#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								13524	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	13524		Missense_Mutation	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.I396T		37	c.1187		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND5			T			13524	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	missense	SNP	NULL	C
C20orf96	140680	genome.wustl.edu	37	20	259879	259879	+	Silent	SNP	G	G	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:259879G>T	ENST00000360321.2	-	5	537	c.399C>A	c.(397-399)atC>atA	p.I133I	C20orf96_ENST00000400269.3_Silent_p.I75I|C20orf96_ENST00000382369.5_Silent_p.I98I	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	133										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CCATCTCCTGGATGGTCTCGA	0.687																																																0			20											110.0	78.0	89.0					20																	259879		2203	4300	6503	207879	SO:0001819	synonymous_variant	140680			AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.399C>A	20.37:g.259879G>T		Somatic		Capture	Illumina GAIIx	4	207879	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Silent	SNP	NULL	p.I133	ENST00000360321.2	37	c.399	CCDS12994.1	20																																																																																			-	NULL		0.687	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf96	protein_coding	OTTHUMT00000077439.2	G	NM_153269		207879	-1	no_errors	NM_153269	genbank	human	predicted	54_36p	silent	SNP	0.112	T
HS3ST6	64711	genome.wustl.edu	37	16	1961684	1961684	+	Silent	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr16:1961684C>T	ENST00000293937.3	-	2	935	c.936G>A	c.(934-936)gtG>gtA	p.V312V	HS3ST6_ENST00000443547.1_Silent_p.V281V|HS3ST6_ENST00000454677.2_Silent_p.V329V			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	312					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						GGGCCTGGGGCACGCGTGGGT	0.697																																																0			16											19.0	22.0	21.0					16																	1961684		2134	4237	6371	1901685	SO:0001819	synonymous_variant	64711					16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.936G>A	16.37:g.1961684C>T		Somatic		Capture	Illumina GAIIx	4	1901685	Q96RX7	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1	p.V281	ENST00000293937.3	37	c.843		16																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1		0.697	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	HS3ST6	protein_coding		C	NM_001009606		1901685	-1	no_errors	NM_001009606	genbank	human	validated	54_36p	silent	SNP	0.986	T
RGS12	6002	genome.wustl.edu	37	4	3424263	3424263	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr4:3424263C>T	ENST00000344733.5	+	11	3903	c.2999C>T	c.(2998-3000)gCg>gTg	p.A1000V	RGS12_ENST00000306648.7_Missense_Mutation_p.A398V|RGS12_ENST00000336727.3_Missense_Mutation_p.A1000V|RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000382788.3_Missense_Mutation_p.A1000V|RGS12_ENST00000538395.1_Missense_Mutation_p.A342V|RGS12_ENST00000338806.4_Missense_Mutation_p.A352V	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1000	RBD 1. {ECO:0000255|PROSITE- ProRule:PRU00262}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATCAACGGGGCGGCCGCGGAC	0.677																																																0			4											44.0	47.0	46.0					4																	3424263		2201	4300	6501	3394061	SO:0001583	missense	6002			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2999C>T	4.37:g.3424263C>T	ENSP00000339381:p.Ala1000Val	Somatic		Capture	Illumina GAIIx	4	3394061	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_PH domain-like,HMMSmart_SM00462,HMMPfam_PID,superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315,superfamily_Ubiquitin-like,HMMPfam_RBD,HMMSmart_SM00455,HMMPfam_GoLoco,HMMSmart_SM00390	p.A1000V	ENST00000344733.5	37	c.2999	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977245	0.92982	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.37915	1.45;1.45;1.45;1.2;1.17;1.22	4.7	4.7	0.59300	Raf-like Ras-binding (3);	0.058529	0.64402	D	0.000002	T	0.57814	0.2079	M	0.63843	1.955	0.58432	D	0.999995	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.976;1.0;1.0;0.999	T	0.59595	-0.7425	10	0.49607	T	0.09	-12.4825	16.6528	0.85221	0.0:1.0:0.0:0.0	.	342;199;199;342;352;398;1000;1000	B7Z764;B3KVS7;A8K440;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;.;RGS12_HUMAN;.	V	1000;1000;1000;398;352;342	ENSP00000339381:A1000V;ENSP00000338509:A1000V;ENSP00000372238:A1000V;ENSP00000304459:A398V;ENSP00000342133:A352V;ENSP00000438888:A342V	ENSP00000304459:A398V	A	+	2	0	RGS12	3394061	1.000000	0.71417	0.989000	0.46669	0.970000	0.65996	5.806000	0.69150	2.165000	0.68154	0.655000	0.94253	GCG	-	superfamily_Ubiquitin-like,HMMPfam_RBD,HMMSmart_SM00455		0.677	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	protein_coding	OTTHUMT00000206602.1	C	NM_002926		3394061	+1	no_errors	NM_198229	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CENPB	1059	genome.wustl.edu	37	20	3766420	3766420	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:3766420C>G	ENST00000379751.4	-	1	917	c.711G>C	c.(709-711)gaG>gaC	p.E237D	CDC25B_ENST00000344256.6_5'Flank|CDC25B_ENST00000379598.5_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	237					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						GGGGCAGCTTCTCGCTGCCGT	0.726																																																0			20											17.0	20.0	19.0					20																	3766420		2191	4260	6451	3714420	SO:0001583	missense	1059			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.711G>C	20.37:g.3766420C>G	ENSP00000369075:p.Glu237Asp	Somatic		Capture	Illumina GAIIx	4	3714420	Q96EI4	Missense_Mutation	SNP	HMMPfam_CENP-B_N,superfamily_Homeodomain_like,HMMPfam_CenpB-DNA-bind,HMMSmart_CENPB,HMMPfam_DDE,HMMPfam_Cenp-B_dimeris,superfamily_SSF101160	p.E237D	ENST00000379751.4	37	c.711	CCDS13064.1	20	.	.	.	.	.	.	.	.	.	.	c	10.35	1.325985	0.24080	.	.	ENSG00000125817	ENST00000379751	T	0.52983	0.64	4.04	-0.329	0.12686	.	0.000000	0.35179	U	0.003390	T	0.43255	0.1239	L	0.48218	1.51	0.26399	N	0.976451	P	0.49635	0.926	P	0.51866	0.682	T	0.37798	-0.9690	10	0.66056	D	0.02	-10.8237	3.621	0.08096	0.1685:0.4427:0.0:0.3888	.	237	P07199	CENPB_HUMAN	D	237	ENSP00000369075:E237D	ENSP00000369075:E237D	E	-	3	2	CENPB	3714420	0.995000	0.38212	0.989000	0.46669	0.281000	0.26958	0.273000	0.18662	-0.397000	0.07691	-0.689000	0.03729	GAG	-	HMMPfam_DDE		0.726	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPB	protein_coding	OTTHUMT00000077772.2	C	NM_001810		3714420	-1	no_errors	NM_001810	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CALR	811	genome.wustl.edu	37	19	13049527	13049527	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr19:13049527C>T	ENST00000316448.5	+	1	107	c.34C>T	c.(34-36)Ctc>Ttc	p.L12F		NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	12					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	GCTCGGCCTCCTCGGCCTGGC	0.711											OREG0025278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											12.0	13.0	13.0					19																	13049527		2190	4273	6463	12910527	SO:0001583	missense	811			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.34C>T	19.37:g.13049527C>T	ENSP00000320866:p.Leu12Phe	Somatic	684	Capture	Illumina GAIIx	4	12910527	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Calreticulin,PatternScan_CALRETICULIN_1,PatternScan_CALRETICULIN_2,PatternScan_CALRETICULIN_REPEAT	p.L12F	ENST00000316448.5	37	c.34	CCDS12288.1	19	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729325	0.48833	.	.	ENSG00000179218	ENST00000316448	T	0.53640	0.61	5.82	3.68	0.42216	Concanavalin A-like lectin/glucanase (1);	0.387037	0.27122	N	0.020829	T	0.36799	0.0980	L	0.50993	1.605	0.54753	D	0.999989	P	0.40476	0.718	B	0.36885	0.235	T	0.08027	-1.0742	10	0.21540	T	0.41	-9.4994	9.2289	0.37425	0.0:0.7758:0.146:0.0782	.	12	P27797	CALR_HUMAN	F	12	ENSP00000320866:L12F	ENSP00000320866:L12F	L	+	1	0	CALR	12910527	0.000000	0.05858	0.626000	0.29213	0.828000	0.46876	-0.657000	0.05335	0.793000	0.33875	0.561000	0.74099	CTC	-	superfamily_Concanavalin A-like lectins/glucanases		0.711	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR	protein_coding	OTTHUMT00000451952.1	C	NM_004343		12910527	+1	no_errors	NM_004343	genbank	human	reviewed	54_36p	missense	SNP	0.055	T
NOTCH3	4854	genome.wustl.edu	37	19	15273310	15273310	+	Missense_Mutation	SNP	T	T	C	rs370239685		TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr19:15273310T>C	ENST00000263388.2	-	32	5954	c.5879A>G	c.(5878-5880)aAa>aGa	p.K1960R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1960					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGCTCCATTTTTGAGCAGGGC	0.577																																																0			19						T	ARG/LYS	0,4406		0,0,2203	97.0	77.0	84.0		5879	3.4	1.0	19		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	NOTCH3	NM_000435.2	26	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	1960/2322	15273310	1,13005	2203	4300	6503	15134310	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5879A>G	19.37:g.15273310T>C	ENSP00000263388:p.Lys1960Arg	Somatic		Capture	Illumina GAIIx	4	15134310	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,HMMSmart_SM00179,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain,HMMPfam_NOD,HMMPfam_NODP,superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.K1960R	ENST00000263388.2	37	c.5879	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	T	20.4	3.975750	0.74360	0.0	1.16E-4	ENSG00000074181	ENST00000263388	T	0.65916	-0.18	4.44	3.38	0.38709	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.65873	0.2733	L	0.31578	0.945	0.47547	D	0.999458	D	0.89917	1.0	D	0.91635	0.999	T	0.64774	-0.6328	9	0.52906	T	0.07	.	9.4257	0.38578	0.1596:0.0:0.0:0.8404	.	1960	Q9UM47	NOTC3_HUMAN	R	1960	ENSP00000263388:K1960R	ENSP00000263388:K1960R	K	-	2	0	NOTCH3	15134310	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.701000	0.61810	0.804000	0.34136	0.528000	0.53228	AAA	-	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank		0.577	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	T	NM_000435		15134310	-1	no_errors	NM_000435	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
HIRA	7290	genome.wustl.edu	37	22	19396100	19396100	+	Silent	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr22:19396100C>T	ENST00000263208.5	-	3	373	c.117G>A	c.(115-117)aaG>aaA	p.K39K	HIRA_ENST00000546308.1_5'UTR|HIRA_ENST00000541063.1_5'UTR|HIRA_ENST00000340170.4_Silent_p.K39K|HIRA_ENST00000464189.1_5'UTR	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	39					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					AGATCACAACCTTCCCAGAAT	0.393																																																0			22											101.0	93.0	96.0					22																	19396100		2203	4300	6503	17776100	SO:0001819	synonymous_variant	7290			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.117G>A	22.37:g.19396100C>T		Somatic		Capture	Illumina GAIIx	4	17776100	Q05BU9|Q8IXN2	Silent	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMPfam_HIRA_B,HMMPfam_Hira	p.K39	ENST00000263208.5	37	c.117	CCDS13759.1	22																																																																																			-	HMMSmart_SM00320,superfamily_WD40 repeat-like		0.393	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	protein_coding	OTTHUMT00000316488.2	C	NM_003325		17776100	-1	no_errors	NM_003325	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
POTEB2	100287399	genome.wustl.edu	37	15	21071247	21071247	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr15:21071247C>T	ENST00000454856.4	-	1	396	c.364G>A	c.(364-366)Gtc>Atc	p.V122I		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	122																	CTGAGCATGACGATGAGATCC	0.577																																																0			15											1.0	2.0	2.0					15																	21071247		61	372	433	19335826	SO:0001583	missense	339010				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.364G>A	15.37:g.21071247C>T	ENSP00000456953:p.Val122Ile	Somatic		Capture	Illumina GAIIx	4	19335826		Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.V159I	ENST00000454856.4	37	c.475	CCDS59248.1	15																																																																																			-	superfamily_Ankyrin repeat,HMMPfam_Ank		0.577	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	protein_coding	OTTHUMT00000471435.1	C			19335826	-1	no_errors	NM_207355	genbank	human	validated	54_36p	missense	SNP	0.006	T
DPYSL5	56896	genome.wustl.edu	37	2	27121400	27121400	+	Silent	SNP	C	C	G			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr2:27121400C>G	ENST00000288699.6	+	2	191	c.33C>G	c.(31-33)ctC>ctG	p.L11L	DPYSL5_ENST00000401478.1_Silent_p.L11L	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	11					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGGATCCTCATCAAGGGAG	0.547																																																0			2											212.0	189.0	197.0					2																	27121400		2203	4300	6503	26974904	SO:0001819	synonymous_variant	56896			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.33C>G	2.37:g.27121400C>G		Somatic		Capture	Illumina GAIIx	4	26974904	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	superfamily_Metalo_hydrolase,HMMPfam_Amidohydro_1,superfamily_SSF51556	p.L11	ENST00000288699.6	37	c.33	CCDS1730.1	2																																																																																			-	superfamily_Metalo_hydrolase		0.547	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	protein_coding	OTTHUMT00000214187.2	C	NM_020134		26974904	+1	no_errors	NM_020134	genbank	human	validated	54_36p	silent	SNP	1.000	G
BPIFA4P	317716	genome.wustl.edu	37	20	31789417	31789417	+	RNA	SNP	C	C	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:31789417C>A	ENST00000375465.3	+	0	379					NR_026760.1		Q86YQ2	LATH_HUMAN	BPI fold containing family A, member 4, pseudogene							extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGTACAAGTACCATTCACGTC	0.488																																																0			20											226.0	196.0	205.0					20																	31789417		692	1591	2283	31253078			0			AY180924		20q11.21	2013-01-24			ENSG00000183566	ENSG00000183566		"""BPI fold containing"""	20469	pseudogene	pseudogene	"""breast cancer and salivary gland expression gene"", ""PLUNC family pseudogene"""	607627				12538848, 21787333	Standard	NR_026760		Approved	BASE	uc002wyq.2	Q86YQ2	OTTHUMG00000032251		20.37:g.31789417C>A		Somatic		Capture	Illumina GAIIx	4	31253078		Missense_Mutation	SNP	NULL	p.P110T	ENST00000375465.3	37	c.328		20																																																																																			-	NULL		0.488	BPIFA4P-003	KNOWN	basic	processed_transcript	ENSG00000183566	pseudogene	OTTHUMT00000469705.1	C	NR_026760		31253078	+1	no_errors	ENST00000375465	ensembl	human	known	54_36p	missense	SNP	0.004	A
BPI	671	genome.wustl.edu	37	20	36936034	36936034	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:36936034G>A	ENST00000262865.4	+	2	297	c.208G>A	c.(208-210)Gac>Aac	p.D70N	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	70					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				TGACTACTCAGACAGCTTTAA	0.527																																																0			20											121.0	115.0	117.0					20																	36936034		2203	4300	6503	36369448	SO:0001583	missense	671			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.208G>A	20.37:g.36936034G>A	ENSP00000262865:p.Asp70Asn	Somatic		Capture	Illumina GAIIx	4	36369448	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Missense_Mutation	SNP	superfamily_Bactericidal_perm-incr_a/b_dom,PatternScan_LBP_BPI_CETP,HMMSmart_BPI1,HMMPfam_LBP_BPI_CETP,HMMPfam_LBP_BPI_CETP_C,HMMSmart_BPI2	p.D70N	ENST00000262865.4	37	c.208	CCDS13303.1	20	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848256	0.32699	.	.	ENSG00000101425	ENST00000262865	T	0.04970	3.52	4.21	3.26	0.37387	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.631864	0.14952	N	0.288857	T	0.04407	0.0121	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.33471	-0.9867	10	0.72032	D	0.01	-0.2552	8.2582	0.31769	0.1066:0.0:0.8934:0.0	.	70	P17213	BPI_HUMAN	N	70	ENSP00000262865:D70N	ENSP00000262865:D70N	D	+	1	0	BPI	36369448	0.854000	0.29725	0.003000	0.11579	0.000000	0.00434	4.609000	0.61148	1.359000	0.45940	-0.150000	0.13652	GAC	-	superfamily_Bactericidal_perm-incr_a/b_dom,HMMSmart_BPI1,HMMPfam_LBP_BPI_CETP		0.527	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BPI	protein_coding	OTTHUMT00000079157.2	G	NM_001725		36369448	+1	no_errors	NM_001725	genbank	human	reviewed	54_36p	missense	SNP	0.015	A
JPH2	57158	genome.wustl.edu	37	20	42788633	42788633	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:42788633C>T	ENST00000372980.3	-	2	1666	c.794G>A	c.(793-795)aGc>aAc	p.S265N		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	265					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CTCTCCCAGGCTGGCGGTGGA	0.701																																																0			20											15.0	16.0	16.0					20																	42788633		2195	4281	6476	42222047	SO:0001583	missense	57158			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.794G>A	20.37:g.42788633C>T	ENSP00000362071:p.Ser265Asn	Somatic		Capture	Illumina GAIIx	4	42222047	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	superfamily_Histone H3 K4-specific methyltransferase SET7/9 N-terminal domain,HMMSmart_SM00698,HMMPfam_MORN,PatternScan_SUGAR_TRANSPORT_1,PatternScan_XYLOSE_ISOMERASE_1	p.S265N	ENST00000372980.3	37	c.794	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	c	15.09	2.730783	0.48939	.	.	ENSG00000149596	ENST00000372980	T	0.63417	-0.04	3.03	2.06	0.26882	.	0.111045	0.64402	U	0.000003	T	0.75766	0.3894	M	0.77820	2.39	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.74213	-0.3738	10	0.38643	T	0.18	.	11.7911	0.52070	0.0:0.8206:0.1794:0.0	.	265	Q9BR39	JPH2_HUMAN	N	265	ENSP00000362071:S265N	ENSP00000362071:S265N	S	-	2	0	JPH2	42222047	1.000000	0.71417	0.630000	0.29268	0.171000	0.22731	5.469000	0.66749	0.466000	0.27193	0.298000	0.19748	AGC	-	NULL		0.701	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	protein_coding	OTTHUMT00000080307.1	C			42222047	-1	no_errors	NM_020433	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NFKBIE	4794	genome.wustl.edu	37	6	44227867	44227867	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr6:44227867C>A	ENST00000275015.5	-	5	1349	c.1350G>T	c.(1348-1350)atG>atT	p.M450I	SLC35B2_ENST00000495706.1_5'Flank|SLC35B2_ENST00000537814.1_5'Flank|SLC35B2_ENST00000393810.1_5'Flank|SLC35B2_ENST00000393812.3_5'Flank|SLC35B2_ENST00000538577.1_5'Flank	NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	450					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATGAGATGCCCATGAGACCCC	0.627																																																0			6											49.0	50.0	50.0					6																	44227867		2203	4300	6503	44335845	SO:0001583	missense	4794			U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.1350G>T	6.37:g.44227867C>A	ENSP00000275015:p.Met450Ile	Somatic		Capture	Illumina GAIIx	4	44335845	Q5T9V9	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.M450I	ENST00000275015.5	37	c.1350	CCDS34463.1	6	.	.	.	.	.	.	.	.	.	.	C	3.205	-0.162799	0.06502	.	.	ENSG00000146232	ENST00000275015;ENST00000443607	T	0.62788	0.0	4.67	-7.96	0.01144	Ankyrin repeat-containing domain (3);	0.638810	0.15041	N	0.283892	T	0.09291	0.0229	N	0.01800	-0.715	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.28681	-1.0036	10	0.37606	T	0.19	-30.6319	5.8364	0.18609	0.2163:0.405:0.3041:0.0746	.	450	O00221	IKBE_HUMAN	I	450;51	ENSP00000275015:M450I	ENSP00000275015:M450I	M	-	3	0	NFKBIE	44335845	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.140000	0.10342	-1.423000	0.02002	-1.045000	0.02358	ATG	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.627	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIE	protein_coding	OTTHUMT00000040733.2	C			44335845	-1	no_errors	NM_004556	genbank	human	validated	54_36p	missense	SNP	0.801	A
TSPEAR	54084	genome.wustl.edu	37	21	45987686	45987686	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr21:45987686G>T	ENST00000323084.4	-	2	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T	TSPEAR_ENST00000397916.1_Missense_Mutation_p.P28T	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	96	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GGAAGATTGGGAACTCTCAAA	0.507																																																0			21											56.0	54.0	54.0					21																	45987686		2203	4300	6503	44812114	SO:0001583	missense	54084			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.286C>A	21.37:g.45987686G>T	ENSP00000321987:p.Pro96Thr	Somatic		Capture	Illumina GAIIx	4	44812114		Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_EPTP	p.P96T	ENST00000323084.4	37	c.286	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	g	0.014	-1.603227	0.00849	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	T;T	0.42131	0.98;0.98	4.68	3.73	0.42828	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	1.038680	0.07563	N	0.917383	T	0.44932	0.1317	M	0.66939	2.045	0.19300	N	0.999976	B	0.19935	0.04	B	0.13407	0.009	T	0.33497	-0.9866	10	0.44086	T	0.13	.	12.4554	0.55702	0.0:0.0:0.8316:0.1684	.	96	Q8WU66	TSEAR_HUMAN	T	96;96;28;96	ENSP00000321987:P96T;ENSP00000381012:P28T	ENSP00000321987:P96T	P	-	1	0	TSPEAR	44812114	0.296000	0.24398	0.081000	0.20488	0.003000	0.03518	1.195000	0.32186	2.140000	0.66376	0.591000	0.81541	CCC	-	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases		0.507	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf29	protein_coding	OTTHUMT00000098761.1	G	NM_144991		44812114	-1	no_errors	NM_144991	genbank	human	provisional	54_36p	missense	SNP	0.185	T
TINAG	27283	genome.wustl.edu	37	6	54214691	54214691	+	Silent	SNP	C	C	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr6:54214691C>A	ENST00000259782.4	+	7	1173	c.1077C>A	c.(1075-1077)tcC>tcA	p.S359S		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	359					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GAGTCTCTTCCAACGTAAGTA	0.363																																																0			6											93.0	92.0	92.0					6																	54214691		2203	4300	6503	54322650	SO:0001819	synonymous_variant	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1077C>A	6.37:g.54214691C>A		Somatic		Capture	Illumina GAIIx	4	54322650	Q5T467|Q9UJW1|Q9ULZ4	Silent	SNP	HMMSmart_SM00201,PatternScan_SMB_1,superfamily_Cysteine proteinases,HMMSmart_SM00645,HMMPfam_Peptidase_C1,PatternScan_THIOL_PROTEASE_ASN	p.S359	ENST00000259782.4	37	c.1077	CCDS4955.1	6																																																																																			-	superfamily_Cysteine proteinases,HMMSmart_SM00645,HMMPfam_Peptidase_C1		0.363	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAG	protein_coding	OTTHUMT00000040984.1	C	NM_014464		54322650	+1	no_errors	NM_014464	genbank	human	validated	54_36p	silent	SNP	1.000	A
EEF1A2	1917	genome.wustl.edu	37	20	62119708	62119708	+	Silent	SNP	G	G	A	rs372257864	byFrequency	TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:62119708G>A	ENST00000298049.7	-	7	1405	c.1335C>T	c.(1333-1335)agC>agT	p.S445S	EEF1A2_ENST00000217182.3_Silent_p.S445S			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	445					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			CGGCGCCGCCGCTCTTCTTCT	0.751													g|||	38	0.00758786	0.0	0.0	5008	,	,		4388	0.0		0.002	False		,,,				2504	0.0368															0			20								1,3895		0,1,1947	7.0	6.0	7.0		1335	0.7	1.0	20		7	21,7681		0,21,3830	no	coding-synonymous	EEF1A2	NM_001958.2		0,22,5777	AA,AG,GG		0.2727,0.0257,0.1897		445/464	62119708	22,11576	1948	3851	5799	61590152	SO:0001819	synonymous_variant	1917			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1335C>T	20.37:g.62119708G>A		Somatic		Capture	Illumina GAIIx	4	61590152	B5BUF3|E1P5J1|P54266|Q0VGC7	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GTP_EFTU,PatternScan_EFACTOR_GTP,superfamily_Translation proteins,HMMPfam_GTP_EFTU_D2,HMMPfam_GTP_EFTU_D3,superfamily_EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain	p.S445	ENST00000298049.7	37	c.1335	CCDS13522.1	20																																																																																			-	NULL		0.751	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A2	protein_coding	OTTHUMT00000080495.1	G	NM_001958		61590152	-1	no_errors	NM_001958	genbank	human	reviewed	54_36p	silent	SNP	0.988	A
RTEL1	51750	genome.wustl.edu	37	20	62324593	62324593	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr20:62324593C>G	ENST00000360203.5	+	30	3274	c.2949C>G	c.(2947-2949)agC>agG	p.S983R	RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.S983R|RTEL1_ENST00000370003.1_Missense_Mutation_p.S228R|RTEL1_ENST00000318100.4_Missense_Mutation_p.S983R|RTEL1_ENST00000508582.2_Missense_Mutation_p.S1007R|RTEL1_ENST00000370018.3_Missense_Mutation_p.S983R					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CTGAGCACAGCATTCCCCGAA	0.627																																																0			20											86.0	90.0	88.0					20																	62324593		2199	4289	6488	61795037	SO:0001583	missense	51750			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2949C>G	20.37:g.62324593C>G	ENSP00000353332:p.Ser983Arg	Somatic		Capture	Illumina GAIIx	4	61795037		Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc2,HMMPfam_ResIII,HMMPfam_DEAD_2,HMMSmart_HELICc2,superfamily_SSF57850	p.S983R	ENST00000360203.5	37	c.2949		20	.	.	.	.	.	.	.	.	.	.	C	14.84	2.655067	0.47467	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000370003	T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02	4.82	2.88	0.33553	.	0.604873	0.18191	N	0.148821	T	0.17619	0.0423	L	0.55481	1.735	0.25033	N	0.991252	P;B;B;D	0.59357	0.946;0.222;0.046;0.985	P;B;B;P	0.61477	0.754;0.031;0.035;0.889	T	0.03910	-1.0993	10	0.66056	D	0.02	-7.9762	6.943	0.24502	0.0:0.6376:0.0:0.3624	.	1007;228;983;983	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	R	983;983;1007;983;228	ENSP00000359035:S983R;ENSP00000322287:S983R;ENSP00000424307:S1007R;ENSP00000353332:S983R;ENSP00000359020:S228R	ENSP00000353332:S983R	S	+	3	2	AL353715.1	61795037	0.005000	0.15991	0.002000	0.10522	0.018000	0.09664	0.829000	0.27449	0.457000	0.26962	0.289000	0.19496	AGC	-	NULL		0.627	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	protein_coding	OTTHUMT00000289781.1	C	NM_032957		61795037	+1	no_errors	NM_032957	genbank	human	reviewed	54_36p	missense	SNP	0.612	G
HKDC1	80201	genome.wustl.edu	37	10	71008266	71008266	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr10:71008266A>C	ENST00000354624.5	+	10	1485	c.1352A>C	c.(1351-1353)aAg>aCg	p.K451T	HKDC1_ENST00000488706.1_3'UTR|HKDC1_ENST00000395086.2_Missense_Mutation_p.K451T	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	451	Hexokinase type-2 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GGCAGCACCAAGGGGGCCGCC	0.637																																																0			10											41.0	42.0	41.0					10																	71008266		2202	4300	6502	70678272	SO:0001583	missense	80201				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1352A>C	10.37:g.71008266A>C	ENSP00000346643:p.Lys451Thr	Somatic		Capture	Illumina GAIIx	4	70678272	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	HMMPfam_Hexokinase_1,superfamily_Actin-like ATPase domain,HMMPfam_Hexokinase_2,PatternScan_HEXOKINASES	p.K451T	ENST00000354624.5	37	c.1352	CCDS7288.1	10	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084605	0.76642	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	T;T	0.11385	2.78;2.78	4.97	3.8	0.43715	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	M	0.80422	2.495	0.50313	D	0.999863	P	0.52463	0.953	P	0.59948	0.866	T	0.01121	-1.1445	10	0.66056	D	0.02	-14.3556	6.9707	0.24646	0.7917:0.0:0.0746:0.1336	.	451	Q2TB90	HKDC1_HUMAN	T	451	ENSP00000346643:K451T;ENSP00000378521:K451T	ENSP00000346643:K451T	K	+	2	0	HKDC1	70678272	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.294000	0.59043	0.879000	0.35944	0.379000	0.24179	AAG	-	HMMPfam_Hexokinase_2,superfamily_Actin-like ATPase domain		0.637	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	protein_coding	OTTHUMT00000048389.1	A	NM_025130		70678272	+1	no_errors	NM_025130	genbank	human	validated	54_36p	missense	SNP	1.000	C
CDH15	1013	genome.wustl.edu	37	16	89258747	89258747	+	Missense_Mutation	SNP	A	A	C	rs75791347	byFrequency	TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr16:89258747A>C	ENST00000289746.2	+	11	1815	c.1750A>C	c.(1750-1752)Aag>Cag	p.K584Q		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	584	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGCTGCGGCAAGGACGGCGT	0.751													c|||	2269	0.453075	0.3616	0.3804	5008	,	,		8209	0.6528		0.4304	False		,,,				2504	0.4458															0			16							GLN/LYS	719,2255		126,467,894	2.0	3.0	2.0		1750	-4.4	0.0	16	dbSNP_131	2	1977,4371		402,1173,1599	no	missense	CDH15	NM_004933.2	53	528,1640,2493	CC,CA,AA		31.1437,24.1762,28.9208	benign	584/815	89258747	2696,6626	1487	3174	4661	87786248	SO:0001583	missense	1013			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1750A>C	16.37:g.89258747A>C	ENSP00000289746:p.Lys584Gln	Somatic		Capture	Illumina GAIIx	4	87786248		Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.K584Q	ENST00000289746.2	37	c.1750	CCDS10976.1	16	1014	0.4642857142857143	172	0.34959349593495936	127	0.35082872928176795	372	0.6503496503496503	343	0.4525065963060686	c	3.132	-0.178252	0.06380	0.241762	0.311437	ENSG00000129910	ENST00000289746	T	0.56941	0.43	4.6	-4.43	0.03568	Cadherin (1);	1.872270	0.03679	N	0.245167	T	0.00012	0.0000	N	0.05383	-0.06	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.38802	-0.9644	9	0.18276	T	0.48	.	3.3286	0.07076	0.1871:0.1478:0.4907:0.1744	.	584	P55291	CAD15_HUMAN	Q	584	ENSP00000289746:K584Q	ENSP00000289746:K584Q	K	+	1	0	CDH15	87786248	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.609000	0.05635	-0.999000	0.03442	-0.675000	0.03792	AAG	-	superfamily_Cadherin		0.751	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	protein_coding	OTTHUMT00000269920.1	A	NM_004933		87786248	+1	no_errors	NM_004933	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
FARP1	10160	genome.wustl.edu	37	13	99083507	99083507	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr13:99083507A>C	ENST00000319562.6	+	18	2381	c.2116A>C	c.(2116-2118)Agc>Cgc	p.S706R	FARP1_ENST00000376586.2_Missense_Mutation_p.S706R|FARP1_ENST00000595437.1_Missense_Mutation_p.S706R	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	706	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CCACCCGCCGAGCCACGCCGA	0.657																																																0			13											10.0	11.0	11.0					13																	99083507		2166	4250	6416	97881508	SO:0001583	missense	10160			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2116A>C	13.37:g.99083507A>C	ENSP00000322926:p.Ser706Arg	Somatic		Capture	Illumina GAIIx	4	97881508	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_Ubiquitin-like,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_Second domain of FERM,HMMPfam_FERM_M,superfamily_PH domain-like,HMMPfam_FERM_C,HMMPfam_FA,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,HMMPfam_PH,HMMSmart_SM00233	p.S706R	ENST00000319562.6	37	c.2116	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	A	11.35	1.613978	0.28712	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.67865	-0.29;-0.29	5.58	4.4	0.53042	Dbl homology (DH) domain (5);	0.337598	0.34932	N	0.003568	T	0.47097	0.1427	N	0.08118	0	0.31481	N	0.667178	B;B	0.27316	0.175;0.084	B;B	0.30029	0.11;0.042	T	0.53739	-0.8396	10	0.49607	T	0.09	.	11.2934	0.49263	0.9285:0.0:0.0715:0.0	.	706;706	Q9Y4F1;C9JME2	FARP1_HUMAN;.	R	706	ENSP00000365771:S706R;ENSP00000322926:S706R	ENSP00000322926:S706R	S	+	1	0	FARP1	97881508	0.105000	0.21958	0.908000	0.35775	0.678000	0.39670	3.383000	0.52471	0.943000	0.37553	0.454000	0.30748	AGC	-	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325		0.657	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	protein_coding	OTTHUMT00000045541.3	A	NM_005766		97881508	+1	no_errors	NM_005766	genbank	human	reviewed	54_36p	missense	SNP	0.988	C
OR5H7P	79291	genome.wustl.edu	37	3	97957742	97957742	+	lincRNA	SNP	C	C	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr3:97957742C>A	ENST00000508616.1	+	0	26																											TGACATTATCCCATTGTTAAA	0.284																																																0			3																																								99440432			0																															3.37:g.97957742C>A		Somatic		Capture	Illumina GAIIx	4	99440432		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1	p.P144T	ENST00000508616.1	37	c.430		3																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.284	RP11-325B23.2-001	KNOWN	basic	lincRNA	ENSG00000187900	lincRNA	OTTHUMT00000359282.1	C			99440432	+1	no_errors	ENST00000341450	ensembl	human	known	54_36p	missense	SNP	0.033	A
LPPR4	9890	genome.wustl.edu	37	1	99772185	99772185	+	Silent	SNP	G	G	T	rs201385642		TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr1:99772185G>T	ENST00000370185.3	+	7	2408	c.1911G>T	c.(1909-1911)ccG>ccT	p.P637P	LPPR4_ENST00000370184.1_Silent_p.P479P|LPPR4_ENST00000457765.1_Silent_p.P579P	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		637					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TACAGATCCCGTCCACTGAAG	0.547																																																0			1											81.0	78.0	79.0					1																	99772185		2203	4300	6503	99544773	SO:0001819	synonymous_variant	9890																														ENST00000370185.3:c.1911G>T	1.37:g.99772185G>T		Somatic		Capture	Illumina GAIIx	4	99544773	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	superfamily_Acid phosphatase/Vanadium-dependent haloperoxidase,HMMPfam_PAP2,HMMSmart_SM00014	p.P637	ENST00000370185.3	37	c.1911	CCDS757.1	1																																																																																			-	NULL		0.547	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	protein_coding	OTTHUMT00000029670.2	G			99544773	+1	no_errors	NM_014839	genbank	human	reviewed	54_36p	silent	SNP	0.549	T
NR5A1	2516	genome.wustl.edu	37	9	127262732	127262732	+	Silent	SNP	C	C	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr9:127262732C>T	ENST00000373588.4	-	4	703	c.507G>A	c.(505-507)ctG>ctA	p.L169L		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	169					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						CGGCCATGGGCAGTGCTGGGG	0.692																																																0			9											7.0	9.0	8.0					9																	127262732		2150	4200	6350	126302553	SO:0001819	synonymous_variant	2516			D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.507G>A	9.37:g.127262732C>T		Somatic		Capture	Illumina GAIIx	4	126302553	O15196|Q5T6F5	Silent	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.L169	ENST00000373588.4	37	c.507	CCDS6856.1	9																																																																																			-	superfamily_Nuclear receptor ligand-binding domain		0.692	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR5A1	protein_coding	OTTHUMT00000054029.1	C	NM_004959		126302553	-1	no_errors	NM_004959	genbank	human	reviewed	54_36p	silent	SNP	0.838	T
PLXNA1	5361	genome.wustl.edu	37	3	126748781	126748781	+	Silent	SNP	C	C	T	rs527394103		TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr3:126748781C>T	ENST00000393409.2	+	27	4935	c.4935C>T	c.(4933-4935)ccC>ccT	p.P1645P	PLXNA1_ENST00000251772.4_Silent_p.P1622P	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1645					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TGATCACGCCCGACCTGGAGA	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		18013	0.0		0.0	False		,,,				2504	0.001															0			3											68.0	66.0	67.0					3																	126748781		2203	4299	6502	128231471	SO:0001819	synonymous_variant	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4935C>T	3.37:g.126748781C>T		Somatic		Capture	Illumina GAIIx	4	128231471		Silent	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.P1622	ENST00000393409.2	37	c.4866	CCDS33847.2	3																																																																																			-	HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP		0.677	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	protein_coding	OTTHUMT00000356451.1	C	NM_032242		128231471	+1	no_errors	NM_032242	genbank	human	validated	54_36p	silent	SNP	0.831	T
ARHGAP39	80728	genome.wustl.edu	37	8	145763178	145763178	+	Intron	SNP	C	C	G			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr8:145763178C>G	ENST00000276826.5	-	6	2723				ARHGAP39_ENST00000377307.2_Missense_Mutation_p.E847D|ARHGAP39_ENST00000540274.1_Intron|ARHGAP39_ENST00000528810.1_5'UTR			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39						axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						TTTCCAGGAGCTCTTTTATGT	0.542																																																0			8											160.0	163.0	162.0					8																	145763178		2203	4300	6503	145733986	SO:0001627	intron_variant	80728				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2522-3592G>C	8.37:g.145763178C>G		Somatic		Capture	Illumina GAIIx	4	145733986	B4E1I1	Missense_Mutation	SNP	HMMSmart_SM00456,HMMPfam_WW,superfamily_WW domain,HMMSmart_SM00139,HMMPfam_MyTH4,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.E847D	ENST00000276826.5	37	c.2541		8	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476024	0.44044	.	.	ENSG00000147799	ENST00000377307	D	0.91521	-2.86	4.95	4.95	0.65309	.	0.632313	0.15696	N	0.249183	D	0.83755	0.5323	L	0.33485	1.01	0.80722	D	1	B	0.22211	0.066	B	0.24006	0.05	T	0.76570	-0.2911	10	0.16420	T	0.52	-16.1984	9.3354	0.38047	0.0:0.902:0.0:0.098	.	847	Q9C0H5-2	.	D	847	ENSP00000366522:E847D	ENSP00000366522:E847D	E	-	3	2	ARHGAP39	145733986	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	0.761000	0.26489	2.297000	0.77311	0.561000	0.74099	GAG	-	HMMPfam_MyTH4		0.542	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	KIAA1688	protein_coding	OTTHUMT00000382509.1	C			145733986	-1	no_errors	NM_025251	genbank	human	validated	54_36p	missense	SNP	1.000	G
FAT2	2196	genome.wustl.edu	37	5	150934013	150934013	+	Silent	SNP	G	G	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr5:150934013G>A	ENST00000261800.5	-	4	3867	c.3855C>T	c.(3853-3855)gaC>gaT	p.D1285D		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1285	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTCATCGCTGTCCTCGATAC	0.552																																																0			5											153.0	130.0	138.0					5																	150934013		2203	4300	6503	150914206	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3855C>T	5.37:g.150934013G>A		Somatic		Capture	Illumina GAIIx	4	150914206	O75091|Q9NSR7	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.D1285	ENST00000261800.5	37	c.3855	CCDS4317.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.552	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	G	NM_001447		150914206	-1	no_errors	NM_001447	genbank	human	reviewed	54_36p	silent	SNP	0.208	A
RPS6KA2	6196	genome.wustl.edu	37	6	167114414	167114414	+	Intron	SNP	C	C	G			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr6:167114414C>G	ENST00000510118.1	-	3	515				RPS6KA2_ENST00000503859.1_Intron			Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2						axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GCATAAAGTACACATTCTCAC	0.458																																																0			6																																								167034404	SO:0001627	intron_variant	645468			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000510118.1:c.174+69936G>C	6.37:g.167114414C>G		Somatic		Capture	Illumina GAIIx	4	167034404	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	RNA	SNP	-	NULL	ENST00000510118.1	37	NULL		6																																																																																			-	-		0.458	RPS6KA2-005	KNOWN	basic	protein_coding	LOC645468	protein_coding	OTTHUMT00000362836.2	C	NM_021135		167034404	-1	pseudogene	XR_017635	genbank	human	model	54_36p	rna	SNP	1.000	G
SH3PXD2B	285590	genome.wustl.edu	37	5	171809099	171809099	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr5:171809099C>A	ENST00000311601.5	-	5	512	c.342G>T	c.(340-342)caG>caT	p.Q114H	SH3PXD2B_ENST00000519643.1_Missense_Mutation_p.Q114H	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	114	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTCATCACACTGAGAGATGT	0.572																																																0			5											31.0	32.0	32.0					5																	171809099		2203	4300	6503	171741704	SO:0001583	missense	285590			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.342G>T	5.37:g.171809099C>A	ENSP00000309714:p.Gln114His	Somatic		Capture	Illumina GAIIx	4	171741704	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	superfamily_PX,HMMPfam_PX,HMMSmart_PX,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.Q114H	ENST00000311601.5	37	c.342	CCDS34291.1	5	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846896	0.71603	.	.	ENSG00000174705	ENST00000519643;ENST00000311601	T;T	0.69306	-0.39;-0.39	5.79	4.03	0.46877	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.75079	0.3801	L	0.49126	1.545	0.58432	D	0.999999	D	0.76494	0.999	D	0.77004	0.989	T	0.74968	-0.3483	10	0.62326	D	0.03	-31.029	10.6653	0.45726	0.0:0.8445:0.0:0.1555	.	114	A1X283	SPD2B_HUMAN	H	114	ENSP00000430890:Q114H;ENSP00000309714:Q114H	ENSP00000309714:Q114H	Q	-	3	2	SH3PXD2B	171741704	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.820000	0.48057	0.802000	0.34089	-0.145000	0.13849	CAG	-	superfamily_PX,HMMPfam_PX,HMMSmart_PX		0.572	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	protein_coding	OTTHUMT00000372449.1	C	NM_017963		171741704	-1	no_errors	NM_001017995	genbank	human	validated	54_36p	missense	SNP	1.000	A
IGFN1	91156	genome.wustl.edu	37	1	201184799	201184799	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr1:201184799G>A	ENST00000335211.4	+	15	9258	c.9128G>A	c.(9127-9129)gGg>gAg	p.G3043E	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_Missense_Mutation_p.G203E	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	586						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						AGGAAGGACGGGGCTGAGGTG	0.647																																																0			1											51.0	45.0	47.0					1																	201184799		2203	4300	6503	199451422	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.9128G>A	1.37:g.201184799G>A	ENSP00000334714:p.Gly3043Glu	Somatic		Capture	Illumina GAIIx	4	199451422	F8WAI1|Q9NT72	Missense_Mutation	SNP	HMMPfam_I-set,superfamily_SSF48726,HMMSmart_IG,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMSmart_IGc2	p.G203E	ENST00000335211.4	37	c.608	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318759	0.60524	.	.	ENSG00000163395	ENST00000335211;ENST00000295591	T;T	0.54479	0.57;0.57	4.83	4.83	0.62350	.	0.238628	0.35407	N	0.003239	T	0.62282	0.2415	L	0.52905	1.665	0.21256	N	0.999746	P	0.49185	0.92	P	0.62560	0.904	T	0.54227	-0.8325	9	.	.	.	.	9.5119	0.39082	0.1482:0.0:0.8518:0.0	.	3043	F8WAI1	.	E	3043;203	ENSP00000334714:G3043E;ENSP00000295591:G203E	.	G	+	2	0	IGFN1	199451422	0.941000	0.31946	0.565000	0.28409	0.161000	0.22273	2.012000	0.40932	2.234000	0.73211	0.561000	0.74099	GGG	-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG		0.647	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	protein_coding		G	NM_178275		199451422	+1	no_errors	NM_178275	genbank	human	validated	54_36p	missense	SNP	0.497	A
NOP58	51602	genome.wustl.edu	37	2	203168125	203168125	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1353-01A-01D-1526-09	TCGA-04-1353-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	65c12882-87e1-445e-9797-9a4998cab3bd	36baba19-f6d1-4939-a5ec-9d3c456c8d9f	g.chr2:203168125A>T	ENST00000264279.5	+	15	1782	c.1556A>T	c.(1555-1557)aAg>aTg	p.K519M		NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	519	Lys-rich.				cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						Gagaaaaagaagaaaaagaaa	0.363																																																0			2											47.0	54.0	52.0					2																	203168125		2195	4296	6491	202876370	SO:0001583	missense	51602				CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.1556A>T	2.37:g.203168125A>T	ENSP00000264279:p.Lys519Met	Somatic		Capture	Illumina GAIIx	4	202876370	Q53SA4|Q6PK08|Q9P036|Q9UFN3	Missense_Mutation	SNP	HMMPfam_NOP5NT,HMMPfam_NOSIC,superfamily_SSF89124,HMMPfam_Nop	p.K519M	ENST00000264279.5	37	c.1556	CCDS2353.1	2	.	.	.	.	.	.	.	.	.	.	A	18.57	3.651699	0.67472	.	.	ENSG00000055044	ENST00000264279	T	0.64618	-0.11	5.39	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.44159	0.1280	N	0.08118	0	0.46542	D	0.999096	D	0.55385	0.971	P	0.46543	0.52	T	0.49670	-0.8915	10	0.87932	D	0	-7.1565	7.7878	0.29101	0.9079:0.0:0.0921:0.0	.	519	Q9Y2X3	NOP58_HUMAN	M	519	ENSP00000264279:K519M	ENSP00000264279:K519M	K	+	2	0	NOP58	202876370	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	3.838000	0.55828	1.072000	0.40860	0.528000	0.53228	AAG	-	NULL		0.363	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP58	protein_coding	OTTHUMT00000256313.2	A	NM_015934		202876370	+1	no_errors	NM_015934	genbank	human	provisional	54_36p	missense	SNP	1.000	T
