#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
IGSF21	84966	genome.wustl.edu	37	1	18704791	18704791	+	Missense_Mutation	SNP	G	G	A	rs201364974	byFrequency	TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:18704791G>A	ENST00000251296.1	+	10	1758	c.1375G>A	c.(1375-1377)Gcc>Acc	p.A459T		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	459						extracellular region (GO:0005576)		p.A459T(2)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CTTGGTGCTCGCCCTGACAGT	0.582													G|||	3	0.000599042	0.0	0.0014	5008	,	,		14577	0.0		0.001	False		,,,				2504	0.001															2	Substitution - Missense(2)	ovary(1)|prostate(1)	1						G	THR/ALA	0,4406		0,0,2203	52.0	47.0	49.0		1375	3.5	1.0	1		49	2,8598	2.2+/-6.3	0,2,4298	yes	missense	IGSF21	NM_032880.4	58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	459/468	18704791	2,13004	2203	4300	6503	18577378	SO:0001583	missense	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.1375G>A	1.37:g.18704791G>A	ENSP00000251296:p.Ala459Thr	Somatic		Capture	Illumina GAIIx	4	18577378	Q8NBR8	Missense_Mutation	SNP	HMMPfam_ig;superfamily_Immunoglobulin	p.A459T	ENST00000251296.1	37	c.1375	CCDS184.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	12.87	2.066630	0.36470	0.0	2.33E-4	ENSG00000117154	ENST00000251296	T	0.52983	0.64	5.39	3.54	0.40534	.	0.591091	0.17376	N	0.176496	T	0.25644	0.0624	N	0.12182	0.205	0.33490	D	0.588584	B	0.21147	0.052	B	0.06405	0.002	T	0.24657	-1.0154	10	0.23302	T	0.38	-12.4312	7.5838	0.27980	0.3209:0.0:0.6791:0.0	.	459	Q96ID5	IGS21_HUMAN	T	459	ENSP00000251296:A459T	ENSP00000251296:A459T	A	+	1	0	IGSF21	18577378	0.969000	0.33509	0.994000	0.49952	0.963000	0.63663	0.511000	0.22739	0.794000	0.33899	0.561000	0.74099	GCC	-	NULL		0.582	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	protein_coding	OTTHUMT00000006924.1	G	NM_032880		18577378	1	no_errors	NM_032880	genbank	human	provisional	54_36p	missense	SNP	1	A
OLFM3	118427	genome.wustl.edu	37	1	102290780	102290780	+	Missense_Mutation	SNP	C	C	G	rs373338533		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:102290780C>G	ENST00000338858.5	-	4	453	c.454G>C	c.(454-456)Gag>Cag	p.E152Q	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000536598.1_Missense_Mutation_p.E57Q|OLFM3_ENST00000359814.3_Missense_Mutation_p.E152Q|OLFM3_ENST00000370103.4_Missense_Mutation_p.E132Q			Q96PB7	NOE3_HUMAN	olfactomedin 3	152					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.E132Q(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		GGCAGGAGCTCGTCCATTTTC	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	73.0	73.0					1																	102290780		2203	4300	6503	102063368	SO:0001583	missense	118427			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.454G>C	1.37:g.102290780C>G	ENSP00000345192:p.Glu152Gln	Somatic		Capture	Illumina GAIIx	Phase_III	102063368	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	HMMPfam_OLF,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase	p.E132Q	ENST00000338858.5	37	c.394		1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013385	0.35511	.	.	ENSG00000118733	ENST00000424771;ENST00000370103;ENST00000338858;ENST00000536598;ENST00000359814	D;D;T;T	0.89746	-2.56;-2.54;-0.78;0.32	5.8	5.8	0.92144	.	0.311762	0.34959	N	0.003550	T	0.81034	0.4739	L	0.36672	1.1	0.38023	D	0.934921	B;B	0.32160	0.082;0.358	B;B	0.31547	0.045;0.132	T	0.80313	-0.1435	10	0.42905	T	0.14	.	20.0452	0.97606	0.0:1.0:0.0:0.0	.	132;152	Q5T3V6;Q96PB7	.;NOE3_HUMAN	Q	3;132;152;57;152	ENSP00000359121:E132Q;ENSP00000345192:E152Q;ENSP00000443471:E57Q;ENSP00000352867:E152Q	ENSP00000345192:E152Q	E	-	1	0	OLFM3	102063368	0.994000	0.37717	0.957000	0.39632	0.470000	0.32858	3.221000	0.51215	2.742000	0.94016	0.655000	0.94253	GAG	-	NULL		0.413	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	protein_coding	OTTHUMT00000030142.1	C			102063368	-1	no_errors	NM_058170	genbank	human	validated	54_36p	missense	SNP	0.997	G
IL12RB2	3595	genome.wustl.edu	37	1	67795362	67795362	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:67795362C>A	ENST00000262345.1	+	6	1397	c.757C>A	c.(757-759)Ctg>Atg	p.L253M	IL12RB2_ENST00000541374.1_Missense_Mutation_p.L253M|IL12RB2_ENST00000371000.1_Missense_Mutation_p.L253M|IL12RB2_ENST00000544434.1_Missense_Mutation_p.L253M	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	253	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.L253M(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						GGGACTGGTACTGCTTAATCG	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											142.0	135.0	138.0					1																	67795362		2203	4300	6503	67567950	SO:0001583	missense	3595			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.757C>A	1.37:g.67795362C>A	ENSP00000262345:p.Leu253Met	Somatic		Capture	Illumina GAIIx	4	67567950	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_Lep_receptor_Ig	p.L253M	ENST00000262345.1	37	c.757	CCDS638.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.684|8.684	0.905832|0.905832	0.17760|0.17760	.|.	.|.	ENSG00000081985|ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434|ENST00000441640	T;T;T;T|.	0.58797|.	0.31;0.31;0.31;0.31|.	5.2|5.2	-0.482|-0.482	0.12078|0.12078	Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	1.301510|.	0.04683|.	N|.	0.412781|.	T|T	0.10337|0.10337	0.0253|0.0253	L|L	0.41236|0.41236	1.265|1.265	0.26413|0.26413	N|N	0.976233|0.976233	B;P;B;B|.	0.38335|.	0.394;0.627;0.168;0.278|.	B;B;B;B|.	0.36030|.	0.079;0.216;0.107;0.057|.	T|T	0.31806|0.31806	-0.9930|-0.9930	10|5	0.62326|.	D|.	0.03|.	-3.8341|-3.8341	0.7912|0.7912	0.01057|0.01057	0.3116:0.3375:0.1631:0.1878|0.3116:0.3375:0.1631:0.1878	.|.	253;253;253;253|.	B4DGA4;F5H7L6;Q99665-2;Q99665|.	.;.;.;I12R2_HUMAN|.	M|N	253|120	ENSP00000262345:L253M;ENSP00000360039:L253M;ENSP00000445276:L253M;ENSP00000442443:L253M|.	ENSP00000262345:L253M|.	L|T	+|+	1|2	2|0	IL12RB2|IL12RB2	67567950|67567950	0.021000|0.021000	0.18746|0.18746	0.914000|0.914000	0.36105|0.36105	0.363000|0.363000	0.29612|0.29612	-0.190000|-0.190000	0.09615|0.09615	0.243000|0.243000	0.21327|0.21327	0.561000|0.561000	0.74099|0.74099	CTG|ACT	-	NULL		0.418	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	protein_coding	OTTHUMT00000025202.2	C	NM_001559		67567950	1	no_errors	NM_001559	genbank	human	reviewed	54_36p	missense	SNP	0.06	A
TYW3	127253	genome.wustl.edu	37	1	75202277	75202277	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:75202277A>G	ENST00000370867.3	+	2	315	c.226A>G	c.(226-228)Aca>Gca	p.T76A	TYW3_ENST00000421739.2_Intron|TYW3_ENST00000479111.1_5'UTR|TYW3_ENST00000457880.2_Missense_Mutation_p.T76A	NM_138467.2	NP_612476.1	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)	76					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)	p.T76A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|ovary(2)|prostate(1)|skin(1)	15						GCTACTGGTTACACACAAACT	0.234																																																1	Substitution - Missense(1)	ovary(1)	1											45.0	54.0	51.0					1																	75202277		2201	4285	6486	74974865	SO:0001583	missense	127253			BX647591	CCDS666.1, CCDS53334.1	1p31.1	2008-02-05	2006-05-25	2006-05-25	ENSG00000162623	ENSG00000162623			24757	protein-coding gene	gene with protein product		611245	"""chromosome 1 open reading frame 171"""	C1orf171		17150819	Standard	NM_138467		Approved	FLJ40918	uc001dgn.3	Q6IPR3	OTTHUMG00000009641	ENST00000370867.3:c.226A>G	1.37:g.75202277A>G	ENSP00000359904:p.Thr76Ala	Somatic		Capture	Illumina GAIIx	4	74974865	B4DSP9|E9PGR7|Q5HYJ0|Q8N7L1	Missense_Mutation	SNP	-	p.T76A	ENST00000370867.3	37	c.226	CCDS666.1	1	.	.	.	.	.	.	.	.	.	.	A	14.27	2.483884	0.44147	.	.	ENSG00000162623	ENST00000457880;ENST00000370867	T;T	0.29917	1.55;1.55	5.71	3.26	0.37387	tRNA wybutosine-synthesizing protein (2);	0.205143	0.49916	D	0.000134	T	0.29588	0.0738	M	0.83953	2.67	0.80722	D	1	P;B	0.44659	0.84;0.412	P;B	0.48334	0.574;0.345	T	0.07009	-1.0795	10	0.45353	T	0.12	-11.3457	9.9647	0.41717	0.729:0.0:0.0:0.271	.	76;76	E9PGR7;Q6IPR3	.;TYW3_HUMAN	A	76	ENSP00000407025:T76A;ENSP00000359904:T76A	ENSP00000359904:T76A	T	+	1	0	TYW3	74974865	0.994000	0.37717	0.962000	0.40283	0.858000	0.48976	3.174000	0.50847	0.362000	0.24319	0.477000	0.44152	ACA	-	NULL		0.234	TYW3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW3	protein_coding	OTTHUMT00000026573.1	A	NM_138467		74974865	1	no_errors	NM_138467	genbank	human	provisional	54_36p	missense	SNP	1	G
DPYD	1806	genome.wustl.edu	37	1	98015254	98015254	+	Silent	SNP	T	T	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:98015254T>G	ENST00000370192.3	-	12	1486	c.1386A>C	c.(1384-1386)ccA>ccC	p.P462P		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	462					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.P462P(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	GATCTACTTCTGGGAGACCCC	0.398																																																1	Substitution - coding silent(1)	ovary(1)	1											90.0	80.0	84.0					1																	98015254		2203	4300	6503	97787842	SO:0001819	synonymous_variant	1806			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1386A>C	1.37:g.98015254T>G		Somatic		Capture	Illumina GAIIx	4	97787842	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Silent	SNP	HMMPfam_DHO_dh;HMMPfam_Fer4;superfamily_alpha-helical ferredoxin;HMMPfam_Pyr_redox_2;superfamily_FMN-linked oxidoreductases;superfamily_Nucleotide-binding domain;superfamily_4Fe-4S ferredoxins	p.P462	ENST00000370192.3	37	c.1386	CCDS30777.1	1																																																																																			-	HMMPfam_Pyr_redox_2		0.398	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	protein_coding	OTTHUMT00000095698.3	T	NM_000110		97787842	-1	no_errors	NM_000110	genbank	human	reviewed	54_36p	silent	SNP	1	G
OR2T6	254879	genome.wustl.edu	37	1	248551073	248551073	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:248551073T>C	ENST00000355728.2	+	1	164	c.164T>C	c.(163-165)cTc>cCc	p.L55P		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L55P(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GACCCTCATCTCCACACCCCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											232.0	183.0	200.0					1																	248551073		2203	4300	6503	246617696	SO:0001583	missense	254879			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.164T>C	1.37:g.248551073T>C	ENSP00000347965:p.Leu55Pro	Somatic		Capture	Illumina GAIIx	4	246617696	A6NE36	Missense_Mutation	SNP	-	p.L55P	ENST00000355728.2	37	c.164	CCDS31114.1	1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.513684	0.64522	.	.	ENSG00000198104	ENST00000355728	T	0.14893	2.47	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37095	N	0.002260	T	0.61426	0.2346	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79152	-0.1921	10	0.87932	D	0	.	13.6971	0.62587	0.0:0.0:0.0:1.0	.	55	Q8NHC8	OR2T6_HUMAN	P	55	ENSP00000347965:L55P	ENSP00000347965:L55P	L	+	2	0	OR2T6	246617696	1.000000	0.71417	0.926000	0.36857	0.698000	0.40448	6.895000	0.75660	1.962000	0.57031	0.523000	0.50628	CTC	-	NULL		0.468	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T6	protein_coding	OTTHUMT00000097344.1	T	NM_001005471		246617696	1	no_errors	NM_001005471	genbank	human	provisional	54_36p	missense	SNP	0.99	C
ITGA8	8516	genome.wustl.edu	37	10	15726087	15726087	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr10:15726087T>C	ENST00000378076.3	-	4	837	c.484A>G	c.(484-486)Aca>Gca	p.T162A		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	162					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.T162A(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TTTTCTGGTGTCGGTTTAAGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	91.0	91.0					10																	15726087		2203	4300	6503	15766093	SO:0001583	missense	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.484A>G	10.37:g.15726087T>C	ENSP00000367316:p.Thr162Ala	Somatic		Capture	Illumina GAIIx	4	15766093	B0YJ31|Q5VX94	Missense_Mutation	SNP	HMMPfam_Integrin_alpha;HMMPfam_FG-GAP;HMMPfam_Integrin_alpha2;superfamily_Integrin domains;superfamily_Integrin alpha N-terminal domain	p.T162A	ENST00000378076.3	37	c.484	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	T	2.350	-0.348981	0.05208	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.53857	0.6	6.03	-0.764	0.11027	.	0.450224	0.27782	N	0.017878	T	0.28067	0.0692	N	0.25647	0.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.15752	-1.0426	10	0.10902	T	0.67	.	4.2081	0.10498	0.2242:0.2635:0.0:0.5123	.	162;162	F5H818;P53708	.;ITA8_HUMAN	A	162	ENSP00000367316:T162A	ENSP00000367316:T162A	T	-	1	0	ITGA8	15766093	0.004000	0.15560	0.000000	0.03702	0.173000	0.22820	0.848000	0.27710	-0.371000	0.08004	-0.256000	0.11100	ACA	-	NULL		0.413	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	protein_coding	OTTHUMT00000046987.1	T	NM_003638		15766093	-1	no_errors	NM_003638	genbank	human	provisional	54_36p	missense	SNP		C
GRIA4	2893	genome.wustl.edu	37	11	105776020	105776020	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:105776020C>A	ENST00000530497.1	+	8	1151	c.1151C>A	c.(1150-1152)cCt>cAt	p.P384H	GRIA4_ENST00000393127.2_Missense_Mutation_p.P384H|GRIA4_ENST00000525187.1_Missense_Mutation_p.P384H|GRIA4_ENST00000393125.2_Missense_Mutation_p.P384H|GRIA4_ENST00000282499.5_Missense_Mutation_p.P384H|GRIA4_ENST00000428631.2_Missense_Mutation_p.P384H			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	384					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.P384H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		AGCACAGGACCTAGAAAGGTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	103.0	106.0					11																	105776020		2202	4299	6501	105281230	SO:0001583	missense	2893			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1151C>A	11.37:g.105776020C>A	ENSP00000435775:p.Pro384His	Somatic		Capture	Illumina GAIIx	4	105281230	Q86XE8	Missense_Mutation	SNP	HMMPfam_Lig_chan;HMMPfam_ANF_receptor;superfamily_Periplasmic binding protein-like I;superfamily_Periplasmic binding protein-like II;superfamily_Voltage-gated potassium channels	p.P384H	ENST00000530497.1	37	c.1151	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	c	21.6	4.176269	0.78564	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000001	T	0.37839	0.1018	L	0.60845	1.875	0.58432	D	0.999993	B;D;D	0.63880	0.203;0.976;0.993	B;P;P	0.58928	0.115;0.848;0.771	T	0.02736	-1.1117	10	0.59425	D	0.04	.	13.5466	0.61707	0.0:0.9288:0.0:0.0712	.	384;384;384	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	H	384	ENSP00000376833:P384H;ENSP00000282499:P384H;ENSP00000376835:P384H;ENSP00000415551:P384H;ENSP00000435775:P384H;ENSP00000432180:P384H	ENSP00000282499:P384H	P	+	2	0	GRIA4	105281230	0.999000	0.42202	0.963000	0.40424	0.958000	0.62258	4.638000	0.61353	2.881000	0.98747	0.651000	0.88453	CCT	-	NULL		0.393	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	protein_coding	OTTHUMT00000388593.1	C			105281230	1	no_errors	NM_000829	genbank	human	reviewed	54_36p	missense	SNP	0.93	A
SYT9	143425	genome.wustl.edu	37	11	7439231	7439231	+	Silent	SNP	G	G	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:7439231G>T	ENST00000318881.6	+	5	1446	c.1209G>T	c.(1207-1209)ctG>ctT	p.L403L		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	403	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.L403L(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		GCAGACGACTGAAGAAGAGGA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	11											167.0	136.0	147.0					11																	7439231		2201	4296	6497	7395807	SO:0001819	synonymous_variant	143425			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1209G>T	11.37:g.7439231G>T		Somatic		Capture	Illumina GAIIx	Phase_III	7395807		Silent	SNP	-	p.L403	ENST00000318881.6	37	c.1209	CCDS7778.1	11																																																																																			-	NULL		0.468	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	protein_coding	OTTHUMT00000384483.1	G	NM_175733		7395807	1	no_errors	NM_175733	genbank	human	provisional	54_36p	silent	SNP	0.995	T
PRR5L	79899	genome.wustl.edu	37	11	36440825	36440825	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:36440825T>A	ENST00000378867.3	+	5	621	c.266T>A	c.(265-267)cTt>cAt	p.L89H	PRR5L_ENST00000530639.1_Missense_Mutation_p.L89H|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000311599.5_Missense_Mutation_p.L63H|PRR5L_ENST00000527487.1_Missense_Mutation_p.L89H	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	89					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)	p.L89H(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						AAGAGTGAACTTGGATCATTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											209.0	182.0	191.0					11																	36440825		2202	4298	6500	36397401	SO:0001583	missense	79899				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.266T>A	11.37:g.36440825T>A	ENSP00000368144:p.Leu89His	Somatic		Capture	Illumina GAIIx	Phase_III	36397401	A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	-	p.L89H	ENST00000378867.3	37	c.266	CCDS31463.1	11	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914166	0.72983	.	.	ENSG00000135362	ENST00000530639;ENST00000311599;ENST00000378867;ENST00000527487	T;T;T;T	0.76060	1.59;1.63;1.59;-0.99	4.34	4.34	0.51931	.	0.071298	0.64402	D	0.000014	T	0.82245	0.4995	M	0.61703	1.905	0.53005	D	0.99996	D;D;D	0.89917	1.0;0.992;1.0	D;P;D	0.79784	0.992;0.875;0.993	D	0.83631	0.0145	10	0.87932	D	0	-18.896	10.1247	0.42643	0.0:0.0:0.0:1.0	.	89;8;89	E9PKY1;Q6MZQ0-3;Q6MZQ0	.;.;PRR5L_HUMAN	H	89;63;89;89	ENSP00000435050:L89H;ENSP00000310103:L63H;ENSP00000368144:L89H;ENSP00000435241:L89H	ENSP00000310103:L63H	L	+	2	0	PRR5L	36397401	0.997000	0.39634	0.997000	0.53966	0.997000	0.91878	3.976000	0.56867	1.956000	0.56807	0.454000	0.30748	CTT	-	NULL		0.498	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FLJ14213	protein_coding	OTTHUMT00000389209.1	T	NM_024841		36397401	1	no_errors	NM_024841	genbank	human	provisional	54_36p	missense	SNP	1	A
INPPL1	3636	genome.wustl.edu	37	11	71941250	71941250	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:71941250G>A	ENST00000298229.2	+	9	1229	c.1025G>A	c.(1024-1026)cGg>cAg	p.R342Q	INPPL1_ENST00000541756.1_Missense_Mutation_p.R100Q|INPPL1_ENST00000538751.1_Missense_Mutation_p.R100Q	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	342					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)	p.R342Q(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GAGGGTGGGCGGCTGGTGCTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	11											48.0	51.0	50.0					11																	71941250		2200	4293	6493	71618898	SO:0001583	missense	3636			Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1025G>A	11.37:g.71941250G>A	ENSP00000298229:p.Arg342Gln	Somatic		Capture	Illumina GAIIx	4	71618898	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	HMMPfam_SH2;HMMPfam_SAM_1;HMMPfam_Exo_endo_phos;superfamily_SAM/Pointed domain;superfamily_SH2 domain;superfamily_DNase I-like	p.R342Q	ENST00000298229.2	37	c.1025	CCDS8213.1	11	.	.	.	.	.	.	.	.	.	.	g	18.45	3.626404	0.66901	.	.	ENSG00000165458	ENST00000545256;ENST00000298229;ENST00000541756;ENST00000538751;ENST00000540329	D;D;D	0.96522	-2.93;-4.04;-4.04	5.38	5.38	0.77491	.	0.156902	0.40640	N	0.001047	D	0.88599	0.6480	N	0.14661	0.345	0.36481	D	0.867844	P	0.44627	0.839	B	0.29077	0.098	D	0.90781	0.4679	10	0.49607	T	0.09	.	10.2239	0.43214	0.0901:0.0:0.9099:0.0	.	342	O15357	SHIP2_HUMAN	Q	100;342;100;100;70	ENSP00000298229:R342Q;ENSP00000446360:R100Q;ENSP00000444619:R100Q	ENSP00000298229:R342Q	R	+	2	0	INPPL1	71618898	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.348000	0.59379	2.517000	0.84864	0.655000	0.94253	CGG	-	NULL		0.642	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	protein_coding	OTTHUMT00000396789.1	G	NM_001567		71618898	1	no_errors	NM_001567	genbank	human	reviewed	54_36p	missense	SNP	1	A
INTS4	92105	genome.wustl.edu	37	11	77672104	77672104	+	Silent	SNP	G	G	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:77672104G>C	ENST00000534064.1	-	5	586	c.552C>G	c.(550-552)gtC>gtG	p.V184V	INTS4_ENST00000529807.1_Silent_p.V184V	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	184					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.V184V(1)	INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CATCTTTTGTGACACTTTTCT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	11											181.0	171.0	175.0					11																	77672104		2200	4292	6492	77349752	SO:0001819	synonymous_variant	92105			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.552C>G	11.37:g.77672104G>C		Somatic		Capture	Illumina GAIIx	4	77349752	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	HMMPfam_HEAT;superfamily_ARM repeat	p.V184	ENST00000534064.1	37	c.552	CCDS31644.1	11																																																																																			-	NULL		0.408	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS4	protein_coding	OTTHUMT00000390927.1	G	NM_033547		77349752	-1	no_errors	NM_033547	genbank	human	validated	54_36p	silent	SNP	0.63	C
PCF11	51585	genome.wustl.edu	37	11	82868481	82868481	+	5'UTR	SNP	A	A	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:82868481A>C	ENST00000298281.4	+	0	452					NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)		p.?(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GCCGCGGCGCAATGTCAGAGC	0.672																																																1	Unknown(1)	ovary(1)	11											19.0	24.0	22.0					11																	82868481		1830	4050	5880	82546129	SO:0001623	5_prime_UTR_variant	51585			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.-1A>C	11.37:g.82868481A>C		Somatic		Capture	Illumina GAIIx	4	82546129	A6H8W7|O43671|Q6P0X8	Silent	SNP	superfamily_ENTH_VHS	p.A99	ENST00000298281.4	37	c.297	CCDS44689.1	11																																																																																			-	NULL		0.672	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	protein_coding	OTTHUMT00000392548.2	A	NM_015885		82546129	1	no_start_codon	ENST00000298281	ensembl	human	known	54_36p	silent	SNP	1	C
OR8G5	219865	genome.wustl.edu	37	11	124135295	124135295	+	Silent	SNP	G	G	A	rs375972074		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr11:124135295G>A	ENST00000524943.2	+	1	573	c.573G>A	c.(571-573)gcG>gcA	p.A191A	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		TGATTTGTGCGTCAGCTCATA	0.398													g|||	1	0.000199681	0.0008	0.0	5008	,	,		23144	0.0		0.0	False		,,,				2504	0.0				Ovarian(169;523 1969 8640 31295 51256)											0			11						G		5,3865		0,5,1930	262.0	253.0	256.0		573	-8.4	0.0	11		256	3,8337		0,3,4167	no	coding-synonymous	OR8G5	NM_001005198.1		0,8,6097	AA,AG,GG		0.036,0.1292,0.0655		191/347	124135295	8,12202	1935	4170	6105	123640505	SO:0001819	synonymous_variant	219865			BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.573G>A	11.37:g.124135295G>A		Somatic		Capture	Illumina GAIIx	4	123640505	B2RND3|Q6IEU6	Silent	SNP	-	p.A191	ENST00000524943.2	37	c.573		11																																																																																			-	NULL		0.398	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	OR8G5	protein_coding	OTTHUMT00000387283.2	G	NM_001005198		123640505	1	no_errors	NM_001005198	genbank	human	provisional	54_36p	silent	SNP		A
CIT	11113	genome.wustl.edu	37	12	120208662	120208662	+	Intron	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr12:120208662C>T	ENST00000261833.7	-	17	2135				CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.R712H	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase						cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R713H(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GTTTTCTCTACGCTCCATGGT	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											134.0	130.0	131.0					12																	120208662		876	1991	2867	118693045	SO:0001627	intron_variant	11113			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2082+1911G>A	12.37:g.120208662C>T		Somatic		Capture	Illumina GAIIx	4	118693045	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	-	p.R712H	ENST00000261833.7	37	c.2135	CCDS9192.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.379186	0.95945	.	.	ENSG00000122966	ENST00000392521	D	0.81659	-1.52	5.97	5.97	0.96955	.	0.000000	0.64402	U	0.000003	D	0.89757	0.6807	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.87186	0.2231	9	0.35671	T	0.21	.	20.4242	0.99069	0.0:1.0:0.0:0.0	.	712	Q2M5E1	.	H	712	ENSP00000376306:R712H	ENSP00000376306:R712H	R	-	2	0	CIT	118693045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.267000	0.78462	2.839000	0.97877	0.655000	0.94253	CGT	-	NULL		0.438	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	protein_coding	OTTHUMT00000259410.4	C	NM_007174		118693045	-1	no_errors	ENST00000392521	ensembl	human	known	54_36p	missense	SNP	1	T
ARID2	196528	genome.wustl.edu	37	12	46244131	46244131	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr12:46244131C>T	ENST00000334344.6	+	15	2397	c.2225C>T	c.(2224-2226)tCt>tTt	p.S742F	ARID2_ENST00000422737.1_Missense_Mutation_p.S593F|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Missense_Mutation_p.S352F|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	742					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S742F(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CCACAGAGTTCTGTTGTTCAG	0.438			"""N, S, F"""		hepatocellular carcinoma																																		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	ovary(1)	12											87.0	86.0	87.0					12																	46244131		2203	4300	6503	44530398	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2225C>T	12.37:g.46244131C>T	ENSP00000335044:p.Ser742Phe	Somatic		Capture	Illumina GAIIx	4	44530398	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	-	p.S742F	ENST00000334344.6	37	c.2225	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847611	0.51164	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.37058	1.22	5.97	5.97	0.96955	.	0.294458	0.39146	N	0.001459	T	0.44603	0.1301	L	0.29908	0.895	0.80722	D	1	P;P;D	0.57257	0.946;0.873;0.979	P;P;P	0.53809	0.735;0.628;0.642	T	0.34329	-0.9833	10	0.87932	D	0	-9.5181	20.428	0.99075	0.0:1.0:0.0:0.0	.	742;352;742	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	F	742;593;352	ENSP00000335044:S742F	ENSP00000335044:S742F	S	+	2	0	ARID2	44530398	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.036000	0.70948	2.837000	0.97791	0.655000	0.94253	TCT	-	NULL		0.438	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	protein_coding	OTTHUMT00000318380.2	C	XM_350875		44530398	1	no_errors	NM_152641	genbank	human	validated	54_36p	missense	SNP	1	T
CLIP1	6249	genome.wustl.edu	37	12	122821266	122821266	+	Silent	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr12:122821266C>A	ENST00000540338.1	-	11	2522	c.2481G>T	c.(2479-2481)ggG>ggT	p.G827G	CLIP1_ENST00000361654.4_Silent_p.G705G|CLIP1_ENST00000302528.7_Silent_p.G816G|CLIP1_ENST00000545889.1_Intron|CLIP1_ENST00000537178.1_Silent_p.G781G|CLIP1_ENST00000358808.2_Silent_p.G816G			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	827					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.G816G(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTAGCTCTCTCCCCTGGAGCT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	12											91.0	90.0	90.0					12																	122821266		2203	4300	6503	121387219	SO:0001819	synonymous_variant	6249				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.2481G>T	12.37:g.122821266C>A		Somatic		Capture	Illumina GAIIx	4	121387219	A0AVD3|Q17RS4|Q29RG0	Silent	SNP	HMMPfam_CAP_GLY;superfamily_Prefoldin;superfamily_Cap-Gly domain	p.G816	ENST00000540338.1	37	c.2448	CCDS58285.1	12																																																																																			-	NULL		0.373	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	protein_coding	OTTHUMT00000401625.1	C	NM_002956		121387219	-1	no_errors	NM_002956	genbank	human	validated	54_36p	silent	SNP	1	A
ZNF44	51710	genome.wustl.edu	37	19	12358175	12358175	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr19:12358175G>C	ENST00000426973.1	-	4	1539	c.1540C>G	c.(1540-1542)Cct>Gct	p.P514A				P15621	ZNF44_HUMAN	zinc finger protein 44	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P514A(1)		ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		CATTTATAAGGTTTCTCTCCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	19																																								12219175	SO:0001583	missense	0			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000426973.1:c.1540C>G	19.37:g.12358175G>C	ENSP00000395745:p.Pro514Ala	Somatic		Capture	Illumina GAIIx	4	12219175	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	-	p.P421A	ENST00000426973.1	37	c.1261		19	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263792	0.39995	.	.	ENSG00000197857	ENST00000426973	T	0.16457	2.34	0.96	0.96	0.19631	.	.	.	.	.	T	0.24236	0.0587	.	.	.	.	.	.	.	.	.	.	.	.	T	0.39781	-0.9597	5	0.72032	D	0.01	.	9.5101	0.39071	0.0:0.0:1.0:0.0	.	.	.	.	A	514	ENSP00000395745:P514A	ENSP00000395745:P514A	P	-	1	0	ZNF44	12219175	0.780000	0.28664	0.042000	0.18584	0.106000	0.19336	1.938000	0.40203	0.837000	0.34925	0.485000	0.47835	CCT	-	NULL		0.398	ZNF44-201	KNOWN	basic	protein_coding	ENSG00000218758	protein_coding		G	NM_016264		12219175	-1	no_start_codon	ENST00000393337	ensembl	human	known	54_36p	missense	SNP	0.7	C
RP11-337C18.8	0	genome.wustl.edu	37	1	146650112	146650112	+	RNA	SNP	G	G	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr1:146650112G>T	ENST00000607149.1	+	0	350				RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.10_ENST00000606856.1_RNA|RP11-337C18.9_ENST00000606152.1_RNA																							TGCCTCTCAGGACTGAGGAAG	0.448																																																0			1																																								145116736			171423																															1.37:g.146650112G>T		Somatic		Capture	Illumina GAIIx	4	145116736		RNA	SNP	-	NULL	ENST00000607149.1	37	NULL		1																																																																																			-	-		0.448	RP11-337C18.8-004	KNOWN	not_organism_supported|basic	antisense	PDIA3P	antisense	OTTHUMT00000471324.1	G			145116736	1	pseudogene	NR_002305	genbank	human	provisional	54_36p	rna	SNP		T
DMXL2	23312	genome.wustl.edu	37	15	51827951	51827951	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr15:51827951A>G	ENST00000251076.5	-	13	2632	c.2345T>C	c.(2344-2346)tTt>tCt	p.F782S	DMXL2_ENST00000543779.2_Missense_Mutation_p.F782S|DMXL2_ENST00000449909.3_Missense_Mutation_p.F782S	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	782						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.F782S(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AGAAGCAACAAAGCAAGCACT	0.383																																																1	Substitution - Missense(1)	ovary(1)	15											91.0	89.0	90.0					15																	51827951		2195	4292	6487	49615243	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2345T>C	15.37:g.51827951A>G	ENSP00000251076:p.Phe782Ser	Somatic		Capture	Illumina GAIIx	4	49615243	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.F782S	ENST00000251076.5	37	c.2345	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	A	20.3	3.966141	0.74131	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.51574	0.7;0.7;0.7	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72787	0.3504	M	0.86420	2.815	0.34194	D	0.672348	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.91635	0.999;0.986;0.991	D	0.84479	0.0604	10	0.87932	D	0	.	15.2263	0.73354	1.0:0.0:0.0:0.0	.	782;782;782	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	S	782	ENSP00000251076:F782S;ENSP00000441858:F782S;ENSP00000400855:F782S	ENSP00000251076:F782S	F	-	2	0	DMXL2	49615243	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	1.993000	0.58246	0.533000	0.62120	TTT	-	NULL		0.383	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	protein_coding	OTTHUMT00000254671.2	A	NM_015263		49615243	-1	no_errors	NM_015263	genbank	human	validated	54_36p	missense	SNP	1	G
ADAMTSL3	57188	genome.wustl.edu	37	15	84651252	84651252	+	Missense_Mutation	SNP	C	C	T	rs148167427		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr15:84651252C>T	ENST00000286744.5	+	21	3096	c.2872C>T	c.(2872-2874)Cgg>Tgg	p.R958W	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R958W	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	958	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R958W(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAACTCCAAACGGCTTGGCAT	0.547																																																1	Substitution - Missense(1)	ovary(1)	15						C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	96.0	96.0	96.0		2872	0.4	0.0	15	dbSNP_134	96	0,8600		0,0,4300	no	missense	ADAMTSL3	NM_207517.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	958/1692	84651252	1,13005	2203	4300	6503	82442256	SO:0001583	missense	57188			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2872C>T	15.37:g.84651252C>T	ENSP00000286744:p.Arg958Trp	Somatic		Capture	Illumina GAIIx	4	82442256	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	TSP_1;HMMPfam_TSP_1;PLAC;HMMPfam_PLAC;I-set;HMMPfam_I-set;ig;HMMPfam_ig;Immunoglobulin;superfamily_Immunoglobulin;TSP-1 type 1 repeat;superfamily_TSP-1 type 1 repeat	p.R958W	ENST00000286744.5	37	c.2872	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320379	0.60634	2.27E-4	0.0	ENSG00000156218	ENST00000286744	T	0.81163	-1.46	5.05	0.358	0.16084	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.228624	0.22949	N	0.053681	D	0.89210	0.6650	M	0.93808	3.46	0.09310	N	1	D;D	0.71674	0.997;0.998	P;P	0.61397	0.888;0.88	T	0.81553	-0.0880	10	0.87932	D	0	.	9.5465	0.39284	0.6606:0.2385:0.1009:0.0	.	958;958	P82987-2;P82987	.;ATL3_HUMAN	W	958	ENSP00000286744:R958W	ENSP00000286744:R958W	R	+	1	2	ADAMTSL3	82442256	0.840000	0.29493	0.002000	0.10522	0.967000	0.64934	2.140000	0.42159	0.144000	0.18951	-0.309000	0.09137	CGG	-	HMMPfam_ig		0.547	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	C	NM_207517		82442256	1	no_errors	NM_207517	genbank	human	validated	54_36p	missense	SNP	0.05	T
SNX29	92017	genome.wustl.edu	37	16	12136876	12136876	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr16:12136876A>G	ENST00000566228.1	+	5	439	c.370A>G	c.(370-372)Aac>Gac	p.N124D	SNX29_ENST00000568359.1_3'UTR	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	124	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)	p.N124D(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CTGTGCCCTCAACGAACACTC	0.657																																																1	Substitution - Missense(1)	ovary(1)	16											39.0	32.0	34.0					16																	12136876		2197	4300	6497	12044377	SO:0001583	missense	84127			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.370A>G	16.37:g.12136876A>G	ENSP00000456480:p.Asn124Asp	Somatic		Capture	Illumina GAIIx	4	12044377	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	-	p.N124D	ENST00000566228.1	37	c.370	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	A	34	5.389644	0.95988	.	.	ENSG00000140660	ENST00000268271	.	.	.	4.91	4.91	0.64330	.	0.059561	0.64402	D	0.000007	T	0.76990	0.4065	M	0.83118	2.625	0.80722	D	1	.	.	.	.	.	.	T	0.80770	-0.1234	7	0.66056	D	0.02	-14.8418	13.5118	0.61517	1.0:0.0:0.0:0.0	.	.	.	.	D	124	.	ENSP00000268271:N124D	N	+	1	0	RUNDC2A	12044377	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.855000	0.92236	2.066000	0.61787	0.379000	0.24179	AAC	-	NULL		0.657	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RUNDC2A	protein_coding	OTTHUMT00000422622.1	A			12044377	1	no_errors	NM_032167	genbank	human	validated	54_36p	missense	SNP	1	G
USP31	57478	genome.wustl.edu	37	16	23080132	23080132	+	Silent	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr16:23080132C>T	ENST00000219689.7	-	16	3293	c.3294G>A	c.(3292-3294)gaG>gaA	p.E1098E	USP31_ENST00000567975.1_Silent_p.E391E	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.E1098E(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TCGGGGATGACTCCTTTTTGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	16											80.0	88.0	85.0					16																	23080132		2197	4300	6497	22987633	SO:0001819	synonymous_variant	57478			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.3294G>A	16.37:g.23080132C>T		Somatic		Capture	Illumina GAIIx	4	22987633	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	HMMPfam_UCH;superfamily_Cysteine proteinases;superfamily_Ubiquitin-like	p.E1098	ENST00000219689.7	37	c.3294	CCDS10607.1	16																																																																																			-	NULL		0.567	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	protein_coding	OTTHUMT00000211607.1	C	NM_020718		22987633	-1	no_errors	NM_020718	genbank	human	validated	54_36p	silent	SNP	0.81	T
TP53	7157	genome.wustl.edu	37	17	7578220	7578224	+	Frame_Shift_Del	DEL	TTTCT	TTTCT	-			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	TTTCT	TTTCT	TTTCT	-	TTTCT	TTTCT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr17:7578220_7578224delTTTCT	ENST00000269305.4	-	6	814_818	c.625_629delAGAAA	c.(625-630)agaaacfs	p.RN209fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.RN209fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Frame_Shift_Del_p.RN209fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.RN209fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.RN209fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.RN209fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	209	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> I (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R209fs*6(38)|p.R209*(18)|p.0?(8)|p.R209K(7)|p.?(5)|p.R209T(3)|p.N210fs*37(3)|p.R77fs*6(2)|p.R209fs*35(2)|p.D207fs*6(2)|p.R209fs*38(2)|p.N210S(2)|p.R77*(2)|p.R116fs*6(2)|p.R116*(2)|p.N210D(1)|p.R77K(1)|p.R209I(1)|p.?fs(1)|p.R116K(1)|p.E204_N210delEYLDDRN(1)|p.R209fs*36(1)|p.D207_R213delDDRNTFR(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.N210fs*7(1)|p.R209R(1)|p.N210H(1)|p.R209S(1)|p.N210T(1)|p.D208fs*38(1)|p.R209_R213delRNTFR(1)|p.D207_V216del10(1)|p.R209fs*7(1)|p.R209fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGAAAAGTGTTTCTGTCATCCAAA	0.541		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	118	Deletion - Frameshift(55)|Substitution - Nonsense(22)|Substitution - Missense(19)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(3)|Substitution - coding silent(1)	lung(20)|breast(13)|biliary_tract(11)|oesophagus(11)|upper_aerodigestive_tract(8)|large_intestine(7)|central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(5)|urinary_tract(5)|prostate(5)|soft_tissue(4)|ovary(4)|pancreas(4)|bone(4)|stomach(3)|salivary_gland(2)|liver(2)|skin(2)|cervix(1)|thyroid(1)	17	GRCh37	CD921041|CD962734|CM004573|CM971504	TP53	D|M																																				7518949	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.625_629delAGAAA	17.37:g.7578220_7578224delTTTCT	ENSP00000269305:p.Arg209fs	Somatic		Capture	Illumina GAIIx	4	7518945	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R209fs	ENST00000269305.4	37	c.629_625	CCDS11118.1	17																																																																																			(deletion:cds_exon[7518902;7519014])	HMMPfam_P53		0.541	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	TTTCT	NM_000546		7518949	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000:0.000:0.000:0.000:0.003	-
DNAH2	146754	genome.wustl.edu	37	17	7695633	7695633	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr17:7695633C>G	ENST00000572933.1	+	46	8577	c.7117C>G	c.(7117-7119)Ctc>Gtc	p.L2373V	DNAH2_ENST00000389173.2_Missense_Mutation_p.L2373V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2373					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L2373V(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGAGGACAAGCTCCCTAAGAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											94.0	88.0	90.0					17																	7695633		2203	4300	6503	7636358	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7117C>G	17.37:g.7695633C>G	ENSP00000458355:p.Leu2373Val	Somatic		Capture	Illumina GAIIx	4	7636358	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	HMMPfam_Dynein_heavy;HMMPfam_AAA_5;HMMPfam_DHC_N1;HMMPfam_DHC_N2;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L2373V	ENST00000572933.1	37	c.7117	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	12.04	1.819261	0.32145	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.19669	2.13	4.98	3.94	0.45596	.	0.086055	0.44902	D	0.000403	T	0.14098	0.0341	L	0.41124	1.26	0.80722	D	1	B	0.32324	0.364	B	0.33846	0.171	T	0.02821	-1.1106	10	0.07175	T	0.84	.	8.3993	0.32576	0.0:0.8194:0.0:0.1806	.	2373	Q9P225	DYH2_HUMAN	V	2373	ENSP00000373825:L2373V	ENSP00000353818:L2373V	L	+	1	0	DNAH2	7636358	1.000000	0.71417	0.998000	0.56505	0.589000	0.36550	2.689000	0.46993	2.581000	0.87130	0.643000	0.83706	CTC	-	NULL		0.542	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	C	NM_020877		7636358	1	no_errors	NM_020877	genbank	human	validated	54_36p	missense	SNP	1	G
MYH1	4619	genome.wustl.edu	37	17	10400653	10400653	+	Silent	SNP	T	T	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr17:10400653T>C	ENST00000226207.5	-	32	4576	c.4482A>G	c.(4480-4482)gaA>gaG	p.E1494E	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1494					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1494E(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GGTCTAAAGATTCCTCATAAG	0.338																																																1	Substitution - coding silent(1)	ovary(1)	17											82.0	82.0	82.0					17																	10400653		2203	4300	6503	10341378	SO:0001819	synonymous_variant	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4482A>G	17.37:g.10400653T>C		Somatic		Capture	Illumina GAIIx	4	10341378	Q14CA4|Q9Y622	Silent	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_tRNA-binding arm;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E1494	ENST00000226207.5	37	c.4482	CCDS11155.1	17																																																																																			-	HMMPfam_Myosin_tail_1		0.338	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	T	NM_005963		10341378	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	silent	SNP	1	C
MTCL1	23255	genome.wustl.edu	37	18	8826019	8826019	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr18:8826019G>T	ENST00000306329.11	+	13	5468	c.5468G>T	c.(5467-5469)tGc>tTc	p.C1823F	SOGA2_ENST00000517570.1_Missense_Mutation_p.C1463F|SOGA2_ENST00000518815.1_Missense_Mutation_p.C829F|SOGA2_ENST00000359865.3_Missense_Mutation_p.C1504F|SOGA2_ENST00000400050.3_Missense_Mutation_p.C1463F|SOGA2_ENST00000306285.7_Missense_Mutation_p.C829F														p.C1504F(1)									TCAGAGATGTGCAGGGAGGAA	0.632																																																1	Substitution - Missense(1)	ovary(1)	18											32.0	34.0	33.0					18																	8826019		2203	4297	6500	8816019	SO:0001583	missense	23255																														ENST00000306329.11:c.5468G>T	18.37:g.8826019G>T	ENSP00000305027:p.Cys1823Phe	Somatic		Capture	Illumina GAIIx	4	8816019		Missense_Mutation	SNP	-	p.C1504F	ENST00000306329.11	37	c.4511		18	.	.	.	.	.	.	.	.	.	.	G	0.322	-0.961096	0.02249	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.29917	2.57;2.57;2.57;1.55	5.22	-0.878	0.10617	.	1.144920	0.06461	N	0.729475	T	0.14657	0.0354	N	0.22421	0.69	0.23386	N	0.99779	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.25710	-1.0124	10	0.09843	T	0.71	-3.3497	0.4349	0.00477	0.2328:0.2392:0.2766:0.2514	.	1814;1504	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	F	1525;1463;1504;1463;829	ENSP00000429556:C1463F;ENSP00000352927:C1504F;ENSP00000382924:C1463F;ENSP00000303670:C829F	ENSP00000303670:C829F	C	+	2	0	CCDC165	8816019	0.996000	0.38824	0.102000	0.21198	0.838000	0.47535	1.997000	0.40786	-0.084000	0.12595	0.462000	0.41574	TGC	-	NULL		0.632	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	KIAA0802	protein_coding	OTTHUMT00000444141.1	G			8816019	1	no_errors	NM_015210	genbank	human	predicted	54_36p	missense	SNP	0.107	T
MTCL1	23255	genome.wustl.edu	37	18	8826031	8826031	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr18:8826031G>T	ENST00000306329.11	+	13	5480	c.5480G>T	c.(5479-5481)gGg>gTg	p.G1827V	SOGA2_ENST00000517570.1_Missense_Mutation_p.G1467V|SOGA2_ENST00000518815.1_Missense_Mutation_p.G833V|SOGA2_ENST00000359865.3_Missense_Mutation_p.G1508V|SOGA2_ENST00000400050.3_Missense_Mutation_p.G1467V|SOGA2_ENST00000306285.7_Missense_Mutation_p.G833V														p.G1508V(1)									AGGGAGGAAGGGGGAGAGGGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	18											35.0	37.0	36.0					18																	8826031		2202	4298	6500	8816031	SO:0001583	missense	23255																														ENST00000306329.11:c.5480G>T	18.37:g.8826031G>T	ENSP00000305027:p.Gly1827Val	Somatic		Capture	Illumina GAIIx	4	8816031		Missense_Mutation	SNP	-	p.G1508V	ENST00000306329.11	37	c.4523		18	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737162	0.30774	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T;T	0.32023	2.47;2.5;2.49;2.5;1.47	5.71	5.71	0.89125	.	0.000000	0.52532	D	0.000062	T	0.51770	0.1694	M	0.72479	2.2	0.54753	D	0.999985	D;D	0.71674	0.998;0.993	D;P	0.64776	0.929;0.854	T	0.51301	-0.8723	10	0.56958	D	0.05	-50.7124	13.0981	0.59204	0.0733:0.0:0.9267:0.0	.	1818;1508	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	V	1529;1467;1508;1467;833	ENSP00000305027:G1529V;ENSP00000429556:G1467V;ENSP00000352927:G1508V;ENSP00000382924:G1467V;ENSP00000303670:G833V	ENSP00000303670:G833V	G	+	2	0	CCDC165	8816031	0.998000	0.40836	0.768000	0.31515	0.869000	0.49853	1.908000	0.39907	2.700000	0.92200	0.462000	0.41574	GGG	-	NULL		0.622	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	KIAA0802	protein_coding	OTTHUMT00000444141.1	G			8816031	1	no_errors	NM_015210	genbank	human	predicted	54_36p	missense	SNP	0.341	T
CELF4	56853	genome.wustl.edu	37	18	35145519	35145519	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr18:35145519C>G	ENST00000591282.1	-	1	85	c.86G>C	c.(85-87)aGt>aCt	p.S29T	CELF4_ENST00000603232.1_Missense_Mutation_p.S29T|CELF4_ENST00000334919.5_Missense_Mutation_p.S29T|CELF4_ENST00000588597.1_Missense_Mutation_p.S29T|CELF4_ENST00000361795.5_Missense_Mutation_p.S29T|CELF4_ENST00000591287.1_Missense_Mutation_p.S29T|CELF4_ENST00000420428.2_Missense_Mutation_p.S29T|CELF4_ENST00000412753.1_Missense_Mutation_p.S29T|CELF4_ENST00000601019.1_Missense_Mutation_p.S29T			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	29	Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.S29T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						GTGCCCGGCACTGCCCGGGCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	18											57.0	54.0	55.0					18																	35145519		2203	4300	6503	33399517	SO:0001583	missense	56853			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.86G>C	18.37:g.35145519C>G	ENSP00000464794:p.Ser29Thr	Somatic		Capture	Illumina GAIIx	4	33399517	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.S29T	ENST00000591282.1	37	c.86	CCDS32818.1	18	.	.	.	.	.	.	.	.	.	.	C	4.119	0.020260	0.08006	.	.	ENSG00000101489	ENST00000361795;ENST00000412753;ENST00000420428;ENST00000334919	T;T;T;T	0.73789	-0.75;-0.72;-0.73;-0.78	5.13	4.2	0.49525	.	0.136527	0.44483	D	0.000460	T	0.43897	0.1268	N	0.02142	-0.665	0.28426	N	0.91748	B;B;B;B;B	0.12013	0.0;0.0;0.005;0.0;0.0	B;B;B;B;B	0.06405	0.0;0.0;0.002;0.001;0.0	T	0.18840	-1.0324	10	0.07175	T	0.84	-9.8614	12.3004	0.54870	0.0:0.7179:0.2821:0.0	.	29;29;29;29;29	Q9BZC1-3;B4DHA8;Q9BZC1-5;Q9BZC1-2;Q9BZC1	.;.;.;.;CELF4_HUMAN	T	29	ENSP00000355089:S29T;ENSP00000406823:S29T;ENSP00000410584:S29T;ENSP00000335631:S29T	ENSP00000335631:S29T	S	-	2	0	CELF4	33399517	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.789000	0.38724	2.548000	0.85928	0.650000	0.86243	AGT	-	NULL		0.557	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRUNOL4	protein_coding	OTTHUMT00000440892.1	C	NM_020180		33399517	-1	no_errors	NM_020180	genbank	human	reviewed	54_36p	missense	SNP	1	G
ZNF724P	440519	genome.wustl.edu	37	19	23405530	23405530	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr19:23405530T>C	ENST00000418100.1	-	4	1634	c.1517A>G	c.(1516-1518)tAc>tGc	p.Y506C				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y506C(1)		endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						TTTACATTTGTAGGGTTTCTC	0.378																																																1	Substitution - Missense(1)	ovary(1)	19																																								23197370	SO:0001583	missense	440519					19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.1517A>G	19.37:g.23405530T>C	ENSP00000413411:p.Tyr506Cys	Somatic		Capture	Illumina GAIIx	4	23197370		Missense_Mutation	SNP	-	p.Y394C	ENST00000418100.1	37	c.1181		19	.	.	.	.	.	.	.	.	.	.	T	10.73	1.432058	0.25813	.	.	ENSG00000196081	ENST00000418100	T	0.25414	1.8	1.08	-0.756	0.11057	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30665	0.0772	.	.	.	0.09310	N	1	D	0.62365	0.991	P	0.53912	0.737	T	0.17899	-1.0354	8	0.72032	D	0.01	.	4.4652	0.11685	0.452:0.0:0.0:0.548	.	506	A8MTY0	ZN724_HUMAN	C	506	ENSP00000413411:Y506C	ENSP00000413411:Y506C	Y	-	2	0	ZNF724P	23197370	0.000000	0.05858	0.980000	0.43619	0.977000	0.68977	-0.483000	0.06536	0.407000	0.25591	0.397000	0.26171	TAC	-	NULL		0.378	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	ZNF724P	protein_coding	OTTHUMT00000465743.1	T			23197370	-1	no_start_codon:no_stop_codon	ENST00000397097	ensembl	human	known	54_36p	missense	SNP	0.11	C
SUPT5H	6829	genome.wustl.edu	37	19	39959442	39959442	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr19:39959442G>C	ENST00000599117.1	+	15	1451	c.1084G>C	c.(1084-1086)Gag>Cag	p.E362Q	SUPT5H_ENST00000359191.6_Missense_Mutation_p.E358Q|SUPT5H_ENST00000598725.1_Missense_Mutation_p.E362Q|SUPT5H_ENST00000432763.2_Missense_Mutation_p.E362Q|SUPT5H_ENST00000402194.2_Missense_Mutation_p.E358Q			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	362	Interaction with RNA polymerase II.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.E362Q(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCTCATCTTTGAGGGGAACCG	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											90.0	85.0	87.0					19																	39959442		2203	4300	6503	44651282	SO:0001583	missense	6829			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1084G>C	19.37:g.39959442G>C	ENSP00000470252:p.Glu362Gln	Somatic		Capture	Illumina GAIIx	4	44651282	O43279|Q59G52|Q99639	Missense_Mutation	SNP	HMMPfam_Supt5;HMMPfam_KOW;superfamily_Translation proteins SH3-like domain;superfamily_N-utilization substance G protein NusG N-terminal domain	p.E362Q	ENST00000599117.1	37	c.1084	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559480	0.86335	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.67	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.75925	0.3916	L	0.61387	1.9	0.80722	D	1	D;D	0.76494	0.999;0.972	D;P	0.78314	0.991;0.688	T	0.76353	-0.2990	8	.	.	.	-26.9357	15.5481	0.76123	0.0:0.1389:0.8611:0.0	.	358;362	O00267-2;O00267	.;SPT5H_HUMAN	Q	362;358;340;362	.	.	E	+	1	0	SUPT5H	44651282	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	9.592000	0.98245	1.389000	0.46526	0.650000	0.86243	GAG	-	NULL		0.527	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	protein_coding	OTTHUMT00000464918.1	G	NM_003169		44651282	1	no_errors	NM_003169	genbank	human	validated	54_36p	missense	SNP	1	C
CCDC61	729440	genome.wustl.edu	37	19	46509877	46509877	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr19:46509877C>A	ENST00000595358.1	+	4	341	c.292C>A	c.(292-294)Cgc>Agc	p.R98S	CCDC61_ENST00000536603.1_Missense_Mutation_p.R98S|CCDC61_ENST00000263284.2_Missense_Mutation_p.R155S|CCDC61_ENST00000594087.1_Missense_Mutation_p.R98S	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61	98						centrosome (GO:0005813)		p.R155S(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		CCTGCGGAACCGCAAGATGGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											24.0	29.0	27.0					19																	46509877		1947	4128	6075	51201717	SO:0001583	missense	729440				CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488	ENST00000595358.1:c.292C>A	19.37:g.46509877C>A	ENSP00000471454:p.Arg98Ser	Somatic		Capture	Illumina GAIIx	Phase_III	51201717	C8CAP4|Q9HDB6	Missense_Mutation	SNP	-	p.R155S	ENST00000595358.1	37	c.463	CCDS46120.2	19	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462527	0.63513	.	.	ENSG00000104983	ENST00000263284;ENST00000536603	T;T	0.41065	1.01;1.01	3.96	3.96	0.45880	.	0.287816	0.33180	N	0.005185	T	0.40498	0.1119	L	0.41632	1.29	0.46222	D	0.998937	P	0.38788	0.647	P	0.45881	0.496	T	0.37314	-0.9711	10	0.72032	D	0.01	-10.5302	9.2452	0.37520	0.2156:0.7844:0.0:0.0	.	98	Q9Y6R9	CCD61_HUMAN	S	155;98	ENSP00000263284:R155S;ENSP00000444279:R98S	ENSP00000263284:R155S	R	+	1	0	CCDC61	51201717	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	3.052000	0.49893	2.250000	0.74265	0.555000	0.69702	CGC	-	NULL		0.632	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CCDC61	protein_coding	OTTHUMT00000461689.1	C	NM_001080402		51201717	1	no_errors	NM_001080402	genbank	human	provisional	54_36p	missense	SNP	1	A
LRP1B	53353	genome.wustl.edu	37	2	141259297	141259297	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:141259297C>T	ENST00000389484.3	-	55	9780	c.8809G>A	c.(8809-8811)Gga>Aga	p.G2937R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2937	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G2937R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAGAACATCCACTGACTTTC	0.403										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											119.0	123.0	122.0					2																	141259297		2203	4300	6503	140975767	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8809G>A	2.37:g.141259297C>T	ENSP00000374135:p.Gly2937Arg	Somatic		Capture	Illumina GAIIx	4	140975767	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	HMMPfam_Ldl_recept_a;HMMPfam_EGF;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_YWTD domain;HMMPfam_Ldl_recept_b;HMMPfam_NHL;superfamily_LDL receptor-like module	p.G2937R	ENST00000389484.3	37	c.8809	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999307	0.93227	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.87809	-2.3	5.41	5.41	0.78517	Growth factor, receptor (1);EGF-like calcium-binding (1);	0.000000	0.85682	U	0.000000	D	0.93514	0.7930	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90703	0.4622	10	0.16420	T	0.52	.	19.5527	0.95328	0.0:1.0:0.0:0.0	.	2937	Q9NZR2	LRP1B_HUMAN	R	2937;2875	ENSP00000374135:G2937R	ENSP00000374135:G2937R	G	-	1	0	LRP1B	140975767	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.013000	0.70776	2.705000	0.92388	0.585000	0.79938	GGA	-	HMMPfam_EGF		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	C	NM_018557		140975767	-1	no_errors	NM_018557	genbank	human	validated	54_36p	missense	SNP	1	T
NR4A2	4929	genome.wustl.edu	37	2	157185866	157185866	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:157185866C>T	ENST00000339562.4	-	3	1195	c.833G>A	c.(832-834)cGc>cAc	p.R278H	NR4A2_ENST00000426264.1_Missense_Mutation_p.R215H|NR4A2_ENST00000409108.2_Missense_Mutation_p.R278H|NR4A2_ENST00000429376.1_Missense_Mutation_p.R215H|NR4A2_ENST00000409572.1_Missense_Mutation_p.R278H|NR4A2_ENST00000539077.1_Missense_Mutation_p.R289H	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	278					adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R278H(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CTCACAGGTGCGCACGCCGTA	0.677																																																1	Substitution - Missense(1)	ovary(1)	2											26.0	25.0	25.0					2																	157185866		2203	4300	6503	156894112	SO:0001583	missense	4929			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.833G>A	2.37:g.157185866C>T	ENSP00000344479:p.Arg278His	Somatic		Capture	Illumina GAIIx	4	156894112	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	HMMPfam_Hormone_recep,HMMPfam_zf-C4,superfamily_Nuclear receptor ligand-binding domain,superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.R278H	ENST00000339562.4	37	c.833	CCDS2201.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629814	0.87660	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000429376	D;D;D;D;D;D	0.96300	-3.97;-3.97;-3.97;-3.97;-3.97;-3.97	5.91	5.91	0.95273	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	N	0.25094	0.71	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97223	0.9879	10	0.59425	D	0.04	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	278	P43354	NR4A2_HUMAN	H	278;215;278;289;278;215	ENSP00000344479:R278H;ENSP00000389986:R215H;ENSP00000386747:R278H;ENSP00000444925:R289H;ENSP00000386993:R278H;ENSP00000410952:R215H	ENSP00000344479:R278H	R	-	2	0	NR4A2	156894112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.768000	0.85345	2.793000	0.96121	0.655000	0.94253	CGC	-	HMMPfam_zf-C4		0.677	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A2	protein_coding	OTTHUMT00000254909.2	C			156894112	-1	no_errors	NM_006186	genbank	human	reviewed	54_36p	missense	SNP	1	T
TBR1	10716	genome.wustl.edu	37	2	162273383	162273383	+	Silent	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:162273383C>T	ENST00000389554.3	+	1	779	c.462C>T	c.(460-462)aaC>aaT	p.N154N	TBR1_ENST00000410035.1_5'Flank	NM_006593.2	NP_006584.1	Q16650	TBR1_HUMAN	T-box, brain, 1	154					axon guidance (GO:0007411)|brain development (GO:0007420)|hindbrain development (GO:0030902)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of neuron projection development (GO:0010975)|specification of organ identity (GO:0010092)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N154N(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(3)	30						TCATCACCAACGGAGCCTACA	0.672																																																1	Substitution - coding silent(1)	ovary(1)	2											66.0	69.0	68.0					2																	162273383		2203	4300	6503	161981629	SO:0001819	synonymous_variant	10716			U49250	CCDS33310.1	2q24.2	2011-06-13			ENSG00000136535	ENSG00000136535		"""T-boxes"""	11590	protein-coding gene	gene with protein product		604616				7619531	Standard	NM_006593		Approved		uc002ubw.1	Q16650	OTTHUMG00000153888	ENST00000389554.3:c.462C>T	2.37:g.162273383C>T		Somatic		Capture	Illumina GAIIx	4	161981629	B0AZS4|B2R6G5|Q14DC5|Q53TH0|Q56A81	Silent	SNP	HMMPfam_T-box;superfamily_p53-like transcription factors	p.N154	ENST00000389554.3	37	c.462	CCDS33310.1	2																																																																																			-	NULL		0.672	TBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBR1	protein_coding	OTTHUMT00000332845.1	C	NM_006593		161981629	1	no_errors	NM_006593	genbank	human	reviewed	54_36p	silent	SNP	1	T
SCN3A	6328	genome.wustl.edu	37	2	165994624	165994624	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:165994624A>T	ENST00000360093.3	-	15	2647	c.2156T>A	c.(2155-2157)cTt>cAt	p.L719H	SCN3A_ENST00000409101.3_Missense_Mutation_p.L670H|SCN3A_ENST00000283254.7_Missense_Mutation_p.L719H	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	719					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L719H(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGATTCTTCAAGTTCTGGAGG	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											63.0	65.0	64.0					2																	165994624		2203	4299	6502	165702870	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2156T>A	2.37:g.165994624A>T	ENSP00000353206:p.Leu719His	Somatic		Capture	Illumina GAIIx	4	165702870	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Ion_trans;HMMPfam_Na_trans_assoc;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.L719H	ENST00000360093.3	37	c.2156		2	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727673	0.69074	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.96856	-4.15;-4.15;-4.07;-3.96	5.76	5.76	0.90799	.	0.000000	0.53938	D	0.000050	D	0.98661	0.9551	H	0.94423	3.535	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.992;0.995;0.998;0.998;0.997	D	0.99597	1.0977	10	0.62326	D	0.03	.	16.3786	0.83431	1.0:0.0:0.0:0.0	.	719;670;670;670;719	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	H	719;719;670;670	ENSP00000353206:L719H;ENSP00000283254:L719H;ENSP00000386726:L670H;ENSP00000403348:L670H	ENSP00000283254:L719H	L	-	2	0	SCN3A	165702870	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.287000	0.95975	2.323000	0.78572	0.528000	0.53228	CTT	-	NULL		0.333	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		A	NM_006922		165702870	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	missense	SNP	1	T
LRP2	4036	genome.wustl.edu	37	2	170044680	170044680	+	Missense_Mutation	SNP	C	C	T	rs143078432		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:170044680C>T	ENST00000263816.3	-	49	9413	c.9128G>A	c.(9127-9129)cGc>cAc	p.R3043H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3043	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R3043H(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACTAATGCAGCGCCCGTTCTG	0.517																																																1	Substitution - Missense(1)	ovary(1)	2						C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	142.0	134.0	137.0		9128	0.2	0.3	2	dbSNP_134	137	0,8600		0,0,4300	no	missense	LRP2	NM_004525.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	3043/4656	170044680	1,13005	2203	4300	6503	169752926	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9128G>A	2.37:g.170044680C>T	ENSP00000263816:p.Arg3043His	Somatic		Capture	Illumina GAIIx	4	169752926	O00711|Q16215	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.R3043H	ENST00000263816.3	37	c.9128	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394317	0.83011	2.27E-4	0.0	ENSG00000081479	ENST00000263816	D	0.96041	-3.89	5.68	0.217	0.15264	.	0.436137	0.26159	N	0.025985	D	0.90570	0.7044	L	0.43757	1.38	0.80722	D	1	P	0.45283	0.855	B	0.38562	0.276	D	0.85430	0.1148	10	0.54805	T	0.06	.	8.5804	0.33626	0.2541:0.6156:0.0:0.1303	.	3043	P98164	LRP2_HUMAN	H	3043	ENSP00000263816:R3043H	ENSP00000263816:R3043H	R	-	2	0	LRP2	169752926	1.000000	0.71417	0.322000	0.25334	0.874000	0.50279	2.327000	0.43858	-0.018000	0.14079	0.650000	0.86243	CGC	-	HMMPfam_Ldl_recept_a		0.517	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525		169752926	-1	no_errors	NM_004525	genbank	human	validated	54_36p	missense	SNP	0.61	T
TTN	7273	genome.wustl.edu	37	2	179633640	179633640	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:179633640G>C	ENST00000591111.1	-	38	9147	c.8923C>G	c.(8923-8925)Ctg>Gtg	p.L2975V	TTN_ENST00000359218.5_Missense_Mutation_p.L2929V|TTN_ENST00000460472.2_Missense_Mutation_p.L2929V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L2975V|TTN_ENST00000342992.6_Missense_Mutation_p.L2975V|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L2929V|TTN_ENST00000360870.5_Missense_Mutation_p.L2975V			Q8WZ42	TITIN_HUMAN	titin	13307	Ig-like 17.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L2975V(2)|p.L2929V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTCTTTCAGCATGGAAGTA	0.358																																																3	Substitution - Missense(3)	ovary(3)	2											111.0	104.0	107.0					2																	179633640		2203	4300	6503	179341885	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.8923C>G	2.37:g.179633640G>C	ENSP00000465570:p.Leu2975Val	Somatic		Capture	Illumina GAIIx	4	179341885	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.L2975V	ENST00000591111.1	37	c.8923		2	.	.	.	.	.	.	.	.	.	.	G	9.196	1.027362	0.19512	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.45	2.65	0.31530	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67487	0.2898	M	0.85542	2.76	0.25289	N	0.989377	D;D;D;D;D	0.76494	0.984;0.984;0.984;0.992;0.999	P;P;P;P;D	0.65443	0.802;0.802;0.802;0.883;0.935	T	0.57271	-0.7840	9	0.87932	D	0	.	9.6796	0.40061	0.2816:0.0:0.7184:0.0	.	2929;2929;2929;2975;2975	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	V	2975;2929;2929;2929;2929;2975	ENSP00000343764:L2975V;ENSP00000434586:L2929V;ENSP00000340554:L2929V;ENSP00000352154:L2929V;ENSP00000354117:L2975V	ENSP00000340554:L2929V	L	-	1	2	TTN	179341885	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	3.199000	0.51043	0.795000	0.33922	-0.253000	0.11424	CTG	-	NULL		0.358	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179341885	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	C
CDK15	65061	genome.wustl.edu	37	2	202700416	202700416	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:202700416G>A	ENST00000374598.4	+	8	781	c.781G>A	c.(781-783)Gtg>Atg	p.V261M	CDK15_ENST00000410091.3_Missense_Mutation_p.V210M|CDK15_ENST00000450471.2_Missense_Mutation_p.V261M|CDK15_ENST00000488419.1_3'UTR|CDK15_ENST00000434439.1_Missense_Mutation_p.V261M|CDK15_ENST00000260967.2_Missense_Mutation_p.V210M			Q96Q40	CDK15_HUMAN	cyclin-dependent kinase 15	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)	p.V210L(1)|p.V210M(1)		breast(3)|endometrium(2)|kidney(5)|large_intestine(1)|lung(14)|ovary(1)	26					Adenosine triphosphate(DB00171)	TTCAGAAGTCGTGACCCTCTG	0.527																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2											82.0	78.0	79.0					2																	202700416		2203	4300	6503	202408661	SO:0001583	missense	65061			AB053308	CCDS2350.1, CCDS58746.1, CCDS58747.1	2q33.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000138395	ENSG00000138395		"""Cyclin-dependent kinases"""	14434	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7"", ""PFTAIRE protein kinase 2"""	ALS2CR7, PFTK2		11586298, 16236519, 19884882	Standard	NM_139158		Approved	PFTAIRE2	uc002uyt.3	Q96Q40	OTTHUMG00000132838	ENST00000374598.4:c.781G>A	2.37:g.202700416G>A	ENSP00000363726:p.Val261Met	Somatic		Capture	Illumina GAIIx	4	202408661	A8K8R9|B8ZZX0|C9J1N8|C9K003|F8W6H8|Q4ZG86|Q53TV1|Q6ZMR9|Q8IUP1	Missense_Mutation	SNP	-	p.V210M	ENST00000374598.4	37	c.628		2	.	.	.	.	.	.	.	.	.	.	G	32	5.154488	0.94686	.	.	ENSG00000138395	ENST00000410091;ENST00000260967;ENST00000450471;ENST00000434439;ENST00000374598	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83312	0.5227	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.998;0.996	D	0.84366	0.0541	10	0.87932	D	0	-16.7409	20.02	0.97489	0.0:0.0:1.0:0.0	.	240;261;261	Q96Q40-2;Q96Q40;F8W6H8	.;CDK15_HUMAN;.	M	210;210;261;261;261	ENSP00000386901:V210M;ENSP00000260967:V210M;ENSP00000406472:V261M;ENSP00000412775:V261M;ENSP00000363726:V261M	ENSP00000260967:V210M	V	+	1	0	CDK15	202408661	1.000000	0.71417	0.991000	0.47740	0.979000	0.70002	9.605000	0.98321	2.809000	0.96659	0.557000	0.71058	GTG	-	NULL		0.527	CDK15-201	KNOWN	basic|appris_candidate_longest	protein_coding	PFTK2	protein_coding	OTTHUMT00000336053.2	G			202408661	1	no_errors	NM_139158	genbank	human	provisional	54_36p	missense	SNP	1	A
SOCS5	9655	genome.wustl.edu	37	2	46986955	46986955	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:46986955G>A	ENST00000306503.5	+	2	1458	c.1286G>A	c.(1285-1287)cGa>cAa	p.R429Q	SOCS5_ENST00000394861.2_Missense_Mutation_p.R429Q	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	429	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)	p.R429L(1)|p.R429Q(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CTGCATGCCCGAATTGAGCAG	0.498																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2											103.0	101.0	102.0					2																	46986955		2203	4300	6503	46840459	SO:0001583	missense	9655			AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1286G>A	2.37:g.46986955G>A	ENSP00000305133:p.Arg429Gln	Somatic		Capture	Illumina GAIIx	4	46840459	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	HMMPfam_SH2;HMMPfam_SOCS_box;superfamily_SH2 domain	p.R429Q	ENST00000306503.5	37	c.1286	CCDS1830.1	2	.	.	.	.	.	.	.	.	.	.	G	16.21	3.060002	0.55325	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	D;D	0.89270	-2.49;-2.49	5.43	3.64	0.41730	SH2 motif (4);	0.056973	0.64402	D	0.000001	D	0.93916	0.8053	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.93888	0.7177	10	0.87932	D	0	-11.2549	11.8239	0.52256	0.1425:0.0:0.8575:0.0	.	429	O75159	SOCS5_HUMAN	Q	429	ENSP00000305133:R429Q;ENSP00000378330:R429Q	ENSP00000305133:R429Q	R	+	2	0	SOCS5	46840459	1.000000	0.71417	0.715000	0.30552	0.898000	0.52572	9.657000	0.98554	0.867000	0.35654	-0.136000	0.14681	CGA	-	HMMPfam_SH2		0.498	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS5	protein_coding	OTTHUMT00000250791.2	G			46840459	1	no_errors	NM_014011	genbank	human	reviewed	54_36p	missense	SNP	1	A
NGEF	25791	genome.wustl.edu	37	2	233759599	233759599	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr2:233759599C>A	ENST00000264051.3	-	6	1134	c.856G>T	c.(856-858)Gcg>Tcg	p.A286S	NGEF_ENST00000539537.1_Missense_Mutation_p.A9S|NGEF_ENST00000373552.4_Missense_Mutation_p.A194S|NGEF_ENST00000409079.1_Missense_Mutation_p.A194S	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	286	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A286S(1)		central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TAGTAGGACGCCTCGGAAGTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											118.0	104.0	109.0					2																	233759599		2203	4300	6503	233467843	SO:0001583	missense	25791			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.856G>T	2.37:g.233759599C>A	ENSP00000264051:p.Ala286Ser	Somatic		Capture	Illumina GAIIx	4	233467843	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PH;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.A286S	ENST00000264051.3	37	c.856	CCDS2500.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.636871|4.636871	0.87760|0.87760	.|.	.|.	ENSG00000066248|ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537;ENST00000416114;ENST00000458735;ENST00000409079|ENST00000420650	T;T;T;T;T;T|.	0.63096|.	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Dbl homology (DH) domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74450|0.74450	0.3718|0.3718	M|M	0.66560|0.66560	2.04|2.04	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.986;1.0|.	D;D;D|.	0.87578|.	0.981;0.913;0.998|.	T|T	0.73382|0.73382	-0.4000|-0.4000	10|5	0.54805|.	T|.	0.06|.	-31.3689|-31.3689	18.7943|18.7943	0.91988|0.91988	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	194;194;286|.	E9PC42;B4DMB8;Q8N5V2|.	.;.;NGEF_HUMAN|.	S|V	286;194;176;9;9;9;194|78	ENSP00000264051:A286S;ENSP00000362653:A194S;ENSP00000439035:A9S;ENSP00000401063:A9S;ENSP00000412614:A9S;ENSP00000387033:A194S|.	ENSP00000264051:A286S|.	A|G	-|-	1|2	0|0	NGEF|NGEF	233467843|233467843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.475000|0.475000	0.33008|0.33008	5.676000|5.676000	0.68131|0.68131	2.440000|2.440000	0.82611|0.82611	0.655000|0.655000	0.94253|0.94253	GCG|GGC	-	HMMPfam_RhoGEF		0.582	NGEF-001	KNOWN	basic|CCDS	protein_coding	NGEF	protein_coding	OTTHUMT00000257051.2	C	XM_044799		233467843	-1	no_errors	NM_019850	genbank	human	validated	54_36p	missense	SNP	1	A
RRBP1	6238	genome.wustl.edu	37	20	17602521	17602521	+	Silent	SNP	T	T	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr20:17602521T>C	ENST00000377813.1	-	14	3522	c.3219A>G	c.(3217-3219)gaA>gaG	p.E1073E	RRBP1_ENST00000455029.2_Silent_p.E414E|RRBP1_ENST00000246043.4_Silent_p.E1073E|RRBP1_ENST00000360807.4_Silent_p.E640E|RRBP1_ENST00000377807.2_Silent_p.E640E|RRBP1_ENST00000470422.1_5'UTR			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1073					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)	p.E640E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						AGACAGAGAGTTCTGGGAGCA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	20											72.0	83.0	79.0					20																	17602521		2203	4300	6503	17550521	SO:0001819	synonymous_variant	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.3219A>G	20.37:g.17602521T>C		Somatic		Capture	Illumina GAIIx	4	17550521	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	-	p.E640	ENST00000377813.1	37	c.1920		20																																																																																			-	NULL		0.607	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	protein_coding	OTTHUMT00000078125.1	T	NM_001042576		17550521	-1	no_errors	NM_001042576	genbank	human	reviewed	54_36p	silent	SNP		C
RRBP1	6238	genome.wustl.edu	37	20	17639676	17639676	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr20:17639676C>T	ENST00000377813.1	-	3	1780	c.1477G>A	c.(1477-1479)Gag>Aag	p.E493K	RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000246043.4_Missense_Mutation_p.E493K|RRBP1_ENST00000360807.4_Intron|RRBP1_ENST00000377807.2_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	493	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TGAGCCCCCTCGGCCTTCTTG	0.597																																																0			20																																								17587676	SO:0001583	missense	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.1477G>A	20.37:g.17639676C>T	ENSP00000367044:p.Glu493Lys	Somatic		Capture	Illumina GAIIx	4	17587676	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	superfamily_Ribosome recycling factor RRF;HMMPfam_Pentapeptide_2;HMMPfam_Rib_recp_KP_reg;superfamily_Spectrin repeat	p.E493K	ENST00000377813.1	37	c.1477		20	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142739	0.37825	.	.	ENSG00000125844	ENST00000377813;ENST00000246043	T;T	0.58060	0.36;0.36	4.17	3.19	0.36642	.	0.000000	0.33457	N	0.004898	T	0.54983	0.1892	.	.	.	0.21325	N	0.999729	.	.	.	.	.	.	T	0.50874	-0.8776	7	0.54805	T	0.06	-17.375	11.4961	0.50408	0.1818:0.8182:0.0:0.0	.	.	.	.	K	493	ENSP00000367044:E493K;ENSP00000246043:E493K	ENSP00000246043:E493K	E	-	1	0	RRBP1	17587676	0.001000	0.12720	0.026000	0.17262	0.004000	0.04260	0.689000	0.25437	1.018000	0.39521	0.456000	0.33151	GAG	-	HMMPfam_Pentapeptide_2		0.597	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	protein_coding	OTTHUMT00000078125.1	C	NM_001042576		17587676	-1	no_errors	ENST00000246043	ensembl	human	known	54_36p	missense	SNP		T
NBEAP3	100418905	genome.wustl.edu	37	22	16123690	16123690	+	IGR	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr22:16123690C>T								LA16c-4G1.3 (60454 upstream) : AP000525.9 (24288 downstream)																							AGCTCCTGCCCCTGACGCTGG	0.617																																																0			22																																								14503690	SO:0001628	intergenic_variant	729057																															22.37:g.16123690C>T		Somatic		Capture	Illumina GAIIx	4	14503690		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.617					LOC729057			C			14503690	1	no_errors	XR_042044	genbank	human	model	54_36p	rna	SNP	0.91	T
SEZ6L	23544	genome.wustl.edu	37	22	26736599	26736599	+	Splice_Site	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr22:26736599G>A	ENST00000248933.6	+	10	2307		c.e10+1		SEZ6L_ENST00000402979.1_Splice_Site|SEZ6L_ENST00000360929.3_Splice_Site|SEZ6L_ENST00000343706.4_Splice_Site|SEZ6L_ENST00000403121.1_Splice_Site|SEZ6L_ENST00000404234.3_Splice_Site|SEZ6L_ENST00000529632.2_Splice_Site			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like						adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.?(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						AACTACATAGGTAGGTGTCTC	0.423																																																1	Unknown(1)	ovary(1)	22											76.0	68.0	71.0					22																	26736599		2203	4300	6503	25066599	SO:0001630	splice_region_variant	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2212+1G>A	22.37:g.26736599G>A		Somatic		Capture	Illumina GAIIx	4	25066599	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Splice_Site	SNP	-	e10+1	ENST00000248933.6	37	c.2212+1	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239138	0.79800	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4833	0.87680	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEZ6L	25066599	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	9.042000	0.93793	2.604000	0.88044	0.313000	0.20887	.	-	-		0.423	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	G		Intron	25066599	1	no_errors	NM_021115	genbank	human	validated	54_36p	splice_site	SNP	1	A
PDXP	57026	genome.wustl.edu	37	22	38061650	38061650	+	Silent	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr22:38061650C>T	ENST00000215904.6	+	2	719	c.663C>T	c.(661-663)tgC>tgT	p.C221C	PDXP_ENST00000403251.1_Silent_p.C4C|SH3BP1_ENST00000599616.1_Silent_p.C530C	NM_020315.4	NP_064711.1	Q96GD0	PLPP_HUMAN	pyridoxal (pyridoxine, vitamin B6) phosphatase	221					actin rod assembly (GO:0031247)|cellular response to ATP (GO:0071318)|positive regulation of actin filament depolymerization (GO:0030836)|protein dephosphorylation (GO:0006470)|pyridoxal phosphate catabolic process (GO:0032361)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heat shock protein binding (GO:0031072)|magnesium ion binding (GO:0000287)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|pyridoxal phosphatase activity (GO:0033883)	p.C221C(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(2)	9	Melanoma(58;0.0574)					TGTTCGAGTGCATCACGGAGA	0.652																																																1	Substitution - coding silent(1)	ovary(1)	22											105.0	90.0	95.0					22																	38061650		2203	4300	6503	36391596	SO:0001819	synonymous_variant	57026			BC064922	CCDS13953.1	22q12.3	2005-08-16			ENSG00000241360	ENSG00000241360			30259	protein-coding gene	gene with protein product		609246				14522954	Standard	NM_020315		Approved	dJ37E16.5, FLJ32703		Q96GD0	OTTHUMG00000044618	ENST00000215904.6:c.663C>T	22.37:g.38061650C>T		Somatic		Capture	Illumina GAIIx	4	36391596	Q9UGY2	Silent	SNP	HMMPfam_Hydrolase;superfamily_HAD-like	p.C221	ENST00000215904.6	37	c.663	CCDS13953.1	22																																																																																			-	HMMPfam_Hydrolase		0.652	PDXP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXP	protein_coding	OTTHUMT00000104105.2	C	NM_020315		36391596	1	no_errors	NM_020315	genbank	human	validated	54_36p	silent	SNP	1	T
ZBTB20	26137	genome.wustl.edu	37	3	114069418	114069418	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr3:114069418C>A	ENST00000474710.1	-	4	1685	c.1507G>T	c.(1507-1509)Gct>Tct	p.A503S	ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000357258.3_Missense_Mutation_p.A430S|ZBTB20_ENST00000462705.1_Missense_Mutation_p.A430S|ZBTB20_ENST00000464560.1_Missense_Mutation_p.A430S|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000393785.2_Missense_Mutation_p.A430S|ZBTB20_ENST00000481632.1_Missense_Mutation_p.A430S|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000471418.1_Missense_Mutation_p.A430S	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	503						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.A430S(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GTGTTGCCAGCTGTGCCAATG	0.607																																					NSCLC(69;748 1344 9802 11203 30933)											1	Substitution - Missense(1)	ovary(1)	3											91.0	63.0	72.0					3																	114069418		2203	4300	6503	115552108	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1507G>T	3.37:g.114069418C>A	ENSP00000419153:p.Ala503Ser	Somatic		Capture	Illumina GAIIx	4	115552108	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	-	p.A430S	ENST00000474710.1	37	c.1288	CCDS54626.1	3	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493690	0.64186	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.11277	2.8;2.8;2.8;2.8;2.79;2.8;2.8	5.57	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.09113	0.0225	N	0.24115	0.695	0.58432	D	0.999999	B	0.19331	0.035	B	0.16722	0.016	T	0.15093	-1.0449	10	0.26408	T	0.33	.	16.3427	0.83092	0.0:0.8678:0.1322:0.0	.	503	Q9HC78	ZBT20_HUMAN	S	430;430;430;430;503;430;430	ENSP00000420324:A430S;ENSP00000377375:A430S;ENSP00000418092:A430S;ENSP00000419902:A430S;ENSP00000419153:A503S;ENSP00000349803:A430S;ENSP00000417307:A430S	ENSP00000349803:A430S	A	-	1	0	ZBTB20	115552108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.449000	0.80643	1.314000	0.45095	0.557000	0.71058	GCT	-	NULL		0.607	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	protein_coding	OTTHUMT00000354951.1	C	NM_015642		115552108	-1	no_errors	NM_015642	genbank	human	provisional	54_36p	missense	SNP	1	A
TMEM108	66000	genome.wustl.edu	37	3	133099417	133099417	+	Missense_Mutation	SNP	G	G	A	rs200944613		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr3:133099417G>A	ENST00000321871.6	+	4	1072	c.862G>A	c.(862-864)Ggt>Agt	p.G288S	TMEM108_ENST00000515826.1_Missense_Mutation_p.G288S|TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.G288S	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	288						integral component of membrane (GO:0016021)		p.G288S(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CCAGGGGGGTGGTTCTACCTT	0.647																																																1	Substitution - Missense(1)	ovary(1)	3						G	SER/GLY,SER/GLY	0,4406		0,0,2203	35.0	33.0	34.0		862,862	1.2	0.1	3		34	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	TMEM108	NM_023943.2,NM_001136469.1	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	288/576,288/576	133099417	1,13005	2203	4300	6503	134582107	SO:0001583	missense	66000			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.862G>A	3.37:g.133099417G>A	ENSP00000324651:p.Gly288Ser	Somatic		Capture	Illumina GAIIx	4	134582107	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	-	p.G288S	ENST00000321871.6	37	c.862	CCDS33858.1	3	.	.	.	.	.	.	.	.	.	.	G	5.364	0.252478	0.10185	0.0	1.16E-4	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.60424	0.41;0.41;0.19	4.24	1.25	0.21368	.	0.499516	0.19013	N	0.125027	T	0.44912	0.1316	L	0.60455	1.87	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.14578	0.011;0.002	T	0.27365	-1.0076	10	0.29301	T	0.29	-0.7635	2.862	0.05590	0.1717:0.1412:0.5426:0.1446	.	288;288	E9PB58;Q6UXF1	.;TM108_HUMAN	S	288	ENSP00000324651:G288S;ENSP00000376838:G288S;ENSP00000423338:G288S	ENSP00000324651:G288S	G	+	1	0	TMEM108	134582107	0.236000	0.23804	0.142000	0.22268	0.393000	0.30537	0.940000	0.28992	0.331000	0.23511	-0.254000	0.11334	GGT	-	NULL		0.647	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM108	protein_coding	OTTHUMT00000356907.2	G	NM_023943		134582107	1	no_errors	NM_023943	genbank	human	validated	54_36p	missense	SNP	0.01	A
EOMES	8320	genome.wustl.edu	37	3	27760901	27760901	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr3:27760901C>T	ENST00000295743.4	-	3	1311	c.1108G>A	c.(1108-1110)Ggg>Agg	p.G370R	EOMES_ENST00000537516.1_Missense_Mutation_p.G75R|EOMES_ENST00000449599.1_Missense_Mutation_p.G370R|EOMES_ENST00000461503.1_5'UTR			O95936	EOMES_HUMAN	eomesodermin	370					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G370R(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						TTTAATTTCCCGAATGAAATC	0.413																																																1	Substitution - Missense(1)	ovary(1)	3											227.0	208.0	214.0					3																	27760901		2203	4300	6503	27735905	SO:0001583	missense	8320			BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.1108G>A	3.37:g.27760901C>T	ENSP00000295743:p.Gly370Arg	Somatic		Capture	Illumina GAIIx	4	27735905	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	-	p.G370R	ENST00000295743.4	37	c.1108	CCDS2646.1	3	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881731	0.91740	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000537516;ENST00000535713	T;T;T	0.80653	-1.4;-1.4;-1.4	5.83	5.83	0.93111	p53-like transcription factor, DNA-binding (1);	0.046925	0.85682	D	0.000000	D	0.88746	0.6520	L	0.60845	1.875	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.81914	0.979;0.983;0.995;0.991	D	0.88648	0.3180	10	0.72032	D	0.01	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	84;370;370;370	B7Z4I2;F5H3K1;G3XAI5;O95936	.;.;.;EOMES_HUMAN	R	370;370;75;235	ENSP00000295743:G370R;ENSP00000388620:G370R;ENSP00000442097:G75R	ENSP00000295743:G370R	G	-	1	0	EOMES	27735905	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.352000	0.59404	2.769000	0.95229	0.655000	0.94253	GGG	-	NULL		0.413	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	C	NM_005442		27735905	-1	no_errors	NM_005442	genbank	human	reviewed	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	3	48162211	48162211	+	IGR	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr3:48162211G>A								RN7SL664P (25616 upstream) : CDC25A (36424 downstream)																							TTTCTTCTGGGCAACCTCCTC	0.388																																																0			3																																								48137215	SO:0001628	intergenic_variant	729349																															3.37:g.48162211G>A		Somatic		Capture	Illumina GAIIx	4	48137215		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.388					LOC729349			G			48137215	-1	pseudogene	XR_015954	genbank	human	model	54_36p	rna	SNP	1	A
DOCK3	1795	genome.wustl.edu	37	3	51370627	51370627	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr3:51370627C>A	ENST00000266037.9	+	35	3577	c.3554C>A	c.(3553-3555)aCc>aAc	p.T1185N		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1185					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.T1185N(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TGGCGCGAGACCGGCATTTCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	3											123.0	123.0	123.0					3																	51370627		1945	4140	6085	51345667	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3554C>A	3.37:g.51370627C>A	ENSP00000266037:p.Thr1185Asn	Somatic		Capture	Illumina GAIIx	4	51345667	O15017	Missense_Mutation	SNP	Ded_cyto;HMMPfam_Ded_cyto;SH3_2;HMMPfam_SH3_2	p.T1185N	ENST00000266037.9	37	c.3554	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626624	0.66901	.	.	ENSG00000088538	ENST00000266037	T	0.22336	1.96	6.06	6.06	0.98353	.	0.042869	0.85682	D	0.000000	T	0.23210	0.0561	L	0.38175	1.15	0.58432	D	0.999992	P	0.41420	0.749	B	0.40602	0.334	T	0.00438	-1.1739	10	0.36615	T	0.2	.	20.6244	0.99512	0.0:1.0:0.0:0.0	.	1185	Q8IZD9	DOCK3_HUMAN	N	1185	ENSP00000266037:T1185N	ENSP00000266037:T1185N	T	+	2	0	DOCK3	51345667	1.000000	0.71417	0.967000	0.41034	0.933000	0.57130	4.829000	0.62737	2.879000	0.98667	0.650000	0.86243	ACC	-	NULL		0.527	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	protein_coding	OTTHUMT00000346478.5	C	NM_004947		51345667	1	no_errors	NM_004947	genbank	human	validated	54_36p	missense	SNP	1	A
MAP3K13	9175	genome.wustl.edu	37	3	185136592	185136592	+	Intron	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr3:185136592C>T	ENST00000265026.3	+	2	249				MAP3K13_ENST00000424227.1_Intron|MAP3K13_ENST00000535426.1_Intron|MAP3K13_ENST00000446828.1_Intron|MAP3K13_ENST00000443863.1_Intron	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CAGCCACGCTCCTCTCAGCCC	0.493																																																0			3																																								186619286	SO:0001627	intron_variant	647276			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.-85-9693C>T	3.37:g.185136592C>T		Somatic		Capture	Illumina GAIIx	4	186619286		RNA	SNP	-	NULL	ENST00000265026.3	37	NULL	CCDS3270.1	3																																																																																			-	-		0.493	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC647276	protein_coding	OTTHUMT00000345268.1	C	NM_004721		186619286	-1	pseudogene	XR_017675	genbank	human	model	54_36p	rna	SNP	0.28	T
IGHV3OR16-9	28307	genome.wustl.edu	37	16	33647488	33647488	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr16:33647488T>C	ENST00000558425.1	-	2	111	c.112A>G	c.(112-114)Aga>Gga	p.R38G																								CAGGACAGTCTCAGGGACCCC	0.572																																																0			16											97.0	111.0	107.0					16																	33647488		1839	4098	5937	33554989	SO:0001583	missense	0																														ENST00000558425.1:c.112A>G	16.37:g.33647488T>C	ENSP00000475107:p.Arg38Gly	Somatic		Capture	Illumina GAIIx	4	33554989		Missense_Mutation	SNP	-	p.R38G	ENST00000558425.1	37	c.112		16																																																																																			-	NULL		0.572	RP11-812E19.9-201	KNOWN	basic	protein_coding	ENSG00000205454	protein_coding		T			33554989	-1	no_start_codon:no_stop_codon	ENST00000360102	ensembl	human	known	54_36p	missense	SNP	0.25	C
TIGD4	201798	genome.wustl.edu	37	4	153691680	153691680	+	Silent	SNP	C	C	T	rs141579935		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr4:153691680C>T	ENST00000304337.2	-	2	1297	c.477G>A	c.(475-477)tcG>tcA	p.S159S		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	159						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S159S(1)		breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					ACCAGACAGTCGAAGGGTCTA	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		19295	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	4						C		0,4404		0,0,2202	43.0	46.0	45.0		477	-6.8	0.0	4	dbSNP_134	45	3,8593	3.0+/-9.4	0,3,4295	no	coding-synonymous	TIGD4	NM_145720.3		0,3,6497	TT,TC,CC		0.0349,0.0,0.0231		159/513	153691680	3,12997	2202	4298	6500	153911130	SO:0001819	synonymous_variant	201798			AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.477G>A	4.37:g.153691680C>T		Somatic		Capture	Illumina GAIIx	4	153911130	Q96LP5	Silent	SNP	-	p.S159	ENST00000304337.2	37	c.477	CCDS34079.1	4																																																																																			-	NULL		0.363	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD4	protein_coding	OTTHUMT00000365028.1	C	NM_145720		153911130	-1	no_errors	NM_145720	genbank	human	reviewed	54_36p	silent	SNP	0.12	T
PCDHGA5	56110	genome.wustl.edu	37	5	140746310	140746310	+	Nonsense_Mutation	SNP	C	C	T	rs561614642		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr5:140746310C>T	ENST00000518069.1	+	1	2413	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	805					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R805*(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAGAACGGCGAGTTCAGGT	0.418													.|||	1	0.000199681	0.0	0.0	5008	,	,		20283	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Nonsense(1)	ovary(1)	5											106.0	117.0	113.0					5																	140746310		2133	4256	6389	140726494	SO:0001587	stop_gained	56110			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2413C>T	5.37:g.140746310C>T	ENSP00000429834:p.Arg805*	Somatic		Capture	Illumina GAIIx	4	140726494	Q2M3F5|Q9Y5D2	Nonsense_Mutation	SNP	-	p.R805*	ENST00000518069.1	37	c.2413	CCDS54925.1	5	.	.	.	.	.	.	.	.	.	.	.	19.54	3.846730	0.71603	.	.	ENSG00000253485	ENST00000518069	.	.	.	5.31	-1.0	0.10196	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999999	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	2.1091	0.03698	0.3753:0.3121:0.204:0.1085	.	.	.	.	X	805	.	ENSP00000429834:R805X	R	+	1	2	PCDHGA5	140726494	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.701000	0.25616	0.069000	0.16605	-0.867000	0.03001	CGA	-	NULL		0.418	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	protein_coding	OTTHUMT00000374742.1	C	NM_018918		140726494	1	no_errors	NM_018918	genbank	human	reviewed	54_36p	nonsense	SNP		T
DUSP1	1843	genome.wustl.edu	37	5	172196695	172196695	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr5:172196695C>T	ENST00000239223.3	-	3	858	c.616G>A	c.(616-618)Gtc>Atc	p.V206I	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	206	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.V206I(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		TTGGCTGAGACGTTGATCAAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	5											214.0	180.0	192.0					5																	172196695		2203	4300	6503	172129301	SO:0001583	missense	1843			X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.616G>A	5.37:g.172196695C>T	ENSP00000239223:p.Val206Ile	Somatic		Capture	Illumina GAIIx	4	172129301	D3DQL9|Q2V508	Missense_Mutation	SNP	HMMPfam_DSPc;HMMPfam_Rhodanese;superfamily_(Phosphotyrosine protein) phosphatases II;superfamily_Rhodanese/Cell cycle control phosphatase	p.V206I	ENST00000239223.3	37	c.616	CCDS4380.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.226031	0.95173	.	.	ENSG00000120129	ENST00000239223;ENST00000457103;ENST00000434080	T	0.62498	0.02	5.32	5.32	0.75619	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.79581	0.4470	M	0.72576	2.205	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.87578	0.998;0.996	T	0.81623	-0.0849	10	0.87932	D	0	.	19.0154	0.92892	0.0:1.0:0.0:0.0	.	206;163	P28562;B4DNT2	DUS1_HUMAN;.	I	206;179;141	ENSP00000239223:V206I	ENSP00000239223:V206I	V	-	1	0	DUSP1	172129301	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.783000	0.85696	2.498000	0.84270	0.561000	0.74099	GTC	-	HMMPfam_DSPc		0.547	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP1	protein_coding	OTTHUMT00000252943.3	C	NM_004417		172129301	-1	no_errors	NM_004417	genbank	human	reviewed	54_36p	missense	SNP	1	T
NADK2	133686	genome.wustl.edu	37	5	36217947	36217947	+	Silent	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr5:36217947C>T	ENST00000381937.4	-	6	683	c.684G>A	c.(682-684)ggG>ggA	p.G228G	NADK2_ENST00000282512.3_Silent_p.G65G|NADK2_ENST00000397338.1_Silent_p.G65G|NADK2_ENST00000514504.1_Silent_p.G228G|NADK2_ENST00000506945.1_Silent_p.G65G	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	228					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)	p.G65G(1)									TTATGCCAGTCCCTTCAAGGT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	5											144.0	127.0	133.0					5																	36217947		2203	4300	6503	36253704	SO:0001819	synonymous_variant	133686			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.684G>A	5.37:g.36217947C>T		Somatic		Capture	Illumina GAIIx	4	36253704	B5MC93|Q6UTX5|Q96NM0	Silent	SNP	-	p.G228	ENST00000381937.4	37	c.684	CCDS47197.1	5																																																																																			-	NULL		0.388	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C5orf33	protein_coding	OTTHUMT00000367541.1	C	NM_153013		36253704	-1	no_errors	NM_001085411	genbank	human	validated	54_36p	silent	SNP	1	T
RAB3C	115827	genome.wustl.edu	37	5	58021919	58021919	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr5:58021919G>A	ENST00000282878.4	+	3	512	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K	RAB3C_ENST00000507977.1_3'UTR	NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	115					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.E115K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		CATTACAAATGAAGAATCCTT	0.398																																																1	Substitution - Missense(1)	ovary(1)	5											119.0	114.0	116.0					5																	58021919		2203	4300	6503	58057676	SO:0001583	missense	115827			AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.343G>A	5.37:g.58021919G>A	ENSP00000282878:p.Glu115Lys	Somatic		Capture	Illumina GAIIx	4	58057676		Missense_Mutation	SNP	HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E115K	ENST00000282878.4	37	c.343	CCDS3976.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.574524	0.96553	.	.	ENSG00000152932	ENST00000282878	T	0.76839	-1.05	5.53	5.53	0.82687	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000016	T	0.69242	0.3089	N	0.05619	-0.005	0.80722	D	1	P	0.40909	0.732	P	0.44860	0.462	T	0.75679	-0.3234	10	0.72032	D	0.01	-15.1661	19.4713	0.94963	0.0:0.0:1.0:0.0	.	115	Q96E17	RAB3C_HUMAN	K	115	ENSP00000282878:E115K	ENSP00000282878:E115K	E	+	1	0	RAB3C	58057676	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.808000	0.99193	2.587000	0.87381	0.563000	0.77884	GAA	-	HMMPfam_Ras		0.398	RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3C	protein_coding	OTTHUMT00000214156.2	G	NM_138453		58057676	1	no_errors	NM_138453	genbank	human	provisional	54_36p	missense	SNP	1	A
BOD1	91272	genome.wustl.edu	37	5	173040254	173040254	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr5:173040254G>A	ENST00000311086.4	-	2	465	c.242C>T	c.(241-243)gCt>gTt	p.A81V	BOD1_ENST00000480951.1_Intron|BOD1_ENST00000471339.1_5'UTR|BOD1_ENST00000285908.5_Missense_Mutation_p.A81V	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	81					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)		p.A81V(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						GTTTTGGTAAGCTGGCTAAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	5											138.0	128.0	131.0					5																	173040254		2203	4300	6503	172972860	SO:0001583	missense	91272			AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.242C>T	5.37:g.173040254G>A	ENSP00000309644:p.Ala81Val	Somatic		Capture	Illumina GAIIx	4	172972860	B4DXH8|Q9BTW1	Missense_Mutation	SNP	-	p.A81V	ENST00000311086.4	37	c.242	CCDS4389.1	5	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572754	0.86542	.	.	ENSG00000145919	ENST00000311086;ENST00000285908	T	0.26067	1.76	5.05	5.05	0.67936	.	0.049871	0.85682	D	0.000000	T	0.52058	0.1711	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.74023	0.982;0.982	T	0.56679	-0.7939	10	0.87932	D	0	-8.3935	18.4336	0.90636	0.0:0.0:1.0:0.0	.	81;81	Q96IK1-2;Q96IK1	.;BOD1_HUMAN	V	81	ENSP00000309644:A81V	ENSP00000285908:A81V	A	-	2	0	BOD1	172972860	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.496000	0.81526	2.354000	0.79902	0.655000	0.94253	GCT	-	NULL		0.393	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1	protein_coding	OTTHUMT00000252963.1	G	NM_138369		172972860	-1	no_errors	NM_138369	genbank	human	provisional	54_36p	missense	SNP	1	A
PREP	5550	genome.wustl.edu	37	6	105736641	105736641	+	Silent	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr6:105736641G>A	ENST00000369110.3	-	11	1638	c.1446C>T	c.(1444-1446)ccC>ccT	p.P482P		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	482					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.P482P(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	ACCTGTAGTTGGGTGTGATGG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	6											104.0	102.0	103.0					6																	105736641		2203	4300	6503	105843334	SO:0001819	synonymous_variant	5550				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.1446C>T	6.37:g.105736641G>A		Somatic		Capture	Illumina GAIIx	4	105843334	Q8N6D4	Silent	SNP	HMMPfam_Peptidase_S9;HMMPfam_Peptidase_S9_N;superfamily_Prolyl oligopeptidase N-terminal domain;superfamily_alpha/beta-Hydrolases	p.P482	ENST00000369110.3	37	c.1446	CCDS5053.1	6																																																																																			-	HMMPfam_Peptidase_S9		0.398	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	protein_coding	OTTHUMT00000041658.1	G			105843334	-1	no_errors	NM_002726	genbank	human	reviewed	54_36p	silent	SNP	1	A
RREB1	6239	genome.wustl.edu	37	6	7248752	7248752	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr6:7248752C>G	ENST00000349384.6	+	12	4929	c.4615C>G	c.(4615-4617)Cca>Gca	p.P1539A	RREB1_ENST00000334984.6_Missense_Mutation_p.P1328A|RREB1_ENST00000379938.2_Missense_Mutation_p.P1594A|RREB1_ENST00000379933.3_Missense_Mutation_p.P1539A	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1539					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P1539A(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AGGGGAAAGGCCATACAAATG	0.542																																																1	Substitution - Missense(1)	ovary(1)	6											67.0	65.0	65.0					6																	7248752		2203	4300	6503	7193751	SO:0001583	missense	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.4615C>G	6.37:g.7248752C>G	ENSP00000305560:p.Pro1539Ala	Somatic		Capture	Illumina GAIIx	4	7193751	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.P1594A	ENST00000349384.6	37	c.4780	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387459	0.82902	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.20069	2.34;2.34;2.34;2.1	5.7	5.7	0.88788	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000011	T	0.46908	0.1417	M	0.82630	2.6	0.45025	D	0.998043	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.999;1.0;0.989	T	0.51419	-0.8708	10	0.87932	D	0	-31.1174	19.8411	0.96685	0.0:1.0:0.0:0.0	.	1328;1539;1594	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	A	1539;1594;1539;1328	ENSP00000369265:P1539A;ENSP00000369270:P1594A;ENSP00000305560:P1539A;ENSP00000335574:P1328A	ENSP00000335574:P1328A	P	+	1	0	RREB1	7193751	1.000000	0.71417	0.991000	0.47740	0.871000	0.50021	7.275000	0.78548	2.683000	0.91414	0.655000	0.94253	CCA	-	NULL		0.542	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	protein_coding	OTTHUMT00000352985.1	C			7193751	1	no_errors	NM_001003699	genbank	human	validated	54_36p	missense	SNP	1	G
TUBB	203068	genome.wustl.edu	37	6	30691259	30691259	+	Silent	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr6:30691259C>T	ENST00000327892.8	+	4	726	c.420C>T	c.(418-420)ggC>ggT	p.G140G	TUBB_ENST00000396389.1_Silent_p.G122G|TUBB_ENST00000330914.3_Silent_p.G68G|TUBB_ENST00000435534.1_Intron|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000396384.1_Silent_p.G68G	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	140					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G140G(1)		breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	ACTCACTGGGCGGGGGCACAG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	6											63.0	63.0	63.0					6																	30691259		2203	4300	6503	30799238	SO:0001819	synonymous_variant	203068			AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.420C>T	6.37:g.30691259C>T		Somatic		Capture	Illumina GAIIx	4	30799238	P05218|Q8WUC1|Q9CY33	Silent	SNP	HMMPfam_Tubulin;HMMPfam_Tubulin_C;superfamily_Tubulin nucleotide-binding domain-like;superfamily_Tubulin C-terminal domain-like	p.G140	ENST00000327892.8	37	c.420	CCDS4687.1	6																																																																																			-	HMMPfam_Tubulin		0.577	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB	protein_coding	OTTHUMT00000076074.2	C	NM_178014		30799238	1	no_errors	NM_178014	genbank	human	provisional	54_36p	silent	SNP	0.99	T
ZBTB22	9278	genome.wustl.edu	37	6	33284546	33284546	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr6:33284546G>A	ENST00000431845.2	-	2	299	c.148C>T	c.(148-150)Cag>Tag	p.Q50*	TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank|DAXX_ENST00000477162.1_5'Flank|ZBTB22_ENST00000418724.1_Nonsense_Mutation_p.Q50*|TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000456592.2_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q50*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						TGCAGACGCTGCTGATTGAGG	0.632																																																1	Substitution - Nonsense(1)	ovary(1)	6											47.0	49.0	48.0					6																	33284546		2203	4300	6503	33392524	SO:0001587	stop_gained	9278			Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.148C>T	6.37:g.33284546G>A	ENSP00000407545:p.Gln50*	Somatic		Capture	Illumina GAIIx	4	33392524	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Nonsense_Mutation	SNP	-	p.Q50*	ENST00000431845.2	37	c.148	CCDS4775.1	6	.	.	.	.	.	.	.	.	.	.	G	32	5.155095	0.94686	.	.	ENSG00000236104	ENST00000418724;ENST00000431845;ENST00000441117	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.9109	0.70755	0.0:0.0:1.0:0.0	.	.	.	.	X	50	.	ENSP00000404403:Q50X	Q	-	1	0	ZBTB22	33392524	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.619000	0.98369	2.374000	0.81015	0.643000	0.83706	CAG	-	NULL		0.632	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB22	protein_coding	OTTHUMT00000076183.2	G			33392524	-1	no_errors	NM_005453	genbank	human	validated	54_36p	nonsense	SNP	1	A
ZNF259P1	442240	genome.wustl.edu	37	6	109107799	109107799	+	RNA	SNP	G	G	A	rs559958564		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr6:109107799G>A	ENST00000572422.1	-	0	441									zinc finger protein 259 pseudogene 1																		GCCAGAGATAGCACGGGTGAT	0.483																																																0			6																																								109214492			442240			Z95118		6q21	2012-10-05	2009-11-20	2009-11-20	ENSG00000219565	ENSG00000219565			13052	pseudogene	pseudogene			"""zinc finger protein 259, pseudogene"""	ZNF259P			Standard	NG_009460		Approved	354J5			OTTHUMG00000016136		6.37:g.109107799G>A		Somatic		Capture	Illumina GAIIx	4	109214492		RNA	SNP	-	NULL	ENST00000572422.1	37	NULL		6																																																																																			-	-		0.483	ZNF259P1-002	KNOWN	basic	processed_transcript	LOC442240	pseudogene	OTTHUMT00000436273.1	G	NG_009460		109214492	-1	pseudogene	XR_016496	genbank	human	model	54_36p	rna	SNP	0.99	A
CSMD1	64478	genome.wustl.edu	37	8	3267072	3267072	+	Silent	SNP	C	C	G	rs185713105	byFrequency	TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr8:3267072C>G	ENST00000520002.1	-	14	2175	c.1620G>C	c.(1618-1620)acG>acC	p.T540T	CSMD1_ENST00000537824.1_Silent_p.T539T|CSMD1_ENST00000539096.1_Silent_p.T539T|CSMD1_ENST00000602723.1_Silent_p.T540T|CSMD1_ENST00000400186.3_Silent_p.T540T|CSMD1_ENST00000542608.1_Silent_p.T539T|CSMD1_ENST00000602557.1_Silent_p.T540T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	540	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.T268T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AACTGCTGCCCGTCCGCTTCC	0.498																																																1	Substitution - coding silent(1)	ovary(1)	8											36.0	37.0	37.0					8																	3267072		1879	4103	5982	3254480	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1620G>C	8.37:g.3267072C>G		Somatic		Capture	Illumina GAIIx	4	3254480	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	-	p.T540	ENST00000520002.1	37	c.1620		8	.	.	.	.	.	.	.	.	.	.	C	6.778	0.512544	0.12944	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.26	-10.5	0.00291	.	.	.	.	.	T	0.39462	0.1079	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54330	-0.8310	4	.	.	.	.	3.3353	0.07098	0.3096:0.0672:0.1458:0.4775	.	.	.	.	R	20	.	.	G	-	1	0	CSMD1	3254480	0.000000	0.05858	0.037000	0.18230	0.888000	0.51559	-6.828000	0.00052	-4.242000	0.00062	-0.254000	0.11334	GGG	-	NULL		0.498	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	C	NM_033225		3254480	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	silent	SNP	0.01	G
LOXL2	4017	genome.wustl.edu	37	8	23217671	23217671	+	Missense_Mutation	SNP	C	C	T	rs370732859		TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr8:23217671C>T	ENST00000389131.3	-	3	832	c.463G>A	c.(463-465)Ggt>Agt	p.G155S	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	155	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)	p.G155S(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CACACCACACCGACATCCTCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	8						C	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	118.0	99.0	106.0		463	5.6	1.0	8		106	0,8600		0,0,4300	no	missense	LOXL2	NM_002318.2	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	155/775	23217671	1,13005	2203	4300	6503	23273616	SO:0001583	missense	4017			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.463G>A	8.37:g.23217671C>T	ENSP00000373783:p.Gly155Ser	Somatic		Capture	Illumina GAIIx	4	23273616	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	HMMPfam_SRCR;superfamily_SRCR-like;HMMPfam_Lysyl_oxidase	p.G155S	ENST00000389131.3	37	c.463	CCDS34864.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.732672	0.96856	2.27E-4	0.0	ENSG00000134013	ENST00000389131;ENST00000524144;ENST00000520871	T;T;T	0.38560	1.13;1.13;1.13	5.62	5.62	0.85841	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.85682	D	0.000000	T	0.64605	0.2613	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62343	-0.6874	10	0.48119	T	0.1	.	18.5877	0.91196	0.0:1.0:0.0:0.0	.	155	Q9Y4K0	LOXL2_HUMAN	S	155;236;196	ENSP00000373783:G155S;ENSP00000427883:G236S;ENSP00000429778:G196S	ENSP00000373783:G155S	G	-	1	0	LOXL2	23273616	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	7.645000	0.83430	2.804000	0.96469	0.655000	0.94253	GGT	-	HMMPfam_SRCR		0.512	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	protein_coding	OTTHUMT00000375603.1	C			23273616	-1	no_errors	NM_002318	genbank	human	reviewed	54_36p	missense	SNP	1	T
SLC24A2	25769	genome.wustl.edu	37	9	19528072	19528072	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr9:19528072T>G	ENST00000341998.2	-	8	1605	c.1544A>C	c.(1543-1545)tAc>tCc	p.Y515S	SLC24A2_ENST00000286344.3_Missense_Mutation_p.Y498S	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	515					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.Y515S(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GACCATCAAGTAAGAGAATAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	9											88.0	77.0	81.0					9																	19528072		2202	4300	6502	19518072	SO:0001583	missense	25769			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1544A>C	9.37:g.19528072T>G	ENSP00000344801:p.Tyr515Ser	Somatic		Capture	Illumina GAIIx	4	19518072	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex	p.Y515S	ENST00000341998.2	37	c.1544	CCDS6493.1	9	.	.	.	.	.	.	.	.	.	.	T	28.1	4.889639	0.91889	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.62105	0.05;0.05	6.17	6.17	0.99709	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.81749	0.4888	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.83547	0.0099	9	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	498;515	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	S	515;498	ENSP00000344801:Y515S;ENSP00000286344:Y498S	.	Y	-	2	0	SLC24A2	19518072	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.798000	0.85924	2.371000	0.80710	0.533000	0.62120	TAC	-	HMMPfam_Na_Ca_ex		0.428	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A2	protein_coding	OTTHUMT00000051866.2	T	NM_020344		19518072	-1	no_errors	NM_020344	genbank	human	provisional	54_36p	missense	SNP	1	G
CCDC180	100499483	genome.wustl.edu	37	9	100085204	100085204	+	Splice_Site	SNP	G	G	C			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chr9:100085204G>C	ENST00000357054.1	+	26	2732		c.e26+1		CCDC180_ENST00000460482.2_Splice_Site|CCDC180_ENST00000375202.2_Splice_Site|CCDC180_ENST00000411667.2_Splice_Site|CCDC180_ENST00000529487.1_Splice_Site|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_Splice_Site			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.?(1)									GAATTGTAAGGTGGGCACCCT	0.587																																																1	Unknown(1)	ovary(1)	9											84.0	62.0	69.0					9																	100085204		2203	4300	6503	99125025	SO:0001630	splice_region_variant	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1797+1G>C	9.37:g.100085204G>C		Somatic		Capture	Illumina GAIIx	4	99125025	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Splice_Site	SNP	-	e15+1	ENST00000357054.1	37	c.1797+1		9	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360340	0.41801	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6313	0.68657	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C9orf174	99125025	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	5.093000	0.64517	2.608000	0.88229	0.561000	0.74099	.	-	-		0.587	CCDC180-201	KNOWN	basic	protein_coding	KIAA1529	protein_coding		G	NM_020893	Intron	99125025	1	no_errors	NM_020893	genbank	human	predicted	54_36p	splice_site	SNP	1	C
IL13RA2	3598	genome.wustl.edu	37	X	114245331	114245331	+	Silent	SNP	A	A	G			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chrX:114245331A>G	ENST00000371936.1	-	7	831	c.582T>C	c.(580-582)aaT>aaC	p.N194N	IL13RA2_ENST00000243213.1_Silent_p.N194N			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	194	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)	p.N194N(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						TGCATCCTATATTTTGTCCAT	0.353																																																1	Substitution - coding silent(1)	ovary(1)	X											106.0	96.0	100.0					X																	114245331		2203	4300	6503	114151587	SO:0001819	synonymous_variant	3598			X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.582T>C	X.37:g.114245331A>G		Somatic		Capture	Illumina GAIIx	4	114151587	A8K7E2|O00667	Silent	SNP	superfamily_Fibronectin type III	p.N194	ENST00000371936.1	37	c.582	CCDS14565.1	X																																																																																			-	NULL		0.353	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL13RA2	protein_coding	OTTHUMT00000057966.1	A	NM_000640		114151587	-1	no_errors	NM_000640	genbank	human	reviewed	54_36p	silent	SNP	0.9	G
TAF1	6872	genome.wustl.edu	37	X	70602947	70602947	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chrX:70602947G>A	ENST00000373790.4	+	12	1928	c.1877G>A	c.(1876-1878)gGt>gAt	p.G626D	TAF1_ENST00000276072.3_Missense_Mutation_p.G647D|TAF1_ENST00000449580.1_Missense_Mutation_p.G626D|TAF1_ENST00000423759.1_Missense_Mutation_p.G647D	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	626	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.G626D(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TACTCATTTGGTGCACTTTCT	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											55.0	51.0	52.0					X																	70602947		2203	4300	6503	70519672	SO:0001583	missense	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1877G>A	X.37:g.70602947G>A	ENSP00000362895:p.Gly626Asp	Somatic		Capture	Illumina GAIIx	4	70519672	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	Bromodomain;HMMPfam_Bromodomain;TBP-binding;HMMPfam_TBP-binding;TAF(II)230 TBP-binding fragment;superfamily_TAF(II)230 TBP-binding fragment;superfamily_Bromodomain	p.G647D	ENST00000373790.4	37	c.1940	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	24.4	4.529493	0.85706	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.09911	2.93;3.0;2.98;2.93	5.82	5.82	0.92795	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.049457	0.85682	D	0.000000	T	0.38772	0.1053	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.20174	-1.0283	10	0.72032	D	0.01	.	19.1009	0.93274	0.0:0.0:1.0:0.0	.	626;647	P21675;P21675-2	TAF1_HUMAN;.	D	626;626;647;647	ENSP00000362895:G626D;ENSP00000389000:G626D;ENSP00000406549:G647D;ENSP00000276072:G647D	ENSP00000276072:G647D	G	+	2	0	TAF1	70519672	1.000000	0.71417	0.993000	0.49108	0.878000	0.50629	9.472000	0.97709	2.461000	0.83175	0.536000	0.68110	GGT	-	NULL		0.473	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	protein_coding	OTTHUMT00000058995.2	G	NM_004606		70519672	1	no_errors	NM_004606	genbank	human	reviewed	54_36p	missense	SNP	1	A
KIAA1210	57481	genome.wustl.edu	37	X	118223499	118223499	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1343-01A-01W-0488-09	TCGA-04-1343-10A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	fbbc3d80-aff2-463e-8eb3-c4361ad7cb98	9018d52d-26a4-4572-aac7-f4e4b4fc5593	g.chrX:118223499C>T	ENST00000402510.2	-	11	1693	c.1694G>A	c.(1693-1695)gGc>gAc	p.G565D		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	565								p.G389D(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ATCGCCCAGGCCATACCCTTC	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											186.0	181.0	183.0					X																	118223499		2025	4166	6191	118107527	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1694G>A	X.37:g.118223499C>T	ENSP00000384670:p.Gly565Asp	Somatic		Capture	Illumina GAIIx	4	118107527	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	-	p.G565D	ENST00000402510.2	37	c.1694	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	8.971	0.973030	0.18736	.	.	ENSG00000250423	ENST00000402510	T	0.10573	2.86	4.83	0.441	0.16577	.	.	.	.	.	T	0.04861	0.0131	N	0.14661	0.345	0.09310	N	1	B	0.19331	0.035	B	0.18263	0.021	T	0.46289	-0.9202	9	0.14656	T	0.56	.	3.6147	0.08073	0.1714:0.4627:0.0:0.3659	.	565	Q9ULL0	K1210_HUMAN	D	565	ENSP00000384670:G565D	ENSP00000384670:G565D	G	-	2	0	RP13-347D8.6	118107527	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.285000	0.01153	-0.182000	0.10602	0.523000	0.50628	GGC	-	NULL		0.473	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	protein_coding	OTTHUMT00000371251.2	C	NM_020721		118107527	-1	no_errors	NM_020721	genbank	human	validated	54_36p	missense	SNP	0.01	T
