	ENST00000368357.3	+	12	2467	c.2115A>C	c.(2113-2115)acA>acC	p.T705T	NCOA7_ENST00000392477.2_Silent_p.T705T|NCOA7_ENST00000229634.9_Silent_p.T590T	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	705					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)	p.T705T(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		ATTTGTACACATTCTTTGTTC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	6											218.0	184.0	196.0					6																	126236497		2203	4300	6503	126278190	SO:0001819	synonymous_variant	135112			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.2115A>C	6.37:g.126236497A>C		Somatic		Capture	Illumina GAIIx	Phase_I	126278190	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Silent	SNP	ENST00000368357.3	37	CCDS5132.1																																																																																				0.433	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
LATS1	9113	broad.mit.edu	37	6	149983199	149983199	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr6:149983199C>G	ENST00000543571.1	-	8	3606	c.3059G>C	c.(3058-3060)aGa>aCa	p.R1020T	LATS1_ENST00000253339.5_Missense_Mutation_p.R1020T	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.R1020T(1)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AGACTGCTGTCTCAGGTCACT	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											112.0	114.0	114.0					6																	149983199		2203	4300	6503	150024892	SO:0001583	missense	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.3059G>C	6.37:g.149983199C>G	ENSP00000437550:p.Arg1020Thr	Somatic		Capture	Illumina GAIIx	Phase_I	150024892		Missense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074715	0.76415	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.07567	3.18;3.18	5.6	5.6	0.85130	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.56097	D	0.000031	T	0.28896	0.0717	M	0.89163	3.01	0.80722	D	1	D	0.64830	0.994	D	0.66716	0.946	T	0.10683	-1.0619	9	.	.	.	.	19.6081	0.95588	0.0:1.0:0.0:0.0	.	1020	O95835	LATS1_HUMAN	T	1020	ENSP00000437550:R1020T;ENSP00000253339:R1020T	.	R	-	2	0	LATS1	150024892	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.442000	0.80503	2.643000	0.89663	0.591000	0.81541	AGA		0.393	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
TNS3	64759	broad.mit.edu	37	7	47342861	47342861	+	Silent	SNP	T	T	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr7:47342861T>A	ENST00000398879.1	-	22	3510	c.3144A>T	c.(3142-3144)tcA>tcT	p.S1048S	TNS3_ENST00000311160.9_Silent_p.S1048S|TNS3_ENST00000355730.3_Silent_p.S808S			Q68CZ2	TENS3_HUMAN	tensin 3	1048					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S1048S(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						TGGGGGTCGGTGACGCTCCAT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	7											17.0	21.0	20.0					7																	47342861		2033	4170	6203	47309386	SO:0001819	synonymous_variant	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3144A>T	7.37:g.47342861T>A		Somatic		Capture	Illumina GAIIx	Phase_I	47309386	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	ENST00000398879.1	37	CCDS5506.2																																																																																				0.667	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
PCLO	27445	broad.mit.edu	37	7	82544341	82544341	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr7:82544341C>T	ENST00000333891.9	-	7	13298	c.12961G>A	c.(12961-12963)Gct>Act	p.A4321T	PCLO_ENST00000437081.1_Missense_Mutation_p.A1041T|PCLO_ENST00000423517.2_Missense_Mutation_p.A4321T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.A4321T(3)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGAGCTTCAGCCTCTTGAGCT	0.438																																																3	Substitution - Missense(3)	endometrium(2)|ovary(1)	7											62.0	60.0	60.0					7																	82544341		1883	4106	5989	82382277	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12961G>A	7.37:g.82544341C>T	ENSP00000334319:p.Ala4321Thr	Somatic		Capture	Illumina GAIIx	Phase_I	82382277		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	8.512	0.866643	0.17250	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16457	2.34;2.35	5.79	5.79	0.91817	.	.	.	.	.	T	0.15955	0.0384	L	0.43152	1.355	0.39537	D	0.968764	B;B;B	0.28783	0.024;0.222;0.222	B;B;B	0.27715	0.005;0.082;0.082	T	0.03423	-1.1038	9	0.87932	D	0	.	9.7593	0.40522	0.0:0.7861:0.1415:0.0724	.	4252;4321;4321	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	T	4321;4321;1041	ENSP00000334319:A4321T;ENSP00000388393:A4321T	ENSP00000334319:A4321T	A	-	1	0	PCLO	82382277	0.945000	0.32115	0.998000	0.56505	0.997000	0.91878	2.111000	0.41883	2.753000	0.94483	0.557000	0.71058	GCT		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
DOCK5	80005	broad.mit.edu	37	8	25198465	25198465	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr8:25198465G>T	ENST00000276440.7	+	23	2444	c.2400G>T	c.(2398-2400)atG>atT	p.M800I		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	800					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.M800I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTTTCAATATGCTGATGGACA	0.438																																					Pancreas(145;34 1887 3271 10937 30165)											1	Substitution - Missense(1)	ovary(1)	8											71.0	67.0	69.0					8																	25198465		2203	4300	6503	25254382	SO:0001583	missense	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2400G>T	8.37:g.25198465G>T	ENSP00000276440:p.Met800Ile	Somatic		Capture	Illumina GAIIx	Phase_I	25254382	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.020|5.020	0.189326|0.189326	0.09547|0.09547	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000444569|ENST00000276440	.|T	.|0.18960	.|2.18	4.99|4.99	-3.09|-3.09	0.05331|0.05331	.|Armadillo-type fold (1);	.|0.895719	.|0.09915	.|N	.|0.739277	T|T	0.06371|0.06371	0.0164|0.0164	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	T|T	0.32851|0.32851	-0.9891|-0.9891	5|10	.|0.30854	.|T	.|0.27	.|.	0.9033|0.9033	0.01279|0.01279	0.4215:0.1667:0.206:0.2058|0.4215:0.1667:0.206:0.2058	.|.	.|790;575;800	.|D3DSS6;Q68DL4;Q9H7D0	.|.;.;DOCK5_HUMAN	S|I	572|800	.|ENSP00000276440:M800I	.|ENSP00000276440:M800I	A|M	+|+	1|3	0|0	DOCK5|DOCK5	25254382|25254382	0.001000|0.001000	0.12720|0.12720	0.070000|0.070000	0.20053|0.20053	0.224000|0.224000	0.24922|0.24922	-0.127000|-0.127000	0.10547|0.10547	-0.252000|-0.252000	0.09528|0.09528	-0.808000|-0.808000	0.03180|0.03180	GCT|ATG		0.438	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
COL15A1	1306	broad.mit.edu	37	9	101747856	101747856	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr9:101747856C>T	ENST00000375001.3	+	3	533	c.110C>T	c.(109-111)tCc>tTc	p.S37F		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	37					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.S37F(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GAGACTGCTTCCCAGGGTCAC	0.552																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	9											56.0	54.0	55.0					9																	101747856		2203	4300	6503	100787677	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.110C>T	9.37:g.101747856C>T	ENSP00000364140:p.Ser37Phe	Somatic		Capture	Illumina GAIIx	Phase_I	100787677	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392531	0.42410	.	.	ENSG00000204291	ENST00000375001	D	0.90900	-2.75	5.11	5.11	0.69529	.	1.458950	0.03909	N	0.281524	D	0.92635	0.7660	L	0.29908	0.895	0.33137	D	0.54385	D	0.69078	0.997	P	0.59012	0.85	D	0.85616	0.1261	10	0.45353	T	0.12	-18.7942	16.3839	0.83495	0.0:1.0:0.0:0.0	.	37	P39059	COFA1_HUMAN	F	37	ENSP00000364140:S37F	ENSP00000364140:S37F	S	+	2	0	COL15A1	100787677	0.744000	0.28250	0.994000	0.49952	0.774000	0.43823	4.610000	0.61155	2.521000	0.84997	0.650000	0.86243	TCC		0.552	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
FAM47C	442444	broad.mit.edu	37	X	37028941	37028941	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:37028941G>A	ENST00000358047.3	+	1	2510	c.2458G>A	c.(2458-2460)Gga>Aga	p.G820R		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	820								p.G820R(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TACCAAGACCGGAGCGTCCCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											62.0	61.0	61.0					X																	37028941		2202	4300	6502	36938862	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2458G>A	X.37:g.37028941G>A	ENSP00000367913:p.Gly820Arg	Somatic		Capture	Illumina GAIIx	Phase_I	36938862	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	1.187	-0.636355	0.03557	.	.	ENSG00000198173	ENST00000358047	T	0.12879	2.64	0.14	0.14	0.14804	.	.	.	.	.	T	0.04452	0.0122	N	0.05383	-0.06	0.09310	N	1	P	0.44139	0.827	B	0.34452	0.183	T	0.34976	-0.9807	8	0.13853	T	0.58	.	.	.	.	.	820	Q5HY64	FA47C_HUMAN	R	820	ENSP00000367913:G820R	ENSP00000367913:G820R	G	+	1	0	FAM47C	36938862	0.019000	0.18553	0.005000	0.12908	0.005000	0.04900	-0.349000	0.07731	0.168000	0.19655	0.169000	0.16792	GGA		0.552	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
KDM5C	8242	broad.mit.edu	37	X	53226114	53226114	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:53226114C>T	ENST00000375401.3	-	19	3267	c.2735G>A	c.(2734-2736)gGg>gAg	p.G912E	KDM5C_ENST00000404049.3_Missense_Mutation_p.G911E|KDM5C_ENST00000375379.3_Missense_Mutation_p.G912E|KDM5C_ENST00000452825.3_Missense_Mutation_p.G845E|KDM5C_ENST00000375383.3_Missense_Mutation_p.G871E	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	912					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.G912E(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CACCTCCACCCCCAGCTGCCG	0.692			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Substitution - Missense(1)	ovary(1)	X											23.0	20.0	21.0					X																	53226114		2198	4288	6486	53242839	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2735G>A	X.37:g.53226114C>T	ENSP00000364550:p.Gly912Glu	Somatic		Capture	Illumina GAIIx	Phase_I	53242839	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.946057	0.34377	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.44	4.44	0.53790	Lysine-specific demethylase-like domain (1);	0.277555	0.33854	U	0.004481	T	0.41050	0.1142	M	0.65975	2.015	0.19575	N	0.999961	B;B;B	0.33345	0.409;0.254;0.146	B;B;B	0.36186	0.211;0.219;0.219	T	0.31223	-0.9951	10	0.30078	T	0.28	-5.6249	9.9425	0.41589	0.0:0.7972:0.2028:0.0	.	845;911;912	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	E	845;912;911;912;871	ENSP00000445176:G845E;ENSP00000364550:G912E;ENSP00000385394:G911E;ENSP00000364528:G912E;ENSP00000364532:G871E	ENSP00000364528:G912E	G	-	2	0	KDM5C	53242839	0.211000	0.23529	0.965000	0.40720	0.995000	0.86356	2.058000	0.41374	1.821000	0.53095	0.594000	0.82650	GGG		0.692	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
FGD1	2245	broad.mit.edu	37	X	54473872	54473872	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:54473872C>A	ENST00000375135.3	-	17	3185	c.2452G>T	c.(2452-2454)Gct>Tct	p.A818S		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	818					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.A818S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TTCTCTGCAGCCACTGAGGCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											68.0	41.0	50.0					X																	54473872		2203	4299	6502	54490597	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2452G>T	X.37:g.54473872C>A	ENSP00000364277:p.Ala818Ser	Somatic		Capture	Illumina GAIIx	Phase_I	54490597	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635482	0.29068	.	.	ENSG00000102302	ENST00000375135	T	0.11063	2.81	5.33	5.33	0.75918	.	0.000000	0.49305	D	0.000144	T	0.07999	0.0200	N	0.19112	0.55	0.36717	D	0.880992	B	0.19935	0.04	B	0.20384	0.029	T	0.17868	-1.0355	10	0.08599	T	0.76	-6.4557	16.8048	0.85623	0.0:1.0:0.0:0.0	.	818	P98174	FGD1_HUMAN	S	818	ENSP00000364277:A818S	ENSP00000364277:A818S	A	-	1	0	FGD1	54490597	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.136000	0.42121	2.229000	0.72834	0.529000	0.55759	GCT		0.542	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
FAAH2	158584	broad.mit.edu	37	X	57358060	57358060	+	Missense_Mutation	SNP	C	C	T	rs141132166		TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:57358060C>T	ENST00000374900.4	+	4	562	c.442C>T	c.(442-444)Cgt>Tgt	p.R148C		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	148						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)	p.R148C(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						ACTCATGAACCGTCGTGATGC	0.413										HNSCC(52;0.14)			.|||	6	0.0015894	0.0	0.0	3775	,	,		14541	0.0		0.0	False		,,,				2504	0.0061															1	Substitution - Missense(1)	ovary(1)	X						C	CYS/ARG	2,3833		0,2,1630,571	101.0	83.0	89.0		442	1.5	0.5	X	dbSNP_134	89	0,6728		0,0,2428,1872	no	missense	FAAH2	NM_174912.3	180	0,2,4058,2443	TT,TC,CC,C		0.0,0.0522,0.0189	probably-damaging	148/533	57358060	2,10561	2203	4300	6503	57374785	SO:0001583	missense	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.442C>T	X.37:g.57358060C>T	ENSP00000364035:p.Arg148Cys	Somatic		Capture	Illumina GAIIx	Phase_I	57374785	Q86VT2|Q96N98	Missense_Mutation	SNP	ENST00000374900.4	37	CCDS14375.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467716	0.26335	5.22E-4	0.0	ENSG00000165591	ENST00000374900	T	0.64260	-0.09	2.38	1.49	0.22878	Amidase signature domain (2);	0.000000	0.64402	U	0.000001	T	0.80352	0.4607	M	0.93808	3.46	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.77670	-0.2501	10	0.72032	D	0.01	.	6.7878	0.23683	0.0:0.8359:0.0:0.1641	.	148	Q6GMR7	FAAH2_HUMAN	C	148	ENSP00000364035:R148C	ENSP00000364035:R148C	R	+	1	0	FAAH2	57374785	0.995000	0.38212	0.534000	0.28014	0.381000	0.30169	3.093000	0.50217	0.052000	0.16007	-0.322000	0.08575	CGT		0.413	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
ZDHHC15	158866	broad.mit.edu	37	X	74742742	74742742	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:74742742C>T	ENST00000373367.3	-	1	348	c.118G>A	c.(118-120)Gtc>Atc	p.V40I	ZDHHC15_ENST00000373361.3_Missense_Mutation_p.V40I|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.V40I|ZDHHC15_ENST00000482827.1_5'UTR	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	40					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.V40I(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						AGTTCAAAGACGTAGGCATAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	X											102.0	79.0	87.0					X																	74742742		2203	4300	6503	74659467	SO:0001583	missense	158866			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.118G>A	X.37:g.74742742C>T	ENSP00000362465:p.Val40Ile	Somatic		Capture	Illumina GAIIx	Phase_I	74659467	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	ENST00000373367.3	37	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682271	0.88542	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.77358	0.78;1.09;-1.09	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.87904	0.6295	M	0.79926	2.475	0.80722	D	1	D;D;B	0.71674	0.998;0.995;0.123	D;P;B	0.75484	0.986;0.838;0.019	D	0.87504	0.2435	10	0.38643	T	0.18	-15.1225	15.6856	0.77409	0.0:1.0:0.0:0.0	.	40;40;40	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	I	40	ENSP00000362465:V40I;ENSP00000445420:V40I;ENSP00000362459:V40I	ENSP00000362459:V40I	V	-	1	0	ZDHHC15	74659467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.395000	0.73228	2.300000	0.77407	0.529000	0.55759	GTC		0.562	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969	
SYTL4	94121	broad.mit.edu	37	X	99941009	99941009	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:99941009T>A	ENST00000372989.1	-	15	1758	c.1427A>T	c.(1426-1428)cAt>cTt	p.H476L	SYTL4_ENST00000263033.5_Missense_Mutation_p.H476L|SYTL4_ENST00000454200.2_Missense_Mutation_p.H478L|SYTL4_ENST00000455616.1_Missense_Mutation_p.H476L|SYTL4_ENST00000372981.1_3'UTR|SYTL4_ENST00000276141.6_Missense_Mutation_p.H476L	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	476					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.H476L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGGGAGGCAATGATCCAGTTT	0.458																																																1	Substitution - Missense(1)	ovary(1)	X											87.0	70.0	76.0					X																	99941009		2203	4298	6501	99827665	SO:0001583	missense	94121				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1427A>T	X.37:g.99941009T>A	ENSP00000362080:p.His476Leu	Somatic		Capture	Illumina GAIIx	Phase_I	99827665	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914513	0.72983	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033	T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16	5.88	5.88	0.94601	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.345544	0.36101	N	0.002795	T	0.07773	0.0195	L	0.40543	1.245	0.52099	D	0.99994	P	0.43542	0.81	B	0.33620	0.167	T	0.33727	-0.9857	9	.	.	.	-19.5063	15.2041	0.73165	0.0:0.0:0.0:1.0	.	476	Q96C24	SYTL4_HUMAN	L	476;476;478;476;476	ENSP00000362080:H476L;ENSP00000390252:H476L;ENSP00000403556:H478L;ENSP00000276141:H476L;ENSP00000263033:H476L	.	H	-	2	0	SYTL4	99827665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.051000	0.76627	1.973000	0.57446	0.486000	0.48141	CAT		0.458	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737	
ACTRT1	139741	broad.mit.edu	37	X	127185495	127185495	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chrX:127185495G>A	ENST00000371124.3	-	1	887	c.691C>T	c.(691-693)Cgc>Tgc	p.R231C		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	231						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R231C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						CGGCTCTTGCGTAGCTCTTTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											130.0	122.0	125.0					X																	127185495		2203	4300	6503	127013176	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.691C>T	X.37:g.127185495G>A	ENSP00000360165:p.Arg231Cys	Somatic		Capture	Illumina GAIIx	Phase_I	127013176	Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	CCDS14611.1	.	.	.	.	.	.	.	.	.	.	G	0.111	-1.138244	0.01742	.	.	ENSG00000123165	ENST00000371124	D	0.94650	-3.48	3.45	-6.89	0.01660	.	1.252160	0.05461	N	0.551277	D	0.86306	0.5901	L	0.28344	0.845	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.71272	-0.4642	10	0.87932	D	0	.	0.4575	0.00511	0.267:0.2136:0.2879:0.2314	.	231	Q8TDG2	ACTT1_HUMAN	C	231	ENSP00000360165:R231C	ENSP00000360165:R231C	R	-	1	0	ACTRT1	127013176	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.426000	0.02443	-2.944000	0.00296	-1.724000	0.00704	CGC		0.512	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	NM_138289	
MIB1	57534	broad.mit.edu	37	18	19353583	19353589	+	Splice_Site	DEL	AGGTAAC	AGGTAAC	-			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	AGGTAAC	AGGTAAC	-	-	AGGTAAC	AGGTAAC	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr18:19353583_19353589delAGGTAAC	ENST00000261537.6	+	4	795_800	c.531_536delAGGTAAC	c.(529-537)aaaggtaac>aac	p.KG177fs	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	177	MIB/HERC2 2. {ECO:0000255|PROSITE- ProRule:PRU00749}.				blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			CTATTCTGTTAGGTAACAGAAATCCAG	0.377																																																1	Unknown(1)	ovary(1)	18																																								17607587	SO:0001630	splice_region_variant	57534			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.532-1AGGTAAC>-	18.37:g.19353583_19353589delAGGTAAC		Somatic		Capture	Illumina GAIIx	Phase_I	17607581	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Splice_Site	DEL	ENST00000261537.6	37	CCDS11871.1																																																																																				0.377	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	Frame_Shift_Del
NEB	4703	broad.mit.edu	37	2	152566216	152566217	+	Frame_Shift_Ins	INS	-	-	T			TCGA-04-1331-01A-01W-0486-08	TCGA-04-1331-10A-01W-0486-08	-	-	T	T	-	-	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	b759b279-fb23-4376-9b89-86b8274fd0bd	38a74c0c-56e7-4e30-b1ae-126cc846b656	g.chr2:152566216_152566217insT	ENST00000172853.10	-	12	1135_1136	c.988_989insA	c.(988-990)acafs	p.T330fs	NEB_ENST00000409198.1_Frame_Shift_Ins_p.T330fs|NEB_ENST00000603639.1_Frame_Shift_Ins_p.T330fs|NEB_ENST00000397345.3_Frame_Shift_Ins_p.T330fs|NEB_ENST00000604864.1_Frame_Shift_Ins_p.T330fs|NEB_ENST00000427231.2_Frame_Shift_Ins_p.T330fs			P20929	NEBU_HUMAN	nebulin	330					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.T330fs*5(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATACTCTGGTGTTTCGGTCTGC	0.386																																																1	Insertion - Frameshift(1)	ovary(1)	2																																								152274463	SO:0001589	frameshift_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.989dupA	2.37:g.152566219_152566219dupT	ENSP00000172853:p.Thr330fs	Somatic		Capture	Illumina GAIIx	Phase_I	152274462	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Frame_Shift_Ins	INS	ENST00000172853.10	37																																																																																					0.386	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
