#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SPATA21	374955	genome.wustl.edu	37	1	16748479	16748479	+	Intron	SNP	C	C	T	rs112564075	byFrequency	TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:16748479C>T	ENST00000335496.1	-	4	517				SPATA21_ENST00000540400.1_Intron|SPATA21_ENST00000466212.1_5'UTR	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		GGAGCCACGACGGACATTGGG	0.597													c|||	93	0.0185703	0.0658	0.0086	5008	,	,		19053	0.0		0.0	False		,,,				2504	0.0															0			1						C		278,4128	153.7+/-187.2	12,254,1937	152.0	140.0	144.0			-0.5	0.0	1	dbSNP_132	144	3,8597	3.0+/-9.4	0,3,4297	no	intron	SPATA21	NM_198546.1		12,257,6234	TT,TC,CC		0.0349,6.3096,2.1605			16748479	281,12725	2203	4300	6503	16621066	SO:0001627	intron_variant	374955				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.35-13G>A	1.37:g.16748479C>T		Somatic		Capture	Illumina GAIIx	4	16621066	B9EK40|F5GXP5	Missense_Mutation	SNP	-	p.V234I	ENST00000335496.1	37	c.700	CCDS172.1	1																																																																																			-	NULL		0.597	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	protein_coding	OTTHUMT00000006677.2	C	NM_198546		16621066	-1	no_errors	ENST00000375584	ensembl	human	known	54_36p	missense	SNP		T
PADI2	11240	genome.wustl.edu	37	1	17396628	17396628	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:17396628G>T	ENST00000375486.4	-	15	1782	c.1719C>A	c.(1717-1719)ttC>ttA	p.F573L	PADI2_ENST00000444885.2_Missense_Mutation_p.F457L|PADI2_ENST00000466151.1_5'UTR	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	573					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)	p.F573L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CGTCCATCTTGAACAGAGCGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											146.0	125.0	132.0					1																	17396628		2203	4300	6503	17269215	SO:0001583	missense	11240			AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1719C>A	1.37:g.17396628G>T	ENSP00000364635:p.Phe573Leu	Somatic		Capture	Illumina GAIIx	4	17269215	Q96DA7|Q9UPN2	Missense_Mutation	SNP	-	p.F573L	ENST00000375486.4	37	c.1719	CCDS177.1	1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687391	0.88639	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	T;T	0.53206	0.63;0.63	4.6	4.6	0.57074	Protein-arginine deiminase, C-terminal (1);	0.147711	0.64402	D	0.000007	T	0.74199	0.3685	M	0.90870	3.155	0.54753	D	0.999982	D;D	0.71674	0.998;0.984	D;P	0.69654	0.965;0.88	T	0.81357	-0.0969	10	0.87932	D	0	-28.8884	16.5165	0.84302	0.0:0.0:1.0:0.0	.	457;573	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	L	573;457	ENSP00000364635:F573L;ENSP00000405894:F457L	ENSP00000364635:F573L	F	-	3	2	PADI2	17269215	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	3.739000	0.55075	2.527000	0.85204	0.563000	0.77884	TTC	-	NULL		0.592	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	protein_coding	OTTHUMT00000006624.1	G			17269215	-1	no_errors	NM_007365	genbank	human	reviewed	54_36p	missense	SNP	1	T
KIF17	57576	genome.wustl.edu	37	1	21016709	21016709	+	Silent	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:21016709C>T	ENST00000247986.2	-	7	1663	c.1353G>A	c.(1351-1353)acG>acA	p.T451T	KIF17_ENST00000375044.1_Silent_p.T351T|KIF17_ENST00000400463.3_Silent_p.T451T|KIF17_ENST00000490034.1_5'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17	451					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.T451T(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCTCCTCCAGCGTGGACAGCC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											56.0	49.0	52.0					1																	21016709		2203	4300	6503	20889296	SO:0001819	synonymous_variant	57576			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1353G>A	1.37:g.21016709C>T		Somatic		Capture	Illumina GAIIx	Phase_III	20889296	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	HMMPfam_Kinesin,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.T451	ENST00000247986.2	37	c.1353	CCDS213.1	1																																																																																			-	NULL		0.627	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	protein_coding	OTTHUMT00000276995.1	C	NM_020816		20889296	-1	no_errors	NM_020816	genbank	human	validated	54_36p	silent	SNP	0.94	T
WNT3A	89780	genome.wustl.edu	37	1	228210473	228210473	+	Silent	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:228210473C>T	ENST00000284523.1	+	2	255	c.177C>T	c.(175-177)taC>taT	p.Y59Y	WNT3A_ENST00000366753.2_Silent_p.Y59Y	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	59					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)	p.Y59Y(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				GCAGGAACTACGTGGAGATCA	0.652																																																1	Substitution - coding silent(1)	ovary(1)	1											54.0	53.0	54.0					1																	228210473		2203	4300	6503	226277096	SO:0001819	synonymous_variant	89780			AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.177C>T	1.37:g.228210473C>T		Somatic		Capture	Illumina GAIIx	4	226277096	Q3SY79|Q3SY80|Q969P2	Silent	SNP	HMMPfam_wnt	p.Y59	ENST00000284523.1	37	c.177	CCDS1564.1	1																																																																																			-	HMMPfam_wnt		0.652	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT3A	protein_coding	OTTHUMT00000091648.1	C	NM_033131		226277096	1	no_errors	NM_033131	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
RAB4A	5867	genome.wustl.edu	37	1	229438689	229438689	+	Missense_Mutation	SNP	G	G	A	rs200242732		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:229438689G>A	ENST00000366690.4	+	7	830	c.622G>A	c.(622-624)Gca>Aca	p.A208T	SPHAR_ENST00000366688.3_5'Flank|RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	208				A -> T (in Ref. 1; AAA60244). {ECO:0000305}.	antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)	p.A208T(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				ACCGCGGCGCGCACAGGCCCC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		14492	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(11;250 603 9619 16563)											1	Substitution - Missense(1)	ovary(1)	1											90.0	92.0	91.0					1																	229438689		2203	4300	6503	227505312	SO:0001583	missense	5867			BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.622G>A	1.37:g.229438689G>A	ENSP00000355651:p.Ala208Thr	Somatic		Capture	Illumina GAIIx	4	227505312	Q5T7P7|Q9BQ44	Missense_Mutation	SNP	HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A208T	ENST00000366690.4	37	c.622	CCDS31050.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	8.917	0.960053	0.18507	.	.	ENSG00000168118	ENST00000366690	T	0.62941	-0.01	5.74	-0.0113	0.13993	.	0.213333	0.48767	N	0.000178	T	0.33585	0.0868	N	0.14661	0.345	0.20307	N	0.999911	B	0.06786	0.001	B	0.04013	0.001	T	0.13098	-1.0522	10	0.12430	T	0.62	.	4.4231	0.11490	0.1737:0.0:0.3792:0.4471	.	203	P20338	RAB4A_HUMAN	T	208	ENSP00000355651:A208T	ENSP00000355651:A208T	A	+	1	0	RAB4A	227505312	0.998000	0.40836	0.000000	0.03702	0.010000	0.07245	3.143000	0.50608	-0.277000	0.09193	-0.181000	0.13052	GCA	-	NULL		0.582	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4A	protein_coding	OTTHUMT00000091727.3	G	NM_004578		227505312	1	no_errors	NM_004578	genbank	human	provisional	54_36p	missense	SNP	0.94	A
GCLM	2730	genome.wustl.edu	37	1	94362292	94362292	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:94362292T>C	ENST00000370238.3	-	5	668	c.422A>G	c.(421-423)gAg>gGg	p.E141G	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	141					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)	p.E141G(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	CTGTAAATGCTCCAAGGAAAG	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											132.0	129.0	130.0					1																	94362292		2203	4300	6503	94134880	SO:0001583	missense	2730			L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.422A>G	1.37:g.94362292T>C	ENSP00000359258:p.Glu141Gly	Somatic		Capture	Illumina GAIIx	4	94134880	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Missense_Mutation	SNP	superfamily_NAD(P)-linked oxidoreductase	p.E141G	ENST00000370238.3	37	c.422	CCDS746.1	1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.448419	0.84101	.	.	ENSG00000023909	ENST00000370238	T	0.42513	0.97	5.5	5.5	0.81552	NADP-dependent oxidoreductase domain (3);	0.142642	0.64402	D	0.000006	T	0.36054	0.0953	L	0.41961	1.31	0.51482	D	0.999923	P	0.49559	0.925	P	0.52514	0.701	T	0.05582	-1.0876	10	0.27785	T	0.31	.	15.9002	0.79369	0.0:0.0:0.0:1.0	.	141	P48507	GSH0_HUMAN	G	141	ENSP00000359258:E141G	ENSP00000359258:E141G	E	-	2	0	GCLM	94134880	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.980000	0.63812	2.219000	0.72066	0.533000	0.62120	GAG	-	NULL		0.423	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLM	protein_coding	OTTHUMT00000029169.1	T	NM_002061		94134880	-1	no_errors	NM_002061	genbank	human	reviewed	54_36p	missense	SNP	1	C
OR14K1	343170	genome.wustl.edu	37	1	247902119	247902119	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr1:247902119A>T	ENST00000283225.2	+	1	203	c.203A>T	c.(202-204)gAc>gTc	p.D68V	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D68V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						TCCTTCTTAGACCTGTGTCTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	141.0	142.0					1																	247902119		2165	4281	6446	245968742	SO:0001583	missense	343170			BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.203A>T	1.37:g.247902119A>T	ENSP00000283225:p.Asp68Val	Somatic		Capture	Illumina GAIIx	4	245968742	A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	-	p.D68V	ENST00000283225.2	37	c.203		1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370017	0.82573	.	.	ENSG00000153230	ENST00000283225	T	0.10668	2.85	3.74	3.74	0.42951	.	0.000000	0.41194	U	0.000934	T	0.17959	0.0431	.	.	.	0.26255	N	0.978668	.	.	.	.	.	.	T	0.02774	-1.1112	7	0.87932	D	0	.	11.368	0.49684	1.0:0.0:0.0:0.0	.	.	.	.	V	68	ENSP00000283225:D68V	ENSP00000283225:D68V	D	+	2	0	OR14K1	245968742	0.982000	0.34865	0.011000	0.14972	0.957000	0.61999	3.011000	0.49567	1.525000	0.49052	0.496000	0.49642	GAC	-	NULL		0.488	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	OR14K1	protein_coding	OTTHUMT00000096868.1	A	NM_001004732		245968742	1	no_errors	ENST00000283225	ensembl	human	known	54_36p	missense	SNP	0.08	T
OR56A1	120796	genome.wustl.edu	37	11	6048547	6048547	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr11:6048547A>C	ENST00000316650.5	-	1	424	c.388T>G	c.(388-390)Tat>Gat	p.Y130D		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y130D(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGGCCACATAACGGTCATAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											126.0	105.0	112.0					11																	6048547		2201	4296	6497	6005123	SO:0001583	missense	120796			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.388T>G	11.37:g.6048547A>C	ENSP00000321246:p.Tyr130Asp	Somatic		Capture	Illumina GAIIx	4	6005123	B2RNI2|Q6IFL0	Missense_Mutation	SNP	-	p.Y130D	ENST00000316650.5	37	c.388	CCDS31405.1	11	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216455	0.39201	.	.	ENSG00000180934	ENST00000316650	T	0.57752	0.38	4.16	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.192286	0.25388	N	0.031035	T	0.79857	0.4518	H	0.96239	3.79	0.36010	D	0.837973	D	0.89917	1.0	D	0.91635	0.999	D	0.88524	0.3098	10	0.87932	D	0	.	12.4382	0.55610	1.0:0.0:0.0:0.0	.	130	Q8NGH5	O56A1_HUMAN	D	130	ENSP00000321246:Y130D	ENSP00000321246:Y130D	Y	-	1	0	OR56A1	6005123	0.998000	0.40836	0.989000	0.46669	0.003000	0.03518	7.255000	0.78338	1.867000	0.54127	0.533000	0.62120	TAT	-	NULL		0.507	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	protein_coding	OTTHUMT00000383757.1	A	NM_001001917		6005123	-1	no_errors	NM_001001917	genbank	human	provisional	54_36p	missense	SNP	1	C
VEZT	55591	genome.wustl.edu	37	12	95694103	95694103	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr12:95694103G>C	ENST00000436874.1	+	12	2099	c.1994G>C	c.(1993-1995)tGt>tCt	p.C665S	VEZT_ENST00000356859.4_3'UTR|VEZT_ENST00000261219.6_Missense_Mutation_p.C617S	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	665					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)		p.C665S(1)		endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						GAGTATTTATGTGAAAACTCT	0.338																																																1	Substitution - Missense(1)	ovary(1)	12											38.0	36.0	37.0					12																	95694103		1840	4093	5933	94218234	SO:0001583	missense	55591			AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.1994G>C	12.37:g.95694103G>C	ENSP00000410083:p.Cys665Ser	Somatic		Capture	Illumina GAIIx	4	94218234	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	-	p.C665S	ENST00000436874.1	37	c.1994	CCDS44954.1	12	.	.	.	.	.	.	.	.	.	.	G	5.883	0.346982	0.11126	.	.	ENSG00000028203	ENST00000436874;ENST00000261219;ENST00000397792;ENST00000397796	T;T;T	0.13901	2.55;2.55;2.55	6.02	3.03	0.35002	.	0.364504	0.37393	N	0.002116	T	0.10423	0.0255	L	0.56769	1.78	0.30763	N	0.74386	B	0.14805	0.011	B	0.11329	0.006	T	0.10823	-1.0613	10	0.18276	T	0.48	-39.0807	1.7826	0.03035	0.2234:0.1447:0.4825:0.1494	.	665	Q9HBM0	VEZA_HUMAN	S	665;617;621;665	ENSP00000410083:C665S;ENSP00000261219:C617S;ENSP00000380894:C621S	ENSP00000261219:C617S	C	+	2	0	VEZT	94218234	0.997000	0.39634	0.997000	0.53966	0.788000	0.44548	0.274000	0.18680	1.553000	0.49476	0.650000	0.86243	TGT	-	NULL		0.338	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEZT	protein_coding	OTTHUMT00000407804.2	G	NM_017599		94218234	1	no_errors	NM_017599	genbank	human	validated	54_36p	missense	SNP	0.998	C
SLC17A8	246213	genome.wustl.edu	37	12	100784850	100784850	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr12:100784850G>A	ENST00000323346.5	+	3	739	c.426G>A	c.(424-426)atG>atA	p.M142I	SLC17A8_ENST00000392989.3_Missense_Mutation_p.M142I	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	142					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.M142I(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						GCTATATTATGACACAAATTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	125.0	124.0					12																	100784850		2203	4300	6503	99308981	SO:0001583	missense	246213			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.426G>A	12.37:g.100784850G>A	ENSP00000316909:p.Met142Ile	Somatic		Capture	Illumina GAIIx	4	99308981	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.M142I	ENST00000323346.5	37	c.426	CCDS9077.1	12	.	.	.	.	.	.	.	.	.	.	G	6.234	0.411278	0.11812	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.52295	0.67;0.67	5.24	5.24	0.73138	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.120360	0.56097	D	0.000029	T	0.10208	0.0250	N	0.00060	-2.34	0.30265	N	0.792776	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20174	-1.0283	10	0.11182	T	0.66	.	8.477	0.33018	0.0767:0.0:0.769:0.1542	.	142;142	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	I	142	ENSP00000316909:M142I;ENSP00000376715:M142I	ENSP00000316909:M142I	M	+	3	0	SLC17A8	99308981	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.537000	0.36083	2.610000	0.88304	0.655000	0.94253	ATG	-	HMMPfam_MFS_1		0.373	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A8	protein_coding	OTTHUMT00000408673.2	G	NM_139319		99308981	1	no_errors	NM_139319	genbank	human	validated	54_36p	missense	SNP	1	A
MYO1H	283446	genome.wustl.edu	37	12	109877506	109877506	+	Missense_Mutation	SNP	C	C	T	rs74528155	byFrequency	TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr12:109877506C>T	ENST00000431443.2	+	23	2347	c.2347C>T	c.(2347-2349)Cgg>Tgg	p.R783W	MYO1H_ENST00000310903.5_Missense_Mutation_p.R773W	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	783						myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CGTGTTTGTGCGGAAGAATTA	0.423													C|||	77	0.0153754	0.0	0.0	5008	,	,		21113	0.0565		0.0	False		,,,				2504	0.0204															0			12						C	TRP/ARG	3,3859		0,3,1928	88.0	85.0	86.0		2317	3.5	1.0	12	dbSNP_131	86	1,8263		0,1,4131	yes	missense	MYO1H	NM_001101421.3	101	0,4,6059	TT,TC,CC		0.0121,0.0777,0.033	probably-damaging	773/1023	109877506	4,12122	1931	4132	6063	108361889	SO:0001583	missense	283446				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2347C>T	12.37:g.109877506C>T	ENSP00000444076:p.Arg783Trp	Somatic		Capture	Illumina GAIIx	4	108361889	F5H3C6	Missense_Mutation	SNP	-	p.R783W	ENST00000431443.2	37	c.2347		12	17	0.007783882783882784	0	0.0	1	0.0027624309392265192	16	0.027972027972027972	0	0.0	C	21.6	4.171766	0.78452	7.77E-4	1.21E-4	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.88818	-2.39;-2.43	5.43	3.48	0.39840	.	.	.	.	.	D	0.83408	0.5248	M	0.79011	2.435	0.32740	N	0.507754	D	0.89917	1.0	D	0.64595	0.927	D	0.87158	0.2213	9	0.66056	D	0.02	.	6.3379	0.21306	0.3299:0.585:0.0:0.0851	.	773	F5H3C6	.	W	773;783	ENSP00000439182:R773W;ENSP00000444076:R783W	ENSP00000439182:R773W	R	+	1	2	MYO1H	108361889	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	2.032000	0.41127	1.228000	0.43614	0.655000	0.94253	CGG	-	NULL		0.423	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	protein_coding		C	NM_173597		108361889	1	no_errors	NM_001101421	genbank	human	inferred	54_36p	missense	SNP	0.978	T
NBEA	26960	genome.wustl.edu	37	13	35630261	35630261	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr13:35630261A>T	ENST00000400445.3	+	7	1621	c.1087A>T	c.(1087-1089)Aat>Tat	p.N363Y	NBEA_ENST00000379939.2_Missense_Mutation_p.N363Y|NBEA_ENST00000310336.4_Missense_Mutation_p.N363Y|NBEA_ENST00000540320.1_Missense_Mutation_p.N363Y	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	363					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.N363Y(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TGTTAACACAAATGATGTAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	13											165.0	154.0	158.0					13																	35630261		1847	4090	5937	34528261	SO:0001583	missense	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1087A>T	13.37:g.35630261A>T	ENSP00000383295:p.Asn363Tyr	Somatic		Capture	Illumina GAIIx	4	34528261	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	HMMPfam_Beach;HMMPfam_WD40;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_DUF1088;superfamily_WD40 repeat-like;superfamily_ARM repeat;superfamily_PH domain-like;superfamily_BEACH domain	p.N363Y	ENST00000400445.3	37	c.1087	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471243	0.84533	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.72317	0.3445	L	0.55990	1.75	0.80722	D	1	D	0.61697	0.99	P	0.62298	0.9	T	0.76077	-0.3091	10	0.87932	D	0	.	14.2302	0.65887	1.0:0.0:0.0:0.0	.	363	Q5T321	.	Y	363	ENSP00000440951:N363Y;ENSP00000383295:N363Y;ENSP00000369271:N363Y;ENSP00000308534:N363Y	ENSP00000308534:N363Y	N	+	1	0	NBEA	34528261	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.287000	0.95975	1.837000	0.53436	0.460000	0.39030	AAT	-	NULL		0.318	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	protein_coding		A	NM_015678		34528261	1	no_errors	NM_015678	genbank	human	reviewed	54_36p	missense	SNP	1	T
RP11-754I20.1	0	genome.wustl.edu	37	14	19117185	19117185	+	RNA	SNP	C	C	A	rs118092272	byFrequency	TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr14:19117185C>A	ENST00000553170.1	+	0	291				RNU6-458P_ENST00000384179.1_RNA																							AATGCAAATTCAGTTGATAAG	0.308																																																0			14																																								18187185			0																															14.37:g.19117185C>A		Somatic		Capture	Illumina GAIIx	4	18187185		Nonsense_Mutation	SNP	-	p.S164*	ENST00000553170.1	37	c.491		14																																																																																			-	NULL		0.308	RP11-754I20.1-002	KNOWN	basic	processed_transcript	ENSG00000215398	pseudogene	OTTHUMT00000408394.1	C			18187185	1	no_start_codon	ENST00000400208	ensembl	human	known	54_36p	nonsense	SNP	0.01	A
ARID4A	5926	genome.wustl.edu	37	14	58814591	58814591	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr14:58814591C>G	ENST00000355431.3	+	15	1772	c.1399C>G	c.(1399-1401)Ccg>Gcg	p.P467A	ARID4A_ENST00000395168.3_Missense_Mutation_p.P467A|ARID4A_ENST00000431317.2_Missense_Mutation_p.P467A|ARID4A_ENST00000348476.3_Missense_Mutation_p.P467A	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	467					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P467A(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						ATTAAAATCTCCGAGGGTGAG	0.294																																																1	Substitution - Missense(1)	ovary(1)	14											57.0	60.0	59.0					14																	58814591		2203	4299	6502	57884344	SO:0001583	missense	5926			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.1399C>G	14.37:g.58814591C>G	ENSP00000347602:p.Pro467Ala	Somatic		Capture	Illumina GAIIx	4	57884344	Q15991|Q15992|Q15993	Missense_Mutation	SNP	HMMPfam_ARID;HMMPfam_RBB1NT;superfamily_ARID-like;superfamily_Tudor/PWWP/MBT	p.P467A	ENST00000355431.3	37	c.1399	CCDS9732.1	14	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184118	0.38609	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.39592	1.07;2.43;2.45;2.43;2.42	5.54	4.65	0.58169	.	0.070343	0.56097	D	0.000025	T	0.53802	0.1819	L	0.36672	1.1	0.58432	D	0.999996	D;P;D	0.89917	1.0;0.642;1.0	D;B;D	0.91635	0.998;0.137;0.999	T	0.53070	-0.8490	10	0.44086	T	0.13	-3.7822	14.336	0.66589	0.0:0.9288:0.0:0.0712	.	467;467;467	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	A	467;467;467;467;145	ENSP00000347602:P467A;ENSP00000344556:P467A;ENSP00000378597:P467A;ENSP00000397368:P467A;ENSP00000416053:P145A	ENSP00000344556:P467A	P	+	1	0	ARID4A	57884344	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	7.059000	0.76684	1.343000	0.45638	-0.142000	0.14014	CCG	-	NULL		0.294	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4A	protein_coding	OTTHUMT00000276927.2	C	NM_023001		57884344	1	no_errors	NM_002892	genbank	human	reviewed	54_36p	missense	SNP	1	G
GPHN	10243	genome.wustl.edu	37	14	67635728	67635728	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr14:67635728C>T	ENST00000315266.5	+	20	3076	c.1955C>T	c.(1954-1956)cCt>cTt	p.P652L	GPHN_ENST00000543237.1_Missense_Mutation_p.P698L|GPHN_ENST00000478722.1_Missense_Mutation_p.P685L|GPHN_ENST00000305960.9_Missense_Mutation_p.P621L|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	652	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.P685L(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ATCTTGGATCCTCGGCCAACC	0.458			T	MLL	AL																																		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	1	Substitution - Missense(1)	ovary(1)	14											112.0	108.0	109.0					14																	67635728		2203	4300	6503	66705481	SO:0001583	missense	10243			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1955C>T	14.37:g.67635728C>T	ENSP00000312771:p.Pro652Leu	Somatic		Capture	Illumina GAIIx	4	66705481	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	HMMPfam_MoCF_biosynth;superfamily_Molybdenum cofactor biosynthesis proteins;HMMPfam_MoeA_N;superfamily_MoeA N-terminal region -like;HMMPfam_MoeA_C;superfamily_MoeA C-terminal domain-like	p.P685L	ENST00000315266.5	37	c.2054	CCDS32103.1	14	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913380	0.92178	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960;ENST00000555503	.	.	.	5.18	4.27	0.50696	Molybdopterin binding (2);	0.000000	0.85682	D	0.000000	T	0.65291	0.2677	L	0.45698	1.435	0.80722	D	1	P;D;P;D	0.76494	0.694;0.999;0.711;0.967	B;D;B;P	0.74348	0.242;0.983;0.128;0.873	T	0.56780	-0.7922	9	0.12430	T	0.62	-6.8351	13.9654	0.64205	0.0:0.9245:0.0:0.0755	.	621;698;652;685	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	L	652;685;698;621;177	.	ENSP00000303019:P621L	P	+	2	0	GPHN	66705481	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.449000	0.66619	2.677000	0.91161	0.650000	0.86243	CCT	-	NULL		0.458	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPHN	protein_coding	OTTHUMT00000074299.2	C	NM_020806		66705481	1	no_errors	NM_020806	genbank	human	reviewed	54_36p	missense	SNP	1	T
GUCY2C	2984	genome.wustl.edu	37	12	14767454	14767454	+	Intron	SNP	A	A	G			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr12:14767454A>G	ENST00000261170.3	-	26	3184				RP11-695J4.2_ENST00000542401.1_RNA|RP11-695J4.2_ENST00000545424.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)						intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CCTCTTTTCCAGGTGGAAGCT	0.358																																																0			12																																								14658721	SO:0001627	intron_variant	100131547				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.3047+346T>C	12.37:g.14767454A>G		Somatic		Capture	Illumina GAIIx	Phase_III	14658721	B2RMY6	Splice_Site	SNP	-	e3-2	ENST00000261170.3	37	c.109-2	CCDS8664.1	12																																																																																			-	-		0.358	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131547	protein_coding	OTTHUMT00000400835.1	A			14658721	1	no_errors	XM_001722468	genbank	human	model	54_36p	splice_site	SNP		G
BUB1B	701	genome.wustl.edu	37	15	40509809	40509809	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr15:40509809C>T	ENST00000287598.6	+	21	2986	c.2791C>T	c.(2791-2793)Cgg>Tgg	p.R931W	RP11-133K1.2_ENST00000558658.1_Missense_Mutation_p.R8W|PAK6_ENST00000441369.1_5'UTR|PAK6_ENST00000453867.1_5'UTR|BUB1B_ENST00000412359.3_Missense_Mutation_p.R945W	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	931	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R931W(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CAGCGGCTTTCGGACTGTACA	0.443			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																													yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	1	Substitution - Missense(1)	ovary(1)	15											228.0	233.0	231.0					15																	40509809		2203	4300	6503	38297101	SO:0001583	missense	701	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2791C>T	15.37:g.40509809C>T	ENSP00000287598:p.Arg931Trp	Somatic		Capture	Illumina GAIIx	4	38297101	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like);HMMPfam_Mad3_BUB1_I	p.R931W	ENST00000287598.6	37	c.2791	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	C	21.1	4.094601	0.76870	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.21361	2.01;2.01	5.7	5.7	0.88788	.	0.266688	0.35615	N	0.003098	T	0.45895	0.1365	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.26538	-1.0100	10	0.56958	D	0.05	-7.7332	18.0206	0.89253	0.0:1.0:0.0:0.0	.	931	O60566	BUB1B_HUMAN	W	931;945;814	ENSP00000287598:R931W;ENSP00000398470:R945W	ENSP00000287598:R931W	R	+	1	2	BUB1B	38297101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.135000	0.50546	2.675000	0.91044	0.591000	0.81541	CGG	-	NULL		0.443	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	protein_coding	OTTHUMT00000252122.4	C			38297101	1	no_errors	NM_001211	genbank	human	validated	54_36p	missense	SNP	1	T
UNC13C	440279	genome.wustl.edu	37	15	54556454	54556454	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr15:54556454G>C	ENST00000260323.11	+	8	3537	c.3537G>C	c.(3535-3537)gaG>gaC	p.E1179D	UNC13C_ENST00000545554.1_Missense_Mutation_p.E1179D|UNC13C_ENST00000537900.1_Missense_Mutation_p.E1177D	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1179					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.E1179D(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGATCAGGGAGAAAAACCGGC	0.398																																																1	Substitution - Missense(1)	ovary(1)	15											56.0	52.0	53.0					15																	54556454		1828	4073	5901	52343746	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3537G>C	15.37:g.54556454G>C	ENSP00000260323:p.Glu1179Asp	Somatic		Capture	Illumina GAIIx	4	52343746	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	-	p.E1179D	ENST00000260323.11	37	c.3537	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800984	0.70567	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.81163	-1.46;-1.46;-1.46	5.54	3.68	0.42216	.	0.054280	0.64402	D	0.000001	D	0.88779	0.6529	M	0.84683	2.71	0.39616	D	0.969961	D;P	0.61080	0.989;0.935	D;B	0.66196	0.942;0.315	D	0.89407	0.3700	10	0.56958	D	0.05	.	11.5166	0.50524	0.1449:0.0:0.8551:0.0	.	1179;1179	F5H090;Q8NB66	.;UN13C_HUMAN	D	1179;1179;1177	ENSP00000260323:E1179D;ENSP00000438156:E1179D;ENSP00000442569:E1177D	ENSP00000260323:E1179D	E	+	3	2	UNC13C	52343746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.173000	0.42472	0.820000	0.34516	0.655000	0.94253	GAG	-	NULL		0.398	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	G	NM_173166		52343746	1	no_errors	NM_001080534	genbank	human	provisional	54_36p	missense	SNP	1	C
OR4G2P	26680	genome.wustl.edu	37	15	102467500	102467500	+	IGR	SNP	A	A	G	rs1167334		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr15:102467500A>G								OR4F4 (4202 upstream) : FAM138E (27587 downstream)																							ACATTTTGGGATTCATAATAG	0.433																																																0			15																																								100285023	SO:0001628	intergenic_variant	26680																															15.37:g.102467500A>G		Somatic		Capture	Illumina GAIIx	4	100285023		Silent	SNP	-	p.N115		37	c.345		15																																																																																			-	NULL	0	0.433					OR4G2P			A			100285023	-1	no_errors	ENST00000328113	ensembl	human	known	54_36p	silent	SNP	0.033	G
Unknown	0	genome.wustl.edu	37	X	16492748	16492748	+	IGR	SNP	G	G	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chrX:16492748G>A								AC073597.1 (98893 upstream) : RN7SL658P (64513 downstream)																							TGGGGTGGTCGGGTTGATCTC	0.517																																																0			X																																								16402669	SO:0001628	intergenic_variant	100132857																															X.37:g.16492748G>A		Somatic		Capture	Illumina GAIIx	4	16402669		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.517					LOC100132857			G			16402669	-1	pseudogene	XR_037457	genbank	human	model	54_36p	rna	SNP	1	A
TP53	7157	genome.wustl.edu	37	17	7577142	7577142	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr17:7577142C>T	ENST00000269305.4	-	8	985	c.796G>A	c.(796-798)Gga>Aga	p.G266R	TP53_ENST00000455263.2_Missense_Mutation_p.G266R|TP53_ENST00000359597.4_Missense_Mutation_p.G266R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.G266R|TP53_ENST00000445888.2_Missense_Mutation_p.G266R|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266R(46)|p.G266*(14)|p.0?(8)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*79(2)|p.N263fs*5(1)|p.G266T(1)|p.L265_K305del41(1)|p.G266_E271delGRNSFE(1)|p.E258fs*71(1)|p.G266fs*9(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTTCCGTCCCAGTAGATTA	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	86	Substitution - Missense(47)|Substitution - Nonsense(14)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(3)|Insertion - Frameshift(1)	lung(16)|large_intestine(11)|ovary(8)|central_nervous_system(6)|urinary_tract(6)|oesophagus(6)|upper_aerodigestive_tract(5)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|liver(2)|skin(2)|pancreas(2)|biliary_tract(1)|peritoneum(1)|salivary_gland(1)|endometrium(1)|eye(1)|pleura(1)	17											49.0	44.0	46.0					17																	7577142		2203	4300	6503	7517867	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.796G>A	17.37:g.7577142C>T	ENSP00000269305:p.Gly266Arg	Somatic		Capture	Illumina GAIIx	4	7517867	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.G266R	ENST00000269305.4	37	c.796	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539769	0.85917	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.63;-7.63;-7.63;-7.63;-7.63;-7.63	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;0.986;0.997	D;D;D;D	0.97110	0.978;1.0;0.962;0.958	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	R	266;266;266;266;266;255;134	ENSP00000352610:G266R;ENSP00000269305:G266R;ENSP00000398846:G266R;ENSP00000391127:G266R;ENSP00000391478:G266R;ENSP00000425104:G134R	ENSP00000269305:G266R	G	-	1	0	TP53	7517867	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA	-	HMMPfam_P53		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517867	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	T
EPB41L3	23136	genome.wustl.edu	37	18	5445240	5445240	+	Missense_Mutation	SNP	G	G	A	rs372730881		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr18:5445240G>A	ENST00000341928.2	-	4	725	c.385C>T	c.(385-387)Cgc>Tgc	p.R129C	EPB41L3_ENST00000544123.1_Missense_Mutation_p.R129C|EPB41L3_ENST00000400111.3_Missense_Mutation_p.R129C|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Missense_Mutation_p.R129C|EPB41L3_ENST00000540638.2_Missense_Mutation_p.R129C	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	129	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.R129C(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CCTCTGGAGCGTTTCTACAGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	18											111.0	92.0	98.0					18																	5445240		2203	4300	6503	5435240	SO:0001583	missense	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.385C>T	18.37:g.5445240G>A	ENSP00000343158:p.Arg129Cys	Somatic		Capture	Illumina GAIIx	4	5435240	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	HMMPfam_Band_41;HMMPfam_SAB;HMMPfam_4_1_CTD;superfamily_Flavin-binding protein dodecin;HMMPfam_FA;superfamily_Second domain of FERM;superfamily_PH domain-like;superfamily_Ubiquitin-like	p.R129C	ENST00000341928.2	37	c.385	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594925	0.86953	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111;ENST00000542652	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1	5.82	5.82	0.92795	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.057689	0.64402	D	0.000001	D	0.89774	0.6812	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.941;0.936;0.94;0.981	D	0.90635	0.4570	10	0.87932	D	0	.	18.8665	0.92294	0.0:0.0:1.0:0.0	.	129;129;20;129;129	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	C	129;20;129;20;129;129;210	ENSP00000343158:R129C;ENSP00000441174:R129C;ENSP00000341138:R129C;ENSP00000382981:R129C	ENSP00000343158:R129C	R	-	1	0	EPB41L3	5435240	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.418000	0.80167	2.753000	0.94483	0.467000	0.42956	CGC	-	HMMPfam_Band_41		0.373	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	protein_coding	OTTHUMT00000254424.1	G	NM_012307		5435240	-1	no_errors	NM_012307	genbank	human	provisional	54_36p	missense	SNP	1	A
STARD6	147323	genome.wustl.edu	37	18	51851219	51851219	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr18:51851219A>G	ENST00000581310.1	-	9	879	c.506T>C	c.(505-507)aTg>aCg	p.M169T	STARD6_ENST00000580990.2_Missense_Mutation_p.M45T|STARD6_ENST00000307844.3_Missense_Mutation_p.M169T			P59095	STAR6_HUMAN	StAR-related lipid transfer (START) domain containing 6	169	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)	p.M169T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)	8				Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)		CTGGACAAACATCACTAGTTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	18											114.0	111.0	112.0					18																	51851219		2202	4300	6502	50105217	SO:0001583	missense	147323			AF480305	CCDS11955.1	18q21.2	2011-09-12	2007-08-16		ENSG00000174448	ENSG00000174448		"""StAR-related lipid transfer (START) domain containing"""	18066	protein-coding gene	gene with protein product		607051	"""START domain containing 6"""			12011452	Standard	NM_139171		Approved		uc010xdt.2	P59095	OTTHUMG00000132702	ENST00000581310.1:c.506T>C	18.37:g.51851219A>G	ENSP00000462349:p.Met169Thr	Somatic		Capture	Illumina GAIIx	4	50105217		Missense_Mutation	SNP	-	p.M169T	ENST00000581310.1	37	c.506	CCDS11955.1	18	.	.	.	.	.	.	.	.	.	.	A	10.75	1.438064	0.25900	.	.	ENSG00000174448	ENST00000307844	T	0.78595	-1.19	5.53	5.53	0.82687	Lipid-binding START (3);START-like domain (1);	0.350903	0.29515	N	0.011932	T	0.66327	0.2778	L	0.27053	0.805	0.28573	N	0.910505	P	0.37914	0.611	B	0.37731	0.257	T	0.63225	-0.6685	10	0.32370	T	0.25	.	12.0438	0.53469	1.0:0.0:0.0:0.0	.	169	P59095	STAR6_HUMAN	T	169	ENSP00000310814:M169T	ENSP00000310814:M169T	M	-	2	0	STARD6	50105217	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.927000	0.63440	2.090000	0.63153	0.338000	0.21704	ATG	-	NULL		0.333	STARD6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STARD6	protein_coding	OTTHUMT00000256000.3	A	NM_139171		50105217	-1	no_errors	NM_139171	genbank	human	provisional	54_36p	missense	SNP	1	G
OR1I1	126370	genome.wustl.edu	37	19	15198451	15198451	+	Missense_Mutation	SNP	C	C	T	rs527608443	byFrequency	TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr19:15198451C>T	ENST00000209540.2	+	1	661	c.575C>T	c.(574-576)aCg>aTg	p.T192M		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T192M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						GGCTCAGACACGCACACCAAC	0.557													C|||	4	0.000798722	0.0	0.0	5008	,	,		22331	0.0		0.0	False		,,,				2504	0.0041															1	Substitution - Missense(1)	ovary(1)	19											129.0	110.0	117.0					19																	15198451		2203	4300	6503	15059451	SO:0001583	missense	126370			AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.575C>T	19.37:g.15198451C>T	ENSP00000209540:p.Thr192Met	Somatic		Capture	Illumina GAIIx	4	15059451	Q96R92	Missense_Mutation	SNP	-	p.T192M	ENST00000209540.2	37	c.575	CCDS32937.1	19	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828416	0.32329	.	.	ENSG00000094661	ENST00000209540	T	0.00265	8.39	4.79	2.67	0.31697	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32785	U	0.005654	T	0.00608	0.0020	M	0.91717	3.235	0.32511	N	0.537584	D	0.89917	1.0	D	0.81914	0.995	T	0.23940	-1.0174	10	0.72032	D	0.01	.	9.0088	0.36129	0.0:0.8184:0.0:0.1815	.	192	O60431	OR1I1_HUMAN	M	192	ENSP00000209540:T192M	ENSP00000209540:T192M	T	+	2	0	OR1I1	15059451	0.003000	0.15002	0.123000	0.21794	0.011000	0.07611	0.716000	0.25836	0.635000	0.30488	0.555000	0.69702	ACG	-	NULL		0.557	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1I1	protein_coding	OTTHUMT00000465665.1	C			15059451	1	no_errors	NM_001004713	genbank	human	provisional	54_36p	missense	SNP	0.95	T
CHERP	10523	genome.wustl.edu	37	19	16641652	16641652	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr19:16641652C>A	ENST00000198939.6	-	6	783	c.747G>T	c.(745-747)caG>caT	p.Q249H	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Missense_Mutation_p.Q238H					calcium homeostasis endoplasmic reticulum protein									p.Q238H(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						CCACGACCTTCTGCAGGGCGG	0.716																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	41.0	39.0					19																	16641652		2009	4166	6175	16502652	SO:0001583	missense	10523			U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.747G>T	19.37:g.16641652C>A	ENSP00000198939:p.Gln249His	Somatic		Capture	Illumina GAIIx	4	16502652		Missense_Mutation	SNP	-	p.Q238H	ENST00000198939.6	37	c.714		19	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019188	0.75275	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	T;T	0.42131	0.98;0.98	5.18	4.13	0.48395	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);Domain of unknown function DUF618 (1);	.	.	.	.	T	0.59838	0.2223	M	0.61703	1.905	0.53688	D	0.999976	D	0.67145	0.996	D	0.81914	0.995	T	0.63024	-0.6729	9	0.72032	D	0.01	-18.6228	13.2166	0.59863	0.0:0.9214:0.0:0.0786	.	238	Q8IWX8	CHERP_HUMAN	H	238;249	ENSP00000439856:Q238H;ENSP00000198939:Q249H	ENSP00000198939:Q249H	Q	-	3	2	CHERP	16502652	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.033000	0.49743	2.441000	0.82636	0.462000	0.41574	CAG	-	NULL		0.716	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CHERP	protein_coding	OTTHUMT00000403372.1	C	NM_006387		16502652	-1	no_errors	NM_006387	genbank	human	validated	54_36p	missense	SNP	1	A
MAP3K19	80122	genome.wustl.edu	37	2	135779370	135779370	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr2:135779370C>T	ENST00000375845.3	-	2	83	c.53G>A	c.(52-54)tGt>tAt	p.C18Y	MAP3K19_ENST00000392915.1_Missense_Mutation_p.C35Y|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392917.3_Missense_Mutation_p.C18Y|MAP3K19_ENST00000358371.4_Missense_Mutation_p.C18Y|MAP3K19_ENST00000392918.3_Missense_Mutation_p.C18Y|MAP3K19_ENST00000375844.3_Missense_Mutation_p.C18Y	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	18							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.C18Y(1)									TGTATCATGACAAATGTCAAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	131.0	136.0					2																	135779370		2203	4300	6503	135495840	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.53G>A	2.37:g.135779370C>T	ENSP00000365005:p.Cys18Tyr	Somatic		Capture	Illumina GAIIx	4	135495840	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.C18Y	ENST00000375845.3	37	c.53	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929403	0.52759	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915	T;D;T;T;T;T	0.85861	-1.24;-2.04;-1.34;-1.38;-1.15;1.09	4.44	2.54	0.30619	.	0.183165	0.26723	N	0.022825	D	0.89213	0.6651	M	0.69823	2.125	0.80722	D	1	D;B;D;B;D;D	0.89917	0.995;0.1;0.997;0.356;0.997;1.0	D;B;D;B;D;D	0.85130	0.986;0.063;0.994;0.127;0.994;0.997	D	0.87654	0.2530	10	0.87932	D	0	.	5.5026	0.16836	0.1968:0.6984:0.0:0.1048	.	18;18;18;35;18;18	B7ZMH9;Q56UN5-3;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;YSK4_HUMAN	Y	18;18;18;18;18;35	ENSP00000365005:C18Y;ENSP00000351140:C18Y;ENSP00000365004:C18Y;ENSP00000376650:C18Y;ENSP00000376649:C18Y;ENSP00000376647:C35Y	ENSP00000351140:C18Y	C	-	2	0	YSK4	135495840	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.886000	0.28241	1.061000	0.40601	0.585000	0.79938	TGT	-	NULL		0.353	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	protein_coding	OTTHUMT00000158244.1	C	NM_025052		135495840	-1	no_errors	NM_025052	genbank	human	validated	54_36p	missense	SNP	1	T
TTN	7273	genome.wustl.edu	37	2	179391846	179391854	+	In_Frame_Del	DEL	TCAGGGTTG	TCAGGGTTG	-	rs267607156|rs370267738		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	TCAGGGTTG	TCAGGGTTG	TCAGGGTTG	-	TCAGGGTTG	TCAGGGTTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr2:179391846_179391854delTCAGGGTTG	ENST00000591111.1	-	313	103162_103170	c.102938_102946delCAACCCTGA	c.(102937-102948)acaaccctgatc>atc	p.TTL34313del	TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN_ENST00000589042.1_In_Frame_Del_p.TTL35954del|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.TTL33386del|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000342175.6_In_Frame_Del_p.TTL27081del|TTN-AS1_ENST00000589391.1_RNA|TTN_ENST00000460472.2_In_Frame_Del_p.TTL26889del|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.TTL27014del|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000587576.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592161.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	34313	Ig-like 152.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCATGATGATCAGGGTTGTCAGGTCATC	0.45																																																0			2	GRCh37	CM022078	TTN	M																																				179100100	SO:0001651	inframe_deletion	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.102938_102946delCAACCCTGA	2.37:g.179391846_179391854delTCAGGGTTG	ENSP00000465570:p.Thr34313_Leu34315del	Somatic		Capture	Illumina GAIIx	Phase_III	179100092	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	-	p.QP*33386in_frame_del	ENST00000591111.1	37	c.100164_100156		2																																																																																			(deletion:cds_exon[179099985,179100280])	NULL		0.450	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	TCAGGGTTG	NM_133378		179100100	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:0.990:1.000:0.998:0.767:0.997:0.996:0.787:1.000	-
RHOB	388	genome.wustl.edu	37	2	20647606	20647606	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr2:20647606T>G	ENST00000272233.4	+	1	772	c.380T>G	c.(379-381)gTc>gGc	p.V127G		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	127					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V127G(1)		breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	GACGAGCATGTCCGCACAGAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	2											71.0	75.0	74.0					2																	20647606		2203	4300	6503	20511087	SO:0001583	missense	388				CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.380T>G	2.37:g.20647606T>G	ENSP00000272233:p.Val127Gly	Somatic		Capture	Illumina GAIIx	4	20511087	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	Ras;HMMPfam_Ras	p.V127G	ENST00000272233.4	37	c.380	CCDS1699.1	2	.	.	.	.	.	.	.	.	.	.	T	6.839	0.524031	0.13066	.	.	ENSG00000143878	ENST00000272233	T	0.70631	-0.5	5.4	0.312	0.15837	Small GTP-binding protein domain (1);	0.160917	0.39475	U	0.001354	T	0.65637	0.2710	L	0.52573	1.65	0.80722	D	1	B	0.33345	0.409	B	0.40329	0.326	T	0.62544	-0.6832	10	0.87932	D	0	-26.4826	9.4413	0.38670	0.0:0.2691:0.0:0.7309	.	127	P62745	RHOB_HUMAN	G	127	ENSP00000272233:V127G	ENSP00000272233:V127G	V	+	2	0	RHOB	20511087	1.000000	0.71417	0.011000	0.14972	0.000000	0.00434	3.143000	0.50608	-0.100000	0.12241	-0.899000	0.02877	GTC	-	HMMPfam_Ras		0.617	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOB	protein_coding	OTTHUMT00000207500.1	T	NM_004040		20511087	1	no_errors	NM_004040	genbank	human	validated	54_36p	missense	SNP	1	G
CAD	790	genome.wustl.edu	37	2	27456286	27456286	+	Missense_Mutation	SNP	G	G	A	rs377122535		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr2:27456286G>A	ENST00000403525.1	+	19	3053	c.2909G>A	c.(2908-2910)cGg>cAg	p.R970Q	CAD_ENST00000264705.4_Missense_Mutation_p.R1033Q			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R1033Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCAGTGCCGGGTGCTGGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	2						G	GLN/ARG	0,4406		0,0,2203	52.0	51.0	51.0		3098	5.6	1.0	2		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	CAD	NM_004341.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1033/2226	27456286	1,13005	2203	4300	6503	27309790	SO:0001583	missense	790			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2909G>A	2.37:g.27456286G>A	ENSP00000384510:p.Arg970Gln	Somatic		Capture	Illumina GAIIx	4	27309790	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	HMMPfam_GATase;HMMPfam_CPSase_sm_chain;superfamily_Carbamoyl phosphate synthetase small subunit N-terminal domain;HMMPfam_CPSase_L_D2;HMMPfam_CPSase_L_D3;HMMPfam_CPSase_L_chain;superfamily_Aspartate/ornithine carbamoyltransferase;HMMPfam_OTCace;HMMPfam_OTCace_N;HMMPfam_Amidohydro_1;superfamily_Composite domain of metallo-dependent hydrolases;HMMPfam_MGS;superfamily_Carbamoyl phosphate synthetase large subunit connection domain;superfamily_Metallo-dependent hydrolases;superfamily_Class I glutamine amidotransferase-like;superfamily_Methylglyoxal synthase-like;superfamily_PreATP-grasp domain;superfamily_Glutathione synthetase ATP-binding domain-like	p.R1033Q	ENST00000403525.1	37	c.3098		2	.	.	.	.	.	.	.	.	.	.	G	36	5.664227	0.96745	0.0	1.16E-4	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97352	-4.35;-4.35	5.62	5.62	0.85841	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96331	0.8803	L	0.50919	1.6	0.80722	D	1	P;D	0.60575	0.928;0.988	B;P	0.47102	0.269;0.537	D	0.96629	0.9465	10	0.72032	D	0.01	-2.9139	18.5877	0.91196	0.0:0.0:1.0:0.0	.	970;1033	F8VPD4;P27708	.;PYR1_HUMAN	Q	1033;970	ENSP00000264705:R1033Q;ENSP00000384510:R970Q	ENSP00000264705:R1033Q	R	+	2	0	CAD	27309790	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.300000	0.59079	2.804000	0.96469	0.655000	0.94253	CGG	-	HMMPfam_CPSase_L_chain		0.572	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	protein_coding	OTTHUMT00000324970.1	G			27309790	1	no_errors	NM_004341	genbank	human	reviewed	54_36p	missense	SNP	1	A
ARHGAP25	9938	genome.wustl.edu	37	2	69049513	69049513	+	Silent	SNP	G	G	T	rs370858973		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr2:69049513G>T	ENST00000295381.3	+	10	1658	c.1239G>T	c.(1237-1239)ccG>ccT	p.P413P	ARHGAP25_ENST00000409202.3_Silent_p.P414P|ARHGAP25_ENST00000409030.3_Silent_p.P406P|ARHGAP25_ENST00000409220.1_Silent_p.P407P|ARHGAP25_ENST00000479844.1_Silent_p.P107P|ARHGAP25_ENST00000467265.1_Silent_p.P374P	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	413					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.P407P(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						GACAGCAGCCGAGCGATGCGT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	2											106.0	116.0	113.0					2																	69049513		2203	4300	6503	68903017	SO:0001819	synonymous_variant	9938			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1239G>T	2.37:g.69049513G>T		Somatic		Capture	Illumina GAIIx	4	68903017	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Silent	SNP	HMMPfam_RhoGAP;HMMPfam_PH;superfamily_GTPase activation domain GAP;superfamily_PH domain-like	p.P413	ENST00000295381.3	37	c.1239		2	.	.	.	.	.	.	.	.	.	.	G	6.341	0.431056	0.12045	.	.	ENSG00000163219	ENST00000497259	.	.	.	5.18	-10.4	0.00318	.	.	.	.	.	T	0.15349	0.0370	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.10154	-1.0642	4	.	.	.	.	3.4276	0.07416	0.3607:0.2481:0.3092:0.082	.	.	.	.	L	273	.	.	R	+	2	0	ARHGAP25	68903017	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-2.265000	0.01172	-2.505000	0.00508	-0.350000	0.07774	CGA	-	NULL		0.522	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	protein_coding		G	NM_014882		68903017	1	no_errors	NM_001007231	genbank	human	validated	54_36p	silent	SNP		T
CPS1	1373	genome.wustl.edu	37	2	211421560	211421560	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr2:211421560G>A	ENST00000233072.5	+	1	299	c.103G>A	c.(103-105)Ggc>Agc	p.G35S	CPS1_ENST00000430249.2_Missense_Mutation_p.G41S	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	35					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.G35S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTCAAGACCTGGCATCAGGCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											102.0	102.0	102.0					2																	211421560		2203	4299	6502	211129805	SO:0001583	missense	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.103G>A	2.37:g.211421560G>A	ENSP00000233072:p.Gly35Ser	Somatic		Capture	Illumina GAIIx	4	211129805	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	HMMPfam_GATase;HMMPfam_CPSase_sm_chain;superfamily_Carbamoyl phosphate synthetase small subunit N-terminal domain;HMMPfam_CPSase_L_D2;HMMPfam_CPSase_L_D3;HMMPfam_CPSase_L_chain;HMMPfam_MGS;superfamily_Carbamoyl phosphate synthetase large subunit connection domain;superfamily_Class I glutamine amidotransferase-like;superfamily_Methylglyoxal synthase-like;superfamily_PreATP-grasp domain;superfamily_Glutathione synthetase ATP-binding domain-like	p.G35S	ENST00000233072.5	37	c.103	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465896	0.43839	.	.	ENSG00000021826	ENST00000417946;ENST00000518043;ENST00000523702;ENST00000430249;ENST00000539150;ENST00000233072;ENST00000544169;ENST00000536125	D;D;D;D;D	0.97598	-3.2;-3.2;-3.37;-4.45;-4.45	5.77	4.9	0.64082	.	0.340599	0.34200	N	0.004170	D	0.92509	0.7621	N	0.24115	0.695	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	D	0.88585	0.3139	10	0.21540	T	0.41	-33.6707	11.6494	0.51279	0.0821:0.0:0.9179:0.0	.	45;35	Q59HF8;P31327	.;CPSM_HUMAN	S	35;35;41;41;43;35;35;35	ENSP00000388496:G35S;ENSP00000430697:G35S;ENSP00000430644:G41S;ENSP00000402608:G41S;ENSP00000233072:G35S	ENSP00000233072:G35S	G	+	1	0	CPS1	211129805	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	2.888000	0.48594	1.426000	0.47256	0.650000	0.86243	GGC	-	NULL		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	protein_coding	OTTHUMT00000256569.5	G			211129805	1	no_errors	NM_001875	genbank	human	reviewed	54_36p	missense	SNP	1	A
GAP43	2596	genome.wustl.edu	37	3	115439656	115439656	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr3:115439656C>T	ENST00000305124.6	+	3	1010	c.644C>T	c.(643-645)aCc>aTc	p.T215I	GAP43_ENST00000393780.3_Missense_Mutation_p.T251I	NM_002045.3	NP_002036.1	P17677	NEUM_HUMAN	growth associated protein 43	215					axon choice point recognition (GO:0016198)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of filopodium assembly (GO:0051489)|regulation of growth (GO:0040008)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.T215I(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)		GTAGATGAAACCAAACCTAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											197.0	207.0	203.0					3																	115439656		2203	4300	6503	116922346	SO:0001583	missense	2596				CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020			4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060				3272162, 8231732	Standard	NM_002045		Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000305124.6:c.644C>T	3.37:g.115439656C>T	ENSP00000305010:p.Thr215Ile	Somatic		Capture	Illumina GAIIx	4	116922346	A8K0Y4	Missense_Mutation	SNP	-	p.T215I	ENST00000305124.6	37	c.644	CCDS33830.1	3	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449795	0.63290	.	.	ENSG00000172020	ENST00000305124;ENST00000393780	T;T	0.59502	0.26;0.26	5.7	5.7	0.88788	Neuromodulin (GAP-43), C-terminal (1);	0.226724	0.36444	N	0.002599	T	0.68632	0.3022	L	0.38175	1.15	0.51012	D	0.999904	D;D	0.63880	0.993;0.993	D;P	0.65874	0.939;0.836	T	0.68565	-0.5375	10	0.54805	T	0.06	-3.9186	19.8298	0.96631	0.0:1.0:0.0:0.0	.	251;215	A8K0Y4;P17677	.;NEUM_HUMAN	I	215;251	ENSP00000305010:T215I;ENSP00000377372:T251I	ENSP00000305010:T215I	T	+	2	0	GAP43	116922346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.677000	0.68142	2.687000	0.91594	0.591000	0.81541	ACC	-	NULL		0.443	GAP43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAP43	protein_coding	OTTHUMT00000258216.2	C	NM_002045		116922346	1	no_errors	NM_002045	genbank	human	reviewed	54_36p	missense	SNP	1	T
CPNE9	151835	genome.wustl.edu	37	3	9768379	9768379	+	Missense_Mutation	SNP	G	G	A	rs566993609		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr3:9768379G>A	ENST00000383832.3	+	19	1565	c.1375G>A	c.(1375-1377)Gtc>Atc	p.V459I	CPNE9_ENST00000383831.3_Missense_Mutation_p.V459I	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	459	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.V459I(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					TATCATTATCGTCGGTGTAGG	0.547																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	3											122.0	117.0	119.0					3																	9768379		1927	4145	6072	9743379	SO:0001583	missense	151835				CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.1375G>A	3.37:g.9768379G>A	ENSP00000373343:p.Val459Ile	Somatic		Capture	Illumina GAIIx	4	9743379	A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	HMMPfam_C2;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);HMMPfam_Copine;superfamily_vWA-like	p.V459I	ENST00000383832.3	37	c.1375	CCDS2574.2	3	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876822	0.72180	.	.	ENSG00000144550	ENST00000383832;ENST00000383831	T;T	0.22945	1.93;1.93	4.4	4.4	0.53042	von Willebrand factor, type A (2);Copine (1);	0.064498	0.64402	D	0.000011	T	0.37489	0.1005	M	0.62723	1.935	0.53688	D	0.999976	P	0.43857	0.819	P	0.48304	0.573	T	0.21759	-1.0236	10	0.45353	T	0.12	.	16.7977	0.85606	0.0:0.0:1.0:0.0	.	459	Q8IYJ1	CPNE9_HUMAN	I	459	ENSP00000373343:V459I;ENSP00000373342:V459I	ENSP00000373342:V459I	V	+	1	0	CPNE9	9743379	1.000000	0.71417	0.962000	0.40283	0.964000	0.63967	6.831000	0.75324	2.257000	0.74773	0.460000	0.39030	GTC	-	HMMPfam_Copine		0.547	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE9	protein_coding	OTTHUMT00000250205.4	G	NM_001033755		9743379	1	no_errors	NM_153635	genbank	human	validated	54_36p	missense	SNP	0.99	A
SCN10A	6336	genome.wustl.edu	37	3	38755561	38755561	+	Missense_Mutation	SNP	A	A	G	rs147130891		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr3:38755561A>G	ENST00000449082.2	-	21	3691	c.3692T>C	c.(3691-3693)aTa>aCa	p.I1231T		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1231					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.I1231T(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TGTGAGACTTATCAGTGAGAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	3						A	THR/ILE	0,4406		0,0,2203	115.0	111.0	112.0		3692	-0.0	1.0	3	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SCN10A	NM_006514.2	89	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	1231/1957	38755561	1,13005	2203	4300	6503	38730565	SO:0001583	missense	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3692T>C	3.37:g.38755561A>G	ENSP00000390600:p.Ile1231Thr	Somatic		Capture	Illumina GAIIx	4	38730565	A6NDQ1	Missense_Mutation	SNP	-	p.I1231T	ENST00000449082.2	37	c.3692	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	A	7.993	0.753712	0.15778	0.0	1.16E-4	ENSG00000185313	ENST00000449082	D	0.98762	-5.12	4.23	-0.0297	0.13917	Ion transport (1);	0.235349	0.39083	N	0.001474	D	0.96765	0.8944	M	0.75264	2.295	0.24603	N	0.993764	B	0.02656	0.0	B	0.04013	0.001	D	0.92755	0.6219	10	0.48119	T	0.1	.	7.1393	0.25546	0.6942:0.0:0.3058:0.0	.	1231	Q9Y5Y9	SCNAA_HUMAN	T	1231	ENSP00000390600:I1231T	ENSP00000390600:I1231T	I	-	2	0	SCN10A	38730565	0.001000	0.12720	0.998000	0.56505	0.440000	0.31957	1.402000	0.34600	0.101000	0.17610	-0.516000	0.04426	ATA	-	NULL		0.542	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	protein_coding	OTTHUMT00000109745.3	A	NM_006514		38730565	-1	no_errors	NM_006514	genbank	human	validated	54_36p	missense	SNP	1	G
LAMB2	3913	genome.wustl.edu	37	3	49166233	49166233	+	Missense_Mutation	SNP	C	C	T	rs544982873		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr3:49166233C>T	ENST00000418109.1	-	15	1915	c.1751G>A	c.(1750-1752)cGc>cAc	p.R584H	LAMB2_ENST00000305544.4_Missense_Mutation_p.R584H	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	584	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.R584H(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGTCACCAGGCGCTCCACCAC	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18550	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											55.0	62.0	60.0					3																	49166233		2203	4300	6503	49141237	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1751G>A	3.37:g.49166233C>T	ENSP00000388325:p.Arg584His	Somatic		Capture	Illumina GAIIx	4	49141237	Q16321	Missense_Mutation	SNP	HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Spectrin repeat;superfamily_EGF/Laminin	p.R584H	ENST00000418109.1	37	c.1751	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.582871	0.96578	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.37058	1.22;1.22	5.04	5.04	0.67666	Laminin IV (1);	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68334	-0.5436	10	0.49607	T	0.09	.	17.9928	0.89174	0.0:1.0:0.0:0.0	.	584	P55268	LAMB2_HUMAN	H	584	ENSP00000388325:R584H;ENSP00000307156:R584H	ENSP00000307156:R584H	R	-	2	0	LAMB2	49141237	0.997000	0.39634	0.992000	0.48379	0.778000	0.44026	3.609000	0.54117	2.348000	0.79779	0.561000	0.74099	CGC	-	NULL		0.617	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	protein_coding	OTTHUMT00000345939.1	C	NM_002292		49141237	-1	no_errors	NM_002292	genbank	human	reviewed	54_36p	missense	SNP	0.96	T
ADCY5	111	genome.wustl.edu	37	3	123008730	123008730	+	Silent	SNP	G	G	A	rs375437829		TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr3:123008730G>A	ENST00000462833.1	-	19	4611	c.3399C>T	c.(3397-3399)tcC>tcT	p.S1133S	ADCY5_ENST00000309879.5_Silent_p.S783S|ADCY5_ENST00000491190.1_Silent_p.S791S	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1133	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.S1133S(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGTTGAGGCCGGAGGCAGCCA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	3						G	,	0,4406		0,0,2203	126.0	107.0	114.0		2349,3399	-10.3	0.0	3		114	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ADCY5	NM_001199642.1,NM_183357.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	783/912,1133/1262	123008730	1,13005	2203	4300	6503	124491420	SO:0001819	synonymous_variant	111			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3399C>T	3.37:g.123008730G>A		Somatic		Capture	Illumina GAIIx	4	124491420	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	HMMPfam_Guanylate_cyc,HMMPfam_DUF1053,superfamily_Adenylyl and guanylyl cyclase catalytic domain	p.S1133	ENST00000462833.1	37	c.3399	CCDS3022.1	3																																																																																			-	HMMPfam_Guanylate_cyc		0.557	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	protein_coding	OTTHUMT00000355889.4	G	XM_171048		124491420	-1	no_errors	NM_183357	genbank	human	validated	54_36p	silent	SNP	0.02	A
ADH6	130	genome.wustl.edu	37	4	100131627	100131630	+	Frame_Shift_Del	DEL	ACTG	ACTG	-			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	-	-	-	ACTG	ACTG	ACTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr4:100131627_100131630delACTG	ENST00000237653.7	-	4	676_679	c.292_295delCAGT	c.(292-297)cagtgtfs	p.QC98fs	RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000394899.2_Frame_Shift_Del_p.QC98fs|ADH6_ENST00000504257.1_5'Flank|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Frame_Shift_Del_p.QC98fs|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000407820.2_5'UTR	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	98					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)	p.Q98fs*8(1)		breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	CATTCTCCACACTGTGGCAGAAAG	0.299																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								100350653	SO:0001589	frameshift_variant	130			AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.292_295delCAGT	4.37:g.100131627_100131630delACTG	ENSP00000237653:p.Gln98fs	Somatic		Capture	Illumina GAIIx	Phase_III	100350650	B3KS45|Q58F53	Frame_Shift_Del	DEL	-	p.C99fs	ENST00000237653.7	37	c.296	CCDS3647.1	4																																																																																			(deletion:cds_exon[100350595;100350682])	NULL		0.299	ADH6-003	KNOWN	basic|CCDS	protein_coding	ADH6	protein_coding	OTTHUMT00000253665.1	ACTG	NM_000672		100350653	-1	no_errors	NM_001102470	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1	-
ZNF595	152687	genome.wustl.edu	37	4	59360	59360	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr4:59360C>A	ENST00000509152.2	+	2	226	c.41C>A	c.(40-42)tCc>tAc	p.S14Y	ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_Missense_Mutation_p.S14Y			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	14	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ATAGAATTCTCCCCTGAAGAG	0.428																																																0			4											356.0	386.0	376.0					4																	59360		2203	4300	6503	49360	SO:0001583	missense	152687			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.41C>A	4.37:g.59360C>A	ENSP00000434858:p.Ser14Tyr	Somatic		Capture	Illumina GAIIx	4	49360		Missense_Mutation	SNP	-	p.S14Y	ENST00000509152.2	37	c.41		4	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543068	0.45280	.	.	ENSG00000197701	ENST00000509152;ENST00000526473	T;T	0.02944	4.1;4.1	1.26	1.26	0.21427	Krueppel-associated box (8);	.	.	.	.	T	0.10981	0.0268	.	.	.	0.22500	N	0.999048	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	T	0.08249	-1.0731	8	0.87932	D	0	.	7.9738	0.30143	0.0:1.0:0.0:0.0	.	14;14	Q8IYB9;Q3SXZ3	ZN595_HUMAN;ZN718_HUMAN	Y	14	ENSP00000434858:S14Y;ENSP00000437878:S14Y	ENSP00000434858:S14Y	S	+	2	0	ZNF595	49360	0.019000	0.18553	0.346000	0.25655	0.196000	0.23810	1.241000	0.32743	0.655000	0.30866	0.484000	0.47621	TCC	-	NULL		0.428	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	ZNF595	protein_coding	OTTHUMT00000357817.2	C	NM_182524		49360	1	no_errors	ENST00000339368	ensembl	human	known	54_36p	missense	SNP	0.64	A
HHIP	64399	genome.wustl.edu	37	4	145629388	145629388	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr4:145629388C>A	ENST00000296575.3	+	7	1881	c.1226C>A	c.(1225-1227)cCa>cAa	p.P409Q		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	409					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.P409Q(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		TATTCCATACCAAGGAGCAAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	4											145.0	115.0	125.0					4																	145629388		2203	4300	6503	145848838	SO:0001583	missense	64399			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1226C>A	4.37:g.145629388C>A	ENSP00000296575:p.Pro409Gln	Somatic		Capture	Illumina GAIIx	4	145848838	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	EGF_2;HMMPfam_EGF_2	p.P409Q	ENST00000296575.3	37	c.1226	CCDS3762.1	4	.	.	.	.	.	.	.	.	.	.	C	33	5.203320	0.95033	.	.	ENSG00000164161	ENST00000296575	T	0.20332	2.08	5.93	5.93	0.95920	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.60919	0.2306	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69986	-0.4996	10	0.87932	D	0	-13.8234	20.3398	0.98759	0.0:1.0:0.0:0.0	.	409	Q96QV1	HHIP_HUMAN	Q	409	ENSP00000296575:P409Q	ENSP00000296575:P409Q	P	+	2	0	HHIP	145848838	1.000000	0.71417	0.342000	0.25602	0.995000	0.86356	7.487000	0.81328	2.811000	0.96726	0.557000	0.71058	CCA	-	NULL		0.512	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIP	protein_coding	OTTHUMT00000364887.2	C			145848838	1	no_errors	NM_022475	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
FAF2	23197	genome.wustl.edu	37	5	175921229	175921229	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr5:175921229G>A	ENST00000261942.6	+	7	667	c.614G>A	c.(613-615)aGg>aAg	p.R205K		NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	205					lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.R205K(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						ATAAACACTAGGATGCTCTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											154.0	144.0	148.0					5																	175921229		2203	4300	6503	175853835	SO:0001583	missense	23197			BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.614G>A	5.37:g.175921229G>A	ENSP00000261942:p.Arg205Lys	Somatic		Capture	Illumina GAIIx	4	175853835	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Missense_Mutation	SNP	-	p.R205K	ENST00000261942.6	37	c.614	CCDS34296.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.61|13.61	2.289509|2.289509	0.40494|0.40494	.|.	.|.	ENSG00000113194|ENSG00000113194	ENST00000261942|ENST00000540174	T|.	0.42513|.	0.97|.	5.36|5.36	4.49|4.49	0.54785|0.54785	UAS (1);|.	0.087322|.	0.85682|.	D|.	0.000000|.	T|T	0.62208|0.62208	0.2409|0.2409	M|M	0.62723|0.62723	1.935|1.935	0.43808|0.43808	D|D	0.996365|0.996365	B|.	0.22800|.	0.075|.	B|.	0.24701|.	0.055|.	T|T	0.59026|0.59026	-0.7531|-0.7531	10|6	0.40728|0.02654	T|T	0.16|1	-7.9639|-7.9639	14.1547|14.1547	0.65410|0.65410	0.0723:0.0:0.9277:0.0|0.0723:0.0:0.9277:0.0	.|.	205|.	Q96CS3|.	FAF2_HUMAN|.	K|N	205|205	ENSP00000261942:R205K|.	ENSP00000261942:R205K|ENSP00000445238:S205N	R|S	+|+	2|2	0|0	FAF2|FAF2	175853835|175853835	1.000000|1.000000	0.71417|0.71417	0.777000|0.777000	0.31699|0.31699	0.684000|0.684000	0.39900|0.39900	5.119000|5.119000	0.64679|0.64679	1.392000|1.392000	0.46585|0.46585	0.650000|0.650000	0.86243|0.86243	AGG|AGT	-	NULL		0.408	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF2	protein_coding	OTTHUMT00000372194.1	G	NM_014613		175853835	1	no_errors	NM_014613	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
MLLT4	4301	genome.wustl.edu	37	6	168352133	168352133	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr6:168352133A>G	ENST00000447894.2	+	29	4078	c.4078A>G	c.(4078-4080)Atc>Gtc	p.I1360V	MLLT4_ENST00000392112.1_Missense_Mutation_p.I1343V|MLLT4_ENST00000392108.3_Missense_Mutation_p.I1360V|MLLT4_ENST00000366806.2_Missense_Mutation_p.I1360V|MLLT4_ENST00000351017.4_Missense_Mutation_p.I1367V|MLLT4_ENST00000400822.3_Missense_Mutation_p.I1359V|MLLT4_ENST00000344191.4_Missense_Mutation_p.I1360V			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1360	Pro-rich.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.I1344V(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTCCCAGCCAATCCGAACAGA	0.612			T	MLL	AL																																		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	1	Substitution - Missense(1)	ovary(1)	6											53.0	69.0	63.0					6																	168352133		2202	4298	6500	168094982	SO:0001583	missense	4301			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4078A>G	6.37:g.168352133A>G	ENSP00000404595:p.Ile1360Val	Somatic		Capture	Illumina GAIIx	4	168094982	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	HMMPfam_RA;HMMPfam_FHA;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_DIL;superfamily_SMAD/FHA domain;superfamily_Ubiquitin-like	p.I1359V	ENST00000447894.2	37	c.4075		6	.	.	.	.	.	.	.	.	.	.	A	0.032	-1.328090	0.01309	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04049	3.92;3.82;3.92;3.92;3.72;3.82;3.82	5.3	-10.6	0.00265	.	0.911809	0.09555	N	0.786351	T	0.00440	0.0014	N	0.13043	0.29	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.45702	-0.9243	10	0.02654	T	1	-23.1464	5.2962	0.15754	0.2064:0.283:0.4185:0.0921	.	1360;1359;1360;1344	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	V	1360;1367;1360;1360;1343;1360;1359;1360	ENSP00000341118:I1360V;ENSP00000252692:I1367V;ENSP00000375956:I1360V;ENSP00000355771:I1360V;ENSP00000375960:I1343V;ENSP00000383623:I1359V;ENSP00000404595:I1360V	ENSP00000345834:I1360V	I	+	1	0	MLLT4	168094982	0.002000	0.14202	0.000000	0.03702	0.015000	0.08874	0.460000	0.21924	-2.771000	0.00365	-2.300000	0.00261	ATC	-	NULL		0.612	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	protein_coding	OTTHUMT00000372077.1	A	NM_005936		168094982	1	no_errors	NM_001040001	genbank	human	validated	54_36p	missense	SNP	0.01	G
STARD3NL	83930	genome.wustl.edu	37	7	38256633	38256633	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr7:38256633C>T	ENST00000009041.7	+	5	646	c.389C>T	c.(388-390)aCg>aTg	p.T130M	STARD3NL_ENST00000544203.1_Missense_Mutation_p.T123M|STARD3NL_ENST00000396013.1_Missense_Mutation_p.T130M|STARD3NL_ENST00000434197.1_Intron	NM_032016.3	NP_114405.1	O95772	MENTO_HUMAN	STARD3 N-terminal like	130	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.					endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.T130M(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10						CAGTTGACAACGGCAGTGACC	0.478																																																1	Substitution - Missense(1)	ovary(1)	7											298.0	259.0	272.0					7																	38256633		2203	4300	6503	38223158	SO:0001583	missense	83930			AJ492267	CCDS5455.1	7p14-p13	2003-02-06			ENSG00000010270	ENSG00000010270			19169	protein-coding gene	gene with protein product		611759				12393907	Standard	NM_032016		Approved	MENTHO, MGC3251	uc003tfr.3	O95772	OTTHUMG00000023659	ENST00000009041.7:c.389C>T	7.37:g.38256633C>T	ENSP00000009041:p.Thr130Met	Somatic		Capture	Illumina GAIIx	4	38223158	A4D1X0	Missense_Mutation	SNP	-	p.T130M	ENST00000009041.7	37	c.389	CCDS5455.1	7	.	.	.	.	.	.	.	.	.	.	C	28.0	4.884854	0.91814	.	.	ENSG00000010270	ENST00000009041;ENST00000544203;ENST00000396013;ENST00000440144;ENST00000453225;ENST00000429075	T;T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16;0.16	5.79	5.79	0.91817	MENTAL domain (2);	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83524	0.0087	10	0.66056	D	0.02	-19.5212	18.8126	0.92064	0.0:1.0:0.0:0.0	.	130	O95772	MENTO_HUMAN	M	130;123;130;130;130;130	ENSP00000009041:T130M;ENSP00000439436:T123M;ENSP00000379334:T130M;ENSP00000411933:T130M;ENSP00000395455:T130M;ENSP00000402028:T130M	ENSP00000009041:T130M	T	+	2	0	STARD3NL	38223158	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.202000	0.77856	2.739000	0.93911	0.655000	0.94253	ACG	-	NULL		0.478	STARD3NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3NL	protein_coding	OTTHUMT00000226929.2	C			38223158	1	no_errors	NM_032016	genbank	human	provisional	54_36p	missense	SNP	1	T
ANGPT1	284	genome.wustl.edu	37	8	108348477	108348477	+	5'UTR	SNP	A	A	G			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr8:108348477A>G	ENST00000520734.1	-	0	161				ANGPT1_ENST00000520052.1_5'UTR			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.L159P(1)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			CTGTATCTCAAGTCGAGAAGT	0.318																																																1	Substitution - Missense(1)	ovary(1)	8											81.0	75.0	77.0					8																	108348477		2201	4300	6501	108417653	SO:0001623	5_prime_UTR_variant	284			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.-125T>C	8.37:g.108348477A>G		Somatic		Capture	Illumina GAIIx	4	108417653	Q5HYA0	Missense_Mutation	SNP	HMMPfam_Fibrinogen_C;superfamily_Fibrinogen C-terminal domain-like	p.L159P	ENST00000520734.1	37	c.476		8	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543876	0.86022	.	.	ENSG00000154188	ENST00000517746;ENST00000297450	T;T	0.45276	0.9;0.9	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.60286	-0.7293	10	0.34782	T	0.22	.	15.6906	0.77450	1.0:0.0:0.0:0.0	.	159;159	Q5HYA0;Q15389	.;ANGP1_HUMAN	P	159	ENSP00000428340:L159P;ENSP00000297450:L159P	ENSP00000297450:L159P	L	-	2	0	ANGPT1	108417653	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	9.095000	0.94175	2.187000	0.69744	0.533000	0.62120	CTT	-	NULL		0.318	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	protein_coding	OTTHUMT00000380428.2	A	NM_001146, NM_139290		108417653	-1	no_errors	NM_001146	genbank	human	reviewed	54_36p	missense	SNP	1	G
Unknown	0	genome.wustl.edu	37	9	67273220	67273220	+	IGR	SNP	G	G	T			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chr9:67273220G>T								AL845321.1 (47768 upstream) : RP11-236F9.2 (16349 downstream)																							CACCCGAAAAGTGGAGAATGG	0.557																																																0			9																																								66963040	SO:0001628	intergenic_variant	375719																															9.37:g.67273220G>T		Somatic		Capture	Illumina GAIIx	4	66963040		Missense_Mutation	SNP	HMMPfam_MIP;superfamily_Aquaporin-like	p.H144Q		37	c.432		9																																																																																			-	NULL	0	0.557					AQP7P1			G			66963040	-1	no_errors	ENST00000334576	ensembl	human	known	54_36p	missense	SNP	0.03	T
MAOA	4128	genome.wustl.edu	37	X	43572007	43572007	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chrX:43572007C>A	ENST00000338702.3	+	5	590	c.467C>A	c.(466-468)aCc>aAc	p.T156N	MAOA_ENST00000497485.1_3'UTR|MAOA_ENST00000542639.1_Missense_Mutation_p.T23N	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	156					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)	p.T156N(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	GACAAAATGACCATGAAAGAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											117.0	97.0	104.0					X																	43572007		2203	4299	6502	43456951	SO:0001583	missense	4128				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.467C>A	X.37:g.43572007C>A	ENSP00000340684:p.Thr156Asn	Somatic		Capture	Illumina GAIIx	4	43456951	B4DF46|Q16426	Missense_Mutation	SNP	HMMPfam_Amino_oxidase;superfamily_FAD/NAD(P)-binding domain;superfamily_FAD-linked reductases C-terminal domain	p.T156N	ENST00000338702.3	37	c.467	CCDS14260.1	X	.	.	.	.	.	.	.	.	.	.	.	16.91	3.251777	0.59212	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	T;T	0.11385	2.78;2.78	5.11	5.11	0.69529	Amine oxidase (1);	0.157396	0.56097	D	0.000033	T	0.42449	0.1203	M	0.91459	3.21	0.53688	D	0.999976	D	0.63046	0.992	D	0.69142	0.962	T	0.55451	-0.8139	10	0.62326	D	0.03	.	17.8319	0.88685	0.0:1.0:0.0:0.0	.	156	P21397	AOFA_HUMAN	N	156;23	ENSP00000340684:T156N;ENSP00000440846:T23N	ENSP00000340684:T156N	T	+	2	0	MAOA	43456951	1.000000	0.71417	0.255000	0.24374	0.284000	0.27059	6.640000	0.74319	2.142000	0.66516	0.431000	0.28591	ACC	-	HMMPfam_Amino_oxidase		0.418	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOA	protein_coding	OTTHUMT00000056300.1	C	NM_000240		43456951	1	no_errors	NM_000240	genbank	human	reviewed	54_36p	missense	SNP	1	A
Unknown	0	genome.wustl.edu	37	X	92479070	92479070	+	IGR	SNP	T	T	A			TCGA-04-1348-01A-01W-0494-09	TCGA-04-1348-11A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1f4dee42-8f3d-4307-b6e5-3381d77d201c	b2ae42d1-f617-4dec-a1c7-c39c6e6fc8ec	g.chrX:92479070T>A								PCDH11X (600841 upstream) : NAP1L3 (446858 downstream)																							TGCTTCAAGATTTCAGGCCTT	0.423																																																0			X																																								92365726	SO:0001628	intergenic_variant	401602																															X.37:g.92479070T>A		Somatic		Capture	Illumina GAIIx	4	92365726		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.423					LOC401602			T			92365726	-1	pseudogene	XR_016272	genbank	human	model	54_36p	rna	SNP	1	A
