#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	broad.mit.edu	37	1	33998804	33998804	+	Silent	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr1:33998804C>T	ENST00000373381.4	-	64	10193	c.10017G>A	c.(10015-10017)acG>acA	p.T3339T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T3195T(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATGCGTTGGCGTCTCTGGCT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											32.0	31.0	31.0					1																	33998804		2203	4300	6503	33771391	SO:0001819	synonymous_variant	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10017G>A	1.37:g.33998804C>T		Somatic		Capture	Illumina GAIIx	Phase_I	33771391	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																					0.617	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
LEPRE1	64175	broad.mit.edu	37	1	43213441	43213441	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr1:43213441C>T	ENST00000296388.5	-	13	1918	c.1867G>A	c.(1867-1869)Gat>Aat	p.D623N	LEPRE1_ENST00000462474.1_5'UTR|LEPRE1_ENST00000236040.4_Missense_Mutation_p.D623N|LEPRE1_ENST00000397054.3_Missense_Mutation_p.D623N			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	623	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)	p.D623N(1)		large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TTTCCGCCATCGAAGTCCCCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											159.0	157.0	158.0					1																	43213441		2203	4300	6503	42986028	SO:0001583	missense	64175			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1867G>A	1.37:g.43213441C>T	ENSP00000296388:p.Asp623Asn	Somatic		Capture	Illumina GAIIx	Phase_I	42986028	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	37	CCDS472.2	.	.	.	.	.	.	.	.	.	.	C	32	5.118393	0.94385	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.42131	0.98;0.98;0.98	5.1	5.1	0.69264	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.153987	0.56097	D	0.000023	T	0.53834	0.1821	L	0.61036	1.89	0.45930	D	0.998769	D;P;D	0.63880	0.993;0.94;0.967	P;P;P	0.52710	0.535;0.545;0.707	T	0.59139	-0.7510	10	0.72032	D	0.01	-26.3936	16.0157	0.80439	0.0:1.0:0.0:0.0	.	623;488;623	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	N	623;623;623;488	ENSP00000380245:D623N;ENSP00000236040:D623N;ENSP00000296388:D623N	ENSP00000236040:D623N	D	-	1	0	LEPRE1	42986028	1.000000	0.71417	0.992000	0.48379	0.902000	0.53008	4.613000	0.61176	2.372000	0.80975	0.655000	0.94253	GAT		0.522	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356	
C1orf85	112770	broad.mit.edu	37	1	156264687	156264687	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr1:156264687C>T	ENST00000362007.1	-	2	267	c.241G>A	c.(241-243)Gta>Ata	p.V81I	C1orf85_ENST00000482579.1_5'Flank	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	81					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V81I(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					GCCACCATTACCACTGCCAGA	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	81.0	79.0					1																	156264687		2203	4300	6503	154531311	SO:0001583	missense	112770			BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.241G>A	1.37:g.156264687C>T	ENSP00000354553:p.Val81Ile	Somatic		Capture	Illumina GAIIx	Phase_I	154531311	A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Missense_Mutation	SNP	ENST00000362007.1	37	CCDS1139.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577408	0.28180	.	.	ENSG00000198715	ENST00000362007	T	0.21932	1.98	5.03	2.08	0.27032	.	0.085473	0.48286	D	0.000188	T	0.05686	0.0149	N	0.22421	0.69	0.80722	D	1	B	0.22683	0.073	B	0.21151	0.033	T	0.17745	-1.0359	10	0.59425	D	0.04	0.1357	9.6568	0.39930	0.1042:0.2198:0.676:0.0	.	81	Q8WWB7	NCUG1_HUMAN	I	81	ENSP00000354553:V81I	ENSP00000354553:V81I	V	-	1	0	C1orf85	154531311	1.000000	0.71417	0.848000	0.33437	0.067000	0.16453	2.353000	0.44089	0.152000	0.19188	0.561000	0.74099	GTA		0.617	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052108.1	NM_144580	
HSD17B7	51478	broad.mit.edu	37	1	162773313	162773313	+	Silent	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr1:162773313G>A	ENST00000254521.3	+	6	790	c.735G>A	c.(733-735)ccG>ccA	p.P245P	HSD17B7_ENST00000367917.3_Intron|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	245					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)	p.P245P(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TGTTGATGCCGGCAATATTGC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											122.0	107.0	112.0					1																	162773313		2203	4300	6503	161039937	SO:0001819	synonymous_variant	51478			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.735G>A	1.37:g.162773313G>A		Somatic		Capture	Illumina GAIIx	Phase_I	161039937	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Silent	SNP	ENST00000254521.3	37	CCDS1242.1																																																																																				0.388	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371	
OR51S1	119692	broad.mit.edu	37	11	4870049	4870049	+	Silent	SNP	C	C	G			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr11:4870049C>G	ENST00000322101.2	-	1	465	c.390G>C	c.(388-390)cgG>cgC	p.R130R	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R130R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCCAGTGCCCGATCAATGG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	11											105.0	101.0	103.0					11																	4870049		2201	4298	6499	4826625	SO:0001819	synonymous_variant	119692			AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.390G>C	11.37:g.4870049C>G		Somatic		Capture	Illumina GAIIx	Phase_I	4826625	B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	37	CCDS31362.1																																																																																				0.527	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
OR2AG2	338755	broad.mit.edu	37	11	6789379	6789379	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr11:6789379T>G	ENST00000338569.2	-	1	907	c.810A>C	c.(808-810)caA>caC	p.Q270H		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q270H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGATGTTGTCTTGTTTGGGGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	11											152.0	138.0	143.0					11																	6789379		2201	4296	6497	6745955	SO:0001583	missense	338755			AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.810A>C	11.37:g.6789379T>G	ENSP00000342697:p.Gln270His	Somatic		Capture	Illumina GAIIx	Phase_I	6745955		Missense_Mutation	SNP	ENST00000338569.2	37	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.862119	0.51482	.	.	ENSG00000188124	ENST00000338569	T	0.00169	8.63	4.47	-3.12	0.05282	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000198	T	0.00328	0.0010	M	0.66560	2.04	0.29402	N	0.861852	D	0.89917	1.0	D	0.85130	0.997	T	0.49542	-0.8929	10	0.35671	T	0.21	.	5.158	0.15046	0.1526:0.2605:0.0:0.5869	.	270	A6NM03	O2AG2_HUMAN	H	270	ENSP00000342697:Q270H	ENSP00000342697:Q270H	Q	-	3	2	OR2AG2	6745955	0.000000	0.05858	0.571000	0.28486	0.990000	0.78478	-3.646000	0.00404	-0.558000	0.06118	0.533000	0.62120	CAA		0.512	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
NUP160	23279	broad.mit.edu	37	11	47869814	47869814	+	Silent	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr11:47869814G>A	ENST00000378460.2	-	1	205	c.159C>T	c.(157-159)cgC>cgT	p.R53R	NUP160_ENST00000530326.1_5'UTR|NUP160_ENST00000532747.1_Silent_p.R19R|NUP160_ENST00000526870.1_Silent_p.R53R	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	53					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.R53R(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TCGGCCTTTCGCGCTCAGCTC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	11											65.0	68.0	67.0					11																	47869814		2201	4298	6499	47826390	SO:0001819	synonymous_variant	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.159C>T	11.37:g.47869814G>A		Somatic		Capture	Illumina GAIIx	Phase_I	47826390	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	ENST00000378460.2	37	CCDS31484.1																																																																																				0.652	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	
OR5D14	219436	broad.mit.edu	37	11	55563433	55563433	+	Silent	SNP	T	T	C			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr11:55563433T>C	ENST00000335605.1	+	1	402	c.402T>C	c.(400-402)taT>taC	p.Y134Y		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y134Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CTCTGCTTTATACAGTGGCCA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	11											101.0	90.0	94.0					11																	55563433		2200	4296	6496	55320009	SO:0001819	synonymous_variant	219436			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.402T>C	11.37:g.55563433T>C		Somatic		Capture	Illumina GAIIx	Phase_I	55320009	Q6IF69|Q6IFD4|Q96RB5	Silent	SNP	ENST00000335605.1	37	CCDS31508.1																																																																																				0.542	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
INTS5	80789	broad.mit.edu	37	11	62416167	62416167	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr11:62416167A>G	ENST00000330574.2	-	2	1437	c.1385T>C	c.(1384-1386)cTa>cCa	p.L462P	GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000534779.1_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	462					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.L462P(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						GGGCGGGCCTAGCACCCCTTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											53.0	57.0	56.0					11																	62416167		2202	4299	6501	62172743	SO:0001583	missense	80789			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.1385T>C	11.37:g.62416167A>G	ENSP00000327889:p.Leu462Pro	Somatic		Capture	Illumina GAIIx	Phase_I	62172743	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	ENST00000330574.2	37	CCDS8027.1	.	.	.	.	.	.	.	.	.	.	A	7.798	0.713079	0.15306	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.87	4.87	0.63330	.	0.284524	0.31301	N	0.007882	T	0.48003	0.1476	N	0.08118	0	0.58432	D	0.99999	D	0.64830	0.994	P	0.59889	0.865	T	0.56691	-0.7937	9	0.59425	D	0.04	.	12.476	0.55814	1.0:0.0:0.0:0.0	.	462	Q6P9B9	INT5_HUMAN	P	462	.	ENSP00000327889:L462P	L	-	2	0	INTS5	62172743	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	3.972000	0.56838	2.052000	0.61016	0.533000	0.62120	CTA		0.597	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628	
ALKBH1	8846	broad.mit.edu	37	14	78161112	78161112	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr14:78161112C>T	ENST00000216489.3	-	3	439	c.424G>A	c.(424-426)Gat>Aat	p.D142N	ALKBH1_ENST00000554097.1_5'UTR	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	142					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)	p.D142N(1)		endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TCCCACAGATCTTGGGTCTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	14											207.0	202.0	204.0					14																	78161112		2203	4300	6503	77230865	SO:0001583	missense	8846			X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.424G>A	14.37:g.78161112C>T	ENSP00000216489:p.Asp142Asn	Somatic		Capture	Illumina GAIIx	Phase_I	77230865	Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543728	0.27563	.	.	ENSG00000100601	ENST00000216489	T	0.32753	1.44	6.04	4.22	0.49857	.	0.341305	0.37136	N	0.002238	T	0.17789	0.0427	N	0.16478	0.41	0.34238	D	0.677347	B	0.18013	0.025	B	0.20184	0.028	T	0.18116	-1.0347	10	0.11182	T	0.66	-20.016	12.2332	0.54500	0.0:0.8638:0.0:0.1362	.	142	Q13686	ALKB1_HUMAN	N	142	ENSP00000216489:D142N	ENSP00000216489:D142N	D	-	1	0	ALKBH1	77230865	0.183000	0.23186	0.020000	0.16555	0.996000	0.88848	0.725000	0.25970	1.557000	0.49525	0.563000	0.77884	GAT		0.423	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020	
METTL16	79066	broad.mit.edu	37	17	2323627	2323627	+	Silent	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr17:2323627G>A	ENST00000263092.6	-	10	1453	c.1326C>T	c.(1324-1326)gcC>gcT	p.A442A	METTL16_ENST00000538844.1_Silent_p.A224A|METTL16_ENST00000571669.2_5'UTR	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	442							methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.A442A(1)		kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						CCTCCACAGCGGCAGCCTCGC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	17											61.0	68.0	66.0					17																	2323627		1847	4079	5926	2270377	SO:0001819	synonymous_variant	79066			AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.1326C>T	17.37:g.2323627G>A		Somatic		Capture	Illumina GAIIx	Phase_I	2270377	D3DTI8|Q86TE5|Q96T16|Q9BVG7	Silent	SNP	ENST00000263092.6	37	CCDS42232.1																																																																																				0.657	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437653.2	NM_024086	
ANKRD12	23253	broad.mit.edu	37	18	9208762	9208762	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr18:9208762G>A	ENST00000262126.4	+	5	652	c.412G>A	c.(412-414)Gca>Aca	p.A138T	ANKRD12_ENST00000400020.3_Missense_Mutation_p.A115T|ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000383440.2_Missense_Mutation_p.A115T	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	138						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A138T(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AAAACAGATGGCACTTCTTAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	18											216.0	189.0	198.0					18																	9208762		2203	4300	6503	9198762	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.412G>A	18.37:g.9208762G>A	ENSP00000262126:p.Ala138Thr	Somatic		Capture	Illumina GAIIx	Phase_I	9198762	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755322	0.69648	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T;T	0.56275	3.41;0.47;3.34	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.66819	0.2828	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.992;0.998;0.996	T	0.67608	-0.5627	10	0.72032	D	0.01	-22.3531	20.0951	0.97834	0.0:0.0:1.0:0.0	.	138;115;138	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	T	115;115;138;138	ENSP00000372932:A115T;ENSP00000441510:A115T;ENSP00000262126:A138T	ENSP00000262126:A138T	A	+	1	0	ANKRD12	9198762	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.869000	0.99810	2.753000	0.94483	0.467000	0.42956	GCA		0.413	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
FCAR	2204	broad.mit.edu	37	19	55401079	55401079	+	Silent	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr19:55401079C>T	ENST00000355524.3	+	5	724	c.714C>T	c.(712-714)ctC>ctT	p.L238L	FCAR_ENST00000359272.4_Silent_p.L226L|FCAR_ENST00000391723.3_Missense_Mutation_p.R202C|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391725.3_Silent_p.L216L|FCAR_ENST00000391726.3_Silent_p.L130L|FCAR_ENST00000353758.4_Silent_p.L129L|FCAR_ENST00000391724.3_Silent_p.L204L|FCAR_ENST00000345937.4_Silent_p.L142L	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	238					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L238L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GACTGGTCCTCGTGGCTCTCT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	19											280.0	272.0	274.0					19																	55401079		2203	4300	6503	60092891	SO:0001819	synonymous_variant	2204			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.714C>T	19.37:g.55401079C>T		Somatic		Capture	Illumina GAIIx	Phase_I	60092891	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	ENST00000355524.3	37	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.567171	0.28003	.	.	ENSG00000186431	ENST00000391723	T	0.00594	6.33	3.8	-7.6	0.01303	.	.	.	.	.	T	0.00468	0.0015	.	.	.	0.20074	N	0.999939	B	0.02656	0.0	B	0.01281	0.0	T	0.44620	-0.9316	8	0.87932	D	0	.	4.4982	0.11851	0.0915:0.1127:0.4212:0.3746	.	202	Q92588	.	C	202	ENSP00000375603:R202C	ENSP00000375603:R202C	R	+	1	0	FCAR	60092891	0.000000	0.05858	0.000000	0.03702	0.580000	0.36256	-2.945000	0.00681	-4.119000	0.00072	-0.262000	0.10625	CGT		0.542	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
BRSK1	84446	broad.mit.edu	37	19	55814187	55814187	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr19:55814187G>A	ENST00000309383.1	+	10	1257	c.980G>A	c.(979-981)gGc>gAc	p.G327D	BRSK1_ENST00000585418.1_Missense_Mutation_p.G327D|BRSK1_ENST00000326848.7_Missense_Mutation_p.G22D|BRSK1_ENST00000590333.1_Missense_Mutation_p.G343D	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	327	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.G327D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GCATCACTGGGCTGCTTCAGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	52.0	55.0					19																	55814187		2203	4300	6503	60505999	SO:0001583	missense	84446			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.980G>A	19.37:g.55814187G>A	ENSP00000310649:p.Gly327Asp	Somatic		Capture	Illumina GAIIx	Phase_I	60505999	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	CCDS12921.1	.	.	.	.	.	.	.	.	.	.	.	29.3	4.991245	0.93106	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	T;T	0.74002	-0.8;0.51	4.69	4.69	0.59074	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);	0.000000	0.85682	D	0.000000	D	0.86678	0.5990	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88843	0.3314	10	0.87932	D	0	.	16.7703	0.85535	0.0:0.0:1.0:0.0	.	327;343	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	D	327;22;22	ENSP00000310649:G327D;ENSP00000320853:G22D	ENSP00000310649:G327D	G	+	2	0	BRSK1	60505999	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.347000	0.97059	2.345000	0.79718	0.655000	0.94253	GGC		0.682	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
NLRP5	126206	broad.mit.edu	37	19	56538441	56538441	+	Missense_Mutation	SNP	C	C	T	rs45627733	byFrequency	TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr19:56538441C>T	ENST00000390649.3	+	7	842	c.842C>T	c.(841-843)aCg>aTg	p.T281M		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	281	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.T281M(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CGGCCTCGCACGGTGGTTCTG	0.552													C|||	5	0.000998403	0.0008	0.0	5008	,	,		19235	0.0		0.004	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						C	MET/THR	2,4076		0,2,2037	48.0	51.0	50.0		842	3.3	0.1	19	dbSNP_127	50	15,8337		0,15,4161	yes	missense	NLRP5	NM_153447.4	81	0,17,6198	TT,TC,CC		0.1796,0.049,0.1368	probably-damaging	281/1201	56538441	17,12413	2039	4176	6215	61230253	SO:0001583	missense	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.842C>T	19.37:g.56538441C>T	ENSP00000375063:p.Thr281Met	Somatic		Capture	Illumina GAIIx	Phase_I	61230253	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	13.96	2.392367	0.42410	4.9E-4	0.001796	ENSG00000171487	ENST00000390649	T	0.80393	-1.37	3.35	3.35	0.38373	NACHT nucleoside triphosphatase (1);	0.000000	0.38111	N	0.001820	D	0.87478	0.6187	M	0.76002	2.32	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77879	-0.2423	10	0.87932	D	0	.	10.4875	0.44731	0.0:1.0:0.0:0.0	rs45627733	281	P59047	NALP5_HUMAN	M	281	ENSP00000375063:T281M	ENSP00000375063:T281M	T	+	2	0	NLRP5	61230253	0.039000	0.19947	0.051000	0.19133	0.003000	0.03518	0.688000	0.25422	2.167000	0.68274	0.655000	0.94253	ACG		0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
GTF2A1L	11036	broad.mit.edu	37	2	48873885	48873885	+	Missense_Mutation	SNP	G	G	A	rs61754876	byFrequency	TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr2:48873885G>A	ENST00000403751.3	+	6	719	c.682G>A	c.(682-684)Gtg>Atg	p.V228M	STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.V932M|GTF2A1L_ENST00000430487.2_Missense_Mutation_p.V194M|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.V932M|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.V932M|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.V932M|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.V885M|LHCGR_ENST00000420913.3_Intron	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	228					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.V932M(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCATAAAATCGTGCCTGAAGC	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											123.0	110.0	115.0					2																	48873885		2203	4300	6503	48727389	SO:0001583	missense	286749			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.682G>A	2.37:g.48873885G>A	ENSP00000384597:p.Val228Met	Somatic		Capture	Illumina GAIIx	Phase_I	48727389	B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	37	CCDS46281.1	.	.	.	.	.	.	.	.	.	.	G	3.154	-0.173515	0.06421	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000437125;ENST00000430487;ENST00000403751	T;T;T;T;T;T	0.47528	2.84;2.82;2.84;2.84;3.1;0.84	4.52	-5.33	0.02713	.	1.770990	0.03153	N	0.168183	T	0.16642	0.0400	N	0.00823	-1.155	0.09310	N	1	B;B;B;B;B	0.12013	0.005;0.003;0.002;0.004;0.001	B;B;B;B;B	0.11329	0.004;0.001;0.004;0.006;0.001	T	0.17653	-1.0362	10	0.41790	T	0.15	.	5.411	0.16349	0.336:0.299:0.3649:0.0	.	194;885;932;228;932	Q9UNN4-2;A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;.;TF2AY_HUMAN;.	M	932;932;932;932;885;227;237;194;228	ENSP00000385499:V932M;ENSP00000385701:V932M;ENSP00000378236:V932M;ENSP00000311493:V932M;ENSP00000378234:V885M;ENSP00000396702:V237M	ENSP00000384597:V228M	V	+	1	0	STON1-GTF2A1L;GTF2A1L	48727389	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-0.850000	0.04317	-0.772000	0.04602	-0.948000	0.02665	GTG		0.413	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872	
SNRNP200	23020	broad.mit.edu	37	2	96957584	96957584	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr2:96957584G>A	ENST00000323853.5	-	17	2292	c.2215C>T	c.(2215-2217)Cgg>Tgg	p.R739W	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	739	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.R739W(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CACATGTCCCGGATGGCCCTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	61.0	63.0					2																	96957584		2203	4300	6503	96321311	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.2215C>T	2.37:g.96957584G>A	ENSP00000317123:p.Arg739Trp	Somatic		Capture	Illumina GAIIx	Phase_I	96321311	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482628	0.84747	.	.	ENSG00000144028	ENST00000323853;ENST00000540328	T	0.76316	-1.01	6.17	6.17	0.99709	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	D	0.93031	0.6448	10	0.87932	D	0	-17.1617	12.9695	0.58505	0.0:0.0:0.7432:0.2568	.	739	O75643	U520_HUMAN	W	739;414	ENSP00000317123:R739W	ENSP00000317123:R739W	R	-	1	2	SNRNP200	96321311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.263000	0.51546	2.941000	0.99782	0.655000	0.94253	CGG		0.557	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
SCN10A	6336	broad.mit.edu	37	3	38802218	38802218	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr3:38802218G>A	ENST00000449082.2	-	7	903	c.904C>T	c.(904-906)Cga>Tga	p.R302*		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	302					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R302*(2)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GAAGTGCCTCGCTTATTTATG	0.458																																																2	Substitution - Nonsense(2)	ovary(1)|endometrium(1)	3											113.0	102.0	106.0					3																	38802218		2203	4300	6503	38777222	SO:0001587	stop_gained	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.904C>T	3.37:g.38802218G>A	ENSP00000390600:p.Arg302*	Somatic		Capture	Illumina GAIIx	Phase_I	38777222	A6NDQ1	Nonsense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433282	0.83776	.	.	ENSG00000185313	ENST00000449082	.	.	.	4.36	-2.59	0.06209	.	3.700920	0.04016	U	0.299077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	1.4459	0.02365	0.1636:0.243:0.3468:0.2467	.	.	.	.	X	302	.	ENSP00000390600:R302X	R	-	1	2	SCN10A	38777222	0.000000	0.05858	0.000000	0.03702	0.423000	0.31445	-1.493000	0.02298	-0.311000	0.08754	0.650000	0.86243	CGA		0.458	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
ZNF721	170960	broad.mit.edu	37	4	436638	436638	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr4:436638G>A	ENST00000338977.5	-	2	1630	c.1582C>T	c.(1582-1584)Cag>Tag	p.Q528*	ZNF721_ENST00000511833.2_Nonsense_Mutation_p.Q540*|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron			Q8TF20	ZN721_HUMAN	zinc finger protein 721	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q310*(1)		endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ATTGCGGACTGTCTAAAGGCT	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	4											84.0	91.0	89.0					4																	436638		2109	4257	6366	426638	SO:0001587	stop_gained	170960			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1582C>T	4.37:g.436638G>A	ENSP00000340524:p.Gln528*	Somatic		Capture	Illumina GAIIx	Phase_I	426638	Q69YG7	Nonsense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	G	18.41	3.617074	0.66672	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	.	.	.	0.701	-0.906	0.10524	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	1.6189	0.02709	0.2706:0.0:0.3957:0.3336	.	.	.	.	X	528;540	.	ENSP00000340524:Q528X	Q	-	1	0	ZNF721	426638	0.000000	0.05858	0.000000	0.03702	0.653000	0.38743	-1.439000	0.02414	-0.298000	0.08921	0.184000	0.17185	CAG		0.408	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
RAB28	9364	broad.mit.edu	37	4	13383174	13383174	+	Missense_Mutation	SNP	G	G	A	rs139395840	byFrequency	TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr4:13383174G>A	ENST00000330852.5	-	5	650	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W	RAB28_ENST00000288723.4_Missense_Mutation_p.R146W|RAB28_ENST00000338176.4_Missense_Mutation_p.R146W	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	146					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R146W(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						TGGCAAAACCGTAAGTGTTTT	0.328													G|||	4	0.000798722	0.003	0.0	5008	,	,		14322	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	4						G	TRP/ARG,TRP/ARG,TRP/ARG	4,4402	8.1+/-20.4	0,4,2199	67.0	69.0	69.0		436,436,436	2.1	0.7	4	dbSNP_134	69	0,8600		0,0,4300	yes	missense,missense,missense	RAB28	NM_001017979.2,NM_001159601.1,NM_004249.3	101,101,101	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging,probably-damaging,probably-damaging	146/222,146/205,146/221	13383174	4,13002	2203	4300	6503	12992272	SO:0001583	missense	9364			X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.436C>T	4.37:g.13383174G>A	ENSP00000328551:p.Arg146Trp	Somatic		Capture	Illumina GAIIx	Phase_I	12992272	G8JLC5|Q8IYR8|Q8NI05	Missense_Mutation	SNP	ENST00000330852.5	37	CCDS33961.1	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	19.70|19.70	3.877388|3.877388	0.72294|0.72294	9.08E-4|9.08E-4	0.0|0.0	ENSG00000157869|ENSG00000157869	ENST00000330852;ENST00000288723;ENST00000338176|ENST00000511649	T;T;T|.	0.77489|.	-1.1;-1.1;-1.1|.	5.87|5.87	2.09|2.09	0.27110|0.27110	Small GTP-binding protein domain (1);|.	0.119762|.	0.56097|.	N|.	0.000037|.	T|T	0.63908|0.63908	0.2551|0.2551	M|M	0.71871|0.71871	2.18|2.18	0.58432|0.58432	D|D	0.999997|0.999997	D;D|.	0.76494|.	0.999;0.999|.	P;P|.	0.61940|.	0.896;0.892|.	T|T	0.58498|0.58498	-0.7626|-0.7626	10|5	0.72032|.	D|.	0.01|.	.|.	9.5919|9.5919	0.39550|0.39550	0.0646:0.0:0.4075:0.5279|0.0646:0.0:0.4075:0.5279	.|.	146;146|.	P51157;P51157-2|.	RAB28_HUMAN;.|.	W|M	146|68	ENSP00000328551:R146W;ENSP00000288723:R146W;ENSP00000340079:R146W|.	ENSP00000288723:R146W|.	R|T	-|-	1|2	2|0	RAB28|RAB28	12992272|12992272	1.000000|1.000000	0.71417|0.71417	0.707000|0.707000	0.30419|0.30419	0.997000|0.997000	0.91878|0.91878	1.971000|1.971000	0.40530|0.40530	0.064000|0.064000	0.16427|0.16427	0.585000|0.585000	0.79938|0.79938	CGG|ACG		0.328	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979	
KIT	3815	broad.mit.edu	37	4	55604662	55604662	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr4:55604662T>C	ENST00000288135.5	+	21	2967	c.2870T>C	c.(2869-2871)aTc>aCc	p.I957T		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	957					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I957T(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTGTGCGGATCAATTCTGTC	0.527		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - Missense(1)	ovary(1)	4											135.0	129.0	131.0					4																	55604662		2203	4300	6503	55299419	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2870T>C	4.37:g.55604662T>C	ENSP00000288135:p.Ile957Thr	Somatic		Capture	Illumina GAIIx	Phase_I	55299419	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.303566	0.60195	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.77358	-1.09;-1.09	5.72	5.72	0.89469	.	0.137643	0.38381	N	0.001715	T	0.76428	0.3986	L	0.55481	1.735	0.46011	D	0.99881	B;P	0.36768	0.127;0.569	B;B	0.39771	0.139;0.309	T	0.78816	-0.2055	10	0.72032	D	0.01	.	14.2508	0.66019	0.0:0.0:0.0:1.0	.	953;957	P10721-2;P10721	.;KIT_HUMAN	T	957;953	ENSP00000288135:I957T;ENSP00000390987:I953T	ENSP00000288135:I957T	I	+	2	0	KIT	55299419	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	6.703000	0.74633	2.185000	0.69588	0.459000	0.35465	ATC		0.527	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
MTRR	4552	broad.mit.edu	37	5	7897055	7897055	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr5:7897055G>T	ENST00000264668.2	+	13	1866	c.1836G>T	c.(1834-1836)agG>agT	p.R612S	MTRR_ENST00000440940.2_Missense_Mutation_p.R585S	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	612					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)	p.R612S(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ATAAGGATAGGGATTATCTAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	5											57.0	60.0	59.0					5																	7897055		2203	4300	6503	7950055	SO:0001583	missense	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1836G>T	5.37:g.7897055G>T	ENSP00000264668:p.Arg612Ser	Somatic		Capture	Illumina GAIIx	Phase_I	7950055	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548085	0.65311	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	T;T	0.77620	-1.11;-1.11	5.49	-0.487	0.12060	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.368957	0.35291	N	0.003302	T	0.69637	0.3133	N	0.25332	0.735	0.80722	D	1	D	0.59357	0.985	P	0.58820	0.846	T	0.63941	-0.6523	10	0.15066	T	0.55	-27.1968	5.7448	0.18114	0.6517:0.0:0.1904:0.1579	.	612	Q9UBK8	MTRR_HUMAN	S	612;585	ENSP00000264668:R612S;ENSP00000402510:R585S	ENSP00000264668:R612S	R	+	3	2	MTRR	7950055	0.996000	0.38824	0.095000	0.20976	0.958000	0.62258	0.727000	0.25999	-0.015000	0.14150	-0.345000	0.07892	AGG		0.363	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
ANKRD32	84250	broad.mit.edu	37	5	94031004	94031004	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr5:94031004T>C	ENST00000265140.5	+	21	3583	c.3164T>C	c.(3163-3165)aTg>aCg	p.M1055T	ANKRD32_ENST00000493934.1_Intron	NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	1055						centrosome (GO:0005813)|nucleus (GO:0005634)		p.M419T(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		CGGTCAGTCATGGAGTTTTCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											149.0	151.0	151.0					5																	94031004		2146	4264	6410	94056760	SO:0001583	missense	84250			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.3164T>C	5.37:g.94031004T>C	ENSP00000265140:p.Met1055Thr	Somatic		Capture	Illumina GAIIx	Phase_I	94056760	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	T	0.091	-1.167230	0.01660	.	.	ENSG00000133302	ENST00000265140	T	0.37752	1.18	5.55	2.7	0.31948	.	1.450950	0.04061	N	0.306306	T	0.12860	0.0312	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33777	-0.9855	10	0.02654	T	1	.	5.4602	0.16612	0.0:0.6128:0.1445:0.2427	.	1055	Q9BQI6	ANR32_HUMAN	T	1055	ENSP00000265140:M1055T	ENSP00000265140:M1055T	M	+	2	0	ANKRD32	94056760	0.329000	0.24696	0.974000	0.42286	0.967000	0.64934	0.012000	0.13287	0.717000	0.32145	-0.132000	0.14878	ATG		0.408	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
WDR36	134430	broad.mit.edu	37	5	110446633	110446633	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr5:110446633A>G	ENST00000513710.2	+	14	1760	c.1756A>G	c.(1756-1758)Atg>Gtg	p.M586V	WDR36_ENST00000505303.1_Missense_Mutation_p.M530V|WDR36_ENST00000506538.2_Missense_Mutation_p.M586V			Q8NI36	WDR36_HUMAN	WD repeat domain 36	586					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.M586V(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TCCAAATATCATGTTGCTACA	0.323																																																1	Substitution - Missense(1)	ovary(1)	5											77.0	81.0	80.0					5																	110446633		2202	4298	6500	110474532	SO:0001583	missense	134430			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1756A>G	5.37:g.110446633A>G	ENSP00000424628:p.Met586Val	Somatic		Capture	Illumina GAIIx	Phase_I	110474532	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	A	5.003	0.186324	0.09495	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.77877	-1.13;-1.13;-0.23	5.72	4.52	0.55395	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.426061	0.32328	N	0.006251	T	0.66761	0.2822	L	0.38531	1.155	0.30955	N	0.724308	B	0.12630	0.006	B	0.10450	0.005	T	0.65915	-0.6052	10	0.87932	D	0	-12.3979	7.3552	0.26714	0.7823:0.1459:0.0719:0.0	.	586	Q8NI36	WDR36_HUMAN	V	586;586;530	ENSP00000423067:M586V;ENSP00000424628:M586V;ENSP00000422158:M530V	ENSP00000422158:M530V	M	+	1	0	WDR36	110474532	0.994000	0.37717	0.971000	0.41717	0.519000	0.34347	2.538000	0.45710	0.943000	0.37553	0.528000	0.53228	ATG		0.323	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
CAMK4	814	broad.mit.edu	37	5	110819728	110819728	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr5:110819728C>A	ENST00000282356.4	+	11	1384	c.986C>A	c.(985-987)gCg>gAg	p.A329E	CAMK4_ENST00000512890.1_3'UTR|CAMK4_ENST00000512453.1_Missense_Mutation_p.A329E	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	329	Calmodulin-binding. {ECO:0000255}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.A329E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AATCAGGCAGCGGTGAAGGCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											32.0	34.0	33.0					5																	110819728		2201	4295	6496	110847627	SO:0001583	missense	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.986C>A	5.37:g.110819728C>A	ENSP00000282356:p.Ala329Glu	Somatic		Capture	Illumina GAIIx	Phase_I	110847627	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022756	0.93462	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.69926	-0.44;-0.44	5.81	5.81	0.92471	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80944	0.4721	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81300	-0.0995	10	0.87932	D	0	.	20.0749	0.97738	0.0:1.0:0.0:0.0	.	329	Q16566	KCC4_HUMAN	E	329	ENSP00000422634:A329E;ENSP00000282356:A329E	ENSP00000282356:A329E	A	+	2	0	CAMK4	110847627	1.000000	0.71417	0.744000	0.31058	0.989000	0.77384	5.526000	0.67116	2.759000	0.94783	0.591000	0.81541	GCG		0.542	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744	
SH3PXD2B	285590	broad.mit.edu	37	5	171765936	171765936	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr5:171765936A>C	ENST00000311601.5	-	13	2343	c.2173T>G	c.(2173-2175)Tcc>Gcc	p.S725A	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	725					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.S725A(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCTCTGCAGGAAATCTCTTTT	0.627																																																1	Substitution - Missense(1)	ovary(1)	5											37.0	41.0	40.0					5																	171765936		2203	4300	6503	171698541	SO:0001583	missense	285590			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2173T>G	5.37:g.171765936A>C	ENSP00000309714:p.Ser725Ala	Somatic		Capture	Illumina GAIIx	Phase_I	171698541	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	37	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	A	1.619	-0.522042	0.04171	.	.	ENSG00000174705	ENST00000311601	T	0.60424	0.19	5.42	-5.97	0.02227	.	1.382880	0.04422	N	0.367776	T	0.38772	0.1053	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23619	-1.0183	9	.	.	.	-1.4909	11.2014	0.48743	0.1713:0.2735:0.5551:0.0	.	725	A1X283	SPD2B_HUMAN	A	725	ENSP00000309714:S725A	.	S	-	1	0	SH3PXD2B	171698541	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.609000	0.05635	-1.240000	0.02529	0.459000	0.35465	TCC		0.627	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
FEZF1	389549	broad.mit.edu	37	7	121943234	121943234	+	Silent	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr7:121943234C>T	ENST00000442488.2	-	2	1000	c.933G>A	c.(931-933)acG>acA	p.T311T	FEZF1_ENST00000331178.4_Silent_p.T307T|FEZF1-AS1_ENST00000437317.1_RNA|FEZF1_ENST00000427185.2_Silent_p.T261T|FEZF1-AS1_ENST00000428449.1_RNA	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	311					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.T307T(1)		breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						AACACACCTGCGTGTGAATGA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	7											140.0	134.0	136.0					7																	121943234		2203	4300	6503	121730470	SO:0001819	synonymous_variant	389549			AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.933G>A	7.37:g.121943234C>T		Somatic		Capture	Illumina GAIIx	Phase_I	121730470	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Silent	SNP	ENST00000442488.2	37	CCDS34741.2																																																																																				0.458	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347410.1	NM_001024613	
GDF6	392255	broad.mit.edu	37	8	97172702	97172702	+	Silent	SNP	G	G	A			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr8:97172702G>A	ENST00000287020.5	-	1	318	c.219C>T	c.(217-219)gaC>gaT	p.D73D		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	73					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.D73D(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					CCCGGGGTTCGTCCTGAGGCC	0.701																																																1	Substitution - coding silent(1)	ovary(1)	8											37.0	45.0	42.0					8																	97172702		2195	4289	6484	97241878	SO:0001819	synonymous_variant	392255				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.219C>T	8.37:g.97172702G>A		Somatic		Capture	Illumina GAIIx	Phase_I	97241878	Q6PI58	Silent	SNP	ENST00000287020.5	37	CCDS34926.1																																																																																				0.701	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557	
PAPPA	5069	broad.mit.edu	37	9	119065126	119065126	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr9:119065126C>G	ENST00000328252.3	+	10	3413	c.3044C>G	c.(3043-3045)aCg>aGg	p.T1015R	PAPPA_ENST00000534838.1_Missense_Mutation_p.T53R|RP11-45A16.4_ENST00000451100.1_RNA	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1015					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T1015R(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGTGTCTACACGCCCCAGGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											124.0	108.0	113.0					9																	119065126		2203	4300	6503	118104947	SO:0001583	missense	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3044C>G	9.37:g.119065126C>G	ENSP00000330658:p.Thr1015Arg	Somatic		Capture	Illumina GAIIx	Phase_I	118104947	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.942695	0.92526	.	.	ENSG00000182752	ENST00000328252;ENST00000443904;ENST00000534838	T;T	0.54071	0.59;0.59	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.77287	0.4108	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.78494	-0.2182	10	0.87932	D	0	-10.923	20.6244	0.99512	0.0:1.0:0.0:0.0	.	53;459;1015	F5GZ19;E7EMD3;Q13219	.;.;PAPP1_HUMAN	R	1015;459;53	ENSP00000330658:T1015R;ENSP00000441461:T53R	ENSP00000330658:T1015R	T	+	2	0	PAPPA	118104947	1.000000	0.71417	0.977000	0.42913	0.971000	0.66376	7.696000	0.84270	2.879000	0.98667	0.650000	0.86243	ACG		0.512	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
TLR4	7099	broad.mit.edu	37	9	120475251	120475251	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chr9:120475251A>G	ENST00000355622.6	+	3	946	c.845A>G	c.(844-846)aAt>aGt	p.N282S	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.N242S	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	282					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.N282S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GGCCTGTGCAATTTGACCATT	0.373																																																1	Substitution - Missense(1)	ovary(1)	9											93.0	99.0	97.0					9																	120475251		2203	4300	6503	119515072	SO:0001583	missense	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.845A>G	9.37:g.120475251A>G	ENSP00000363089:p.Asn282Ser	Somatic		Capture	Illumina GAIIx	Phase_I	119515072	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	A	1.363	-0.588154	0.03799	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.37915	1.45;1.17	5.78	3.46	0.39613	.	0.414246	0.25200	N	0.032391	T	0.27731	0.0682	L	0.47716	1.5	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.23583	-1.0184	10	0.16420	T	0.52	.	9.2	0.37251	0.8776:0.0:0.1224:0.0	.	282	O00206	TLR4_HUMAN	S	242;282	ENSP00000377997:N242S;ENSP00000363089:N282S	ENSP00000363089:N282S	N	+	2	0	TLR4	119515072	0.001000	0.12720	0.045000	0.18777	0.047000	0.14425	1.353000	0.34045	0.480000	0.27534	0.533000	0.62120	AAT		0.373	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
L1CAM	3897	broad.mit.edu	37	X	153129865	153129865	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1342-01A-01W-0486-08	TCGA-04-1342-11A-01W-0487-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6d6e1264-33ec-40e6-adc1-f615cd65f95c	f9bf2033-8805-44aa-910c-c64bd388d4d3	g.chrX:153129865C>T	ENST00000370060.1	-	25	3423	c.3234G>A	c.(3232-3234)tgG>tgA	p.W1078*	L1CAM_ENST00000370057.3_Nonsense_Mutation_p.W1078*|L1CAM_ENST00000543994.1_Nonsense_Mutation_p.W1080*|L1CAM_ENST00000538883.1_Nonsense_Mutation_p.W1080*|L1CAM_ENST00000361981.3_Nonsense_Mutation_p.W1073*|L1CAM_ENST00000370055.1_Nonsense_Mutation_p.W1073*|L1CAM_ENST00000361699.4_Nonsense_Mutation_p.W1078*	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1078	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.W1078*(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTGCAGGTCCCACTGCGTGT	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	X											141.0	123.0	130.0					X																	153129865		2203	4300	6503	152783059	SO:0001587	stop_gained	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3234G>A	X.37:g.153129865C>T	ENSP00000359077:p.Trp1078*	Somatic		Capture	Illumina GAIIx	Phase_I	152783059	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Nonsense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847699	0.91277	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	.	.	.	4.55	4.55	0.56014	.	0.430644	0.20032	N	0.100688	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.937	0.52878	0.0:1.0:0.0:0.0	.	.	.	.	X	1078;1080;1078;1080;1073;1073;23;1078	.	ENSP00000355380:W1078X	W	-	3	0	L1CAM	152783059	0.981000	0.34729	0.974000	0.42286	0.925000	0.55904	1.398000	0.34554	1.848000	0.53677	0.468000	0.43344	TGG		0.582	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
