#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
IVL	3713	genome.wustl.edu	37	1	152882578	152882578	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr1:152882578A>C	ENST00000368764.3	+	2	369	c.305A>C	c.(304-306)gAa>gCa	p.E102A	IVL_ENST00000392667.2_5'UTR			P07476	INVO_HUMAN	involucrin	102					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.E102A(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGAAAGCAGAAAACCCAGAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	54.0	54.0					1																	152882578		2203	4300	6503	151149202	SO:0001583	missense	3713			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.305A>C	1.37:g.152882578A>C	ENSP00000357753:p.Glu102Ala	Somatic		Capture	Illumina GAIIx	4	151149202	Q5T7P4	Missense_Mutation	SNP	HMMPfam_Involucrin	p.E102A	ENST00000368764.3	37	c.305	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.133963	0.37630	.	.	ENSG00000163207	ENST00000368764	T	0.09817	2.94	4.98	-5.21	0.02815	.	.	.	.	.	T	0.01353	0.0044	N	0.14661	0.345	0.09310	N	0.999999	B	0.26744	0.158	B	0.20767	0.031	T	0.45469	-0.9259	9	0.39692	T	0.17	.	5.0336	0.14423	0.2329:0.1311:0.508:0.128	.	102	P07476	INVO_HUMAN	A	102	ENSP00000357753:E102A	ENSP00000357753:E102A	E	+	2	0	IVL	151149202	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.297000	0.08276	-1.130000	0.02914	0.459000	0.35465	GAA	-	NULL		0.498	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	protein_coding	OTTHUMT00000034664.1	A	NM_005547		151149202	1	no_errors	NM_005547	genbank	human	reviewed	54_36p	missense	SNP		C
CRB1	23418	genome.wustl.edu	37	1	197391053	197391053	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr1:197391053C>T	ENST00000367400.3	+	6	2230	c.2095C>T	c.(2095-2097)Cac>Tac	p.H699Y	CRB1_ENST00000538660.1_Missense_Mutation_p.H699Y|CRB1_ENST00000544212.1_Missense_Mutation_p.H180Y|CRB1_ENST00000367397.1_Missense_Mutation_p.H80Y|CRB1_ENST00000535699.1_Missense_Mutation_p.H630Y|CRB1_ENST00000367399.2_Missense_Mutation_p.H587Y|CRB1_ENST00000543483.1_3'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	699	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H699Y(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GTGTGACTGCCACAGGCCCTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	57.0	56.0					1																	197391053		2202	4300	6502	195657676	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2095C>T	1.37:g.197391053C>T	ENSP00000356370:p.His699Tyr	Somatic		Capture	Illumina GAIIx	4	195657676	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_EGF/Laminin	p.H699Y	ENST00000367400.3	37	c.2095	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.877311	0.00537	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.65	-4.33	0.03677	Concanavalin A-like lectin/glucanase, subgroup (1);EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.44159	0.1280	N	0.11560	0.145	0.21416	N	0.999697	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.0;0.002;0.0;0.001	T	0.42699	-0.9436	9	0.02654	T	1	.	6.4451	0.21871	0.0:0.3169:0.2862:0.3969	.	699;630;587;348;699	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	Y	630;699;699;587;180;80;348	ENSP00000438786:H630Y;ENSP00000438091:H699Y;ENSP00000356370:H699Y;ENSP00000356369:H587Y;ENSP00000444556:H180Y;ENSP00000356367:H80Y	ENSP00000356367:H80Y	H	+	1	0	CRB1	195657676	1.000000	0.71417	0.300000	0.25030	0.020000	0.10135	1.094000	0.30951	-1.131000	0.02910	-0.859000	0.03014	CAC	-	HMMPfam_EGF		0.522	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	C	NM_201253		195657676	1	no_errors	NM_201253	genbank	human	reviewed	54_36p	missense	SNP	1	T
RBBP4	5928	genome.wustl.edu	37	1	33123108	33123108	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr1:33123108C>A	ENST00000373493.5	+	3	404	c.245C>A	c.(244-246)gCc>gAc	p.A82D	RBBP4_ENST00000458695.2_Missense_Mutation_p.A47D|RBBP4_ENST00000524393.1_Intron|RBBP4_ENST00000373485.1_Missense_Mutation_p.A82D|RBBP4_ENST00000544435.1_Intron|RBBP4_ENST00000414241.3_Missense_Mutation_p.A81D	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4	82					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)	p.A82D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CTTGTTATAGCCAGTGTGCAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	105.0	112.0					1																	33123108		2203	4300	6503	32895695	SO:0001583	missense	5928			BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.245C>A	1.37:g.33123108C>A	ENSP00000362592:p.Ala82Asp	Somatic		Capture	Illumina GAIIx	4	32895695	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Missense_Mutation	SNP	-	p.A82D	ENST00000373493.5	37	c.245	CCDS366.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.265493	0.95399	.	.	ENSG00000162521	ENST00000414241;ENST00000373493;ENST00000373485;ENST00000458695;ENST00000490500;ENST00000445722	T;T;T;T	0.71934	-0.58;-0.61;-0.5;-0.56	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.88865	0.6553	H	0.96943	3.91	0.80722	D	1	D;P	0.56035	0.974;0.955	P;P	0.61592	0.644;0.891	D	0.92463	0.5979	10	0.87932	D	0	.	18.1598	0.89705	0.0:1.0:0.0:0.0	.	81;82	Q09028-2;Q09028	.;RBBP4_HUMAN	D	81;82;82;47;47;47	ENSP00000398242:A81D;ENSP00000362592:A82D;ENSP00000362584:A82D;ENSP00000396057:A47D	ENSP00000362584:A82D	A	+	2	0	RBBP4	32895695	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.692000	0.84203	2.607000	0.88179	0.561000	0.74099	GCC	-	NULL		0.433	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBBP4	protein_coding	OTTHUMT00000021957.3	C	NM_005610		32895695	1	no_errors	NM_005610	genbank	human	reviewed	54_36p	missense	SNP	1	A
FAM183A	440585	genome.wustl.edu	37	1	43616454	43616454	+	Silent	SNP	C	C	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr1:43616454C>G	ENST00000335282.4	+	2	156	c.156C>G	c.(154-156)ccC>ccG	p.P52P	FAM183A_ENST00000410048.1_Silent_p.P24P|FAM183A_ENST00000409337.1_3'UTR	NM_001101376.2	NP_001094846.2	A6NL82	F183A_HUMAN	family with sequence similarity 183, member A	52								p.P52P(3)		kidney(1)|large_intestine(1)|lung(2)|ovary(3)	7						CCAGGAAGCCCATGTCTTGGC	0.468																																																3	Substitution - coding silent(3)	lung(2)|ovary(1)	1											87.0	79.0	81.0					1																	43616454		1891	4118	6009	43389041	SO:0001819	synonymous_variant	440585			AI192630, AI375550, AL139138	CCDS44126.1	1p34.2	2008-08-11			ENSG00000186973	ENSG00000186973			34347	protein-coding gene	gene with protein product						11181995	Standard	NM_001101376		Approved	LOC440585, hCG23177	uc009vwo.3	A6NL82	OTTHUMG00000007286	ENST00000335282.4:c.156C>G	1.37:g.43616454C>G		Somatic		Capture	Illumina GAIIx	Phase_III	43389041	B7ZBL8	Silent	SNP	-	p.P52	ENST00000335282.4	37	c.156	CCDS44126.1	1																																																																																			-	NULL		0.468	FAM183A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM183A	protein_coding	OTTHUMT00000019024.3	C	NM_001101376		43389041	1	no_errors	NM_001101376	genbank	human	validated	54_36p	silent	SNP	1	G
SYDE2	84144	genome.wustl.edu	37	1	85655917	85655917	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr1:85655917A>C	ENST00000341460.5	-	2	1313	c.1264T>G	c.(1264-1266)Tca>Gca	p.S422A		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	422					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.S344A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		GAGCACAGTGAGTCTTCAGTA	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											167.0	157.0	160.0					1																	85655917		2025	4189	6214	85428505	SO:0001583	missense	84144			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1264T>G	1.37:g.85655917A>C	ENSP00000340594:p.Ser422Ala	Somatic		Capture	Illumina GAIIx	4	85428505	Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	-	p.S422A	ENST00000341460.5	37	c.1264	CCDS44169.1	1	.	.	.	.	.	.	.	.	.	.	A	4.198	0.035398	0.08148	.	.	ENSG00000097096	ENST00000341460	T	0.06218	3.33	5.96	-3.43	0.04810	.	3.104450	0.00982	N	0.003387	T	0.01765	0.0056	L	0.44542	1.39	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.45977	-0.9224	10	0.23302	T	0.38	.	7.2307	0.26040	0.2652:0.2619:0.4729:0.0	.	422;422	Q5VT97;Q5VT97-2	SYDE2_HUMAN;.	A	422	ENSP00000340594:S422A	ENSP00000340594:S422A	S	-	1	0	SYDE2	85428505	0.000000	0.05858	0.017000	0.16124	0.002000	0.02628	-0.713000	0.05007	-0.345000	0.08325	-1.136000	0.01936	TCA	-	NULL		0.483	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE2	protein_coding	OTTHUMT00000127989.2	A			85428505	-1	no_errors	NM_032184	genbank	human	validated	54_36p	missense	SNP	0.27	C
ETNK2	55224	genome.wustl.edu	37	1	204116636	204116636	+	Intron	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr1:204116636G>T	ENST00000367202.4	-	3	669				ETNK2_ENST00000367199.2_Intron|ETNK2_ENST00000367198.2_5'Flank|ETNK2_ENST00000367201.3_Intron	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2						glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CCGAGGCCCTGTGTCCCAGCT	0.587																																																0			1											110.0	114.0	113.0					1																	204116636		876	1991	2867	202383259	SO:0001627	intron_variant	55224			AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.519-744C>A	1.37:g.204116636G>T		Somatic		Capture	Illumina GAIIx	4	202383259	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	-	p.T23K	ENST00000367202.4	37	c.68	CCDS1442.2	1	.	.	.	.	.	.	.	.	.	.	G	8.176	0.792673	0.16258	.	.	ENSG00000143845	ENST00000455266;ENST00000422699	T	0.55588	0.51	4.41	-2.47	0.06442	.	.	.	.	.	T	0.36853	0.0982	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.33574	-0.9863	6	0.44086	T	0.13	.	1.0171	0.01509	0.3755:0.1501:0.3207:0.1537	.	.	.	.	K	23	ENSP00000405497:T23K	ENSP00000405497:T23K	T	-	2	0	ETNK2	202383259	0.000000	0.05858	0.000000	0.03702	0.488000	0.33401	0.046000	0.14035	-0.737000	0.04824	-0.145000	0.13849	ACA	-	NULL		0.587	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK2	protein_coding	OTTHUMT00000087893.1	G	NM_018208		202383259	-1	no_start_codon	ENST00000367198	ensembl	human	known	54_36p	missense	SNP		T
CHUK	1147	genome.wustl.edu	37	10	101978483	101978483	+	Silent	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr10:101978483G>A	ENST00000370397.7	-	8	875	c.789C>T	c.(787-789)agC>agT	p.S263S		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)	p.S263S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	ACCTACAAAGGCTATTTGGTT	0.388																																					Ovarian(159;52 1904 10536 35305 37148)											1	Substitution - coding silent(1)	ovary(1)	10											111.0	107.0	108.0					10																	101978483		2203	4300	6503	101968473	SO:0001819	synonymous_variant	1147			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.789C>T	10.37:g.101978483G>A		Somatic		Capture	Illumina GAIIx	4	101968473	O14666|Q13132|Q5W0I4|Q92467	Silent	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);superfamily_Purine and uridine phosphorylases	p.S263	ENST00000370397.7	37	c.789	CCDS7488.1	10																																																																																			-	NULL		0.388	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	protein_coding	OTTHUMT00000049836.1	G	NM_001278		101968473	-1	no_errors	NM_001278	genbank	human	reviewed	54_36p	silent	SNP	1	A
IGHV1-18	28468	genome.wustl.edu	37	14	106641705	106641705	+	RNA	SNP	A	A	T	rs370565499		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr14:106641705A>T	ENST00000390605.2	-	0	267									immunoglobulin heavy variable 1-18																		GTAAGCGCTGATCCATCCCAT	0.542																																																0			14						A		0,4142		0,0,2071	205.0	197.0	199.0			1.3	0.0	14		199	1,8427		0,1,4213	no	intergenic				0,1,6284	TT,TA,AA		0.0119,0.0,0.0080			106641705	1,12569	2071	4214	6285	105712750			0			M99641		14q32.33	2012-02-08			ENSG00000211945	ENSG00000211945		"""Immunoglobulins / IGH locus"""	5549	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152276		14.37:g.106641705A>T		Somatic		Capture	Illumina GAIIx	4	105712750		Missense_Mutation	SNP	-	p.I70N	ENST00000390605.2	37	c.209		14																																																																																			-	NULL		0.542	IGHV1-18-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211945	IG_V_gene	OTTHUMT00000325664.1	A	NG_001019		105712750	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390605	ensembl	human	known	54_36p	missense	SNP		T
CARS	833	genome.wustl.edu	37	11	3048008	3048008	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:3048008C>G	ENST00000397111.5	-	9	1047	c.802G>C	c.(802-804)Gtc>Ctc	p.V268L	CARS-AS1_ENST00000499962.1_RNA|CARS_ENST00000397114.3_Missense_Mutation_p.V258L|CARS_ENST00000401769.3_Missense_Mutation_p.V281L|CARS_ENST00000380525.4_Missense_Mutation_p.V351L|CARS_ENST00000278224.9_Missense_Mutation_p.V268L			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	268					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.V268L(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	TCAAAGTAGACAGACCCATTG	0.478			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	1	Substitution - Missense(1)	ovary(1)	11											102.0	99.0	100.0					11																	3048008		2202	4298	6500	3004584	SO:0001583	missense	833			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.802G>C	11.37:g.3048008C>G	ENSP00000380300:p.Val268Leu	Somatic		Capture	Illumina GAIIx	4	3004584	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases;superfamily_Glutathione S-transferase (GST) C-terminal domain;HMMPfam_tRNA-synt_1e;superfamily_Nucleotidylyl transferase	p.V351L	ENST00000397111.5	37	c.1051	CCDS7742.1	11	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456125	0.63401	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.61040	0.14;0.18;0.17;0.17;0.15	4.48	4.48	0.54585	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.79953	0.4535	M	0.88241	2.94	0.80722	D	1	D;D;D;D;D;D	0.71674	0.998;0.996;0.989;0.993;0.998;0.989	D;D;D;P;D;D	0.78314	0.991;0.988;0.936;0.894;0.987;0.936	D	0.84913	0.0849	10	0.87932	D	0	-27.8103	17.3559	0.87335	0.0:1.0:0.0:0.0	.	281;351;268;268;351;258	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	L	351;268;268;258;281	ENSP00000369897:V351L;ENSP00000380300:V268L;ENSP00000278224:V268L;ENSP00000380303:V258L;ENSP00000384069:V281L	ENSP00000278224:V268L	V	-	1	0	CARS	3004584	1.000000	0.71417	0.998000	0.56505	0.123000	0.20343	7.189000	0.77747	2.315000	0.78130	0.655000	0.94253	GTC	-	HMMPfam_tRNA-synt_1e		0.478	CARS-001	KNOWN	basic|CCDS	protein_coding	CARS	protein_coding	OTTHUMT00000030117.4	C	NM_001751		3004584	-1	no_errors	NM_001014437	genbank	human	reviewed	54_36p	missense	SNP	1	G
Unknown	0	genome.wustl.edu	37	11	20596274	20596275	+	IGR	DNP	GG	GG	TC			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	GG	GG	TC	TC	GG	GG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:20596274_20596275GG>TC								PRMT3 (65475 upstream) : SLC6A5 (24670 downstream)																							CTCTGAGTATGGCCCAAAAATC	0.495																																																0			11																																								20552851	SO:0001628	intergenic_variant	645490																															11.37:g.20596274_20596275delinsTC		Somatic		Capture	Illumina GAIIx	4	20552850		Missense_Mutation	DNP	-	p.G109S		37	c.325_326		11																																																																																			-	NULL	0	0.495					LOC645490			GG			20552851	1	no_errors	XM_928515	genbank	human	model	54_36p	missense	DNP	1.000:1.000	TC
OR5I1	10798	genome.wustl.edu	37	11	55703285	55703285	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:55703285C>T	ENST00000301532.3	-	1	591	c.592G>A	c.(592-594)Gag>Aag	p.E198K		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	198					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E198K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						AGGAGCCACTCATTAATTGTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	11											46.0	51.0	50.0					11																	55703285		2200	4294	6494	55459861	SO:0001583	missense	10798			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.592G>A	11.37:g.55703285C>T	ENSP00000301532:p.Glu198Lys	Somatic		Capture	Illumina GAIIx	4	55459861	Q6IEU4	Missense_Mutation	SNP	-	p.E198K	ENST00000301532.3	37	c.592	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	C	14.72	2.618481	0.46736	.	.	ENSG00000167825	ENST00000301532	T	0.00207	8.55	5.16	4.24	0.50183	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000215	T	0.00384	0.0012	L	0.45228	1.405	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.59247	-0.7490	10	0.46703	T	0.11	.	12.4122	0.55473	0.0:0.6747:0.3253:0.0	.	198	Q13606	OR5I1_HUMAN	K	198	ENSP00000301532:E198K	ENSP00000301532:E198K	E	-	1	0	OR5I1	55459861	0.093000	0.21703	0.960000	0.40013	0.715000	0.41141	1.143000	0.31553	1.275000	0.44379	-0.189000	0.12847	GAG	-	NULL		0.378	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	protein_coding	OTTHUMT00000391528.1	C	NM_006637		55459861	-1	no_errors	NM_006637	genbank	human	reviewed	54_36p	missense	SNP	0.8	T
PC	5091	genome.wustl.edu	37	11	66618550	66618550	+	Silent	SNP	T	T	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:66618550T>C	ENST00000393958.2	-	16	2277	c.2184A>G	c.(2182-2184)gaA>gaG	p.E728E	PC_ENST00000529047.1_5'Flank|PC_ENST00000528224.1_5'Flank|PC_ENST00000393960.1_Silent_p.E728E|PC_ENST00000393955.2_Silent_p.E728E	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	728	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)	p.E728E(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCACCAGCTCTTCGGCCAAGC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	11											58.0	54.0	55.0					11																	66618550		2200	4295	6495	66375126	SO:0001819	synonymous_variant	5091			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2184A>G	11.37:g.66618550T>C		Somatic		Capture	Illumina GAIIx	4	66375126	B4DN00|Q16705	Silent	SNP	HMMPfam_HMGL-like,HMMPfam_PYC_OADA,HMMPfam_CPSase_L_D2,HMMPfam_CPSase_L_chain,HMMPfam_Biotin_carb_C,superfamily_Single hybrid motif,superfamily_Rudiment single hybrid motif,superfamily_Aldolase,superfamily_PreATP-grasp domain,superfamily_Glutathione synthetase ATP-binding domain-like,superfamily_post-HMGL domain-like,HMMPfam_Biotin_lipoyl	p.E728	ENST00000393958.2	37	c.2184	CCDS8152.1	11																																																																																			-	HMMPfam_HMGL-like		0.662	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	protein_coding	OTTHUMT00000393115.1	T	NM_001040716		66375126	-1	no_errors	NM_000920	genbank	human	reviewed	54_36p	silent	SNP	0.811	C
PDE2A	5138	genome.wustl.edu	37	11	72300239	72300239	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:72300239G>T	ENST00000334456.5	-	12	1164	c.919C>A	c.(919-921)Cag>Aag	p.Q307K	PDE2A_ENST00000418754.2_Missense_Mutation_p.Q192K|RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000444035.2_Missense_Mutation_p.Q298K|PDE2A_ENST00000540345.1_Missense_Mutation_p.Q298K|PDE2A_ENST00000544570.1_Missense_Mutation_p.Q300K|PDE2A_ENST00000376450.3_Intron	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	307	GAF 1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.Q307K(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	TCCTTCAGCTGGATGGACTTC	0.602																																																1	Substitution - Missense(1)	ovary(1)	11											87.0	67.0	74.0					11																	72300239		2200	4293	6493	71977887	SO:0001583	missense	5138			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.919C>A	11.37:g.72300239G>T	ENSP00000334910:p.Gln307Lys	Somatic		Capture	Illumina GAIIx	4	71977887	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	HMMPfam_PDEase_I,HMMPfam_GAF,superfamily_HD-domain/PDEase-like,superfamily_GAF domain-like	p.Q307K	ENST00000334456.5	37	c.919	CCDS8216.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.16|16.16	3.044087|3.044087	0.55110|0.55110	.|.	.|.	ENSG00000186642|ENSG00000186642	ENST00000538299|ENST00000334456;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000475807	.|T;T;T;T;T;T	.|0.69040	.|-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.46|5.46	4.48|4.48	0.54585|0.54585	.|GAF (2);	.|2.775740	.|0.01043	.|N	.|0.004323	T|T	0.57873|0.57873	0.2083|0.2083	N|N	0.22421|0.22421	0.69|0.69	0.31327|0.31327	N|N	0.685269|0.685269	.|B;B;B;B;B	.|0.18166	.|0.026;0.007;0.004;0.006;0.016	.|B;B;B;B;B	.|0.15052	.|0.006;0.012;0.003;0.005;0.005	T|T	0.46133|0.46133	-0.9213|-0.9213	5|10	.|0.46703	.|T	.|0.11	.|.	10.0534|10.0534	0.42230|0.42230	0.0:0.0:0.7098:0.2902|0.0:0.0:0.7098:0.2902	.|.	.|192;307;298;300;307	.|E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646	.|.;PDE2A_HUMAN;.;.;.	Q|K	68|307;298;376;300;192;298;131	.|ENSP00000334910:Q307K;ENSP00000411657:Q298K;ENSP00000442256:Q300K;ENSP00000410310:Q192K;ENSP00000446399:Q298K;ENSP00000439077:Q131K	.|ENSP00000334910:Q307K	P|Q	-|-	2|1	0|0	PDE2A|PDE2A	71977887|71977887	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.371000|3.371000	0.52379|0.52379	2.562000|2.562000	0.86427|0.86427	0.491000|0.491000	0.48974|0.48974	CCA|CAG	-	HMMPfam_GAF		0.602	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE2A	protein_coding	OTTHUMT00000219839.2	G	NM_002599		71977887	-1	no_errors	NM_002599	genbank	human	validated	54_36p	missense	SNP	1	T
HEPHL1	341208	genome.wustl.edu	37	11	93839282	93839282	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:93839282A>T	ENST00000315765.9	+	17	3039	c.3031A>T	c.(3031-3033)Agc>Tgc	p.S1011C		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	1011	Plastocyanin-like 6.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.S1015G(1)|p.S1015C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TCATGCTGAGAGCTTTCTTTT	0.363																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	11											131.0	129.0	130.0					11																	93839282		1880	4113	5993	93478930	SO:0001583	missense	341208			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.3031A>T	11.37:g.93839282A>T	ENSP00000313699:p.Ser1011Cys	Somatic		Capture	Illumina GAIIx	4	93478930	Q3C1W7	Missense_Mutation	SNP	-	p.S1011C	ENST00000315765.9	37	c.3031	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	A	19.76	3.888115	0.72524	.	.	ENSG00000181333	ENST00000315765	D	0.99709	-6.48	5.95	4.81	0.61882	Cupredoxin (2);Multicopper oxidase, type 2 (1);	0.079544	0.85682	D	0.000000	D	0.99722	0.9892	M	0.92169	3.28	0.37087	D	0.899275	D	0.89917	1.0	D	0.81914	0.995	D	0.97717	1.0194	10	0.62326	D	0.03	-15.9233	12.3335	0.55054	0.9331:0.0:0.0669:0.0	.	1011	Q6MZM0	HPHL1_HUMAN	C	1011	ENSP00000313699:S1011C	ENSP00000313699:S1011C	S	+	1	0	HEPHL1	93478930	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.949000	0.75971	2.279000	0.76181	0.533000	0.62120	AGC	-	NULL		0.363	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	A	XM_291947		93478930	1	no_errors	NM_001098672	genbank	human	validated	54_36p	missense	SNP	1	T
C11orf63	79864	genome.wustl.edu	37	11	122774724	122774724	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr11:122774724G>C	ENST00000531316.1	+	2	528	c.436G>C	c.(436-438)Gcg>Ccg	p.A146P	C11orf63_ENST00000227349.2_Missense_Mutation_p.A146P|C11orf63_ENST00000307257.6_Missense_Mutation_p.A146P			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	146					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.A146P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GTCTGTGGAAGCGTTGCCGGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	114.0	110.0					11																	122774724		2202	4299	6501	122279934	SO:0001583	missense	79864			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.436G>C	11.37:g.122774724G>C	ENSP00000431669:p.Ala146Pro	Somatic		Capture	Illumina GAIIx	4	122279934	A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	-	p.A146P	ENST00000531316.1	37	c.436	CCDS8438.1	11	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831563	0.50845	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.47177	0.85;0.85	5.83	2.61	0.31194	.	0.595915	0.16983	N	0.191630	T	0.54447	0.1859	M	0.63428	1.95	0.09310	N	1	D;D	0.57571	0.98;0.98	P;P	0.58331	0.837;0.837	T	0.43261	-0.9402	10	0.62326	D	0.03	-2.1762	4.5203	0.11956	0.336:0.0:0.5101:0.1538	.	146;146	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	P	146	ENSP00000227349:A146P;ENSP00000431669:A146P	ENSP00000227349:A146P	A	+	1	0	C11orf63	122279934	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	0.546000	0.23284	0.812000	0.34326	-0.150000	0.13652	GCG	-	NULL		0.532	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	protein_coding	OTTHUMT00000387511.1	G	NM_024806		122279934	1	no_errors	NM_024806	genbank	human	validated	54_36p	missense	SNP	0.01	C
PZP	5858	genome.wustl.edu	37	12	9355158	9355158	+	Silent	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr12:9355158G>A	ENST00000261336.2	-	3	418	c.390C>T	c.(388-390)gtC>gtT	p.V130V	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	130					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V130V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TGTCTGTCTGGACAAAGACCA	0.488																																					Melanoma(125;1402 1695 4685 34487 38571)											1	Substitution - coding silent(1)	ovary(1)	12											145.0	142.0	143.0					12																	9355158		2203	4300	6503	9246425	SO:0001819	synonymous_variant	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.390C>T	12.37:g.9355158G>A		Somatic		Capture	Illumina GAIIx	4	9246425	A6ND27|Q15273|Q2NKL2|Q7M4N7	Silent	SNP	HMMPfam_A2M;HMMPfam_A2M_N;superfamily_Terpenoid cyclases/Protein prenyltransferases;superfamily_Invasin/intimin cell-adhesion fragments;HMMPfam_A2M_recep;superfamily_Alpha-macroglobulin receptor domain;HMMPfam_A2M_N_2;HMMPfam_A2M_comp	p.V130	ENST00000261336.2	37	c.390	CCDS8600.1	12																																																																																			-	HMMPfam_A2M_N		0.488	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	protein_coding	OTTHUMT00000337624.1	G	NM_002864		9246425	-1	no_errors	NM_002864	genbank	human	validated	54_36p	silent	SNP	1	A
LRRIQ1	84125	genome.wustl.edu	37	12	85466872	85466872	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr12:85466872G>C	ENST00000393217.2	+	11	2944	c.2883G>C	c.(2881-2883)tgG>tgC	p.W961C		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	961								p.W961C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		ACTTATACTGGAATTGTAAGt	0.368																																																1	Substitution - Missense(1)	ovary(1)	12											66.0	65.0	65.0					12																	85466872		2203	4300	6503	83991003	SO:0001583	missense	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2883G>C	12.37:g.85466872G>C	ENSP00000376910:p.Trp961Cys	Somatic		Capture	Illumina GAIIx	4	83991003	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	-	p.W961C	ENST00000393217.2	37	c.2883	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	G	3.722	-0.057293	0.07317	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.24350	1.86	3.49	0.0793	0.14415	.	1.655260	0.03643	U	0.239845	T	0.28797	0.0714	L	0.29908	0.895	0.09310	N	1	D;D	0.62365	0.983;0.991	P;P	0.52881	0.57;0.712	T	0.18085	-1.0348	10	0.62326	D	0.03	.	5.6148	0.17426	0.4829:0.0:0.5171:0.0	.	961;936	Q96JM4;C9JI57	LRIQ1_HUMAN;.	C	961;936;961	ENSP00000376910:W961C	ENSP00000256007:W961C	W	+	3	0	LRRIQ1	83991003	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	-0.438000	0.06905	-0.071000	0.12886	0.655000	0.94253	TGG	-	NULL		0.368	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	protein_coding	OTTHUMT00000388249.2	G	NM_032165		83991003	1	no_errors	NM_001079910	genbank	human	validated	54_36p	missense	SNP	0.01	C
ACAD10	80724	genome.wustl.edu	37	12	112187149	112187149	+	Splice_Site	SNP	C	C	T	rs144749824	byFrequency	TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr12:112187149C>T	ENST00000313698.4	+	18	2972	c.2817C>T	c.(2815-2817)cgC>cgT	p.R939R	ACAD10_ENST00000455480.2_Splice_Site_p.R970R	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	939						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.R939R(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TGAAGGCCCGCGTGAGTGCTT	0.592													C|||	6	0.00119808	0.0045	0.0	5008	,	,		19576	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						C	,	13,4393	20.2+/-43.8	0,13,2190	38.0	37.0	37.0		2910,2817	-9.4	0.1	12	dbSNP_134	37	0,8600		0,0,4300	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	ACAD10	NM_001136538.1,NM_025247.5	,	0,13,6490	TT,TC,CC		0.0,0.2951,0.1	,	970/1091,939/1060	112187149	13,12993	2203	4300	6503	110671532	SO:0001630	splice_region_variant	80724			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2817+1C>T	12.37:g.112187149C>T		Somatic		Capture	Illumina GAIIx	4	110671532	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Silent	SNP	-	p.R939	ENST00000313698.4	37	c.2817	CCDS31903.1	12																																																																																			-	NULL		0.592	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	protein_coding	OTTHUMT00000368307.1	C	NM_025247	Silent	110671532	1	no_errors	NM_025247	genbank	human	reviewed	54_36p	silent	SNP	0.51	T
DIAPH3	81624	genome.wustl.edu	37	13	60413502	60413502	+	Missense_Mutation	SNP	G	G	A	rs201024887		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr13:60413502G>A	ENST00000400324.4	-	23	3038	c.2818C>T	c.(2818-2820)Ccc>Tcc	p.P940S	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400320.1_Missense_Mutation_p.P894S|DIAPH3_ENST00000377908.2_Missense_Mutation_p.P929S|DIAPH3_ENST00000400319.1_Missense_Mutation_p.P870S|DIAPH3_ENST00000267215.4_Missense_Mutation_p.P940S|DIAPH3_ENST00000400330.1_Missense_Mutation_p.P940S	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	940	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P940S(1)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TCAGGAGGGGGAAAGGTTTCC	0.383																																																1	Substitution - Missense(1)	ovary(1)	13											87.0	82.0	84.0					13																	60413502		1863	4095	5958	59311503	SO:0001583	missense	81624			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2818C>T	13.37:g.60413502G>A	ENSP00000383178:p.Pro940Ser	Somatic		Capture	Illumina GAIIx	4	59311503	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	-	p.P940S	ENST00000400324.4	37	c.2818	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648087	0.47258	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	4.8	4.8	0.61643	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.246709	0.42294	D	0.000731	T	0.16300	0.0392	L	0.48218	1.51	0.39162	D	0.962434	B;P	0.44309	0.266;0.832	B;B	0.33254	0.132;0.16	T	0.10132	-1.0643	10	0.56958	D	0.05	.	18.2703	0.90066	0.0:0.0:1.0:0.0	.	677;940	Q9NSV4-1;Q9NSV4	.;DIAP3_HUMAN	S	940;940;929;894;870;929;870;894;940;677;940	ENSP00000383178:P940S;ENSP00000383184:P940S;ENSP00000367141:P929S;ENSP00000383173:P870S;ENSP00000383174:P894S;ENSP00000267215:P940S	ENSP00000267214:P677S	P	-	1	0	DIAPH3	59311503	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.589000	0.61006	2.400000	0.81607	0.586000	0.80456	CCC	-	NULL		0.383	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	protein_coding	OTTHUMT00000045166.3	G	NM_001042517		59311503	-1	no_errors	NM_001042517	genbank	human	validated	54_36p	missense	SNP	1	A
TDP1	55775	genome.wustl.edu	37	14	90429796	90429799	+	Frame_Shift_Del	DEL	AGAA	AGAA	-			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	AGAA	AGAA	AGAA	-	AGAA	AGAA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr14:90429796_90429799delAGAA	ENST00000335725.4	+	3	588_591	c.338_341delAGAA	c.(337-342)gagaaafs	p.EK113fs	TDP1_ENST00000555880.1_Frame_Shift_Del_p.EK113fs|TDP1_ENST00000393454.2_Frame_Shift_Del_p.EK113fs|TDP1_ENST00000555565.1_Intron|TDP1_ENST00000393452.3_Frame_Shift_Del_p.EK113fs|TDP1_ENST00000357382.3_5'UTR	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	113					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)	p.K114fs*98(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		ATCAAAAAGGAGAAAGACATCTCT	0.539								Repair of DNA-protein crosslinks																																								1	Deletion - Frameshift(1)	ovary(1)	14																																								89499552	SO:0001589	frameshift_variant	55775			AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.338_341delAGAA	14.37:g.90429796_90429799delAGAA	ENSP00000337353:p.Glu113fs	Somatic		Capture	Illumina GAIIx	Phase_III	89499549	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Frame_Shift_Del	DEL	HMMPfam_Tyr-DNA_phospho,superfamily_Phospholipase D/nuclease	p.K114fs	ENST00000335725.4	37	c.338_341	CCDS9888.1	14																																																																																			(deletion:cds_exon[89499212,89499770])	NULL		0.539	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDP1	protein_coding	OTTHUMT00000411239.1	AGAA	NM_018319		89499552	1	no_errors	NM_001008744	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.643:0.282:0.061:0.048	-
MIR513A1	574509	genome.wustl.edu	37	X	146295092	146295092	+	RNA	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:146295092G>T	ENST00000385138.1	-	0	17					NR_030231.1				microRNA 513a-1																		tacgctgaatggctgaatgtg	0.428																																																0			X											122.0	96.0	104.0					X																	146295092		1568	3582	5150	146102784			574509					Xq27.3	2011-09-12	2008-01-07	2008-12-18	ENSG00000207873	ENSG00000207873		"""ncRNAs / Micro RNAs"""	32141	non-coding RNA	RNA, micro			"""microRNA 513-1"""	MIRN513-1, MIRN513A1			Standard	NR_030231		Approved	hsa-mir-513-1, hsa-mir-513a-1					X.37:g.146295092G>T		Somatic		Capture	Illumina GAIIx	4	146102784		RNA	SNP	-	NULL	ENST00000385138.1	37	NULL		X																																																																																			-	-		0.428	MIR513A1-201	KNOWN	basic	miRNA	MIRN513A1	miRNA		G	NR_030231		146102784	-1	no_errors	ENST00000385138	ensembl	human	known	54_36p	rna	SNP	0.3	T
RTF1	23168	genome.wustl.edu	37	15	41772484	41772484	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr15:41772484G>C	ENST00000389629.4	+	17	1999	c.1987G>C	c.(1987-1989)Gat>Cat	p.D663H		NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	663					DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)	p.D538H(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		CAAAGTACACGATTTTGATGT	0.463																																																1	Substitution - Missense(1)	ovary(1)	15											94.0	85.0	88.0					15																	41772484		2203	4300	6503	39559776	SO:0001583	missense	23168			D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.1987G>C	15.37:g.41772484G>C	ENSP00000374280:p.Asp663His	Somatic		Capture	Illumina GAIIx	4	39559776	Q96BX6	Missense_Mutation	SNP	HMMPfam_Plus-3	p.D538H	ENST00000389629.4	37	c.1612	CCDS32200.2	15	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892746	0.91889	.	.	ENSG00000137815	ENST00000389629	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.77844	0.4191	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.80037	-0.1550	9	0.72032	D	0.01	-18.1576	18.6447	0.91407	0.0:0.0:1.0:0.0	.	663	Q92541	RTF1_HUMAN	H	663	.	ENSP00000374280:D663H	D	+	1	0	RTF1	39559776	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.624000	0.98398	2.392000	0.81423	0.563000	0.77884	GAT	-	NULL		0.463	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTF1	protein_coding	OTTHUMT00000258111.1	G	NM_015138		39559776	1	no_errors	NM_015138	genbank	human	validated	54_36p	missense	SNP	1	C
SLC28A2	9153	genome.wustl.edu	37	15	45554233	45554233	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr15:45554233G>A	ENST00000347644.3	+	4	256	c.191G>A	c.(190-192)aGc>aAc	p.S64N	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	64					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)	p.S64N(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	TGGCCTTTCAGCAAAGCAAGA	0.403																																					NSCLC(92;493 1501 26361 28917 47116)											1	Substitution - Missense(1)	ovary(1)	15											179.0	166.0	170.0					15																	45554233		2198	4298	6496	43341525	SO:0001583	missense	9153			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.191G>A	15.37:g.45554233G>A	ENSP00000315006:p.Ser64Asn	Somatic		Capture	Illumina GAIIx	4	43341525	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	-	p.S64N	ENST00000347644.3	37	c.191	CCDS10121.1	15	.	.	.	.	.	.	.	.	.	.	G	3.324	-0.138126	0.06669	.	.	ENSG00000137860	ENST00000347644	D	0.82255	-1.59	5.64	-3.52	0.04682	.	1.424290	0.04030	N	0.301229	T	0.63522	0.2518	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47446	-0.9117	10	0.17832	T	0.49	0.1026	2.0307	0.03529	0.1245:0.3423:0.1265:0.4067	.	64	O43868	S28A2_HUMAN	N	64	ENSP00000315006:S64N	ENSP00000315006:S64N	S	+	2	0	SLC28A2	43341525	0.000000	0.05858	0.007000	0.13788	0.393000	0.30537	-1.282000	0.02799	-0.393000	0.07739	-0.565000	0.04167	AGC	-	NULL		0.403	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A2	protein_coding	OTTHUMT00000254219.2	G	NM_004212		43341525	1	no_errors	NM_004212	genbank	human	provisional	54_36p	missense	SNP	0.02	A
HERC1	8925	genome.wustl.edu	37	15	63952072	63952072	+	Nonsense_Mutation	SNP	A	A	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr15:63952072A>C	ENST00000443617.2	-	47	9374	c.9287T>G	c.(9286-9288)tTa>tGa	p.L3096*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3096					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L3096*(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCCAGCAAGTAATTCAAATTC	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	15											77.0	72.0	74.0					15																	63952072		1886	4114	6000	61739125	SO:0001587	stop_gained	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.9287T>G	15.37:g.63952072A>C	ENSP00000390158:p.Leu3096*	Somatic		Capture	Illumina GAIIx	4	61739125	Q8IW65	Nonsense_Mutation	SNP	HMMPfam_RCC1;HMMPfam_HECT;HMMPfam_WD40;HMMPfam_SPRY;superfamily_RCC1/BLIP-II;superfamily_WD40 repeat-like;superfamily_Hect E3 ligase catalytic domain	p.L3096*	ENST00000443617.2	37	c.9287	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	A	51	18.077609	0.99899	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	15.8865	0.79255	1.0:0.0:0.0:0.0	.	.	.	.	X	3096	.	ENSP00000390158:L3096X	L	-	2	0	HERC1	61739125	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.075000	0.94004	2.143000	0.66587	0.528000	0.53228	TTA	-	NULL		0.408	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	protein_coding	OTTHUMT00000418523.1	A	NM_003922		61739125	-1	no_errors	NM_003922	genbank	human	reviewed	54_36p	nonsense	SNP	1	C
SEC11A	23478	genome.wustl.edu	37	15	85213257	85213257	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr15:85213257C>T	ENST00000268220.7	-	6	1173	c.533G>A	c.(532-534)cGt>cAt	p.R178H	SEC11A_ENST00000455959.3_Missense_Mutation_p.R152H|SEC11A_ENST00000560266.1_3'UTR|SEC11A_ENST00000558134.1_Missense_Mutation_p.V159M	NM_014300.2	NP_055115.1	P67812	SC11A_HUMAN	SEC11 homolog A (S. cerevisiae)	178					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)	p.R178H(1)		ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			TTCTTACTCACGATGAACCAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	15											87.0	77.0	80.0					15																	85213257		1929	4138	6067	83014261	SO:0001583	missense	23478			AF061737	CCDS45340.1, CCDS61742.1, CCDS61743.1, CCDS61744.1, CCDS73776.1	15q25.2	2006-11-07	2006-11-07	2006-11-07		ENSG00000140612			17718	protein-coding gene	gene with protein product			"""SEC11-like 1 (S. cerevisiae)"""	SEC11L1			Standard	NM_001271919		Approved	SPC18, sid2895, SPCS4A	uc031qtg.1	P67812		ENST00000268220.7:c.533G>A	15.37:g.85213257C>T	ENSP00000268220:p.Arg178His	Somatic		Capture	Illumina GAIIx	4	83014261	B2RAD7|B4DUL4|H0YK72|H0YK83|O75957|P21378|Q53FQ8	Missense_Mutation	SNP	-	p.R178H	ENST00000268220.7	37	c.533	CCDS45340.1	15	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235277	0.79800	.	.	ENSG00000140612	ENST00000268220;ENST00000455959	.	.	.	5.84	4.9	0.64082	.	0.109676	0.64402	D	0.000004	D	0.84911	0.5577	M	0.93462	3.42	0.54753	D	0.999987	D	0.89917	1.0	D	0.65874	0.939	D	0.88804	0.3287	9	0.87932	D	0	.	13.8946	0.63764	0.1536:0.8464:0.0:0.0	.	178	P67812	SC11A_HUMAN	H	178;152	.	ENSP00000268220:R178H	R	-	2	0	SEC11A	83014261	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	6.013000	0.70776	1.433000	0.47394	0.655000	0.94253	CGT	-	NULL		0.433	SEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC11A	protein_coding	OTTHUMT00000418777.1	C	NM_014300		83014261	-1	no_errors	NM_014300	genbank	human	provisional	54_36p	missense	SNP	1	T
JUP	3728	genome.wustl.edu	37	17	39912440	39912442	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	CTC	CTC	CTC	-	CTC	CTC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr17:39912440_39912442delCTC	ENST00000393931.3	-	13	2189_2191	c.2071_2073delGAG	c.(2071-2073)gagdel	p.E691del	JUP_ENST00000393930.1_In_Frame_Del_p.E691del|JUP_ENST00000310706.5_In_Frame_Del_p.E691del|JUP_ENST00000540235.1_Intron	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	691					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)	p.E691del(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CTCCATAGGGCTCATTGATGGGA	0.562																																					Colon(16;42 520 6044 17852 28530)											1	Deletion - In frame(1)	ovary(1)	17																																								37165968	SO:0001651	inframe_deletion	3728			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.2071_2073delGAG	17.37:g.39912440_39912442delCTC	ENSP00000377508:p.Glu691del	Somatic		Capture	Illumina GAIIx	Phase_III	37165966	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	In_Frame_Del	DEL	superfamily_ARM repeat,Arm,HMMPfam_Arm,HEAT,HMMPfam_HEAT	p.E691in_frame_del	ENST00000393931.3	37	c.2073_2071	CCDS11407.1	17																																																																																			(deletion:cds_exon[37165953,37165992])	NULL		0.562	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	protein_coding	OTTHUMT00000257406.1	CTC			37165968	-1	no_errors	NM_002230	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.953:0.993:0.998	-
SCRN2	90507	genome.wustl.edu	37	17	45915948	45915948	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr17:45915948T>A	ENST00000290216.9	-	6	1012	c.887A>T	c.(886-888)gAt>gTt	p.D296V	SCRN2_ENST00000407215.3_Missense_Mutation_p.D296V|SCRN2_ENST00000584123.1_Missense_Mutation_p.D304V	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	296						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)	p.D296V(1)		cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CTGCGTGGGATCCTGGGGCAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											113.0	102.0	106.0					17																	45915948		2203	4300	6503	43270947	SO:0001583	missense	90507			BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.887A>T	17.37:g.45915948T>A	ENSP00000290216:p.Asp296Val	Somatic		Capture	Illumina GAIIx	Phase_III	43270947	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	-	p.D296V	ENST00000290216.9	37	c.887	CCDS11519.1	17	.	.	.	.	.	.	.	.	.	.	T	18.21	3.573943	0.65765	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.10005	3.04;2.92	5.51	5.51	0.81932	.	0.247838	0.46442	D	0.000292	T	0.28067	0.0692	M	0.81942	2.565	0.80722	D	1	D;D;D	0.63880	0.986;0.993;0.986	P;P;P	0.56916	0.809;0.809;0.809	T	0.03095	-1.1073	10	0.87932	D	0	-25.2896	10.7187	0.46028	0.0:0.0:0.1597:0.8403	.	296;296;296	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	V	296	ENSP00000290216:D296V;ENSP00000383935:D296V	ENSP00000290216:D296V	D	-	2	0	SCRN2	43270947	0.936000	0.31750	0.996000	0.52242	0.394000	0.30568	4.033000	0.57282	2.088000	0.63022	0.528000	0.53228	GAT	-	NULL		0.592	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN2	protein_coding	OTTHUMT00000441383.1	T	NM_138355		43270947	-1	no_errors	NM_138355	genbank	human	validated	54_36p	missense	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7577609	7577609	+	Splice_Site	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr17:7577609C>T	ENST00000269305.4	-	7	862		c.e7-1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(33)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGAGCCAACCTAGGAGATAA	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	43	Unknown(33)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	biliary_tract(9)|lung(9)|central_nervous_system(4)|bone(4)|liver(4)|upper_aerodigestive_tract(3)|breast(3)|oesophagus(2)|ovary(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	17	GRCh37	CS011061	TP53	S							89.0	75.0	80.0					17																	7577609		2203	4300	6503	7518334	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.673-1G>A	17.37:g.7577609C>T		Somatic		Capture	Illumina GAIIx	4	7518334	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e6-1	ENST00000269305.4	37	c.673-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808655	0.70797	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.965	0.58480	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518334	1.000000	0.71417	0.321000	0.25320	0.603000	0.37013	7.494000	0.81503	2.158000	0.67659	0.462000	0.41574	.	-	-		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7518334	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.99	T
OTOP2	92736	genome.wustl.edu	37	17	72929593	72929593	+	Missense_Mutation	SNP	C	C	T	rs201682015		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr17:72929593C>T	ENST00000580223.1	+	6	1672	c.1642C>T	c.(1642-1644)Cgc>Tgc	p.R548C	OTOP2_ENST00000331427.4_Missense_Mutation_p.R548C|OTOP3_ENST00000328801.4_5'Flank			Q7RTS6	OTOP2_HUMAN	otopetrin 2	548						integral component of membrane (GO:0016021)		p.R548C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					CATCTTCTACCGCATGCACGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											123.0	93.0	103.0					17																	72929593		2203	4300	6503	70441188	SO:0001583	missense	92736			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1642C>T	17.37:g.72929593C>T	ENSP00000463837:p.Arg548Cys	Somatic		Capture	Illumina GAIIx	4	70441188		Missense_Mutation	SNP	-	p.R548C	ENST00000580223.1	37	c.1642	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623497	0.66901	.	.	ENSG00000183034	ENST00000331427	T	0.54866	0.55	4.44	3.45	0.39498	.	0.000000	0.85682	D	0.000000	T	0.74107	0.3673	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79145	-0.1924	10	0.87932	D	0	-14.5647	12.606	0.56523	0.2983:0.7017:0.0:0.0	.	548	Q7RTS6	OTOP2_HUMAN	C	548	ENSP00000332528:R548C	ENSP00000332528:R548C	R	+	1	0	OTOP2	70441188	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.310000	0.33551	1.183000	0.42943	0.561000	0.74099	CGC	-	NULL		0.612	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	protein_coding	OTTHUMT00000445306.1	C	NM_178160		70441188	1	no_errors	NM_178160	genbank	human	provisional	54_36p	missense	SNP	0.997	T
TRAPPC8	22878	genome.wustl.edu	37	18	29444598	29444598	+	Silent	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr18:29444598G>A	ENST00000283351.4	-	19	3072	c.2737C>T	c.(2737-2739)Ctg>Ttg	p.L913L	TRAPPC8_ENST00000582539.1_Silent_p.L859L	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	913					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.L913L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACCTCCAACAGTGGCATTTCT	0.323																																																1	Substitution - coding silent(1)	ovary(1)	18											108.0	104.0	105.0					18																	29444598		2203	4300	6503	27698596	SO:0001819	synonymous_variant	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2737C>T	18.37:g.29444598G>A		Somatic		Capture	Illumina GAIIx	4	27698596	A0JP15|B3KME5|Q9H0L2	Silent	SNP	superfamily_TPR-like	p.L913	ENST00000283351.4	37	c.2737	CCDS11901.1	18																																																																																			-	NULL		0.323	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	KIAA1012	protein_coding	OTTHUMT00000255355.1	G	NM_014939		27698596	-1	no_errors	NM_014939	genbank	human	validated	54_36p	silent	SNP	1	A
AP1M1	8907	genome.wustl.edu	37	19	16345060	16345060	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr19:16345060G>C	ENST00000291439.3	+	11	1673	c.1224G>C	c.(1222-1224)tgG>tgC	p.W408C	AP1M1_ENST00000444449.2_Missense_Mutation_p.W420C|AP1M1_ENST00000541844.1_Missense_Mutation_p.W336C|AP1M1_ENST00000429941.2_Missense_Mutation_p.W355C|AP1M1_ENST00000590756.1_Missense_Mutation_p.W336C	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	408	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)		p.W408C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CCCTGCCCTGGGTGCGTTATA	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	61.0	65.0					19																	16345060		2203	4300	6503	16206060	SO:0001583	missense	8907				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.1224G>C	19.37:g.16345060G>C	ENSP00000291439:p.Trp408Cys	Somatic		Capture	Illumina GAIIx	4	16206060	Q4TTY5	Missense_Mutation	SNP	HMMPfam_Adap_comp_sub,superfamily_Second domain of Mu2 adaptin subunit (ap50) of ap2 adaptor,superfamily_SNARE-like	p.W408C	ENST00000291439.3	37	c.1224	CCDS12342.1	19	.	.	.	.	.	.	.	.	.	.	G	15.56	2.870809	0.51695	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.25749	1.78;1.78;1.78;1.89	3.58	3.58	0.41010	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	H	0.96547	3.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.77550	-0.2546	10	0.87932	D	0	-23.6006	14.7335	0.69399	0.0:0.0:1.0:0.0	.	355;420;408	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	C	420;408;336;355	ENSP00000388996:W420C;ENSP00000291439:W408C;ENSP00000445682:W336C;ENSP00000411498:W355C	ENSP00000291439:W408C	W	+	3	0	AP1M1	16206060	1.000000	0.71417	0.998000	0.56505	0.410000	0.31052	9.354000	0.97083	2.017000	0.59298	0.561000	0.74099	TGG	-	HMMPfam_Adap_comp_sub		0.642	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1M1	protein_coding	OTTHUMT00000460492.1	G	NM_032493		16206060	1	no_errors	NM_032493	genbank	human	reviewed	54_36p	missense	SNP	1	C
ZNF229	7772	genome.wustl.edu	37	19	44934173	44934173	+	Silent	SNP	T	T	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr19:44934173T>C	ENST00000588931.1	-	6	1216	c.783A>G	c.(781-783)ggA>ggG	p.G261G	ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Silent_p.G255G	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G261G(1)		breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				AGCCATTCTCTCCAGGGTTAA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	19											101.0	94.0	96.0					19																	44934173		1910	4107	6017	49626013	SO:0001819	synonymous_variant	7772			AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.783A>G	19.37:g.44934173T>C		Somatic		Capture	Illumina GAIIx	4	49626013	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	-	p.G261	ENST00000588931.1	37	c.783	CCDS42574.1	19																																																																																			-	NULL		0.423	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	protein_coding	OTTHUMT00000460833.1	T	NM_014518		49626013	-1	no_errors	NM_014518	genbank	human	validated	54_36p	silent	SNP		C
SCN9A	6335	genome.wustl.edu	37	2	167143055	167143055	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:167143055T>A	ENST00000409435.1	-	10	1392	c.1393A>T	c.(1393-1395)Aca>Tca	p.T465S	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.T466S|SCN9A_ENST00000409672.1_Missense_Mutation_p.T465S|SCN9A_ENST00000375387.4_Missense_Mutation_p.T466S			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	465					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.T465S(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTTTGGATGTTTCAGAAGAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											42.0	38.0	39.0					2																	167143055		1811	4076	5887	166851301	SO:0001583	missense	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1393A>T	2.37:g.167143055T>A	ENSP00000386330:p.Thr465Ser	Somatic		Capture	Illumina GAIIx	4	166851301	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Ion_trans;HMMPfam_Na_trans_assoc;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.T465S	ENST00000409435.1	37	c.1393	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	T	8.421	0.846403	0.16963	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6;-2.6	5.86	3.4	0.38934	Domain of unknown function DUF3451 (1);	0.184196	0.38897	N	0.001532	T	0.72020	0.3409	N	0.04880	-0.145	0.24389	N	0.994756	B;B;B	0.19817	0.039;0.003;0.005	B;B;B	0.35073	0.195;0.012;0.012	T	0.59129	-0.7512	10	0.08381	T	0.77	.	0.5974	0.00738	0.1814:0.1702:0.189:0.4595	.	465;465;466	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	S	465;466;466;465;330;330	ENSP00000386306:T465S;ENSP00000364536:T466S;ENSP00000304748:T466S;ENSP00000386330:T465S;ENSP00000413212:T330S;ENSP00000393141:T330S	ENSP00000304748:T466S	T	-	1	0	SCN9A	166851301	0.973000	0.33851	1.000000	0.80357	0.996000	0.88848	0.339000	0.19875	2.238000	0.73509	0.477000	0.44152	ACA	-	NULL		0.433	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	protein_coding	OTTHUMT00000333639.1	T	NM_002977		166851301	-1	no_errors	NM_002977	genbank	human	validated	54_36p	missense	SNP	0.92	A
LRP2	4036	genome.wustl.edu	37	2	169989189	169989189	+	Silent	SNP	C	C	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:169989189C>G	ENST00000263816.3	-	77	13908	c.13623G>C	c.(13621-13623)gtG>gtC	p.V4541V		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4541					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.V4541V(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGATACAGTCACCTGTGGAC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	2											107.0	105.0	105.0					2																	169989189		2203	4300	6503	169697435	SO:0001819	synonymous_variant	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13623G>C	2.37:g.169989189C>G		Somatic		Capture	Illumina GAIIx	4	169697435	O00711|Q16215	Silent	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.V4541	ENST00000263816.3	37	c.13623	CCDS2232.1	2																																																																																			-	NULL		0.378	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525		169697435	-1	no_errors	NM_004525	genbank	human	validated	54_36p	silent	SNP	0.02	G
SOS1	6654	genome.wustl.edu	37	2	39213276	39213276	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:39213276G>C	ENST00000426016.1	-	24	3777	c.3691C>G	c.(3691-3693)Cta>Gta	p.L1231V	SOS1_ENST00000395038.2_Missense_Mutation_p.L1216V|SOS1_ENST00000402219.2_Missense_Mutation_p.L1231V			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1231					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1231V(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TGGAGATGTAGTGGTGAGCTT	0.512									Noonan syndrome																																							1	Substitution - Missense(1)	ovary(1)	2											147.0	153.0	151.0					2																	39213276		2203	4300	6503	39066780	SO:0001583	missense	6654	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3691C>G	2.37:g.39213276G>C	ENSP00000387784:p.Leu1231Val	Somatic		Capture	Illumina GAIIx	4	39066780	A8K2G3|B4DXG2	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_RasGEF_N;HMMPfam_PH;HMMPfam_RasGEF;HMMPfam_Histone;superfamily_Ras GEF;superfamily_Histone-fold;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.L1231V	ENST00000426016.1	37	c.3691	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475247	0.43942	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038	T;T;T	0.78364	-1.01;-1.01;-1.17	5.8	4.92	0.64577	.	0.106863	0.45867	D	0.000333	T	0.79969	0.4538	L	0.36672	1.1	0.80722	D	1	D	0.63880	0.993	D	0.67548	0.952	T	0.75062	-0.3450	10	0.12103	T	0.63	.	13.9969	0.64407	0.0737:0.0:0.9263:0.0	.	1231	Q07889	SOS1_HUMAN	V	1231;1231;948;1216	ENSP00000387784:L1231V;ENSP00000384675:L1231V;ENSP00000378479:L1216V	ENSP00000378479:L1216V	L	-	1	2	SOS1	39066780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.050000	0.49877	1.426000	0.47256	0.650000	0.86243	CTA	-	NULL		0.512	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	protein_coding	OTTHUMT00000219948.3	G	NM_005633		39066780	-1	no_errors	NM_005633	genbank	human	reviewed	54_36p	missense	SNP	1	C
CDKL4	344387	genome.wustl.edu	37	2	39440595	39440595	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:39440595G>C	ENST00000395035.3	-	3	308	c.309C>G	c.(307-309)atC>atG	p.I103M	CDKL4_ENST00000378803.1_Missense_Mutation_p.I103M			Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	103	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.I103M(1)		breast(1)|large_intestine(2)|liver(1)|lung(7)|ovary(1)	12		all_hematologic(82;0.248)				ATACGCTTTTGATCACTCCAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											76.0	84.0	81.0					2																	39440595		2203	4300	6503	39294099	SO:0001583	missense	344387				CCDS33184.1	2p22.3	2011-11-04			ENSG00000205111	ENSG00000205111		"""Cyclin-dependent kinases"""	19287	protein-coding gene	gene with protein product							Standard	NM_001009565		Approved		uc002rrm.3	Q5MAI5	OTTHUMG00000133574	ENST00000395035.3:c.309C>G	2.37:g.39440595G>C	ENSP00000378476:p.Ile103Met	Somatic		Capture	Illumina GAIIx	4	39294099	Q2NME9	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.I103M	ENST00000395035.3	37	c.309		2	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819186	0.32145	.	.	ENSG00000205111	ENST00000378803;ENST00000395035	T;T	0.68765	-0.35;-0.35	4.67	2.83	0.33086	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.132552	0.33772	N	0.004578	T	0.69468	0.3114	M	0.73598	2.24	0.31935	N	0.611708	B;B	0.32467	0.372;0.006	B;B	0.42959	0.403;0.098	T	0.73107	-0.4087	10	0.72032	D	0.01	-15.3231	7.6416	0.28296	0.2022:0.0:0.7978:0.0	.	103;103	Q2NME9;Q5MAI5	.;CDKL4_HUMAN	M	103	ENSP00000368080:I103M;ENSP00000378476:I103M	ENSP00000368080:I103M	I	-	3	3	CDKL4	39294099	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.659000	0.24994	0.386000	0.24997	0.561000	0.74099	ATC	-	HMMPfam_Pkinase		0.348	CDKL4-002	NOVEL	basic|appris_candidate_longest	protein_coding	CDKL4	protein_coding	OTTHUMT00000331655.1	G	XM_293029		39294099	-1	no_errors	NM_001009565	genbank	human	provisional	54_36p	missense	SNP	1	C
SERTAD2	9792	genome.wustl.edu	37	2	64893136	64893136	+	Intron	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:64893136C>T	ENST00000476805.2	-	2	725							Q14140	SRTD2_HUMAN	SERTA domain containing 2						negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						GAGGCTGGGGCTGGGTCAGCA	0.532																																																0			2																																								64746640	SO:0001627	intron_variant	730187			D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000476805.2:c.344-29127G>A	2.37:g.64893136C>T		Somatic		Capture	Illumina GAIIx	4	64746640	Q53TS2	RNA	SNP	-	NULL	ENST00000476805.2	37	NULL		2																																																																																			-	-		0.532	SERTAD2-002	KNOWN	not_organism_supported|mRNA_end_NF|basic	processed_transcript	LOC730187	protein_coding	OTTHUMT00000327470.2	C	NM_014755		64746640	1	pseudogene	XR_042354	genbank	human	model	54_36p	rna	SNP	1	T
CNNM3	26505	genome.wustl.edu	37	2	97490936	97490936	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:97490936A>G	ENST00000305510.3	+	2	1395	c.1367A>G	c.(1366-1368)tAc>tGc	p.Y456C	ANKRD23_ENST00000476975.1_Intron|CNNM3_ENST00000377060.3_Intron	NM_017623.4	NP_060093.3	Q8NE01	CNNM3_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 3	456					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.Y456C(1)		NS(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)|skin(1)|urinary_tract(2)	13						TCTGAAGACTACCGTGAGTCC	0.607																																																1	Substitution - Missense(1)	ovary(1)	2											71.0	58.0	62.0					2																	97490936		2203	4300	6503	96854663	SO:0001583	missense	26505			AF216965	CCDS2025.1, CCDS2026.1	2q11.2	2014-08-08	2014-08-07		ENSG00000168763	ENSG00000168763			104	protein-coding gene	gene with protein product		607804	"""cyclin M3"""	ACDP3		21393841, 24632616	Standard	XM_005263917		Approved		uc002swy.3	Q8NE01	OTTHUMG00000130531	ENST00000305510.3:c.1367A>G	2.37:g.97490936A>G	ENSP00000305449:p.Tyr456Cys	Somatic		Capture	Illumina GAIIx	Phase_III	96854663	B3KX67|Q8TBV4|Q96IW4|Q9NRK4|Q9NXW6	Missense_Mutation	SNP	-	p.Y456C	ENST00000305510.3	37	c.1367	CCDS2025.1	2	.	.	.	.	.	.	.	.	.	.	A	13.12	2.143082	0.37825	.	.	ENSG00000168763	ENST00000305510	D	0.91792	-2.91	5.56	4.39	0.52855	.	0.210253	0.42172	D	0.000743	D	0.92205	0.7528	M	0.83774	2.66	0.80722	D	1	P	0.37352	0.591	B	0.42738	0.396	D	0.90232	0.4280	10	0.54805	T	0.06	-9.3116	6.6455	0.22933	0.7651:0.1565:0.0785:0.0	.	456	Q8NE01	CNNM3_HUMAN	C	456	ENSP00000305449:Y456C	ENSP00000305449:Y456C	Y	+	2	0	CNNM3	96854663	1.000000	0.71417	0.998000	0.56505	0.784000	0.44337	2.801000	0.47908	0.932000	0.37266	0.533000	0.62120	TAC	-	NULL		0.607	CNNM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNNM3	protein_coding	OTTHUMT00000252952.2	A	NM_017623		96854663	1	no_errors	NM_017623	genbank	human	validated	54_36p	missense	SNP	1	G
GLS	2744	genome.wustl.edu	37	2	191819354	191819354	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:191819354C>G	ENST00000320717.3	+	16	2015	c.1757C>G	c.(1756-1758)tCt>tGt	p.S586C	GLS_ENST00000409428.1_Missense_Mutation_p.S91C	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	586					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.S586C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GACTATGATTCTAGAACAGCA	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											84.0	86.0	86.0					2																	191819354		2203	4300	6503	191527599	SO:0001583	missense	2744			AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1757C>G	2.37:g.191819354C>G	ENSP00000317379:p.Ser586Cys	Somatic		Capture	Illumina GAIIx	4	191527599	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_beta-lactamase/transpeptidase-like;HMMPfam_Glutaminase	p.S586C	ENST00000320717.3	37	c.1757	CCDS2308.1	2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819463	0.90873	.	.	ENSG00000115419	ENST00000320717;ENST00000457316;ENST00000409428;ENST00000412247	T;T;T;T	0.34667	1.35;1.35;1.35;1.51	5.38	5.38	0.77491	Ankyrin repeat-containing domain (4);	0.060739	0.64402	D	0.000001	T	0.52517	0.1739	L	0.35644	1.08	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.72075	0.848;0.976;0.976	T	0.51973	-0.8637	10	0.66056	D	0.02	-18.4559	19.3333	0.94303	0.0:1.0:0.0:0.0	.	157;586;586	B7Z2P1;A8K132;O94925	.;.;GLSK_HUMAN	C	586;157;91;107	ENSP00000317379:S586C;ENSP00000395596:S157C;ENSP00000387177:S91C;ENSP00000403329:S107C	ENSP00000317379:S586C	S	+	2	0	GLS	191527599	1.000000	0.71417	0.957000	0.39632	0.976000	0.68499	5.560000	0.67332	2.793000	0.96121	0.655000	0.94253	TCT	-	HMMPfam_Ank		0.353	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS	protein_coding	OTTHUMT00000255999.2	C			191527599	1	no_errors	NM_014905	genbank	human	validated	54_36p	missense	SNP	1	G
SON	6651	genome.wustl.edu	37	21	34926882	34926882	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr21:34926882C>T	ENST00000356577.4	+	3	5820	c.5345C>T	c.(5344-5346)tCt>tTt	p.S1782F	SON_ENST00000300278.4_Missense_Mutation_p.S1782F|SON_ENST00000290239.6_Missense_Mutation_p.S1782F|SON_ENST00000381679.4_Missense_Mutation_p.S1782F|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1782					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S1782F(1)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCTTCAGAGTCTTCTTCAGAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	21											76.0	80.0	79.0					21																	34926882		2202	4300	6502	33848752	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5345C>T	21.37:g.34926882C>T	ENSP00000348984:p.Ser1782Phe	Somatic		Capture	Illumina GAIIx	4	33848752	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	HMMPfam_G-patch;HMMPfam_dsrm;superfamily_WD40 repeat-like;superfamily_dsRNA-binding domain-like	p.S1782F	ENST00000356577.4	37	c.5345	CCDS13629.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.39|16.39	3.110163|3.110163	0.56398|0.56398	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.34072	.|1.38;1.38;1.38;1.38	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.47852	.|D	.|0.000208	T|T	0.57417|0.57417	0.2052|0.2052	L|L	0.56769|0.56769	1.78|1.78	0.52099|0.52099	D|D	0.99994|0.99994	.|D;D;D;D;D	.|0.76494	.|0.999;0.995;0.997;0.999;0.999	.|D;D;D;D;D	.|0.85130	.|0.997;0.986;0.994;0.997;0.996	T|T	0.59289|0.59289	-0.7482|-0.7482	5|10	.|0.87932	.|D	.|0	.|.	16.1179|16.1179	0.81321|0.81321	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1782;1782;1463;1782;1782	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	F|F	777|1782	.|ENSP00000348984:S1782F;ENSP00000290239:S1782F;ENSP00000300278:S1782F;ENSP00000371095:S1782F	.|ENSP00000290239:S1782F	L|S	+|+	1|2	0|0	SON|SON	33848752|33848752	0.864000|0.864000	0.29904|0.29904	0.925000|0.925000	0.36789|0.36789	0.905000|0.905000	0.53344|0.53344	2.254000|2.254000	0.43214|0.43214	2.546000|2.546000	0.85860|0.85860	0.591000|0.591000	0.81541|0.81541	CTT|TCT	-	NULL		0.413	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	C	NM_138927		33848752	1	no_errors	NM_138927	genbank	human	reviewed	54_36p	missense	SNP	0.93	T
FBXO40	51725	genome.wustl.edu	37	3	121341495	121341495	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr3:121341495G>T	ENST00000338040.4	+	3	1633	c.1219G>T	c.(1219-1221)Gaa>Taa	p.E407*		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	407					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E407*(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		TTTGGAAAGAGAACTCAAAGG	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	3											117.0	112.0	114.0					3																	121341495		2203	4300	6503	122824185	SO:0001587	stop_gained	51725			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1219G>T	3.37:g.121341495G>T	ENSP00000337510:p.Glu407*	Somatic		Capture	Illumina GAIIx	4	122824185	B2RAX7|Q32M70|Q9ULM5	Nonsense_Mutation	SNP	HMMPfam_F-box;superfamily_TRAF domain-like;superfamily_F-box domain	p.E407*	ENST00000338040.4	37	c.1219	CCDS33835.1	3	.	.	.	.	.	.	.	.	.	.	G	40	8.260967	0.98732	.	.	ENSG00000163833	ENST00000338040	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-19.5671	17.4071	0.87476	0.0:0.0:1.0:0.0	.	.	.	.	X	407	.	ENSP00000337510:E407X	E	+	1	0	FBXO40	122824185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.721000	0.93114	0.655000	0.94253	GAA	-	NULL		0.463	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO40	protein_coding	OTTHUMT00000355158.1	G	NM_016298		122824185	1	no_errors	NM_016298	genbank	human	validated	54_36p	nonsense	SNP	1	T
GPR78	27201	genome.wustl.edu	37	4	8584315	8584315	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr4:8584315G>T	ENST00000382487.4	+	2	1143	c.726G>T	c.(724-726)aaG>aaT	p.K242N	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	242					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.K242N(1)		central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						CCACCAGGAAGATTGGCATTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	4											145.0	122.0	130.0					4																	8584315		2203	4300	6503	8635215	SO:0001583	missense	27201			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.726G>T	4.37:g.8584315G>T	ENSP00000371927:p.Lys242Asn	Somatic		Capture	Illumina GAIIx	4	8635215	Q8NGV3	Missense_Mutation	SNP	7tm_1;HMMPfam_7tm_1;Family A G protein-coupled receptor-like;superfamily_Family A G protein-coupled receptor-like	p.K242N	ENST00000382487.4	37	c.726	CCDS3403.1	4	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416048	0.42817	.	.	ENSG00000155269	ENST00000382487	T	0.37235	1.21	2.43	2.43	0.29744	GPCR, rhodopsin-like superfamily (1);	0.169266	0.37955	U	0.001866	T	0.46367	0.1389	L	0.54323	1.7	0.31646	N	0.647443	D	0.76494	0.999	D	0.73380	0.98	T	0.51942	-0.8641	10	0.72032	D	0.01	.	3.8188	0.08827	0.3491:0.0:0.6509:0.0	.	242	Q96P69	GPR78_HUMAN	N	242	ENSP00000371927:K242N	ENSP00000371927:K242N	K	+	3	2	GPR78	8635215	1.000000	0.71417	0.003000	0.11579	0.014000	0.08584	1.807000	0.38902	1.183000	0.42943	0.563000	0.77884	AAG	-	HMMPfam_7tm_1		0.627	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR78	protein_coding	OTTHUMT00000359201.1	G			8635215	1	no_errors	NM_080819	genbank	human	validated	54_36p	missense	SNP	1	T
ADAMTS3	9508	genome.wustl.edu	37	4	73171758	73171758	+	Missense_Mutation	SNP	G	G	C	rs199518563		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr4:73171758G>C	ENST00000286657.4	-	16	2242	c.2206C>G	c.(2206-2208)Cct>Gct	p.P736A		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	736	Spacer.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P736A(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTAGCCCCAGGGGGTATATCA	0.403																																					NSCLC(168;1941 2048 2918 13048 43078)											1	Substitution - Missense(1)	ovary(1)	4											119.0	119.0	119.0					4																	73171758		2203	4300	6503	73390622	SO:0001583	missense	9508			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2206C>G	4.37:g.73171758G>C	ENSP00000286657:p.Pro736Ala	Somatic		Capture	Illumina GAIIx	4	73390622	A1L3U9|Q9BXZ8	Missense_Mutation	SNP	"HMMPfam_TSP_1;HMMPfam_Reprolysin;HMMPfam_Pep_M12B_propep;HMMPfam_ADAM_spacer1;superfamily_Metalloproteases (""zincins"") catalytic domain;superfamily_TSP-1 type 1 repeat"	p.P736A	ENST00000286657.4	37	c.2206	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	G	5.189	0.220451	0.09863	.	.	ENSG00000156140	ENST00000286657	T	0.41758	0.99	5.49	4.64	0.57946	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.20659	0.0497	N	0.04245	-0.25	0.39127	D	0.961788	B	0.09022	0.002	B	0.14023	0.01	T	0.17077	-1.0381	10	0.02654	T	1	.	16.7166	0.85398	0.0:0.1294:0.8706:0.0	.	736	O15072	ATS3_HUMAN	A	736	ENSP00000286657:P736A	ENSP00000286657:P736A	P	-	1	0	ADAMTS3	73390622	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.042000	0.64202	1.446000	0.47643	0.650000	0.86243	CCT	-	HMMPfam_ADAM_spacer1		0.403	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	protein_coding	OTTHUMT00000252164.2	G			73390622	-1	no_errors	NM_014243	genbank	human	reviewed	54_36p	missense	SNP	1	C
LOC101928978	101928978	genome.wustl.edu	37	4	85166665	85166665	+	IGR	SNP	T	T	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr4:85166665T>C								RNU6-774P (11749 upstream) : RP11-42A4.1 (125880 downstream)																							GGTCCTCAGCTCAGTTTTTGG	0.572																																																0			4																																								85385689	SO:0001628	intergenic_variant	152845																															4.37:g.85166665T>C		Somatic		Capture	Illumina GAIIx	4	85385689		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.572					LOC152845			T			85385689	1	pseudogene	XR_038721	genbank	human	model	54_36p	rna	SNP	1	C
CLGN	1047	genome.wustl.edu	37	4	141311798	141311798	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr4:141311798G>A	ENST00000325617.5	-	14	2176	c.1736C>T	c.(1735-1737)tCt>tTt	p.S579F	CLGN_ENST00000414773.1_Missense_Mutation_p.S579F|CLGN_ENST00000537281.1_Missense_Mutation_p.S579F	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	579					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)	p.S579F(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					CTCTGACCCAGACTTATTTGA	0.313																																																1	Substitution - Missense(1)	ovary(1)	4											183.0	171.0	175.0					4																	141311798		2202	4299	6501	141531248	SO:0001583	missense	1047			D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.1736C>T	4.37:g.141311798G>A	ENSP00000326699:p.Ser579Phe	Somatic		Capture	Illumina GAIIx	4	141531248	B3KS90|B4DXV8|D3DNY8	Missense_Mutation	SNP	HMMPfam_Calreticulin;superfamily_Concanavalin A-like lectins/glucanases;superfamily_P-domain of calnexin/calreticulin	p.S579F	ENST00000325617.5	37	c.1736	CCDS3751.1	4	.	.	.	.	.	.	.	.	.	.	G	17.29	3.353036	0.61293	.	.	ENSG00000153132	ENST00000325617;ENST00000414773;ENST00000537281;ENST00000545667	T;T;T	0.52754	0.65;0.65;0.65	5.5	5.5	0.81552	.	0.287885	0.32343	N	0.006229	T	0.60183	0.2249	L	0.47716	1.5	0.53005	D	0.999963	D	0.63880	0.993	P	0.59288	0.855	T	0.61272	-0.7096	10	0.62326	D	0.03	-20.3285	18.3728	0.90412	0.0:0.0:1.0:0.0	.	579	O14967	CLGN_HUMAN	F	579;579;579;496	ENSP00000326699:S579F;ENSP00000392782:S579F;ENSP00000439381:S579F	ENSP00000326699:S579F	S	-	2	0	CLGN	141531248	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	5.151000	0.64875	2.581000	0.87130	0.591000	0.81541	TCT	-	NULL		0.313	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLGN	protein_coding	OTTHUMT00000257272.2	G	NM_004362		141531248	-1	no_errors	NM_004362	genbank	human	reviewed	54_36p	missense	SNP	1	A
TENM2	57451	genome.wustl.edu	37	5	167642199	167642199	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr5:167642199G>C	ENST00000518659.1	+	21	4039	c.4000G>C	c.(4000-4002)Gag>Cag	p.E1334Q	TENM2_ENST00000519204.1_Missense_Mutation_p.E1213Q|TENM2_ENST00000403607.2_Missense_Mutation_p.E1158Q|TENM2_ENST00000545108.1_Missense_Mutation_p.E1333Q|TENM2_ENST00000520394.1_Missense_Mutation_p.E1095Q	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1334					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.E1167Q(1)									AGGGACGGGAGAGCAGTGTCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	5											91.0	99.0	96.0					5																	167642199		1965	4128	6093	167574777	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4000G>C	5.37:g.167642199G>C	ENSP00000429430:p.Glu1334Gln	Somatic		Capture	Illumina GAIIx	4	167574777	Q9ULU2	Missense_Mutation	SNP	-	p.E1333Q	ENST00000518659.1	37	c.3997		5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038693	0.75617	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90444	-2.2;-2.19;-2.3;-2.66;-2.67	5.1	5.1	0.69264	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.94221	0.8145	L	0.58354	1.805	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.996	D;D;D	0.76071	0.987;0.971;0.986	D	0.93780	0.7083	10	0.44086	T	0.13	.	18.5487	0.91056	0.0:0.0:1.0:0.0	.	1333;1334;1095	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Q	1334;1333;1213;1095;1158	ENSP00000429430:E1334Q;ENSP00000438635:E1333Q;ENSP00000428964:E1213Q;ENSP00000427874:E1095Q;ENSP00000384905:E1158Q	ENSP00000384905:E1158Q	E	+	1	0	ODZ2	167574777	1.000000	0.71417	0.996000	0.52242	0.361000	0.29550	9.813000	0.99286	2.368000	0.80403	0.655000	0.94253	GAG	-	NULL		0.557	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	G	NM_001122679		167574777	1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1	C
ARL15	54622	genome.wustl.edu	37	5	53467629	53467629	+	Missense_Mutation	SNP	C	C	A	rs142010064		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr5:53467629C>A	ENST00000504924.1	-	2	271	c.178G>T	c.(178-180)Gtc>Ttc	p.V60F	ARL15_ENST00000510591.2_5'UTR|ARL15_ENST00000507646.2_Missense_Mutation_p.V60F|ARL15_ENST00000502271.1_Intron	NM_019087.2	NP_061960.1	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	60					small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	GTP binding (GO:0005525)	p.V48F(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		Lung NSC(810;0.000779)				GTCGACACGACGTTATCGGGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	5											66.0	67.0	67.0					5																	53467629		1957	4140	6097	53503386	SO:0001583	missense	54622			BC026093	CCDS54850.1	5p15.2	2014-05-09	2005-11-03	2005-11-03		ENSG00000185305		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25945	protein-coding gene	gene with protein product			"""ADP-ribosylation factor related protein 2"""	ARFRP2		12477932	Standard	NM_019087		Approved	FLJ20051	uc003jpg.1	Q9NXU5		ENST00000504924.1:c.178G>T	5.37:g.53467629C>A	ENSP00000433427:p.Val60Phe	Somatic		Capture	Illumina GAIIx	4	53503386	Q6IAD0	Missense_Mutation	SNP	-	p.V60F	ENST00000504924.1	37	c.178	CCDS54850.1	5	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635728	0.29068	.	.	ENSG00000185305	ENST00000504924;ENST00000507646	T;D	0.82526	-0.43;-1.62	5.93	4.15	0.48705	.	0.156015	0.53938	D	0.000049	T	0.80523	0.4639	L	0.58969	1.84	0.39412	D	0.966777	P	0.43542	0.81	P	0.45794	0.493	T	0.81640	-0.0841	10	0.87932	D	0	-16.1539	5.5774	0.17231	0.0:0.6408:0.0:0.3592	.	60	Q9NXU5	ARL15_HUMAN	F	60	ENSP00000433427:V60F;ENSP00000432680:V60F	ENSP00000433427:V60F	V	-	1	0	ARL15	53503386	1.000000	0.71417	0.042000	0.18584	0.155000	0.21991	1.712000	0.37940	1.508000	0.48769	0.561000	0.74099	GTC	-	NULL		0.512	ARL15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL15	protein_coding	OTTHUMT00000368432.2	C	NM_019087		53503386	-1	no_errors	NM_019087	genbank	human	validated	54_36p	missense	SNP	0.79	A
NR2F1	7025	genome.wustl.edu	37	5	92929415	92929415	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr5:92929415T>G	ENST00000327111.3	+	3	2826	c.1139T>G	c.(1138-1140)gTg>gGg	p.V380G	NR2F1_ENST00000506162.1_3'UTR	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	380					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.V380G(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		CTGCGCACCGTGTCCTCCTCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											117.0	112.0	114.0					5																	92929415		2203	4300	6503	92955171	SO:0001583	missense	7025			BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.1139T>G	5.37:g.92929415T>G	ENSP00000325819:p.Val380Gly	Somatic		Capture	Illumina GAIIx	4	92955171		Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;HMMPfam_zf-C4_C;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.V380G	ENST00000327111.3	37	c.1139	CCDS4068.1	5	.	.	.	.	.	.	.	.	.	.	T	23.7	4.445026	0.83993	.	.	ENSG00000175745	ENST00000327111	T	0.53423	0.62	6.17	6.17	0.99709	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	T	0.75302	0.3831	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80674	-0.1277	10	0.87932	D	0	.	16.4957	0.84242	0.0:0.0:0.0:1.0	.	380	P10589	COT1_HUMAN	G	380	ENSP00000325819:V380G	ENSP00000325819:V380G	V	+	2	0	NR2F1	92955171	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	GTG	-	HMMPfam_Hormone_recep		0.582	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2F1	protein_coding	OTTHUMT00000239293.2	T	NM_005654		92955171	1	no_errors	NM_005654	genbank	human	provisional	54_36p	missense	SNP	1	G
ZNF354A	6940	genome.wustl.edu	37	5	178139749	178139749	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr5:178139749G>T	ENST00000335815.2	-	5	1327	c.1130C>A	c.(1129-1131)aCt>aAt	p.T377N		NM_005649.2	NP_005640.2	O60765	Z354A_HUMAN	zinc finger protein 354A	377					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T377N(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(3)|ovary(2)|skin(2)|stomach(2)	19	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		CTTCTCTCCAGTGTGAATTCT	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											63.0	67.0	66.0					5																	178139749		2201	4280	6481	178072355	SO:0001583	missense	6940			AF116030	CCDS4438.1	5q35.3	2013-01-08		2001-11-23	ENSG00000169131	ENSG00000169131		"""Zinc fingers, C2H2-type"", ""-"""	11628	protein-coding gene	gene with protein product		602444		TCF17		9465904	Standard	NM_005649		Approved	KID-1, EZNF, HKL1, KID1	uc003mjj.3	O60765	OTTHUMG00000130895	ENST00000335815.2:c.1130C>A	5.37:g.178139749G>T	ENSP00000337122:p.Thr377Asn	Somatic		Capture	Illumina GAIIx	4	178072355	Q9UNJ8	Missense_Mutation	SNP	-	p.T377N	ENST00000335815.2	37	c.1130	CCDS4438.1	5	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911907	0.52439	.	.	ENSG00000169131	ENST00000335815	T	0.26067	1.76	4.96	4.09	0.47781	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33916	N	0.004437	T	0.44664	0.1304	M	0.62723	1.935	0.41446	D	0.987953	D	0.89917	1.0	D	0.74674	0.984	T	0.34825	-0.9813	10	0.66056	D	0.02	-12.7997	11.0965	0.48147	0.0922:0.0:0.9078:0.0	.	377	O60765	Z354A_HUMAN	N	377	ENSP00000337122:T377N	ENSP00000337122:T377N	T	-	2	0	ZNF354A	178072355	0.904000	0.30761	0.969000	0.41365	0.622000	0.37654	1.216000	0.32443	2.741000	0.93983	0.655000	0.94253	ACT	-	NULL		0.403	ZNF354A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354A	protein_coding	OTTHUMT00000253481.1	G	NM_005649		178072355	-1	no_errors	NM_005649	genbank	human	validated	54_36p	missense	SNP	1	T
BEND3	57673	genome.wustl.edu	37	6	107391738	107391738	+	Silent	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr6:107391738C>T	ENST00000369042.1	-	4	847	c.657G>A	c.(655-657)ctG>ctA	p.L219L	BEND3_ENST00000429433.2_Silent_p.L219L			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	219								p.L219L(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CAAGGGAGAGCAGGTCCACCT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	6											124.0	94.0	104.0					6																	107391738		2203	4300	6503	107498431	SO:0001819	synonymous_variant	57673			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.657G>A	6.37:g.107391738C>T		Somatic		Capture	Illumina GAIIx	4	107498431	A2RRH2|Q9HCL9	Silent	SNP	-	p.L219	ENST00000369042.1	37	c.657	CCDS34507.1	6																																																																																			-	NULL		0.572	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND3	protein_coding	OTTHUMT00000041686.1	C	NM_020913		107498431	-1	no_errors	NM_001080450	genbank	human	provisional	54_36p	silent	SNP	1	T
LAMA2	3908	genome.wustl.edu	37	6	129826344	129826344	+	Splice_Site	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr6:129826344G>T	ENST00000421865.2	+	61	8596		c.e61-1			NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.?(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTTTTTTGTAGATTAAGATAA	0.373																																																1	Unknown(1)	ovary(1)	6											65.0	68.0	67.0					6																	129826344		2203	4300	6503	129868037	SO:0001630	splice_region_variant	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.8548-1G>T	6.37:g.129826344G>T		Somatic		Capture	Illumina GAIIx	4	129868037	Q14736|Q5VUM2|Q93022	Splice_Site	SNP	-	e61-1	ENST00000421865.2	37	c.8548-1	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377775	0.82682	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8946	0.96949	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMA2	129868037	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	8.216000	0.89764	2.711000	0.92665	0.655000	0.94253	.	-	-		0.373	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	G		Intron	129868037	1	no_errors	NM_000426	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
AKAP7	9465	genome.wustl.edu	37	6	131602692	131602692	+	Silent	SNP	C	C	G	rs369639075		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr6:131602692C>G	ENST00000431975.2	+	8	971	c.873C>G	c.(871-873)ccC>ccG	p.P291P	AKAP7_ENST00000263050.3_Silent_p.P27P|AKAP7_ENST00000368123.4_Silent_p.P269P|AKAP7_ENST00000537868.1_Intron|AKAP7_ENST00000342266.4_Silent_p.P24P|AKAP7_ENST00000541650.1_Intron|AKAP7_ENST00000474850.2_Silent_p.P47P	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	291						cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)	p.P269P(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		GAGGGGAGCCCGATGACGCTG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	6											59.0	60.0	60.0					6																	131602692		2203	4300	6503	131644385	SO:0001819	synonymous_variant	9465			AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.873C>G	6.37:g.131602692C>G		Somatic		Capture	Illumina GAIIx	4	131644385	B4DUC3|Q9HCZ8	Silent	SNP	-	p.P269	ENST00000431975.2	37	c.807	CCDS5142.2	6																																																																																			-	NULL		0.507	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AKAP7	protein_coding	OTTHUMT00000042209.2	C	NM_004842		131644385	1	no_errors	NM_016377	genbank	human	reviewed	54_36p	silent	SNP	0.88	G
ENPP3	5169	genome.wustl.edu	37	6	131995408	131995408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr6:131995408G>A	ENST00000414305.1	+	9	1077	c.749G>A	c.(748-750)tGg>tAg	p.W250*	ENPP3_ENST00000427148.2_Nonsense_Mutation_p.W216*|ENPP3_ENST00000358229.5_Nonsense_Mutation_p.W250*|ENPP3_ENST00000357639.3_Nonsense_Mutation_p.W250*|ENPP3_ENST00000543135.1_Nonsense_Mutation_p.W216*			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	250	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.W250*(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CCAGCCTGGTGGCATGGGCAA	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	6											63.0	59.0	61.0					6																	131995408		2203	4300	6503	132037101	SO:0001587	stop_gained	5169			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.749G>A	6.37:g.131995408G>A	ENSP00000406261:p.Trp250*	Somatic		Capture	Illumina GAIIx	4	132037101	Q5JTL3	Nonsense_Mutation	SNP	HMMPfam_Somatomedin_B;HMMPfam_Phosphodiest;superfamily_Alkaline phosphatase-like;superfamily_His-Me finger endonucleases;superfamily_Somatomedin B domain	p.W250*	ENST00000414305.1	37	c.749	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.028277	0.97216	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	.	.	.	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.1048	18.5472	0.91052	0.0:0.0:1.0:0.0	.	.	.	.	X	250;250;216;216;250	.	ENSP00000350265:W250X	W	+	2	0	ENPP3	132037101	1.000000	0.71417	0.999000	0.59377	0.594000	0.36715	6.005000	0.70716	2.756000	0.94617	0.637000	0.83480	TGG	-	HMMPfam_Phosphodiest		0.413	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	protein_coding	OTTHUMT00000043627.2	G			132037101	1	no_errors	NM_005021	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
TRIM39	56658	genome.wustl.edu	37	6	30309530	30309530	+	Missense_Mutation	SNP	G	G	C	rs115963942	byFrequency	TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr6:30309530G>C	ENST00000396547.1	+	8	1211	c.1051G>C	c.(1051-1053)Gtc>Ctc	p.V351L	TRIM39_ENST00000376659.5_Missense_Mutation_p.V321L|TRIM39_ENST00000376656.4_Missense_Mutation_p.V351L|TRIM39_ENST00000540416.1_Missense_Mutation_p.V321L|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.V233L|TRIM39_ENST00000396551.3_Missense_Mutation_p.V321L|TRIM39_ENST00000396548.1_Missense_Mutation_p.V321L			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	351	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.V351L(1)		ovary(3)	3						TCCTAACCTAGTCCTGTCAGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											77.0	54.0	62.0					6																	30309530		1510	2708	4218	30417509	SO:0001583	missense	56658			BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.1051G>C	6.37:g.30309530G>C	ENSP00000379796:p.Val351Leu	Somatic		Capture	Illumina GAIIx	4	30417509	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	-	p.V351L	ENST00000396547.1	37	c.1051	CCDS34377.1	6	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026735	0.54683	.	.	ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556	T;T;T;T;T;T;T	0.10668	3.58;2.85;3.58;3.58;3.58;2.85;3.58	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.185299	0.37530	N	0.002055	T	0.03651	0.0104	N	0.16201	0.385	0.30819	N	0.738035	B;B;B	0.29766	0.106;0.256;0.045	B;B;B	0.37989	0.047;0.262;0.034	T	0.42361	-0.9456	10	0.28530	T	0.3	.	13.1433	0.59446	0.0:0.1603:0.8397:0.0	.	235;351;321	F5H2V3;Q9HCM9;Q9HCM9-2	.;TRI39_HUMAN;.	L	321;351;351;321;321;235;321;321;351;233	ENSP00000379800:V321L;ENSP00000365844:V351L;ENSP00000439400:V321L;ENSP00000379797:V321L;ENSP00000365847:V321L;ENSP00000379796:V351L;ENSP00000424048:V233L	ENSP00000365844:V351L	V	+	1	0	TRIM39-RPP21;TRIM39	30417509	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	0.347000	0.20014	2.730000	0.93505	0.655000	0.94253	GTC	-	NULL		0.567	TRIM39-002	KNOWN	basic|CCDS	protein_coding	TRIM39	protein_coding	OTTHUMT00000076086.2	G	NM_172016		30417509	1	no_errors	NM_021253	genbank	human	reviewed	54_36p	missense	SNP	0.9	C
HIVEP2	3097	genome.wustl.edu	37	6	143090799	143090799	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr6:143090799G>C	ENST00000367604.1	-	4	5716	c.5077C>G	c.(5077-5079)Ctt>Gtt	p.L1693V	HIVEP2_ENST00000012134.2_Missense_Mutation_p.L1693V|HIVEP2_ENST00000367603.2_Missense_Mutation_p.L1693V			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1693					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1693V(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GACCTCAGAAGAGCCAGCGTG	0.468																																					Esophageal Squamous(107;843 1510 13293 16805 42198)											1	Substitution - Missense(1)	ovary(1)	6											147.0	137.0	141.0					6																	143090799		1895	4129	6024	143132492	SO:0001583	missense	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5077C>G	6.37:g.143090799G>C	ENSP00000356576:p.Leu1693Val	Somatic		Capture	Illumina GAIIx	4	143132492	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	-	p.L1693V	ENST00000367604.1	37	c.5077	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907428	0.72868	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.12569	2.67;2.67;2.67	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.38825	0.1055	M	0.86097	2.795	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.32241	-0.9914	10	0.87932	D	0	-21.3117	20.3697	0.98890	0.0:0.0:1.0:0.0	.	1693	P31629	ZEP2_HUMAN	V	1693	ENSP00000356576:L1693V;ENSP00000356575:L1693V;ENSP00000012134:L1693V	ENSP00000012134:L1693V	L	-	1	0	HIVEP2	143132492	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.923000	0.87546	2.811000	0.96726	0.655000	0.94253	CTT	-	NULL		0.468	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	protein_coding	OTTHUMT00000042495.1	G			143132492	-1	no_errors	NM_006734	genbank	human	provisional	54_36p	missense	SNP	1	C
PTPRZ1	5803	genome.wustl.edu	37	7	121698857	121698857	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr7:121698857G>A	ENST00000393386.2	+	28	6943	c.6532G>A	c.(6532-6534)Gat>Aat	p.D2178N	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.D1311N	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2178	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.D2178N(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GTTATAGGATGATTATGTACT	0.338																																																1	Substitution - Missense(1)	ovary(1)	7											90.0	91.0	90.0					7																	121698857		2203	4300	6503	121486093	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6532G>A	7.37:g.121698857G>A	ENSP00000377047:p.Asp2178Asn	Somatic		Capture	Illumina GAIIx	4	121486093	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	superfamily_Carbonic anhydrase;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_(Phosphotyrosine protein) phosphatases II;HMMPfam_Y_phosphatase;HMMPfam_Carb_anhydrase	p.D2178N	ENST00000393386.2	37	c.6532	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.947066	0.92593	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	D;D	0.82984	-1.67;-1.67	6.07	6.07	0.98685	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.88262	0.6389	L	0.36672	1.1	0.80722	D	1	D;P;P	0.89917	1.0;0.859;0.95	D;P;D	0.87578	0.998;0.842;0.93	D	0.86889	0.2047	10	0.46703	T	0.11	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1317;1311;2178	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	N	2178;1311	ENSP00000377047:D2178N;ENSP00000410000:D1311N	ENSP00000377047:D2178N	D	+	1	0	PTPRZ1	121486093	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	8.033000	0.88852	2.885000	0.99019	0.655000	0.94253	GAT	-	HMMPfam_Y_phosphatase		0.338	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	G	NM_002851		121486093	1	no_errors	NM_002851	genbank	human	reviewed	54_36p	missense	SNP	1	A
MEST	4232	genome.wustl.edu	37	7	130138007	130138007	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr7:130138007C>T	ENST00000223215.4	+	5	588	c.367C>T	c.(367-369)Cag>Tag	p.Q123*	MIR335_ENST00000362173.1_RNA|MEST_ENST00000437945.1_Nonsense_Mutation_p.Q123*|MEST_ENST00000341441.5_Nonsense_Mutation_p.Q114*|MEST_ENST00000378576.4_Nonsense_Mutation_p.Q114*|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000416162.2_Nonsense_Mutation_p.Q114*|MEST_ENST00000393187.1_Nonsense_Mutation_p.Q114*|MEST_ENST00000462132.1_Intron	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	123					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.Q123*(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					CATATTTGAGCAGGCCAGCAT	0.507																																					Colon(126;2182 2305 6517 35181)											1	Substitution - Nonsense(1)	ovary(1)	7											77.0	75.0	75.0					7																	130138007		2203	4300	6503	129925243	SO:0001587	stop_gained	4232				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.367C>T	7.37:g.130138007C>T	ENSP00000223215:p.Gln123*	Somatic		Capture	Illumina GAIIx	4	129925243	B2R6S1|O14973|O15007|Q6AI49|Q92571	Nonsense_Mutation	SNP	HMMPfam_Abhydrolase_1;superfamily_alpha/beta-Hydrolases	p.Q123*	ENST00000223215.4	37	c.367	CCDS5822.1	7	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780750	0.90195	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000399874;ENST00000433159;ENST00000393187;ENST00000421001;ENST00000223215;ENST00000437945;ENST00000437637;ENST00000458161	.	.	.	5.33	5.33	0.75918	.	0.053218	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-17.1431	18.3565	0.90359	0.0:1.0:0.0:0.0	.	.	.	.	X	114;114;114;114;114;114;114;114;123;123;114;114	.	ENSP00000223215:Q123X	Q	+	1	0	MEST	129925243	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.348000	0.79366	2.656000	0.90262	0.561000	0.74099	CAG	-	HMMPfam_Abhydrolase_1		0.507	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEST	protein_coding	OTTHUMT00000345183.2	C	NM_002402		129925243	1	no_errors	NM_002402	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
HOXA2	3199	genome.wustl.edu	37	7	27140404	27140404	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr7:27140404T>C	ENST00000222718.5	-	2	1382	c.1072A>G	c.(1072-1074)Agc>Ggc	p.S358G	HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	358					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S358G(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						AAGTCTAAGCTGTCAGCTGAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	7											93.0	92.0	92.0					7																	27140404		2203	4300	6503	27106929	SO:0001583	missense	3199				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.1072A>G	7.37:g.27140404T>C	ENSP00000222718:p.Ser358Gly	Somatic		Capture	Illumina GAIIx	4	27106929	A1L4K3|B2RMW3	Missense_Mutation	SNP	HMMPfam_Homeobox;superfamily_Homeodomain-like	p.S358G	ENST00000222718.5	37	c.1072	CCDS5403.1	7	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904289	0.33628	.	.	ENSG00000105996	ENST00000222718	T	0.10099	2.91	5.66	5.66	0.87406	.	0.178481	0.64402	D	0.000014	T	0.16342	0.0393	M	0.66506	2.035	0.44079	D	0.996839	B	0.28439	0.212	B	0.30316	0.114	T	0.01476	-1.1345	10	0.39692	T	0.17	.	15.5758	0.76380	0.0:0.0:0.0:1.0	.	358	O43364	HXA2_HUMAN	G	358	ENSP00000222718:S358G	ENSP00000222718:S358G	S	-	1	0	HOXA2	27106929	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.912000	0.69948	2.153000	0.67306	0.533000	0.62120	AGC	-	NULL		0.428	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA2	protein_coding	OTTHUMT00000358508.2	T			27106929	-1	no_errors	NM_006735	genbank	human	reviewed	54_36p	missense	SNP	1	C
PKD1L1	168507	genome.wustl.edu	37	7	47906198	47906198	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr7:47906198A>C	ENST00000289672.2	-	25	3961	c.3911T>G	c.(3910-3912)cTg>cGg	p.L1304R		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1304	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.L1304R(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AAGGTTTTTCAGGCTGGAATT	0.443																																																1	Substitution - Missense(1)	ovary(1)	7											107.0	102.0	104.0					7																	47906198		2203	4300	6503	47872723	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3911T>G	7.37:g.47906198A>C	ENSP00000289672:p.Leu1304Arg	Somatic		Capture	Illumina GAIIx	4	47872723	Q6UWK1	Missense_Mutation	SNP	-	p.L1304R	ENST00000289672.2	37	c.3911	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	A	15.28	2.787851	0.49997	.	.	ENSG00000158683	ENST00000289672	T	0.68181	-0.31	4.94	4.94	0.65067	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.000000	0.49916	D	0.000129	T	0.78013	0.4217	M	0.66939	2.045	0.35252	D	0.778836	D	0.89917	1.0	D	0.97110	1.0	T	0.81455	-0.0925	10	0.28530	T	0.3	-14.6701	12.5286	0.56100	1.0:0.0:0.0:0.0	.	1304	Q8TDX9	PK1L1_HUMAN	R	1304	ENSP00000289672:L1304R	ENSP00000289672:L1304R	L	-	2	0	PKD1L1	47872723	1.000000	0.71417	0.993000	0.49108	0.459000	0.32528	4.120000	0.57897	1.863000	0.54032	0.533000	0.62120	CTG	-	NULL		0.443	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	protein_coding	OTTHUMT00000340974.1	A	NM_138295		47872723	-1	no_errors	NM_138295	genbank	human	reviewed	54_36p	missense	SNP	0.96	C
PKD1L1	168507	genome.wustl.edu	37	7	47933590	47933590	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr7:47933590G>T	ENST00000289672.2	-	15	2388	c.2338C>A	c.(2338-2340)Cct>Act	p.P780T		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	780	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.P780T(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ACACTGACAGGGGCCTGGGCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	7											88.0	65.0	73.0					7																	47933590		2203	4300	6503	47900115	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2338C>A	7.37:g.47933590G>T	ENSP00000289672:p.Pro780Thr	Somatic		Capture	Illumina GAIIx	4	47900115	Q6UWK1	Missense_Mutation	SNP	-	p.P780T	ENST00000289672.2	37	c.2338	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	g	17.80	3.477748	0.63849	.	.	ENSG00000158683	ENST00000289672	T	0.69175	-0.38	5.23	5.23	0.72850	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.086835	0.44285	D	0.000470	T	0.77857	0.4193	L	0.56769	1.78	0.34296	D	0.683842	D	0.89917	1.0	D	0.79784	0.993	T	0.79928	-0.1596	10	0.25106	T	0.35	-29.3624	16.3617	0.83270	0.0:0.0:1.0:0.0	.	780	Q8TDX9	PK1L1_HUMAN	T	780	ENSP00000289672:P780T	ENSP00000289672:P780T	P	-	1	0	PKD1L1	47900115	1.000000	0.71417	0.516000	0.27786	0.736000	0.42039	6.196000	0.72094	2.462000	0.83206	0.543000	0.68304	CCT	-	NULL		0.597	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	protein_coding	OTTHUMT00000340974.1	G	NM_138295		47900115	-1	no_errors	NM_138295	genbank	human	reviewed	54_36p	missense	SNP	0.47	T
PLXNA4	91584	genome.wustl.edu	37	7	131833364	131833364	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr7:131833364C>A	ENST00000359827.3	-	26	5664	c.4702G>T	c.(4702-4704)Gaa>Taa	p.E1568*	PLXNA4_ENST00000321063.4_Nonsense_Mutation_p.E1568*			Q9HCM2	PLXA4_HUMAN	plexin A4	1568					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.E1568*(1)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTGATGTCTTCATCCTGCAAG	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	7											168.0	167.0	167.0					7																	131833364		2168	4292	6460	131483904	SO:0001587	stop_gained	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4702G>T	7.37:g.131833364C>A	ENSP00000352882:p.Glu1568*	Somatic		Capture	Illumina GAIIx	4	131483904	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Nonsense_Mutation	SNP	-	p.E1568*	ENST00000359827.3	37	c.4702	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	47	13.066194	0.99717	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.3069	0.90185	0.0:1.0:0.0:0.0	.	.	.	.	X	1568	.	ENSP00000323194:E1568X	E	-	1	0	PLXNA4	131483904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.731000	0.84895	2.312000	0.78011	0.561000	0.74099	GAA	-	NULL		0.542	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	protein_coding	OTTHUMT00000338422.2	C	NM_181775		131483904	-1	no_errors	NM_020911	genbank	human	validated	54_36p	nonsense	SNP	1	A
CSGALNACT1	55790	genome.wustl.edu	37	8	19316132	19316132	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr8:19316132T>C	ENST00000454498.2	-	5	1669	c.656A>G	c.(655-657)gAc>gGc	p.D219G	CSGALNACT1_ENST00000544602.1_Missense_Mutation_p.D219G|CSGALNACT1_ENST00000522854.1_Missense_Mutation_p.D219G|CSGALNACT1_ENST00000332246.6_Missense_Mutation_p.D219G|CSGALNACT1_ENST00000518542.1_5'UTR|CSGALNACT1_ENST00000311540.4_Missense_Mutation_p.D219G	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1	219					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)	p.D219G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		TGTCCCTTTGTCCCTTTCTGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	8											232.0	216.0	221.0					8																	19316132		2203	4300	6503	19360412	SO:0001583	missense	55790			AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.656A>G	8.37:g.19316132T>C	ENSP00000411816:p.Asp219Gly	Somatic		Capture	Illumina GAIIx	4	19360412	B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Missense_Mutation	SNP	-	p.D219G	ENST00000454498.2	37	c.656	CCDS6010.1	8	.	.	.	.	.	.	.	.	.	.	T	21.7	4.184935	0.78677	.	.	ENSG00000147408	ENST00000454498;ENST00000332246;ENST00000311540;ENST00000522854;ENST00000544602	T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.34774	0.0909	M	0.79475	2.455	0.80722	D	1	P	0.46142	0.873	P	0.53185	0.72	T	0.06499	-1.0823	10	0.21540	T	0.41	-36.3413	15.2208	0.73310	0.0:0.0:0.0:1.0	.	219	Q8TDX6	CGAT1_HUMAN	G	219	ENSP00000411816:D219G;ENSP00000330805:D219G;ENSP00000310891:D219G;ENSP00000429809:D219G;ENSP00000442155:D219G	ENSP00000310891:D219G	D	-	2	0	CSGALNACT1	19360412	1.000000	0.71417	0.969000	0.41365	0.895000	0.52256	7.622000	0.83099	2.333000	0.79357	0.533000	0.62120	GAC	-	NULL		0.423	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CSGALNACT1	protein_coding	OTTHUMT00000375204.1	T	NM_018371		19360412	-1	no_errors	NM_018371	genbank	human	validated	54_36p	missense	SNP	1	C
EBF2	64641	genome.wustl.edu	37	8	25899653	25899653	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr8:25899653C>A	ENST00000520164.1	-	2	783	c.246G>T	c.(244-246)gaG>gaT	p.E82D	EBF2_ENST00000408929.3_5'Flank	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	82					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E82D(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TCCGCTCGATCTCCACCGGCT	0.562																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)											1	Substitution - Missense(1)	ovary(1)	8											78.0	88.0	85.0					8																	25899653		2165	4286	6451	25955570	SO:0001583	missense	64641			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.246G>T	8.37:g.25899653C>A	ENSP00000430241:p.Glu82Asp	Somatic		Capture	Illumina GAIIx	4	25955570	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	-	p.E82D	ENST00000520164.1	37	c.246	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017534	0.75161	.	.	ENSG00000221818	ENST00000520164	T	0.57436	0.4	5.02	4.15	0.48705	.	0.000000	0.85682	U	0.000000	T	0.67524	0.2902	M	0.86178	2.8	0.80722	D	1	P	0.50528	0.936	P	0.55011	0.766	T	0.72481	-0.4280	10	0.72032	D	0.01	-24.2839	10.2931	0.43608	0.0:0.8288:0.0:0.1712	.	82	Q9HAK2	COE2_HUMAN	D	82	ENSP00000430241:E82D	ENSP00000430241:E82D	E	-	3	2	EBF2	25955570	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.620000	0.36976	1.370000	0.46153	0.561000	0.74099	GAG	-	NULL		0.562	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	protein_coding	OTTHUMT00000375886.2	C	NM_022659		25955570	-1	no_errors	NM_022659	genbank	human	validated	54_36p	missense	SNP	1	A
CLU	1191	genome.wustl.edu	37	8	27462678	27462678	+	Missense_Mutation	SNP	G	G	A	rs371872334		TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr8:27462678G>A	ENST00000316403.10	-	5	997	c.592C>T	c.(592-594)Cgg>Tgg	p.R198W	CLU_ENST00000546343.1_Missense_Mutation_p.R209W|CLU_ENST00000560366.1_Missense_Mutation_p.R250W|CLU_ENST00000523500.1_Missense_Mutation_p.R198W|CLU_ENST00000405140.3_Missense_Mutation_p.R198W			P10909	CLUS_HUMAN	clusterin	198					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)	p.R250W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		TGGGGCTCCCGGGTGAAGAAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	8						G	TRP/ARG	0,4406		0,0,2203	86.0	78.0	81.0		592	3.1	0.0	8		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	CLU	NM_203339.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	198/450	27462678	1,13005	2203	4300	6503	27518595	SO:0001583	missense	1191			M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.592C>T	8.37:g.27462678G>A	ENSP00000315130:p.Arg198Trp	Somatic		Capture	Illumina GAIIx	4	27518595	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	HMMPfam_Clusterin	p.R250W	ENST00000316403.10	37	c.748	CCDS47832.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.74|14.74	2.624913|2.624913	0.46840|0.46840	0.0|0.0	1.16E-4|1.16E-4	ENSG00000120885|ENSG00000120885	ENST00000522098|ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000380446;ENST00000520012;ENST00000520796	.|T;T;T	.|0.23754	.|1.89;1.89;1.89	4.96|4.96	3.07|3.07	0.35406|0.35406	.|Clusterin, N-terminal (1);	.|1.767710	.|0.02481	.|N	.|0.088490	T|T	0.43545|0.43545	0.1252|0.1252	M|M	0.65975|0.65975	2.015|2.015	0.09310|0.09310	N|N	1|1	.|D;D;D;D	.|0.76494	.|0.999;0.998;0.998;0.998	.|P;P;P;P	.|0.57679	.|0.825;0.731;0.731;0.761	T|T	0.04017|0.04017	-1.0984|-1.0984	5|10	.|0.37606	.|T	.|0.19	-5.132|-5.132	5.5388|5.5388	0.17026|0.17026	0.1024:0.0:0.6828:0.2148|0.1024:0.0:0.6828:0.2148	.|.	.|63;250;209;198	.|E7ETA7;P10909-2;P10909-5;P10909	.|.;.;.;CLUS_HUMAN	L|W	60|250;209;198;198;23;63;198	.|ENSP00000446413:R209W;ENSP00000385419:R198W;ENSP00000429620:R198W	.|ENSP00000315130:R250W	P|R	-|-	2|1	0|2	CLU|CLU	27518595|27518595	0.003000|0.003000	0.15002|0.15002	0.001000|0.001000	0.08648|0.08648	0.005000|0.005000	0.04900|0.04900	1.014000|1.014000	0.29950|0.29950	0.983000|0.983000	0.38602|0.38602	0.563000|0.563000	0.77884|0.77884	CCG|CGG	-	HMMPfam_Clusterin		0.612	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLU	protein_coding	OTTHUMT00000219953.3	G	NM_001831		27518595	-1	no_errors	NM_001831	genbank	human	validated	54_36p	missense	SNP		A
RIMS2	9699	genome.wustl.edu	37	8	105010466	105010466	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr8:105010466A>T	ENST00000436393.2	+	16	2673	c.2432A>T	c.(2431-2433)cAc>cTc	p.H811L	RIMS2_ENST00000507740.1_Missense_Mutation_p.H825L|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1095	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.H811L(1)|p.H825L(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACCATCATCACAGGGATGGC	0.358										HNSCC(12;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	8											125.0	110.0	114.0					8																	105010466		1880	4106	5986	105079642	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2432A>T	8.37:g.105010466A>T	ENSP00000390665:p.His811Leu	Somatic		Capture	Illumina GAIIx	4	105079642	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	superfamily_PDZ domain-like;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);HMMPfam_C2;HMMPfam_PDZ	p.H825L	ENST00000436393.2	37	c.2474		8	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187964	0.38609	.	.	ENSG00000176406	ENST00000329869;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T	0.18016	2.34;2.24;2.68	4.81	3.62	0.41486	.	.	.	.	.	T	0.07999	0.0200	N	0.08118	0	0.80722	D	1	B;B	0.16166	0.016;0.0	B;B	0.13407	0.009;0.0	T	0.19943	-1.0290	9	0.36615	T	0.2	.	6.2677	0.20936	0.6743:0.1661:0.0:0.1595	.	811;825	D6RA03;Q9UQ26-3	.;.	L	1048;825;825;811	ENSP00000423559:H825L;ENSP00000386228:H825L;ENSP00000390665:H811L	ENSP00000332184:H1048L	H	+	2	0	RIMS2	105079642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.566000	0.45948	0.831000	0.34780	0.528000	0.53228	CAC	-	NULL		0.358	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	protein_coding	OTTHUMT00000367217.1	A	NM_001100117		105079642	1	no_errors	NM_014677	genbank	human	validated	54_36p	missense	SNP	1	T
IGKV1D-43	28891	genome.wustl.edu	37	2	90249162	90249162	+	RNA	SNP	A	A	C			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr2:90249162A>C	ENST00000468879.1	+	0	299									immunoglobulin kappa variable 1D-43																		TGTAGGAGACAGAGTCACCAT	0.463																																																0			2											142.0	143.0	142.0					2																	90249162		1912	4144	6056	89886467			0			X72817		2p11.2	2012-10-03			ENSG00000242580	ENSG00000242580		"""Immunoglobulins / IGK locus"""	5758	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151572		2.37:g.90249162A>C		Somatic		Capture	Illumina GAIIx	4	89886467		Silent	SNP	-	p.R40	ENST00000468879.1	37	c.118		2																																																																																			-	NULL		0.463	IGKV1D-43-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211634	IG_V_gene	OTTHUMT00000323147.2	A	NG_000833		89886467	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390279	ensembl	human	known	54_36p	silent	SNP	0.02	C
SMC2	10592	genome.wustl.edu	37	9	106887320	106887320	+	Silent	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr9:106887320G>A	ENST00000286398.7	+	18	2673	c.2385G>A	c.(2383-2385)caG>caA	p.Q795Q	SMC2_ENST00000303219.8_Silent_p.Q795Q|SMC2_ENST00000374793.3_Silent_p.Q795Q|SMC2_ENST00000374787.3_Silent_p.Q795Q	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	795					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.Q795Q(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						AAGATGCTCAGAAAAAACTGG	0.328																																																1	Substitution - coding silent(1)	ovary(1)	9											81.0	88.0	85.0					9																	106887320		2203	4300	6503	105927141	SO:0001819	synonymous_variant	10592			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2385G>A	9.37:g.106887320G>A		Somatic		Capture	Illumina GAIIx	4	105927141	Q6IEE0|Q9P1P2	Silent	SNP	-	p.Q795	ENST00000286398.7	37	c.2385	CCDS35086.1	9																																																																																			-	NULL		0.328	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	protein_coding	OTTHUMT00000053470.1	G			105927141	1	no_errors	NM_001042550	genbank	human	validated	54_36p	silent	SNP	1	A
CA9	768	genome.wustl.edu	37	9	35676372	35676372	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr9:35676372G>A	ENST00000378357.4	+	5	930	c.826G>A	c.(826-828)Gcc>Acc	p.A276T	CA9_ENST00000493245.1_Intron	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	276	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.A276T(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GGCCGTGTTGGCCGCCTTTCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	9											100.0	105.0	104.0					9																	35676372		2203	4300	6503	35666372	SO:0001583	missense	768			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.826G>A	9.37:g.35676372G>A	ENSP00000367608:p.Ala276Thr	Somatic		Capture	Illumina GAIIx	4	35666372	Q5T4R1	Missense_Mutation	SNP	HMMPfam_Carb_anhydrase;superfamily_Carbonic anhydrase	p.A276T	ENST00000378357.4	37	c.826	CCDS6585.1	9	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073921	0.55646	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.61510	0.1	4.85	3.94	0.45596	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.090261	0.45126	D	0.000393	T	0.64271	0.2583	L	0.54965	1.715	0.37717	D	0.924766	D;P	0.54047	0.964;0.902	P;B	0.56434	0.798;0.346	T	0.71258	-0.4646	10	0.87932	D	0	.	10.5678	0.45184	0.0:0.0:0.8072:0.1928	.	276;276	F5H404;Q16790	.;CAH9_HUMAN	T	276	ENSP00000367608:A276T	ENSP00000367608:A276T	A	+	1	0	CA9	35666372	1.000000	0.71417	0.959000	0.39883	0.070000	0.16714	4.368000	0.59505	1.380000	0.46344	-0.181000	0.13052	GCC	-	HMMPfam_Carb_anhydrase		0.637	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA9	protein_coding	OTTHUMT00000055479.1	G	NM_001216		35666372	1	no_errors	NM_001216	genbank	human	reviewed	54_36p	missense	SNP	1	A
HEMGN	55363	genome.wustl.edu	37	9	100693217	100693217	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr9:100693217C>A	ENST00000259456.3	-	4	603	c.460G>T	c.(460-462)Gca>Tca	p.A154S		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	154					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)		p.A154S(1)		NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TTTTGTACTGCTATTTCTTGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	9											166.0	164.0	165.0					9																	100693217		2203	4300	6503	99733038	SO:0001583	missense	55363			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.460G>T	9.37:g.100693217C>A	ENSP00000259456:p.Ala154Ser	Somatic		Capture	Illumina GAIIx	4	99733038	Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	-	p.A154S	ENST00000259456.3	37	c.460	CCDS6731.1	9	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322630	0.23994	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	4.46	2.45	0.29901	.	1.665280	0.03222	N	0.177796	T	0.29684	0.0741	L	0.36672	1.1	0.09310	N	1	P	0.38677	0.642	B	0.38458	0.274	T	0.18713	-1.0328	9	0.15499	T	0.54	0.3103	6.6374	0.22891	0.0:0.763:0.0:0.237	.	154	Q9BXL5	HEMGN_HUMAN	S	154	.	ENSP00000259456:A154S	A	-	1	0	HEMGN	99733038	0.053000	0.20554	0.043000	0.18650	0.907000	0.53573	1.017000	0.29989	0.699000	0.31761	0.591000	0.81541	GCA	-	NULL		0.378	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	protein_coding	OTTHUMT00000053344.2	C	NM_197978		99733038	-1	no_errors	NM_018437	genbank	human	validated	54_36p	missense	SNP	0.01	A
SVEP1	79987	genome.wustl.edu	37	9	113169063	113169063	+	Silent	SNP	T	T	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chr9:113169063T>G	ENST00000401783.2	-	38	9153	c.8817A>C	c.(8815-8817)gcA>gcC	p.A2939A	SVEP1_ENST00000374469.1_Silent_p.A2916A|SVEP1_ENST00000297826.5_Silent_p.A865A	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2939	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.A2942A(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAGGAATCTCTGCATCCCAGT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	9											182.0	181.0	181.0					9																	113169063		2018	4176	6194	112208884	SO:0001819	synonymous_variant	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8817A>C	9.37:g.113169063T>G		Somatic		Capture	Illumina GAIIx	4	112208884	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	-	p.A2939	ENST00000401783.2	37	c.8817	CCDS48004.1	9																																																																																			-	NULL		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		T			112208884	-1	no_errors	NM_153366	genbank	human	validated	54_36p	silent	SNP	0.7	G
ZCCHC12	170261	genome.wustl.edu	37	X	117959654	117959654	+	Silent	SNP	G	G	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:117959654G>A	ENST00000310164.2	+	4	954	c.447G>A	c.(445-447)gtG>gtA	p.V149V		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	149					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V149V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						ccctttatgtgatccgtttag	0.488																																																1	Substitution - coding silent(1)	ovary(1)	X											122.0	122.0	122.0					X																	117959654		2203	4300	6503	117843682	SO:0001819	synonymous_variant	170261			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.447G>A	X.37:g.117959654G>A		Somatic		Capture	Illumina GAIIx	4	117843682	B3KV48|Q6PID5|Q8N1C1	Silent	SNP	-	p.V149	ENST00000310164.2	37	c.447	CCDS14574.1	X																																																																																			-	NULL		0.488	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	protein_coding	OTTHUMT00000058014.1	G	NM_173798		117843682	1	no_errors	NM_173798	genbank	human	provisional	54_36p	silent	SNP	1	A
WWC3	55841	genome.wustl.edu	37	X	10035469	10035469	+	Silent	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:10035469C>T	ENST00000380861.4	+	3	550	c.159C>T	c.(157-159)gcC>gcT	p.A53A	WWC3_ENST00000454666.1_Silent_p.A53A	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	53					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.A53A(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TCGAGCTGGCCCAGGAGGAAT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	X											63.0	53.0	57.0					X																	10035469		2203	4300	6503	9995469	SO:0001819	synonymous_variant	55841			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.159C>T	X.37:g.10035469C>T		Somatic		Capture	Illumina GAIIx	4	9995469	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_Spectrin repeat	p.A53	ENST00000380861.4	37	c.159	CCDS14136.1	X																																																																																			-	NULL		0.478	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	protein_coding	OTTHUMT00000055725.1	C	NM_015691		9995469	1	no_errors	NM_015691	genbank	human	validated	54_36p	silent	SNP	0.42	T
MAGEB16	139604	genome.wustl.edu	37	X	35820616	35820616	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:35820616T>A	ENST00000399989.1	+	2	582	c.303T>A	c.(301-303)gaT>gaA	p.D101E	MAGEB16_ENST00000399992.1_Missense_Mutation_p.D133E|MAGEB16_ENST00000399988.1_Missense_Mutation_p.D101E|MAGEB16_ENST00000399987.1_Missense_Mutation_p.D101E|MAGEB16_ENST00000399985.1_Missense_Mutation_p.D101E	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	101								p.D268E(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						CCTCAGAGGATACATCAGACC	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											57.0	53.0	54.0					X																	35820616		1957	4160	6117	35730537	SO:0001583	missense	139604				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.303T>A	X.37:g.35820616T>A	ENSP00000382871:p.Asp101Glu	Somatic		Capture	Illumina GAIIx	4	35730537	A8MU30	Missense_Mutation	SNP	-	p.D101E	ENST00000399989.1	37	c.303	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	T	8.995	0.978762	0.18812	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.01584	4.77;4.75;4.77;4.77;4.77	3.13	-6.26	0.02033	.	6.402970	0.00166	N	0.000012	T	0.01558	0.0050	L	0.33189	0.99	0.09310	N	1	B	0.15141	0.012	B	0.12837	0.008	T	0.43814	-0.9368	10	0.33141	T	0.24	.	2.5813	0.04819	0.1577:0.451:0.1588:0.2325	.	101	A2A368	MAGBG_HUMAN	E	101;133;101;101;101	ENSP00000382870:D101E;ENSP00000382874:D133E;ENSP00000382869:D101E;ENSP00000382871:D101E;ENSP00000382867:D101E	ENSP00000382867:D101E	D	+	3	2	MAGEB16	35730537	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.641000	0.05434	-1.700000	0.01414	-0.544000	0.04233	GAT	-	NULL		0.473	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	protein_coding	OTTHUMT00000251034.1	T			35730537	1	no_errors	NM_001099921	genbank	human	provisional	54_36p	missense	SNP		A
FAM47C	442444	genome.wustl.edu	37	X	37028413	37028413	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:37028413C>G	ENST00000358047.3	+	1	1982	c.1930C>G	c.(1930-1932)Ccg>Gcg	p.P644A		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	644								p.P644A(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAGTCTCCGCCCGGAGCCTCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	X											44.0	48.0	47.0					X																	37028413		2200	4298	6498	36938334	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1930C>G	X.37:g.37028413C>G	ENSP00000367913:p.Pro644Ala	Somatic		Capture	Illumina GAIIx	4	36938334	Q6ZU46	Missense_Mutation	SNP	-	p.P644A	ENST00000358047.3	37	c.1930	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	10.33	1.321310	0.23994	.	.	ENSG00000198173	ENST00000358047	T	0.21734	1.99	1.61	-2.25	0.06888	.	.	.	.	.	T	0.21674	0.0522	M	0.80746	2.51	0.09310	N	1	B	0.31548	0.328	B	0.27076	0.076	T	0.16247	-1.0409	9	0.48119	T	0.1	.	6.1048	0.20067	0.0:0.5059:0.0:0.4941	.	644	Q5HY64	FA47C_HUMAN	A	644	ENSP00000367913:P644A	ENSP00000367913:P644A	P	+	1	0	FAM47C	36938334	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.433000	0.06948	-0.609000	0.05724	-0.500000	0.04577	CCG	-	NULL		0.637	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	C	NM_001013736		36938334	1	no_errors	NM_001013736	genbank	human	provisional	54_36p	missense	SNP	0.65	G
ELK1	2002	genome.wustl.edu	37	X	47500736	47500736	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:47500736C>G	ENST00000247161.3	-	2	204	c.105G>C	c.(103-105)aaG>aaC	p.K35N	ELK1_ENST00000376983.3_Missense_Mutation_p.K35N|ELK1_ENST00000343894.4_Missense_Mutation_p.K35N|ELK1_ENST00000592066.1_5'UTR	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	35					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K35N(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						CATCCACCAGCTTGAATTCAC	0.562																																																1	Substitution - Missense(1)	ovary(1)	X											99.0	77.0	84.0					X																	47500736		2203	4300	6503	47385680	SO:0001583	missense	2002			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.105G>C	X.37:g.47500736C>G	ENSP00000247161:p.Lys35Asn	Somatic		Capture	Illumina GAIIx	4	47385680	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Missense_Mutation	SNP	"HMMPfam_Ets;superfamily_""Winged helix"" DNA-binding domain"	p.K35N	ENST00000247161.3	37	c.105	CCDS14283.1	X	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639017	0.67130	.	.	ENSG00000126767	ENST00000247161;ENST00000376983;ENST00000343894	T;T;T	0.60920	0.15;0.15;0.15	4.89	4.03	0.46877	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.81446	0.4824	H	0.95950	3.745	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84451	0.0588	10	0.87932	D	0	.	9.8331	0.40954	0.0:0.898:0.0:0.102	.	35	P19419	ELK1_HUMAN	N	35	ENSP00000247161:K35N;ENSP00000366182:K35N;ENSP00000345585:K35N	ENSP00000247161:K35N	K	-	3	2	ELK1	47385680	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	1.904000	0.39868	1.055000	0.40461	0.506000	0.49869	AAG	-	HMMPfam_Ets		0.562	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELK1	protein_coding	OTTHUMT00000056436.1	C	NM_005229		47385680	-1	no_errors	NM_005229	genbank	human	reviewed	54_36p	missense	SNP	1	G
THOC2	57187	genome.wustl.edu	37	X	122829904	122829904	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1362-01A-01W-0494-09	TCGA-04-1362-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	830e207f-458e-4628-b7bc-287c2f2e12e5	629e5b70-2205-4a40-9575-f69c019edf53	g.chrX:122829904C>T	ENST00000245838.8	-	7	599	c.568G>A	c.(568-570)Gat>Aat	p.D190N	THOC2_ENST00000491737.1_Missense_Mutation_p.D75N|THOC2_ENST00000355725.4_Missense_Mutation_p.D190N	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	190					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.D111N(1)		breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						AAGATTAAATCACTAGTAATA	0.289																																																1	Substitution - Missense(1)	ovary(1)	X											51.0	46.0	48.0					X																	122829904		1798	4052	5850	122657585	SO:0001583	missense	57187			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.568G>A	X.37:g.122829904C>T	ENSP00000245838:p.Asp190Asn	Somatic		Capture	Illumina GAIIx	4	122657585	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	-	p.D190N	ENST00000245838.8	37	c.568	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016776	0.54576	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.4	5.4	0.78164	.	0.000000	0.64402	U	0.000014	T	0.60470	0.2271	L	0.57536	1.79	0.54753	D	0.999989	B;B	0.30326	0.181;0.276	B;B	0.26614	0.022;0.071	T	0.60409	-0.7269	9	0.44086	T	0.13	-14.6816	18.26	0.90031	0.0:1.0:0.0:0.0	.	111;190	B4DKZ6;Q8NI27	.;THOC2_HUMAN	N	190;190;75;111	.	ENSP00000245838:D190N	D	-	1	0	THOC2	122657585	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	6.146000	0.71777	2.250000	0.74265	0.538000	0.68166	GAT	-	NULL		0.289	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	protein_coding	OTTHUMT00000058153.3	C			122657585	-1	no_errors	NM_001081550	genbank	human	validated	54_36p	missense	SNP	1	T
